KR20160042238A - Novel scopulariopsis brevicaulis m 2 4 7 9 and use therof - Google Patents

Abstract

The present invention relates to a novel Scopulariopsis brevicaulis (S. brevicaulis) M2479 strain and a use thereof. More specifically, the S. brevicaulis M2479 strain derived from soy sources and identified can obtain proper yield in industrial production due to excellent proteolysis ability, can produce pastes with a rich flavor having traditional soy sources. In addition, the S. brevicaulis M2479 strain can be helpfully used as seed strains for producing the soy sources by solving problems of an improved production method of soy sources using existing Aspergillus oryzae.

Description

Novel Scopulariopsis brevica ulis M2479 and use therof}

The present invention provides a strain of Scopulariopsis brevicaulis ( S. brevicaulis ) M2479, a strain using the strain, and a method of producing a strain using the strain.

Chungkukjang, doenjang, and soy sauce, which are soup foods in Korea, are foods that have been ingested for hundreds of years by our ancestors. These foods have no special side effects. They contain various beneficial physiologically active substances that cause antioxidative effect, thrombolytic effect and blood pressure lowering effect .

At present, the industrial production of soybeans in Korea is Aspergillus The mass production of improved varieties using oryzae is the mainstay.

As a related prior art, Korean Patent No. 10-1284580 entitled "Process for producing yeast and fermented soybean using the yeast by inoculating aspergillus oryzae as a strain to bean bean, " No. 10-1056546, And a method for producing the same, and Korean Patent No. 10-0597953 "A method for producing an edible product having improved flavor and flavor ".

However, Aspergillus In the case of the improved varieties produced by using oryzae , there is a disadvantage in that it does not have a sufficient flavor, in particular, a rich flavor of the traditional Japanese soup, which is distinguished from Japanese smile natto.

Therefore, it is required to study new strains capable of producing a product having a rich flavor possessed by a traditional product, while achieving a production yield suitable for the industrial production of the product.

Therefore, the inventors of the present invention found that Aspergillus As a result of efforts to solve the problems of the modified soybean production method using oryzae , the fungi were isolated and identified in Meju, which had been fermented in the second half of the fermentation period . brevicaulis M2479 strain can be obtained in the production yield suitable for industrial production method it has excellent proteolytic activity, and break down proteins in the soybean to effectively produce the amino nitrogen and amino acids to produce a soy sauce having a rich flavor with the traditional soy sauce The present invention has been completed.

For the industrial production of a soy sauce having a superior object is traditional flavor of the present invention, yet can improve the flavor of the final product Paste, a novel fungal strain can serve as seed strains, which can shorten the production time Paste S. brevicaulis M2479 strains, strains using the strains, and methods for producing the strains using the strains.

In order to achieve the above object, the present invention relates to a method for producing scopulariopsis < RTI ID = 0.0 > ( Scopulariopsis < / RTI > brevicaulis ; S. brevicaulis ) M2479 strain.

The present invention also provides a soybean fermented product prepared using S. brevicaulis strain M2479 according to the present invention.

Also, the present invention provides a method for producing soybean fermented product using S. brevicaulis strain M2479 according to the present invention.

The present invention also provides a method for mass production of protease using S. brevicaulis strain M2479 according to the present invention.

In addition, the present invention provides a method for mass production of free amino acid using S. brevicaulis strain M2479 according to the present invention.

S. brevicaulis M2479 strain according to the present invention can produce a soy sauce having a rich flavor can be obtained with all the production yield suitable for industrial production due to the high proteolytic activity, with the traditional soy sauce, traditional Aspergillus It is possible to solve the problem of the improved type production method using oryzae .

Specifically, S. brevicaulis M2479 has an excellent proteolytic activity, and can effectively produce free amino acids that have an amino-nitrogen content and a savory taste of doenjang from soybeans, which are the main ingredients of soy sauce. Thus, S. brevicaulis M2479 Aspergillus used Compared with the improved soybean paste using oryzae , it has a rich traditional flavor The S. brevicaulis M2479 can be used as a seed strain for the production of soy sauce, since the sauce having improved flavor can be produced during a shortened production period in large quantities.

FIG. 1 is a diagram showing morphological characteristics of S. brevicaulis strain M2479.
Fig. 2 shows the molecular characteristics of S. brevicaulis strain M2479.
FIG. 3 is a graph showing the temperature growth characteristics and water activity of S. brevicaulis strain M2479.
FIG. 4 is a graph showing the results of analyzing the total free amino acid content of soybean fermented by S. brevicaulis strain M2479. FIG.
FIG. 5 is a graph showing the results of analysis of the contents of free amino acids in soybean fermentations prepared from strain S. brevicaulis M2479. FIG.

Hereinafter, the present invention will be described in detail.

The present invention relates to novel Scoring System pool La options breather non cowl-less; provide (Scopulariopsis brevicaulis S. brevicaulis) M2479 strain.

The strain is a strain having an rDAN ITS composed of the nucleotide sequence of SEQ ID NO: 1 and deposited with Accession No. KACC 93202P.

The strain has an optimal growth temperature of 25 to 30 ° C and exhibits drought resistance due to vigorous growth even in 20% sucrose-added TSA in a dry state.

The strain has excellent protease activity and has remarkable protease activity as compared with the homologous S. brevicaulis strains isolated from the genus .

The above-mentioned strain can effectively decompose protein of soybean to effectively produce amino nitrogen which gives a delicious taste of miso, and Aspergillus Amino nitrogen and reducing sugar are remarkably superior to oryzae .

The above-mentioned strain can decompose protein of soybean to effectively produce free amino acid which gives a delicious taste of miso, and Aspergillus Compared to oryzae , the total amino acid content is remarkably superior.

The present invention also provides a soybean fermented product prepared using S. brevicaulis strain M2479 according to the present invention.

Also, the present invention provides a method for producing soybean fermented product using S. brevicaulis strain M2479 according to the present invention.

Preferably, the soybean fermented product is selected from the group consisting of meju, or soybean paste, chungkukjang, clove, kochujang, buckwheat and soy sauce.

The soybean fermented product can be produced by a common meju and soy sauce manufacturing method known in the art.

The S. brevicaulis soybean fermented product prepared using the strain M2479 has a high amino nitrogen and a reducing sugar, which is Aspergillus compared with soybean fermented by using the oryzae strain.

The above-mentioned strain can decompose protein of soybean to effectively produce free amino acid which gives a delicious taste of miso, and Aspergillus Compared to oryzae , the total amino acid content is remarkably superior.

In addition, the present invention provides a method for mass production of protease using S. brevicaulis strain M2479 according to the present invention.

Specifically,

1) culturing S. brevicaulis strain M2479; And

2) separating and purifying the protease in the culture medium cultured in step 1).

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention, and it is to be understood by those skilled in the art that the present invention is not limited thereto It will be obvious.

< Example  1> From Meju S. brevicaulis  Isolation and Identification of Strain

The fungi of 1479 strains were isolated from MEA, DG18, and DRBC medium by direct separation and dilution plate method from the 323 subspecies or restaurants in Korea, which were confirmed to have good flavor and were identified and finally identified Fungi of 26 genera and 101 species were isolated and identified.

Among the 101 species of fungi that were isolated and identified, the fungi commonly produced by morphological identification and molecular biology identification from the samples in the latter half of the fermentation of Meju, Scopulariopsis brevicaulis ; S. brevicaulis ) species. At this time, the morphological identification was observed in the culture form of MEA and CYA medium, and the detailed structure of the strain grown in the MEA medium was identified by observing the optical microscope (Fig. 1). Molecular biologic identification was performed by rDNA ITS region analysis and homology (Fig. 2).

The rDNA ITS sequence used in the analysis is as follows.

TGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAAGTTACTCTTCAAAACCCA

TTGTGAACCTTACCTCTTGCCGCGCGTTGCCTCGGCGGGGAGGCGGGGTCTGGGTCGGCGCGCCCCTCACCGGGCCGCCG

TCCCCGTCCCCGTCCCCGCCGGCCGCGCCAAACTCTAAATTTGAAAAAGCGTACTGCACGTTCTGATTCAAAACAAAAAAA

CAAGTCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT

TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGCAGCAATCTGCCGGGCATGCCTGTCCGAGCGT

CATTTCTTCCCTCGAGCGCGGCTAGCCCTACGGGGCCTGCCGTCGCCCGGTGTTGGGGCTCTACGGGTGGGGCTCGTCCC

CCCCGCAGTCCCCGAAATGTAGTGGCGGTCCAGCCGCGGCGCCCCCTGCGTAGTAGATCCTACATCTCGCATCGGGTCCC

GGCGAAGGCCAGCCGTCGAACCTTTTATTTCATGGTTGACCTCGAT (SEQ ID NO: 1)

Therefore, the present inventors have deposited in the Korean Agricultural Culture Collection (KACC), a depository institution, on June 10, 2014 (Deposit No. KACC 93202P).

< Example  2> S. brevicaulis Of temperature growth and water activity

<2-1> Investigation of proper culture temperature

S. brevicaulis was inoculated in TSA medium (tripticase soy agar medium, 15 g tripticase soy agar (Difco 211825), 7.5 g agar, 500 ml distilled water) and cultured in an incubation room at 25 ° C for 5-7 days . When spores were formed, the spores were scraped off and suspended in semi solid medium (0.2% agar, 0.05% Tween 80), vortexed strongly, and then inoculated with 3 μl of 5 μl each. After incubation at 0, 4, 10, 15, 20, 25, 30, 37, 45, and 50 ℃ in an incubator for 7 days, the lengths of three points were measured and the average was obtained.

As a result, as shown in Fig. 3, the growth rate of S. brevicaulis gradually increased from 4 째 C to the apex at 30 째 C, then gradually decreased to 45 째 C. Thus, S. brevicaulis showed the most active growth ability at 25 to 30 ° C (FIG. 3).

<2-2> Investigation of water activity

The strain and spore suspension were prepared in the same manner as in Example <2-1> above. TSA supplemented with 20% sucrose was used as the medium for selective growth, and one point of 5 μl of spore suspension was inoculated. The strain was cultured in an incubation room at 25 ° C for 7 days, and then the length of one point was measured and compared with the 25 ° C growth measurement.

As a result, active growth was observed even in 20% sucrose added TSA in a dry state, and it was resistant to drying. Therefore, it was found that it could grow vigorously until the late Meju period fermentation.

< Example  3> S. brevicaulis Of protease ( protease ) Secretory function  Research

S. brevicaulis isolated from meju A total of 62 strains of semi solid medium spore suspension were prepared and used. Protease enzyme activity screening was performed on solid medium. Specifically, the protease secretion ability was determined by inoculating 3 g of 5 μg of bacteria into a plant agar to which 1% skim milk had been added to Water agar (10 g agar, 500 ml distilled water), and incubated in a 25 ° C. incubation room incubation room) for 5 days and then a clear zone was observed.

As a result, as shown in Table 1, the resulting enzyme activity screening of S. brevicaulis S. brevicaulis the M2479 was confirmed to have a remarkably excellent protease activity than the other strains.

Investigation of the ability of S. brevicaulis to secrete solid protease M No. Protease M No. Lactase M No. Lactase M No. Lactase 104 + 621 ++ 2466 ++ 2485 + 110 ++ 626 ++ 2467 + 2486 ++ 114 + 683 ++ 2469 ++ 2487 ++ 156 ++ 814 + 2470 + 2488 ++ 164 + 1174 + 2471 + 2492 + 472 ++ 1178 + 2472 ++ 2493 + 481 + 1179 ++ 2473 ++ 2494 + 485 + 1180 + 2474 + 2496 ++ 492 - 1181 ++ 2475 + 2498 + 499 + 1183 ++ 2477 ++ 2499 + 526 ^* +++ 1184 + 2478 + 2501 ++ 544 + 1185 - 2479 +++ 2502 + 548 + 1186 ++ 2480 + 2503 + 564 ++ 1187 + 2482 + 2504 + 586 + 1188 + 2483 + 613 ++ 1189 - 2484 ++

-, no reaction; + &Lt; 1 mm; 1 mm < ++ < 3 mm; 3 mm? +++ <6 mm; 6? ++++ <10; +++++? 10;

* Boiled soybeans showed an enzyme activity of 48% of S. brevicaulis M2479.

< Example  4> S. brevicaulis M2479 Protease released from boiled soybean Amount of enzyme  Measure

<4-1> Crude enzyme solution  extraction

Solid phase protease activity of S. brevicaulis 62 strain After observing the screening, the enzyme activity was quantitatively analyzed by preparing soybean meal with S. brevicaulis M2479, which has a good protease result.

Specifically, 20 g of raw soybean and 30 ml of distilled water were added to a 100 ml Erlenmeyer flask at 121 ° C for 35 minutes. After cooling in a clean bench, the spore solution of the selected strain was added to 1% (v / w) In 2X10 &lt; ⁶ &gt; CFU / ml and incubated in an incubation room at 25 [deg.] C for 14 days. 5 g of the yeast was suspended in 50 ml of distilled water, shaken at 30 ° C for 4 hours, and centrifuged at 4,200 rpm for 20 minutes. The supernatant was used as a crude enzyme solution and stored at 0 ° C.

<4-2> Measurement of protease

To the 1.5 ml of 0.6% casein (0.06 M NaH ₂ PO ₄ buffer, pH 7.0), 1 ml of pH 7.0 0.06 M NaH ₂ PO ₄ buffer was added and the mixture was preheated at 40 ° C for 5 minutes. 0.5 ml of crude enzyme solution was added thereto, followed by reaction at 40 ° C for 60 minutes. Then, 5 ml of 0.4 M trichloroacetic acid (TCA) was added to stop the reaction. After allowing to stand at room temperature for 30 minutes, 5 ml of a 0.4 M NaCO ₆ solution and 1 ml of a 5-fold diluted Folin reagent solution were added to 1 ml of the filtered solution in a filter paper (No.4 Whatman), and the solution was developed at 40 ° C for 30 minutes. In the control, just before addition of the TCA solution, enzyme solution was added and color development was carried out as above. The resulting color was maintained at 25 [deg.] C and absorbance was measured at 660 nm. Tyrosine (10.0 mg) was taken and 1N HCl (1 ml) was added to make the total volume 100 ml. This solution was added to 5 ml of 0.4 M NaCO ₆ solution and 1 ml of a 5-fold diluted Folin reagent solution in 1 ml of 10, 40, 70, and 100 μg / ml of the stock solution at 40 ° C for 30 minutes. The resulting color was maintained at 25 캜 and absorbance was measured at 660 nm to prepare a calibration curve. 1 g of the sample was expressed as one unit in terms of an amount of liberating 1 ug of tyrosine for 60 minutes.

As a result, as shown in Table 2, it was 224.968 units for S. brevicaulis M2479, while the control Aspergillus In the case of oryzae , it was only 55.515 units. Therefore, it was confirmed that S. brevicaulis M2479 in boiled soybeans had a higher protease activity than the control strain used in the conventional industrial production of Meju.

Quantitation of protease from soybean by S. brevicaulis M2479 Isolates Origin no. Fungal species Protease enzyme (unit) Isolate M2479 S. brevicaulis 224.968 Control CF1001 Aspergillus oryzae 55.515

< Example  5> S. brevicaulis M2479S  Strain Soybean fermentation product  Manufacturing and component analysis

<5-1> Soybean fermentation product  Produce

One strain of S. brecicalulis M2479 was inoculated to produce bean meju. Domestic soybeans (soybean: Glycine max, Seokyeong) were purchased as the experimental material. Domestic sun salt was used for the salt. Soybean bean, which is an important material of the study, was washed, soaked in distilled water at 25 ° C for 24 hours, and then used after water was removed. 400 g of soybean bean called 1 L in distilled water and 100 ml of distilled water were placed in a Erlenmeyer flask (1 L) and autoclaved at 121 ° C for 35 minutes. Then, the soybean was cooled in an aseptic condition (Clean bench), and the spore suspension of the selected strain was inoculated with ⁴ × 10 ⁶ CFU / ml of 1% (v / w) of the soybean amount and incubated for 96 hours in the incubation room incubation room, where all work was aseptically as possible. Thereafter, 200 ml of 18% (v / w) brine was immersed in bean meju, physically disrupted using a stomaker (Bag Mixer® 400), immersed in a glass bottle and immersed in 40 g of salted salmon It was aged for 40 days and used in the experiment.

<5-2> Amino nitrogen ( NH ₂ -N) content measurement

To 5 g of doenjang, 50 ml of distilled water was added to a 100 ml beaker and homogenized. After shaking at 30 ° C for 4 hours, the supernatant was centrifuged at 4,200 rpm for 20 minutes. The supernatant was used as a sample for storage at 0 ° C.

Amino nitrogen content during soybean paste fermentation was measured by Formol titration. 2 ml of each sample was taken and taken in two test tubes. 4 ml of a neutral formalin solution and 4 ml of water were added to one side and 8 ml of distilled water was added to the other side by a blank test. Amounts of amino nitrogen were measured by titration with 0.1 N NaOH solution on both sides until the pH reached 8.4.

<5-3> Measurement of reducing sugar

To 5 g of doenjang, 50 ml of distilled water was added to a 100 ml beaker and homogenized. After shaking at 30 ° C for 4 hours, the supernatant was centrifuged at 4,200 rpm for 20 minutes. The supernatant was used as a sample at 0 ° C.

Reducing sugar content was measured by DNS method. 0.3 ml of sample was added and 1 ml of dinitrosalicylic acid reagent was added. After cooling for 5 minutes in a bath, the absorbance was measured at 550 nm and converted to glucose using a standard curve.

As a result, as shown in Table 3, S. brevicaulis M2479 had higher amino acid nitrogen and reducing sugar than the control.

Previous studies have shown that aminophylline is closely related to the taste of miso as a free amino acid (free amino group) produced by decomposition of soybean protein during the preparation and storage of doenjang. As a result, S. brevicaulis M2479 is able to efficiently produce aminotransparent nitrogen flavored soybean protein by decomposing the protein of soybean, so that S. brevicaulis M2479 Was evaluated to have excellent fermentation characteristics in the production of soybean paste. It was found that S. brevicaulis M2479 having such excellent fermentation characteristics can be used as an excellent seed for the production of soy sauce.

Isolates Origin no. Fungal species Amino nitrogen (mg%) Reducing sugar (%) Isolate M2479 S. brevicaulis 489.90 0.185 Control CF1001 Aspergillus oryzae 420.26 0.145

<5-4> Fermented soybean ^One H- NMR  analysis

¹ H-NMR nuclear magnetic resonance spectroscopy (Nuclear Magnetic Resonance 600) analysis was performed to examine the metabolite of soybean fermented product. The soybean fermented product was lyophilized to a powder form and 0.1 g of the powder was dissolved in 99.9% deuterium oxide (600 ul, D2O) and 5 mM sodium 2,2-dimethyl-2-silapentane-5-sulfonate (DDS, 97% . The lysates were transferred to a 600-MHz NMR tube and ¹ H-NMR spectra were obtained using a 600-MHz NMR spectrometer (Avance-600, Bruker). Identification and concentration of each metabolite were performed using the Chenomx NMR suite program (ver. 6.1, Chenomx, Canada).

As a result, as shown in Figure 4, S. brevicaulis Total free amino acid content of M2479 was higher than that of control. As shown in FIG. 5, the contents of glutamate and tyrpsine were higher than those of the control, and alanine, lysine and serine, which are sweet components, And it is expected to contribute to the flavor of the cabbage. In particular, when comparing the results of the present experiment with the results of the present experiment, glutamate is a component showing a large amount of content, which is much higher than that of the control.

Korea Agricultural Microbiology Resource Center KACC93202P 20140610

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Novel Scopulariopsis brevicaulis M 2479 and use therof <130> p2014-0065 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 606 <212> RNA <213> rDNA ITS of Scopulariopsis brevicaulis M2479 <400> 1 tgaggaagta aaagtcgtaa caaggtctcc gttggtgaac cagcggaggg atcattaccg 60 aagttactct tcaaaaccca ttgtgaacct tacctcttgc cgcgcgttgc ctcggcgggg 120 aggcggggtc tgggtcggcg cgcccctcac cgggccgccg tccccgtccc cgtccccgcc 180 ggccgcgcca aactctaaat ttgaaaaagc gtactgcacg ttctgattca aaacaaaaaa 240 caagtcaaaa cttttaacaa cggatctctt ggttctggca tcgatgaaga acgcagcgaa 300 atgcgataag taatgtgaat tgcagaattc agtgaatcat cgaatctttg aacgcacatt 360 gcgcccggca gcaatctgcc gggcatgcct gtccgagcgt catttcttcc ctcgagcgcg 420 gctagcccta cggggcctgc cgtcgcccgg tgttggggct ctacgggtgg ggctcgtccc 480 ccccgcagtc cccgaaatgt agtggcggtc cagccgcggc gccccctgcg tagtagatcc 540 tacatctcgc atcgggtccc ggcgaaggcc agccgtcgaa ccttttattt catggttgac 600 CTCgat 606

Claims (15)

Scopulariopsis &lt; / RTI &gt; deposited with accession number KACC 93202P brevicaulis ; S. brevicaulis ) strain M2479.
2. The strain of S. brevicaulis M2479 according to claim 1, wherein the strain has an rDNA ITS consisting of the nucleotide sequence of SEQ ID NO: 1.
The strain of S. brevicaulis M2479 according to claim 1, wherein the strain has an optimum growth temperature of 25 to 30 占 폚.
The strain of S. brevicaulis M2479 according to claim 1, wherein the strain exhibits a drought resistance.
The strain of S. brevicaulis M2479 according to claim 1, wherein the strain has a protease activity.
The strain of S. brevicaulis M2479 according to claim 1, wherein the strain has an amino nitrogen and a reducing sugar.
The strain of S. brevicaulis M2479 according to claim 1, wherein the strain has a free amino acid.
The method of claim 1 wherein the strain is S. brevicaulis M2479 strain characterized in that it has a glutamate (glutamate), lysine (lysine) activity.
A fermented soybean fermented by using the strain S. brevicaulis M2479 of any one of claims 1 to 8.
10. The fermented soybean according to claim 9, wherein the soybean fermented product has an amino nitrogen and a reducing sugar.
[10] The fermented soybean according to claim 9, wherein the soybean fermented product is selected from the group consisting of meju, soybean paste, chongkukjang, soybean paste, kochujang, buckwheat and soy sauce.
8. A method for producing a fermented soybean comprising inoculating a soybean strain of S. brevicaulis M2479 according to any one of claims 1 to 8 and then fermenting.
13. The method for producing a soybean fermented product according to claim 12, wherein the soybean fermented product has an amino nitrogen and a reducing sugar.
13. The method for producing a soybean fermented product according to claim 12, wherein the soybean fermented product is selected from the group consisting of meju, soybean paste, chungkukjang, soybean curd, kochujang, buckwheat and soy sauce.
1) culturing a strain of S. brevicaulis M2479 according to any one of claims 1 to 8; And
2) A method for mass production of protease from a strain of S. brevicaulis M2479 comprising isolating the protease from the culture broth cultured in step 1).

Images