KR20160008054A - Composition for improving hair or skin conditions comprising ursolic acid - Google Patents

Abstract

The present invention relates to a composition comprising ursolic acid as an active ingredient for improving hair or skin conditions. Particularly, the present invention relates to a composition which can show effects of preventing hair loss; stimulating hair sprouting; stimulating hair growth; adding gloss to hairs; preventing damages to hairs; preventing, alleviating, and reducing or treating poliosis or vitiligo; or alleviating or treating scars, by comprising ursolic acid as an active ingredient.

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for improving hairs or skin condition comprising, as an active ingredient,

The present invention relates to a hair or skin condition improving composition comprising uronic acid as an active ingredient. Specifically, the present invention relates to a composition for improving body hair or skin condition comprising uronic acid as an active ingredient. The composition contains uronic acid as an active ingredient to prevent hair loss, promote hair growth, promote hair growth, impart body hair gloss, Alleviating, alleviating, treating or alleviating scarring or alleviating acne, or improving or treating scarring.

Hair is an important part of the process of increasing interest in beauty as the age changes. Hair is a thin, exfoliated structure produced from the surface of the skin. It acts as a cushion against external impact, protects the human body from external stimuli such as direct sunlight, cold, friction, danger, and discharges the heavy metals such as arsenic, mercury and zinc harmful to the body to the outside of the body. The side is also being emphasized.

However, many people are complaining of hair loss due to various causes, including dietary changes and increased internal and external stress.

Human hair has about 100,000 to 150,000 hairs, and each hair has a different growth period. The hair growth cycle consists of three stages: the anagen stage where hair grows most actively, the catagen stage where hair starts to degenerate, and the telogen stage where hair growth stops or rests. .

In general, alopecia refers to an increase in the number of abnormal hair loss due to shortening of hair growth rate in the growing period and increased number of hair in the retrogressive or resting period among these cycles.

Male hormones play an important role in the death and elimination of hair follicles. DKK-1 (Dickkopf-related protein) plays an important role in hair follicle growth inhibition and death, among factors expressed in hair follicles by male hormone.

On the other hand, for periodic hair growth, hair follicle regeneration and stem cell activation must be performed, which is known to be caused by the production and activation of Wnt / β-catenin. In addition, DKK-1 mentioned above is known to be an antagonist of Wnt / [beta] -catenin, so that the above signal system is very important for controlling hair growth.

As a therapeutic agent for the treatment or prevention of alopecia that has been developed so far, there are a female hormone-based agent such as minoxidil, finasteride, tricosaccharide (maleic anhydride, etc.) for promoting blood circulation, strengthening hair follicles, trichosaccharide), and the like. However, there are many limitations in use due to side effects such as sexual dysfunction, possibility of giving birth to a malformed baby, and general hair growth.

The hair is composed of cuticle, cortex and medulla from the outermost periphery. The outermost morphe is again composed of a plasma membrane layer, multiple layers of cuticle structure, cuticle and cuticle And a CMC (cuticle membrane complex) layer between them. The cuticle layer, which accounts for a significant portion of the hair mass, is mostly composed of proteins and contains some lipids and sugar components.

As the hair is damaged by physical and chemical stimuli, the shape of the PM layer and the cuticle change or fall off, and the loss of the constituent proteins and lipids is induced. As the hair damage progresses, the cuticle gradually disappears. In very severe cases, the hair follicles and the layer of the hair are exposed to the surface, and these layers are weaker than the physical and chemical stimuli in comparison with the cuticle, To the stage.

Many studies have been conducted to minimize the damage of hair and to improve the condition of natural hair. Studies on compositions for hair containing most of the cuticles, that is, keratin components, studies on prevention of peeling and disappearance of cuticles by maintaining the moisture of hair, and organic / inorganic polymer compounds or cationic surfactants Has been used to provide a coating effect on the surface of hair, thereby studying to cope with external stimuli, stimulating blood flow of hair follicle cells, and activating metabolism to produce healthy hair. However, until now, even the mechanism of hair damage In addition to being not clearly defined, the applications of previous researches are still at the concept level, and they are short-lived, temporal effects, or are incompatible with the characteristics of individuals, and thus they have not been able to achieve definite improvement in hair damage.

Under these circumstances, the inventors of the present invention have solved the above-mentioned problems, and have found that it is possible to minimize the side effects, secure the human body while enhancing the hair growth and strengthening the film structure on the hair surface to minimize the peeling and disappearance of the inner cuticle from the external stimulus, In order to find a new active ingredient that can effectively prevent injuries and body hair damage, it has been found that uronic acid activates the Wnt / β-catenin signaling system and reduces DKK-1 gene expression, thereby preventing hair loss and promoting hair growth It can not only promote hair growth but also can prevent, alleviate, improve or treat white moth, vitiligo or scar. It can exert excellent hair coating effect when applied to human body and increase moisture retention of hair, As well as helping to prevent hair damage, It was completed.

An object of the present invention is to prevent hair loss, promote hair growth, promote hair growth, impart luster to hair, and prevent hair damage by using a composition containing uronic acid as an active ingredient.

Another object of the present invention is to provide a composition for hair which has high affinity for human body and high stability and has little side effects even when used for a long time.

Another object of the present invention is to prevent, alleviate, ameliorate, or treat white spot, black spot or scar using a composition containing uronic acid as an active ingredient.

In order to solve the above problems, the present invention provides a hair condition improving composition comprising uric acid as an active ingredient.

The present invention provides, as an embodiment, a cosmetic composition for preventing hair loss, promoting hair growth, promoting hair growth, imparting hair gloss or preventing hair damage, which comprises ursolic acid or a cosmetically acceptable salt thereof as an active ingredient .

In another embodiment, the present invention provides a pharmaceutical composition comprising, as an active ingredient, ursolic acid or a pharmaceutically acceptable salt thereof as an active ingredient for preventing hair loss, promoting hair growth, promoting hair growth, to provide.

In the present invention, the uricol acid may be represented by the following general formula (1).

[Chemical Formula 1]

In another embodiment, the present invention provides a cosmetic composition for prevention, alleviation or improvement of white moth or alleviation comprising ursolic acid or a cosmetically acceptable salt thereof as an active ingredient.

In another embodiment, the present invention provides a pharmaceutical composition for prevention, alleviation or treatment of white moth or lucerne comprising ursolic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

As another embodiment of the present invention, there is provided a cosmetic composition for improving scarring comprising ursolic acid or a cosmetically acceptable salt thereof as an active ingredient.

In another embodiment, the present invention provides a pharmaceutical composition for treating scarring comprising ursolic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In the present invention, the uric acid is characterized by activating the Wnt /? - catenin signaling system.

In the present invention, the uric acid is characterized by decreasing DKK-1 gene expression.

In the present invention, the content of uronic acid is preferably 0.001 to 10% by weight in the total composition.

Hereinafter, the present invention will be described in detail.

The present invention is based on the fact that uric acid activates the Wnt / beta-catenin signaling system and has the effect of reducing DKK-1 gene expression.

The term " ursolic acid "used in the present invention may be a compound represented by the following formula (1), and the name of the compound is (1S, 2R, 4aS, 6aR, 6aS, 6bR, 8aR, 10S, 12aR, 10-hydroxy-1,2,6a, 6b, 9,9,12a-heptamethyl-2,3,4,5,6,6a, 7,8,8a, 10,11,12,13,14b- Tetradecahydro-1H-picene-4-carboxylic acid.

[Chemical Formula 1]

Ursol acid is one of the terpenoids belonging to the terpenoid family and is known as a highly important anticancer substance. The natural state of Ursol is a metabolite of herbaceous plants used in traditional medicinal plants such as cinnabar, cinnabar, berries, cedar, cinnabar, hawthorn, dogrose, and rhodendron. Ursolic acid has been reported to have strong antioxidative, insecticidal, anti-inflammatory, antifungal, anticonvulsant, antitumor and mutagenic inhibitory effects.

The uronic acid of the present invention exhibits an effect of activating the Wnt /? - catenin signaling system, and this effect was first identified in the present invention.

Specifically, in one embodiment of the present invention, it was confirmed that when the composition containing the uric acid as an active ingredient was treated, the Wnt / β-catenin signaling system could be activated (Example 2).

In addition, the above-mentioned uric acid of the present invention has an effect of reducing the expression of DKK-1 gene, which plays an important role in inhibiting hair follicle growth and killing, and this effect was first identified in the present invention.

Specifically, in one embodiment of the present invention, it was confirmed that the expression of DKK-1 gene could be reduced by treating the composition containing the uric acid as an active ingredient (Example 3).

In particular, the uronic acid of the present invention activates the Wnt /? - catenin signaling system and at the same time reduces the expression of DKK-1 gene and consequently promotes differentiation or proliferation into hair follicle cells, , Hair growth stimulation, or body hair growth promoting effect.

The term " differentiation into hair follicle " means a process in which stem cells present in hair follicles differentiate into hair follicle cells.

The proliferation of the hair follicle cells means a process of increasing the number of cells by repeating the division of the hair follicle cells.

Specifically, in one embodiment of the present invention, the cosmetic composition comprising the uric acid as an active ingredient may be used as a hair cosmetic composition. After the hair cosmetic composition is manufactured, the number of hair is remarkably less than 3 months, As a result of using weak male and female subjects, it was confirmed that the subjects were excellent in the thickness, density, and elasticity of the hair.

In another embodiment of the present invention, a cosmetic composition containing uric acid as an active ingredient is used as a cosmetic composition for men and women having an eyelash composition having a number of eyelashes remarkably less than or equal to three months As a result, it was confirmed that the degree of satisfaction of the thickness, density, length, elasticity and overall evaluation items of the eyelashes was excellent.

In addition, the uronic acid of the present invention acts on the surface of damaged hair to form a film structure, thereby acting as a defense against external stimuli, penetrating into the CMC layer in the hair to increase the moisture content and increase the fluidity, To inhibit the body hair gloss or hair loss.

In one embodiment of the present invention, the hair sample treated with the hair lotion composition containing the uric acid as an active ingredient is completely coated with the cuticle layer of the hair as compared to the hair sample treated with the hair lotion composition not containing the uric acid It was confirmed that the condition of the hair surface was improved sharply and the adsorption property and the water holding power to the hair surface were also improved, thereby helping to prevent hair damage (Examples 6 and 7).

Therefore, the uricol acid of the present invention not only has the effect of promoting the production and growth of new hair follicles, but also smoothly improves the state of the surface of the hair and can prevent hair damage. Therefore, it can be used as an anti-hair restorer, hair growth promoter, hair growth promoter, Or as an active ingredient of an anticancer agent.

Accordingly, the present invention also relates to the use of uronic acid for the preparation of a cosmetic composition, pharmaceutical composition or food composition for preventing hair loss, promoting hair growth, promoting hair growth, preventing hair glowing or body hair damage and applying effective amount of uric acid to the skin , Hair growth promotion, hair growth promotion, hair gloss impartation, or prevention of hair damage.

In addition, the uric acid of the present invention can induce the production of melanin by activating the Wnt / beta -catenin signal transduction system, and can exhibit an effect on scar reduction or treatment.

The uronic acid of the present invention can induce melanogenesis to prevent, alleviate, ameliorate, or treat white mucus or vitiligo.

Therefore, the uronic acid of the present invention has an effect of activating the Wnt / beta -catenin signal transduction system and inducing the production of melanin, so that it can be usefully used as an effective ingredient for the treatment of white moth or leukosis.

Accordingly, the present invention also relates to the use of uronic acid for the preparation of a cosmetic composition or pharmaceutical composition for preventing, alleviating, ameliorating or treating white spot or vitiligo, and the use of an effective amount of uronic acid in the skin for preventing, Mitigate, ameliorate, or treat the disease.

In addition, the uronic acid of the present invention has an effect of activating the Wnt /? -Catenin signal transduction system to improve or treat scarring, so that it can be effectively used as an active ingredient of a scar treatment agent.

Accordingly, the present invention relates to the use of uronic acid for the preparation of cosmetic compositions or pharmaceutical compositions for the prevention, alleviation, amelioration or treatment of scarring, and to the prevention, alleviation, amelioration or treatment of scarring, comprising applying an effective amount of uric acid to the skin ≪ / RTI >

The uronic acid of the present invention may contain uric acid hydrate, uronic acid derivative and the like within the range having the same efficacy, and may include a solvent or a stereoisomer thereof. The above-mentioned uric acid can be chemically synthesized or extracted directly from natural materials such as coconut tree, fruit of coconut tree, white sugarbeet tree, seabuckson, vine tangerine, hawthorn tree, dogrose, or rhodendron tree, It can also be used. When the uronic acid is separated from a natural substance, it may be a concept including both an extract of a natural product or a fraction thereof, as long as it contains the uronic acid.

In addition, the uronic acid of the present invention may exist in a solvate as well as in a non-solvate form including the form of a hydrate, an ethanolate and the like. The inventive uronic acid may exist in crystalline or amorphous form, and all such physical forms are included within the scope of the present invention.

The uric acid used in one embodiment of the present invention was purchased from Phyto Ingredients Inc. (China).

The uronic acid of the present invention may be used in the form of a pharmaceutical or cosmetically acceptable salt thereof.

As such salts, acid addition salts formed by pharmaceutical or cosmetically acceptable free acids are useful. Acid addition salts can be prepared in a conventional manner, for example, by dissolving the compound in an excess amount of an aqueous acid solution and precipitating the salt with a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It is also possible to heat an equimolar amount of the compound and an acid or alcohol (e.g., glycol monomethyl ether) in water, and then evaporate the mixture to dryness, or the precipitated salt may be subjected to suction filtration.

As the free acid, an inorganic acid or an organic acid can be used. The inorganic acid may be, for example, hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. These may be used alone or in admixture of two or more. Non-limiting examples of the organic acid include methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, mandelic acid, The present invention also relates to the use of a compound of formula (I) as an acid, citric acid, lactic acid, glycollic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillyric acid, hydroiodic acid and the like. These may be used alone or in combination of two or more.

In addition, the uronic acid can be made into a pharmaceutically or cosmetically acceptable metal salt using a base. The alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess amount of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the non-soluble compound salt, and evaporating and drying the filtrate. As the metal salt, it is preferable to produce sodium, potassium or calcium salt in particular, but it is not limited thereto. The corresponding silver salt can also be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (for example, silver nitrate).

The pharmaceutically or cosmetically acceptable salt of the uronic acid may include all salts of acidic or basic groups which may be present in the compound of the uronic acid, unless otherwise indicated. For example, the pharmaceutically or cosmetically acceptable salts may include sodium, calcium, and potassium salts of hydroxy groups, and other pharmacologically or cosmetically acceptable salts of amino groups include hardro-bromide, sulfate (Salicylate) salts such as hydrogen sulfates, phosphates, hydrogen phosphates, dihydrogen phosphates, acetates, succinates, citrates, tartrates, lactates, mandelates, methanesulfonates (mesylates) and p- And can be prepared through a method for producing a salt known in the art.

The term "hairs" used in the present invention refers collectively to hairs distributed in the body. For the purpose of the present invention, the distribution of the hairs is not particularly limited. However, for the purpose of the present invention, the hairs that are distributed in the body parts that can enhance the aesthetics by the generation, growth or altitude distribution of hairs, . ≪ / RTI >

The term "hair loss prevention" used in the present invention means that the phenomenon of hair falling off the hair follicle or scalp is inhibited or weakened.

As used herein, the term " promoting hair growth "means that hair is produced, and is used in a broad sense to increase hair growth rate and amount. In addition, it means that hair root function is strengthened, hair dropping and generation cycle is shortened, and the number of hairs growing in hair follicles is increased.

The term " hair growth promotion "as used in the present invention means that the thickness of the hair body produced is increased or the length of hair growth is increased.

As used herein, the term " hair glowing "means imparting a state of being lustrous and moist without feeling flabby.

As used herein, the term "hair damage prevention" refers to a function to prevent external stimuli by forming a film structure on the surface of hairs, or to penetrate into the internal CMC layer in the case of hairs to increase water content and increase fluidity, This means indirectly suppressing the departure.

The uronic acid of the present invention can be preferably added to a composition for preventing hair loss, promoting hair growth, promoting hair growth, imparting hair gloss or preventing hair damage, but is not limited thereto.

In addition, the composition for preventing hair loss, promoting hair growth, promoting hair growth, imparting hair luster, or preventing hair loss damage, which comprises the uronic acid of the present invention as an active ingredient, may further contain one or more active ingredients exhibiting the same or similar functions . For example, it may contain known components for preventing hair loss, promoting hair growth, promoting hair growth, imparting hair shine or preventing hair damage. In this case, the effect of preventing the hair loss, promoting the hair growth, promoting the hair growth, imparting the hair luster, or preventing hair loss in the composition of the present invention may be further enhanced. When the above ingredients are added, skin safety, easiness of formulation, and stability of effective ingredients can be considered according to the combined use.

The term " white hair " used in the present invention means that the hair turns white, and most of the appearance of progression of aging is not limited to such a cause.

The term " vitiligo "used in the present invention means a decolorizing disease in which white spots appear on the skin due to destruction of melanocytes.

The uronic acid of the present invention can be added to a composition for preventing, alleviating, alleviating, or treating white moth or alleviosis, but is not limited thereto.

In addition, the composition for preventing, alleviating, alleviating, or treating white mold or vitiligo comprising the uronic acid of the present invention as an active ingredient may further contain one or more active ingredients exhibiting the same or similar functions. E. G., Ingredients known in the art for preventing, alleviating, ameliorating or treating white moths or vitiligo. In this case, the effect of preventing, alleviating, improving or treating white moth or vitiligo of the composition of the present invention may be further enhanced. When the above ingredients are added, skin safety, easiness of formulation, and stability of effective ingredients can be considered according to the combined use.

As used herein, the term "scar" refers to a trail of a scar on the body of a living being healed. In general, a shallow scar is usually left, but a large scar is healed, Sometimes the appearance of the part remains unsightly, and these traces are called scars. Specifically, the scar can be a scar due to burns or acne.

The uronic acid of the present invention can be preferably added to a composition for preventing, alleviating, improving or treating scarring, but is not limited thereto.

In addition, the composition for preventing, alleviating, improving or treating scar, which comprises the uronic acid of the present invention as an active ingredient, may further contain one or more active ingredients exhibiting the same or similar functions. For example, it may contain ingredients for preventing, alleviating, ameliorating or treating known scars. In this case, the scar prevention, alleviation, improvement, or therapeutic effect of the composition of the present invention may be further enhanced. When the above ingredients are added, skin safety, easiness of formulation, and stability of effective ingredients can be considered according to the combined use.

When the uronic acid of the present invention is used as a drug for preventing hair loss, promoting hair growth, promoting hair growth, imparting hair gloss or preventing hair damage, it may further comprise an acceptable carrier.

The term "pharmaceutically acceptable" of the present invention refers to compositions and molecules that are physiologically acceptable and typically do not cause unexpected reactions when administered to humans. Preferably, as used herein, the term " pharmaceutically acceptable "means that it is approved by other commonly known pharmacopoeias for use in mammals and especially humans.

Pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose , Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil, and the like.

The pharmaceutical composition of the present invention can be administered parenterally, and can be administered in the form of a general pharmaceutical preparation, for example, various forms of parenteral administration at the time of clinical administration. In the case of formulation, the filler, , A wetting agent, a disintegrant, a surfactant, and the like.

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, or lyophilisers. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent.

The pharmaceutical composition of the present invention can provide a desirable hair growth effect or hair growth promoting effect when it contains an effective amount of uric acid. In the present invention, "effective amount" means an amount of a compound capable of exhibiting an effect of preventing hair loss, promoting hair growth, promoting hair growth, imparting hair gloss or preventing hair loss. The effective amount of the uronic acid contained in the composition of the present invention will vary depending on the form in which the composition is produced, the manner in which the compound is applied to the skin, and the time on the skin. For example, when the composition is commercialized as a medicine, uronic acid may be contained at a high concentration as compared with a product such as a shampoo, a hair conditioner, and a hair pack, which are routinely applied to the skin. Accordingly, the daily dose is 0.1 to 100 mg / kg, preferably 1 to 50 mg / kg, more preferably 5 to 20 mg / kg, based on the amount of uronic acid, . In addition, the dose may be increased or decreased according to age, sex, weight, degree of disease, route of administration, and the like. Accordingly, the dosage is not limited in any way to the scope of the present invention.

The pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

The present invention can also be provided as a formulation for external skin preparation for preventing hair loss, promoting hair growth, promoting hair growth, imparting hair gloss or preventing hair damage, which comprises uronic acid as an active ingredient.

When the uronic acid is used as an external preparation for skin, it may further contain at least one selected from the group consisting of fatty substances, organic solvents, solubilizers, thickeners and gelling agents, softening agents, antioxidants, suspending agents, stabilizers, foaming agents, For example, those conventionally used in ionic or nonionic emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, And may contain adjuvants conventionally used in the field of dermatology, such as any other ingredient. The components can also be introduced in amounts commonly used in the field of dermatology.

When uronic acid is provided as a topical dermal preparation, it may have a formulation that is applicable to hair, such as, but not limited to, gels, creams, patches, or sprays.

The present invention can also be provided as a formulation of a cosmetic composition for preventing hair loss, promoting hair growth, promoting hair growth, imparting hair gloss or preventing hair damage, which comprises uronic acid as an active ingredient.

When uronic acid is used as a cosmetic product, the cosmetic product containing uronic acid as an active ingredient can be produced in the form of a general emulsified formulation and a solubilized formulation. For example, they may have formulations such as sprays, hair gels, hair packs, shampoos, hair conditioners, hair lotions, hair essences, patches or sprays.

The cosmetic composition may further contain, in addition to uronic acid, a lipid, an organic solvent, a solubilizer, a thickener and a gelling agent, a softener, an antioxidant, a suspending agent, a stabilizer, a foaming agent, a fragrance, Or any other commonly used in cosmetics such as nonionic emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, barrier agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or cosmetics ≪ RTI ID = 0.0 > ingredients. ≪ / RTI >

Preferably, the composition of the present invention can be prepared in any form that can be applied to scalp, such as liquid, cream, paste, or solid form, and can be added with usual additives to prevent hair loss, promote hair growth, promote hair growth, Hair shampoo, hair conditioner, hair lotion, liquid type hair growth agent type, etc. for preventing hair loss, and the aerosol type of these formulations is also included.

The composition of the present invention may contain 0.001 to 10% by weight, preferably 0.005 to 5% by weight, more preferably 0.01 to 3% by weight, of uronic acid relative to the total weight of the total composition.

If the content of uronic acid is less than 0.001% by weight, it may be difficult to expect the promotion of hair growth induction, the maintenance of hair moisture and the reduction of cuticle peeling, and if the content exceeds 10% by weight, It is difficult to secure stability.

The composition containing uronic acid of the present invention exhibits an effect of promoting hair growth. In addition, the composition containing uronic acid of the present invention not only exhibits the effect of promoting hair growth, but also exhibits an excellent effect in preventing hair loss, exhibits an excellent effect in imparting hair shine through coating of the hair surface, It is also excellent.

The composition comprising the uronic acid of the present invention can be used as a safe and excellent cosmetic raw material or pharmaceutical ingredient. In particular, the composition of the present invention provides excellent hair loss prevention, hair growth promotion, hair growth promotion, hair luster application, or hair loss prevention effect without side effects such as irritation or itching in the human body.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a graph showing the degree of DKK-1 expression upon treatment of uric acid with dihydrotestosterone. FIG. According to the results shown in Fig. 1, the treatment of uric acid has an effect of decreasing DKK-1 expression, which is increased by dihydrotestosterone treatment.
2A is an SEM image showing the surface cuticle state of a hair sample treated with a hair lotion composition not containing uric acid.
2B is an SEM image showing the surface cuticle state of a hair sample treated with a hair lotion composition containing uric acid.
2C is an SEM image showing the surface cuticle state of a healthy normal hair sample without treatment.

Hereinafter, the constitution and effects of the present invention will be described in more detail through examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not limited by these embodiments.

Example  One: Ursolic acid Of cytotoxicity

Ursolic acid of the present invention was purchased from Phyto Ingredients Inc. (China).

In this example, cell proliferation changes of Follicle Dermal Papilla (Promocell, Germany) were measured using Cell Counting Kit-8 (Dojindo Lab, USA) for the evaluation of cytotoxicity of ursolic acid.

First, a uniform number of cells were plated on a 96-well plate and stabilized. Ursolic acid was then added to the cells to a final concentration of 10 μg / ml or 20 μg / ml, followed by further incubation for 48 hours. Thereafter, CCK-8 was treated and the absorbance was measured at 450 nm for 2 hours. As a positive control, 6-bromoindirubin-3'-oxime (BIO) was used, which is known to activate the Wnt / β-catenin signal pathway by inhibiting GSK-3 in the Wnt signaling system. The relative cell viability of cells treated with Ursolic acid versus untreated was calculated by the following Equation 1, and the results are shown in Table 1 below.

[Equation 1]

Relative cell viability = (compound treated group) / (untreated group) X 100

sample No treatment BIO
1 μM Ursolic acid
10 μg / ml Ursolic acid
20 / / ml Survival rate (%) 100 103 98 97

From Table 1, it can be seen that there is no significant difference in the number of cells due to uricolic acid treatment.

Example 2: Effect of Ursolic acid on the activity of Wnt / β-catenin signal pathway

TOP flash reporter (Millipore, USA) was used to investigate the effect of uricolic acid on Wnt / β-catenin signal pathway activation. Human dermal papilla cells were inoculated in a 24-well plate at 2 × 10 ⁵ / well, cultured for 24 hours, treated with 10 μg / ml or 20 μg / ml of uricolic acid, and further cultured for 15 hours to obtain dual luciferase assay The firefly luciferase activity was measured using a kit (Promega, USA). The measurements corrected firefly luciferase levels to renilla luciferase levels.

In order to accurately measure the activity of luciferase, the activity of each sample was measured three times, and the activity relative to the control group was calculated as an increase rate (%). Negative control group was treated without treatment. As a positive control, 6-bromoindirubin-3'-oxime (BIO) was used, which is known to activate the Wnt / β-catenin signal pathway by inhibiting GSK-3 in the Wnt signaling system.

sample Control group BIO
1 μM Ursolic acid
10 μg / ml Ursolic acid
20 / / ml Growth rate (%) 1.00 1.54 1.37 1.91

As shown in Table 2, ursolic acid of the present invention increases the TOP flash reporter activity in a concentration-dependent manner, indicating that it has excellent activity against Wnt / β-catenin signal transduction.

Example 3: DHT-induced inhibition of DKK-1

Activation of Wnt / β-catenin promotes hair growth, while male hormone or dihydrotestosterone (WAKO, Japan) acts as an antagonist of Wnt / β-catenin through the promotion of DKK-1 gene expression.

Therefore, in order to investigate whether Ursolic acid inhibits DKK-1 gene, which is an antagonist of Wnt / β-catenin, hair growth can be promoted. Human umbilical cells were treated with 20 ㎍ / ml of uricolic acid and 100 nM of dihydrotestosterone After the treatment, the expression of DKK-1 was confirmed by RT-PCR using the primer (Bioneer, Korea) shown in Table 3 below.

Standing column Forward TGATGAGTACTGCGCTAGTC (SEQ ID NO: 1) Reverse CTCCTATGCTTGGTACACAC (SEQ ID NO: 2)

The results were analyzed by using a comparative CT (ΔΔCT) Experiment (Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2-Delta Delta C (T) (2001)). Internal control was performed using GAPDH, and the results are shown in FIG.

It can be seen from FIG. 1 that the treatment of uricolic acid significantly reduces the expression of DKK-1, which is increased by dihydrotestosterone treatment, thereby promoting hair growth.

Various formulation examples of the composition according to the present invention will be described in detail based on the above-mentioned effect test results. It should be apparent to those skilled in the art, however, that these formulation examples are merely examples of the composition of the present invention and that the composition of the present invention is not limited to these formulations only.

Formulation Example 1 and Comparative Formulation Example 1: Hairtonic composition (% by weight)

Hair tonics were prepared according to the prescriptions of the following Table 4 by a conventional method.

Compounding ingredient Comparative Formulation Example 1 Formulation Example 1 ethanol 55 55 Castor oil 5 5 glycerin 3 3 Pyrrothonol amine 0.1 0.1 Ursolic acid - 0.5 Spices and Pigments Suitable amount Suitable amount Purified water Balance (100 total) Balance (100 total)

Formulation Example 2 and Comparative Formulation Example 2: Shampoo composition (% by weight)

The shampoo was prepared in a usual manner according to the prescription of Table 5 below.

Compounding ingredient Comparative Formulation Example 2 Formulation Example 2 Polyquaternium 0.5 0.5 Sodium lauryl sulfate (30%) 20 20 Sodium polyoxyethylene lauryl sulfate 30 30 Coconut oil fatty acid diethanolamide 3 3 Quaternary ammonium cationic surfactant 2 2 Carbopol-1342 0.3 0.3 Paraoxybenzoic acid ester 0.2 0.2 Ursolic acid - 0.5 Spices and Pigments Suitable amount Suitable amount Purified water Balance (100 total) Balance (100 total)

Example 4: Test for confirming hair growth effect of the hair composition of the present invention

The hair-forming compositions of Formulation Examples 1 and 2 and Comparative Formulation Examples 1 and 2 were applied to 20 men and women who had significantly fewer hairs or less hair and showed hair loss symptoms five times a week for 6 months For hair and scalp. After the use, the evaluation showed improvement (very good: +5, slightly better; +4, no change: 3, slightly worse; 2: very poor; 1) to the thickness of hair, density, elasticity and overall evaluation items 3 months, and 6 months, and the average values are shown in Table 6 below.

Comparative Formulation Example 1 Comparative Formulation Example 2 Formulation Example 1 Formulation Example 2 Three months later
Average score Thickness of hair 3.1 3.2 4.1 4.2 Density 3.2 3.2 3.9 3.7 Resilience 3.0 3.4 4.2 4.3 Overall rating 3.1 3.3 4.1 4.1 6 months later
Average score Thickness of hair 3.4 3.3 4.3 4.5 Density 3.2 3.4 4.5 4.2 Resilience 3.5 3.2 4.4 4.3 Overall rating 3.4 3.2 4.4 4.3

As shown in Table 6, when the hair composition of the present invention was used for 3 months or longer, it was found that the subjects were satisfied with respect to thickness, density, and elasticity of the hair. In addition, as the result of using for 6 months, this satisfaction is more excellent, and it can be seen that the continuous use can provide more excellent effect.

Formulation Example 3 and Comparative Formulation Example 3 Eyebrow tonic composition (% by weight)

Eyebrow tonic compositions were prepared in a conventional manner according to the prescription of Table 7 below.

Compounding ingredient Comparative Formulation Example 3 Formulation Example 3 ethanol 40 40 Tocopheryl acetate 0.1 0.1 Salicylic acid 0.3 0.3 L-menthol 0.3 0.3 Ursolic acid - 0.5 Twin 20 Suitable amount Suitable amount Purified water Balance (100 total) Balance (100 total)

Formulation Example 4 and Comparative Formulation Example 4: eyebrow shampoo composition (% by weight)

The eyebrow shampoo compositions were prepared in a conventional manner according to the prescription of Table 8 below.

Compounding ingredient Comparative Formulation Example 4 Formulation Example 4 paraffin 5 5 Cetostearyl alcohol 5.5 5.5 Petrogradum 5.5 5.5 Glycerin monostearate 3 3 Polyoxyethylene octyldodecyl ether 3 3 Propylparaben 0.3 0.3 glycerin 7 7 Ursolic acid - 0.5 Dipropylene glycol 20 20 Polyethylene glycol 5 5 Spices Suitable amount Suitable amount Purified water Balance (100 total) Balance (100 total)

Example 5: Effect confirmation test of eyebrow formulation composition of the present invention

The eyebrow tonic compositions and the eyebrow shampoo compositions of Formulation Examples 3 to 4 and Comparative Forms Examples 3 to 4 were applied to 15 men and women who had significantly fewer or fewer eyelashes than normal, Respectively. After the use, the evaluation showed that the degree of improvement (very good, +5, slightly better, +4, no change; 3, slightly worse; 2, worse; 1, worse) on the thickness of eyelashes, density, length, elasticity and overall evaluation items ) Was performed after 3 months, and average values were shown in Table 9 below.

Comparative Formulation Example 3 Comparative Formulation Example 4 Formulation Example 3 Formulation Example 4 Three months later
Average score Eyelash length 3.2 3.1 4.1 4.2 Thickness of Eyelashes 3.1 3.3 4.7 4.6 The degree of dense lashes 3.2 3.1 4.3 4.4 Elasticity of eyelashes 3.2 3.2 4.7 4.6 Overall rating 3.2 3.2 4.5 4.5

From Table 9 above, the experiment participants using the eyebrow formulation composition of the present invention gave satisfactory evaluation for all items. In particular, the evaluation of the thickness and elasticity of the eyelashes was the best.

Example 6: Test for confirming the effect of hair coating by observing the surface state of hair

Hair hair lotion compositions, which were formulations according to the prescription of the following Table 10, were used to dry the hair samples, and a few strands were taken randomly and the surface state was observed with an SEM (Scanning Electron Microscope).

Compounding ingredient Comparative Formulation Example 5 (% by weight) Formulation Example 5 (% by weight) Cetostearyl alcohol 2 2 Stearyltriethylammonium chloride 2 2 Hydroxyethyl cellulose 0.5 0.5 Pyrrothonol amine 0.1 0.1 Ursolic acid - 0.5 Spices and Pigments Suitable amount Suitable amount Purified water Balance (100 total) Balance (100 total)

The results are shown in Fig.

The sample (Formulation Example 5) treated with the hair lotion composition containing Ursolic acid shown in FIG. 2B had a higher cuticle layer than the sample treated with the hair lotion composition containing no ursolic acid (Comparative Formulation Example 5) And it was found that the condition of the surface of the hair was improved shine. In addition, as shown in FIG. 2, adsorption to hair surface was also very good. From the above results, it can be seen that the use of ursolic acid in the composition for hair can help prevent hair damage due to perming, dyeing (discoloration), physical stimulation as well as imparting gloss to the hair.

Example 7 Evaluation of Water Retention of Ursolic Acid Containing Composition

The shampoo composition containing ursolic acid, a formulation according to the prescription of Table 11 below, was diluted 10-fold in purified water, and the hair specimen was shaken for 5 minutes in a diluted solution. Each hair specimen was washed and rinsed in flowing water for the same time (30 seconds) and dried. The above procedure was repeated ten times to prepare an evaluation hair specimen. The prepared hair specimens were stored in a humidity chamber of 82% humidity for 24 hours. Each hair sample was weighed in an amount of 500 mg, and moisture was measured and recorded at 65 ° C for 40 minutes at 30 seconds intervals using an electronic moisture meter (Mettler HG-53). Thereafter, the temperature was raised to 180 ° C and the water content was measured for 30 minutes. The results are shown in Table 12 below.

Compounding ingredient Comparative Formulation Example 6 Formulation Example 6 Polyquaternium 0.5 0.5 Sodium lauryl sulfate (30%) 20 20 Sodium polyoxyethylene lauryl sulfate 30 30 Coconut oil fatty acid diethanolamide 3 3 Quaternary ammonium cationic surfactant 2 2 Carbopol-1342 0.3 0.3 Paraoxybenzoic acid ester 0.2 0.2 Ursolic acid - 0.5 Spices and Pigments Suitable amount Suitable amount Purified water Balance (100 total) Balance (100 total)

First moisture content (%) ¹⁾ Second moisture content (%) ²⁾ Absolute moisture content (%) ³⁾ Comparative Formulation Example 6 89.39 86.75 17.24 Formulation Example 6 82.27 76.48 21.15 [Note] 1) First moisture content (%): the amount of water evaporated from hair at about 65%;
Average value after about 30 to 40 minutes
2) second moisture content (%): the amount of water evaporated from hair at about 180 ° C;
Average value after about 60 to 70 minutes
3) Absolute moisture content (%): The amount of water which has not evaporated at about 64 ° C

It can be seen from the above Table 12 that Formulation Example 6 has a significantly smaller amount of water to be evaporated than Comparative Formulation Example 6. [ Absolute moisture content was also confirmed to be higher in Formulation 6 than in Comparative Formulation 6.

<110> LG HOUSEHOLD & HEALTH CARE LTD. <120> Composition for making hair or skin conditions          ursolic acid <130> KPA140590-KR <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for DKK-1 expression <400> 1 tgatgagtac tgcgctagtc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for DKK-1 expression <400> 2 ctcctatgct tggtacacac 20

Claims (14)

A cosmetic composition for preventing hair loss, promoting hair growth, promoting hair growth, preventing hair loss or preventing hair damage, comprising ursolic acid or a cosmetically acceptable salt thereof as an active ingredient.
The cosmetic composition according to claim 1, wherein the uric acid is represented by the following formula (1): (1) a hair loss inhibitor, (2) a hair growth promoting agent, (3) a hair growth promoting agent,
[Chemical Formula 1]

The cosmetic composition for preventing hair loss, promoting hair growth, promoting hair growth, preventing hair loss or preventing hair damage, wherein the uronic acid activates the Wnt /? - catenin signaling system.
The cosmetic composition for preventing hair loss, promoting hair growth, promoting hair growth, imparting hair gloss or preventing body hair damage, wherein the uric acid reduces DKK-1 gene expression.
The cosmetic composition according to claim 1, wherein the content of uronic acid is 0.001 to 10% by weight of the total composition, which promotes hair growth, promotes hair growth, prevents hair luster, or prevents hair damage.
A pharmaceutical composition for preventing hair loss, promoting hair growth, promoting hair growth, inhibiting hair gloss or preventing hair damage, comprising ursolic acid or a pharmaceutically acceptable salt thereof as an active ingredient.
[Claim 7] The pharmaceutical composition according to claim 6, wherein the uric acid is represented by the following formula (1): (1) to prevent hair loss, promote hair growth, promote hair growth,
[Chemical Formula 1]

The pharmaceutical composition according to claim 6, wherein the uronic acid activates a Wnt /? - catenin signaling system. The pharmaceutical composition for preventing hair loss, promoting hair growth, promoting hair growth, preventing hair loss or preventing hair damage.
[Claim 7] The pharmaceutical composition according to claim 6, wherein the erosanic acid reduces DKK-1 gene expression to prevent hair loss, promote hair growth, promote hair growth, prevent hair shine or prevent hair damage.
[Claim 7] The pharmaceutical composition according to claim 6, wherein the content of uronic acid is 0.001 to 10% by weight of the total composition, which promotes hair growth, promotes hair growth, and provides hair gloss or hair loss.
A cosmetic composition for prevention, alleviation or improvement of white moth or alleviation comprising ursolic acid or a cosmetically acceptable salt thereof as an active ingredient.
A pharmaceutical composition for preventing, alleviating, or treating white moth or alleviosis comprising ursolic acid or a pharmaceutically acceptable salt thereof as an active ingredient.
A cosmetic composition for improving scarring comprising ursolic acid or a cosmetically acceptable salt thereof as an active ingredient.
A pharmaceutical composition for scar treatment comprising ursolic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

Images