KR20160002369A - Standard plasmid for detecting of genetically modified organisms and analysis method using the same - Google Patents

Abstract

The present invention relates to a standard plasmid for detecting a genetically modified organism, a quantitative analysis method of foreign genes mixed with a genetically modified organism using the standard plasmid, and a kit for the quantitative analysis of a genetically modified plant comprising the standard plasmid. The standard plasmid according to the present invention can be used in the detection of a genome including a cry3Bb1 gene, and is especially useful as a standard material capable of analyzing whether the gene is mixed with species like corn MON863, or the mixing rate of the same.

Description

TECHNICAL FIELD [0001] The present invention relates to a standard plasmid for assaying a genetic modification, an assay method using the same, and a kit for assay.

The present invention relates to a standard plasmid for the assay of transgenic plants, in particular a standard plasmid for the assay of transgenic plants containing the cry3Bb1 gene. The present invention also relates to a method for quantitatively analyzing an exogenous transgene incorporated into a transgenic plant using the standard plasmid and a kit for assaying transgenic plants containing the standard plasmid.

Genetically modified foods are food products derived from GMOs (genetically modified organisms) that are the latest technology to improve the shelf life, nutrient content, color, flavor and texture of food. GMO is a generic term that refers to organisms that increase productivity by artificially isolating and linking useful genes of animals, plants, or microorganisms, unlike conventional breeding by breeding of crops. It refers to organisms, not traditional breeding or natural recombination, Refers to an organism that acquires a new genetic trait by inserting an exogenous gene into the genetic material of the reference organism using biotechnology. And genetically modified foods refer to foods made from these genetic modifications.

Generally, to increase the productivity of GM crops, genes related to herbicide resistance, insect resistance, tolerance and cold tolerance are introduced into agricultural products. Today, there are many GMO foods on the market, among which soybean is the most important, and corn, papaya, pumpkin, and other varieties. On the other hand, there is a controversy about the human health of GMOs, and consumers and farmers are increasingly concerned about GMO globally. In order to commercialize genetically modified crops, environmental risk, human health and food safety are required to be evaluated. In the countries where GMOs are imported, regulatory systems including GMO labeling are established. In Korea, there is a labeling system to label transgenic plants when transgenic plants contain more than 3% of genetically modified plants, and other countries have similar tolerance values. Therefore, besides the qualitative analysis method for measuring whether or not GMO is mixed, accurate analysis technique for quantitatively measuring the mixing ratio has been required.

Quantitative analysis of GMOs is divided into two categories: protein analysis and DNA analysis. In general, the ELISA method using a protein expressed from a gene introduced into a transgenic plant has a limitation in that the detection intensity is lower than that of the PCR method, and protein denaturation may occur due to heat treatment. Therefore, a technology for quantifying a gene introduced into a transgenic plant using a real-time PCR method that quantitatively monitors the amount of amplification product together with amplification of the gene is currently mainly used. In addition to the primer set required for qualitative PCR, data can be obtained as a ratio of the intrinsic gene and the foreign gene to the reference material by real-time PCR using a fluorescent probe and CRM (certified reference material) or a standard plasmid as a standard material have.

The accuracy and precision of analysis of GMO tolerance values became very important according to the implementation of GMO markers. In order to accurately and precisely analyze tolerance values, the standard materials used for analysis are very important. Standard materials should also ensure long-term preservability and stability and homogeneity of their own.

Currently, reference materials are standard materials or genetically modified plants produced by mixing seeds of genetically modified plants and non-GMO seeds of each crop by weight in a conventional manner, Standard plasmids are used which are prepared by inserting an internal gene and an amplicon of an introduced gene extracted from a sample containing a certain amount of plants.

It is an object of the present invention to provide a standard plasmid for assaying transgenic plants comprising a gene consisting of the nucleotide sequence of SEQ ID NO: 1 and a gene consisting of the nucleotide sequence of SEQ ID NO:

Another object of the present invention is to provide a method for quantitatively analyzing an exogenous transgene incorporated into a transgenic plant using the standard plasmid.

It is still another object of the present invention to provide a kit for assaying transgenic plants comprising the standard plasmid.

It is still another object of the present invention to provide a kit for assaying transgenic plants comprising a protein expressed from the standard plasmid.

Accordingly, it is an object of the present invention to provide a kit for assaying genomic DNA comprising a plasmid DNA standard material for qualitative and quantitative analysis of GM maize by measuring the amount of recombinant gene MON863 corn, and a standard plasmid.

The present invention provides a standard plasmid for assaying transgenic plants, more specifically, a standard plasmid for transgenic plant assay comprising a gene consisting of a nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 2.

The gene consisting of the nucleotide sequence of SEQ ID NO: 1 is ssIIb And the gene consisting of the nucleotide sequence of SEQ ID NO: 2 is the cry3Bb1 gene.

The ssIIb The gene may be a PCR product obtained by performing PCR using a primer set consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4, but is not limited thereto.

The cry3Bb1 gene may be a PCR product obtained by performing PCR using a primer set consisting of the nucleotide sequences of SEQ ID NOS: 6 and 7, but is not limited thereto.

The ssIIb The gene is an inherent gene of a plant, and the cry3Bb1 gene is preferably a foreign introduced gene incorporated into a transgenic plant, but is not limited thereto. More specifically, the ssIIb gene is a starch synthase IIb ( ssIIb ) gene, which is an endogenous gene of corn. In the present invention, ssIIb is selected as an internal gene of corn, and the Food and Drug Administration also recommends the use of ssIIb as an internal gene as an official method for the examination of recombinant maize. The cry3Bb1 gene is expressed by Bacillus thuringiensis subsp . It is a gene that expresses the Cry3Bb1 delta-endotoxin protein from Kumamotoensis (Btk).

In one embodiment of the present invention, the cry3Bb1 gene comprises a 5 'flanking sequence and a 3' flanking sequence. The standard plasmid for transgenic plant assay But is not limited thereto.

As used herein, the term "transgenic plant" refers to a subgenera of a genetically modified organism (GMO), which refers to an organism that has been manipulated to take advantage of the gene from a particular organism and introduce it into an existing organism It belongs to the concept. In other words, a transgenic organism can be said to be a transgenic plant.

The transgenic plant to be tested with the standard plasmid according to the present invention may be, but is not limited to, the maize MON863 variety.

"MON863" of the present invention is a pest-resistant maize developed by Monsanto, USA using Monsanto, USA. It uses PV-ZMIRI13 to insert two genes cry3Bb1 and nptII into corn root worms Coleopteran) is modified to exhibit resistance to pests. cry3Bb1 is a Bacillus thuringiensis subsp . It is a gene derived from Kumamotoensis (Btk) that expresses Cry3Bb1 delata-endotoxin protein and is resistant to Coleopteran insects including corn root worms. Thus, the MON863 variety of corn contains the cry3Bb1 gene and is suitable as a genetic modification of the quantitative analysis using the standard plasmid of the present invention. However, it is not necessarily limited thereto, and it is obvious that any genetic modification containing the cry3Bb1 gene can be an object of the test according to the present invention.

The standard plasmid is preferably pBlunt-11kbMS having a cleavage map of FIG. 1, but is not limited thereto. The pBlunt-11kbMS plasmid can be used as a standard plasmid for a quantitative assay method for calculating the gene incorporation rate of the gene mutant according to the present invention.

In one embodiment of the present invention, the standard plasmid was constructed by ligating the PCR product of maize's inherent gene ( ssIIb ) and GM gene ( cry3Bb1 ) into a pCR-Blunt vector (Invitrogen, USA) (pBlunt-11bMS). Specifically, cry3Bb1 amplified by the primer set of SEQ ID NOs: 6 and 7 The PCR product of the gene was obtained and inserted into the pCR-Blunt vector. Then, to obtain the ssIIb insertion gene, the PCR product of the ssIIb gene amplified by the primer set of SEQ ID NOS: 3 and 4 was obtained. Then, the pCR-Blunt vector was subjected to standard PCR using a Zero PCR cloning kit (Invitrogen, USA) pBlunt-11kbMS was prepared.

In addition, an event of a transgenic plant can be determined using the standard plasmid of the present invention. Even the same modified gene is called an "event" for each such breed if the gene is inserted at a different location on the chromosome. Therefore, the standard plasmid of the present invention is more suitable as a standard substance for GMO detection because it enables to test a plurality of events of a genetic modification as well as varieties of a GM variant.

In addition, the present invention provides a method for quantitatively analyzing an exogenous transgene incorporated into a transgenic plant using the standard plasmid.

More specifically, the quantitative analysis method

I) diluting the standard plasmid by concentration;

(Ii) performing real-time PCR using a PCR primer set for assay and a probe using the standard plasmid diluted by the concentration and the DNA obtained from the biological sample as templates, respectively;

Iii) calculating a standard quantitative curve by measuring the amount of the PCR product performed on the diluted standard plasmid; And

Iv) introducing the amount of the PCR product performed on the DNA obtained from the biological sample into the standard quantitative curve to calculate the incorporation rate of the foreign introduced gene.

As used herein, the term "PCR (Polymerase Chain Reaction)" is a method for amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase, and is well known in the art.

As used herein, the term "real-time PCR" is a technique for monitoring and analyzing the increase of PCR amplification products in real time (Levak KJ, et al., PCR Methods, Appl., 4 (6): 357 -62 (1995)). The PCR reaction can be monitored by recording fluorescence emission in each cycle during the exponential phase, during which the increase in PCR product is proportional to the initial amount of target template. The higher the starting copy number of the nucleic acid target, the faster the fluorescence increase is observed and the lower the threshold value cycle. A pronounced increase in fluorescence above the baseline value measured between 3-15 cycles implies detection of accumulated PCR products. Compared to conventional PCR methods, real-time PCR has the following advantages: (a) conventional PCR is measured in a plateau, while real-time PCR provides data during the exponential growth phase have; (b) the increase in the reporter fluorescence signal is directly proportional to the number of amplicons generated; (c) The degraded probe provides permanent record amplification of the amplicon; (d) increase in detection range; (e) requires at least 1,000 times less nucleic acid than conventional PCR methods; (f) detection of amplified DNA without separation by electrophoresis is possible; (g) using a small amplicon size can achieve increased amplification efficiency; And (h) the risk of contamination is low.

When the amount of PCR amplified acid reaches a detectable amount by fluorescence, the amplification curve begins to occur, and the signal rises exponentially to reach the stagnation state. The larger the initial amount of DNA, the faster the amplification curve appears because the number of cycles with which the amount of amplified product reaches the detectable amount is smaller. Therefore, when real-time PCR is performed using a stepwise diluted standard sample, an amplification curve is obtained in which the initial DNA amounts are arranged in the order of the same intervals. Here, if a threshold is set at an appropriate point, the CT value at which the threshold and the amplification curve intersect is calculated.

In real-time PCR, PCR amplification products are detected through fluorescence. The detection methods are largely an interchelating method (SYBR Green I method) and a method using a fluorescent label probe (TaqMan probe method). Since the interchelating method detects double stranded DNA, it is possible to construct a reaction system at low cost without preparing a gene-specific probe. The method using a fluorescent label probe is costly, while the detection specificity is high, so even the similar sequence can be detected.

TaqMan probes, on the other hand, typically use probes that contain a fluorescent substance at the 5'-end and a quencher at the 3'-end (e.g., TAMRA or non-fluorescent quencher (NFQ)). The TaqMan probes are designed to anneal to internal parts of the PCR product.

The TaqMan probe specifically hybridizes to the template DNA in the annealing step, but the fluorescence is inhibited by the quencher on the probe. During the extension reaction, the TaqMan probe hybridized to the template is degraded by the 5 'to 3' nuclease activity of the Taq DNA polymerase, and the fluorescent dye is released from the probe and the inhibition by the quencher is released, indicating fluorescence. At this time, the 5'-terminal of the TaqMan probe should be located downstream of the 3'-terminal of the primer. That is, when the 3'-end of the primer is extended by a template-dependent nucleic acid polymerase, the 5'-3 'nuclease activity of the polymerase cleaves the 5'-end of the TaqMan probe, A signal is generated.

Both the reporter molecule and the quencher molecule attached to the TaqMan probe are fluorescent materials. Fluorescent reporter molecules and quencher molecules that may be used in the present invention may be any of those known in the art and are not limited thereto.

According to the present invention, when real-time PCR is used, the amount of fluorescence generated in the PCR amplification is measured by using a bidirectional primer and a detection probe that specifically bind to the DNA of the endogenous and transgene, Can be calculated. That is, the above quantitative analysis method is a method of analyzing how many percent of transgenic plants are contained through the relative ratio of foreign introduced genes to the inherent genes that the plants of the corresponding variety have.

According to one embodiment of the present invention, a standard curve representing the number of PCR cycles for the number of gene copies is calculated by measuring fluorescence by real-time PCR using a standard probe for detection, a primer for detecting an introduced gene, and a primer for detecting an inherent gene By comparing this to real-time PCR products from the analytical samples, the incorporation rate of transgenic plants in the sample can be analyzed.

Preferably, in the quantitative analysis method, the PCR primer set in step ii) may be a primer set consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4 and a primer set consisting of the nucleotide sequences of SEQ ID NOS: 6 and 7, 5 and 8, but is not limited thereto.

The primer set consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4 may specifically detect the ssIIb gene.

The primer set consisting of the nucleotide sequences of SEQ ID NOS: 6 and 7 includes cry3Bb1 It may be to specifically detect the gene.

The probe comprising the nucleotide sequence of SEQ ID NO: 5 may be a probe for detecting ssIIb gene.

The probe comprising the nucleotide sequence of SEQ ID NO: 8 is cry3Bb1 And may be a probe for gene detection.

As used herein, the term "primer " refers to a single stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target. Oligonucleotides used as primers can also include nucleotide analogs such as phosphorothioates, alkylphosphorothioates or peptide nucleic acids or they can contain an intercalating agent ). Preferably, the primer is a deoxyribonucleotide and is a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primers may also include ribonucleotides.

As used herein, the term "probe" is a single-stranded nucleic acid molecule comprising a sequence that is substantially complementary to the target nucleic acid sequence. The probe used in the present invention means a detection probe in which a fluorescent substance is introduced into a base sequence for quantitative analysis during real-time PCR. The kind of the detection probe can be appropriately selected by those skilled in the art depending on the type of the inherent gene and the introduced gene.

In step iii) of the quantitative analysis method, standard quantitative curves are obtained by diluting a standard plasmid DNA at a predetermined ratio, performing real-time PCR on a plurality of standard samples having different gene copy numbers, and performing PCR on the number of gene copies obtained therefrom Can be calculated by applying the number of cycles. Specifically, the DNA of a standard substance of which the mixing ratio is known is appropriately diluted to make the number of copies at regular intervals, or DNAs of transgenic plants and unmodified plants are mixed at a predetermined ratio to prepare several samples When real-time PCR is performed for the PCR, the degree of fluorescence according to the number of PCR cycles can be measured. At this time, select the region where the fluorescence signal of the standard solution is exponentially amplified, set the threshold line (Th. Line), and set Th. The number of cycles at the point where the line and the amplification curve of the standard solution intersect is called the threshold cycle (Ct), which is the most reproducible correlation with the initial concentration of the sample (number of gene copies) This is the most important figure in the analysis. In the real-time PCR, a standard curve is created by converting the number of gene copies of the reference material at the Ct value into a log value and the number of PCR cycles with respect to the number of copies of the gene as the Y axis. When the fluorescence intensity of the analytical sample is applied to this standard curve, the number of gene copies of the analytical sample can be known.

In the above quantitative analysis method, the transgenic plant is preferably a maize MON863 variety, but is not limited thereto.

The present invention also provides a kit for assaying transgenic plants comprising the standard plasmid.

The transgenic plant that is the object of the assay kit is preferably a genetically modified maize of the MON863 variety, but is not limited thereto.

The present invention provides a kit for assaying transgenic plants containing the standard plasmid, enabling quantitative analysis by real-time PCR for transgenic plant assay containing the cry3Bb1 gene.

The kit may additionally include reagents for transcription, amplification, and product detection and instructions therefor. For example, the kit may contain a transcriptional enzyme, a deoxynucleotide, a thermostable polymerase suitable for DNA amplification reactions, and a reagent for labeling and detecting nucleic acids.

In addition, the present invention provides a kit for assaying transgenic plants comprising a protein expressed from the standard plasmid.

The standard plasmid of the present invention contains a T7 promoter, and the foreign gene cry3Bb1 introduced into the standard plasmid The gene and the ssIIb gene, an inherent gene, are operably linked to the T7 promoter. Therefore, the Cry3Bb1 protein and the SsIIb protein can be expressed from the standard plasmid of the present invention in an appropriate protein expression environment. These expressed proteins can be used as a standard protein for quantitative analysis or qualitative analysis using an ELISA (Enzyme Linked Immunosorbent Assay) method or the like.

The transgenic plant that is the object of the assay kit is preferably a genetically modified maize of the MON863 variety, but is not limited thereto.

The standard plasmid according to the present invention can be used for the screening of a genome containing the cry3Bb1 gene, and thus can identify a genus or an event of transgenic plants. Especially It is very useful as a reference material for analyzing whether or not it is mixed with a variety such as corn MON863. Therefore, it is possible to provide an accurate and reliable quantitative analysis method and a detection kit for corn MON863, which is a genetic modification, using the standard plasmid according to the present invention, and can be suitably used for accurately detecting the inclusion rate of genetic modification have.

1 is a block diagram of a standard plasmid according to one embodiment of the present invention.
2 is a graph showing a result of measurement of the concentration of standard plasmid DNA according to the present invention.
FIG. 3 is an electrophoresis image for identifying a gene inserted into a vector to make a standard plasmid according to the present invention. (Insert confirmed with plasmid DNA cut with M: molecular weight marker, 1,2: 11kbMS pDNA, UC: plasmid DNA, C: enzyme)
4 is a graph showing fluorescence measurement values of standard plasmid DNA according to the present invention.
FIG. 5 shows the result of confirming homogeneity by performing real-time quantitative PCR using a standard plasmid DNA according to the present invention.
6 shows the result of confirming short-term stability by performing real-time quantitative PCR using a standard plasmid DNA according to the present invention.
FIG. 7 shows the result of confirming long-term stability by performing real-time quantitative PCR using a standard plasmid DNA according to the present invention.
8 (a) shows the result of quantitative analysis of an inherent gene of an unknown sample using a standard plasmid according to the present invention, (b) shows the result of quantitative analysis of an inherent gene of a standard plasmid and an unknown sample according to the present invention Real-time PCR results are shown.
9 (a) shows the result of quantitative analysis of an introduced gene of an unknown sample using a standard plasmid according to the present invention, and (b) shows the result of quantitative analysis of an introduced gene of a standard plasmid and an unknown sample according to the present invention Real-time PCR results are shown.

Hereinafter, the present invention will be described in more detail with reference to examples. It will be apparent to those skilled in the art that these embodiments are provided to understand the contents of the present invention and that the scope of the present invention is not limited to these embodiments.

<Examples>

1. Standard plasmid production

A standard plasmid was prepared by ligating a PCR product to the intrinsic gene ( ssIIb , SEQ ID NO: 1) of corn and the GM gene ( cry3Bb1 , SEQ ID NO: 2) and inserting it into a pCR-Blunt vector (Invitrogen, USA) pBlunt-11kbMS, Fig. 1).

Specifically, first, to secure the insert to the gene of the full gene (flanking region exists), cry3Bb1 amplified by the forward primer (MON863-5 ', SEQ ID NO: 6) and reverse primer (MON863-3', SEQ ID NO: 7) The PCR product of the gene was obtained and inserted into the pCR-Blunt vector. Thereafter, a PCR product of the ssIIb gene amplified by the ssIIb forward primer (ssIIb 1-5 ', SEQ ID NO: 3) and the reverse primer (ssIIb 1-3', SEQ ID NO: 4) was obtained in order to secure the ssIIb insertion gene , and a standard plasmid pBlunt-11kbMS was constructed using the Zero PCR cloning kit (Invitrogen, USA) in the pCR-Blunt vector.

The recombinant plasmid pBlunt-11kbMS was introduced into E. coli strain TOP10 cells and transformed, followed by cell culture in LB medium.

SEQ ID NO: Primer / probe type Primer / probe base sequence 3 ssIIb 1-5 ' 5'-CTCCCAATCCTTTGACATCTGC -3 ' 4 ssIIb 1-3 ' 5'-TCGATTTCTCTCTTGGTGACAGG -3 ' 5 ssIIb-taq 5'FAM- AGCAAAGTCAGAGCGCTGCAATGCA -TAMRA3 ' 6 MON863-5 ' 5'-GTAGGATCGGAAAGCTTGGTAC -3 ' 7 MON863-3 ' 5'-TGTTACGGCCTAAATGCTGAACT -3 ' 8 MON863-taq 5'FAM-TGAACACCCATCCGAACAAGTAGGGTCA -TAMRA3 '

2. Plasmid DNA extraction

Plasmid DNA (pDNA) was extracted using the plasmid maxi kit (Qiagen) from the cell obtained in Example 1 as it was or with slight modification to the method proposed by the manufacturer.

Specifically, the cultured cells were harvested by centrifugation at 6000 g for 15 minutes at 4 ° C, and 10 ml buffer P1 was added to the harvested cell pellet and resuspended. After addition of 10 ml Buffer P2, invert and mix 4-6 times. After incubation for 5 minutes at room temperature (15-25 ° C), add 10 ml Buffer P3. (Inverting) and allowed to mix in ice for 20 minutes. The supernatant was then centrifuged at 20000 g or more for 30 minutes at 4 ° C (if the supernatant is not clean, further centrifugation is performed). The Qiagen-tip was equilibrated by passing 10 ml Buffer QBT through gravity, then the supernatant from step 5 was passed through the Qiagen-tip, and the Qiagen-tip was washed twice with 30 ml Buffer QC. The DNA was isolated by placing 15 ml Buffer QF in a 50 ml tube. 10.5 ml of isopropanol was added and the separated DNA was precipitated at ≥15000 g for 30 minutes at 4 ° C, and then the supernatant was discarded. The precipitate was washed with 5 ml of 70% ethanol at room temperature and centrifuged at ≥15000 g for 10 minutes, and the supernatant was carefully discarded. The pellet was left to dry naturally for 5-10 minutes and finally dissolved in a suitable volume of buffer (eg, TE buffer, pH 8.0, 10 mM Tris, pH 8.5) to prepare finally extracted plasmid DNA (pDNA).

3. Identification of plasmid DNA concentration, insertion gene and contamination level

In order to qualitatively evaluate and quantify the extracted plasmid DNA, absorbance measurement and fluorescence measurement using picogreen were performed. The DNA solution showed a UV absorbance spectrum of a typical DNA having a peak near 260 nm as a result of measurement of ultraviolet absorbance (see FIG. 2 and Table 2).

In order to identify the inserted ssIIb gene in standard plasmid DNA (pDNA), restriction enzymes were treated to separate the inserts and confirmed by electrophoresis (FIG. 3). Electrophoresis result The expected size of 2890 bp of ssIIb gene was confirmed [(a) M: Molecular weight marker, 1,2: 11kbMS pDNA, (b) M: molecular weight marker, control: 11kbMS pDNA (uncut) PDNA 8866 bp, 2: insert 2890 bp].

In addition, the extracted plasmid DNA was judged to be a good quality sample with less impurities such as proteins. The degree of protein contamination in the DNA solution can be determined as follows. When the absorbance at 260 nm is divided by the absorbance at 280 nm and a value between 1.7 and 2.0 is obtained, it is judged to be high-quality DNA with little protein contamination. All the DNA samples used in this experiment have values between these values, . In addition, the absorbance at 260 nm can be divided by the absorbance at 230 nm to determine the degree of contamination of sugars in the DNA solution (eg, polysaccharides that make up the plant tissue). If a value of 0.8 or more is obtained, it is judged to be high-quality DNA. All the DNA samples used in the present experiment had a value of 0.8 or more, and it was judged to be a high-quality sample which can be subjected to the next step with less sugar contamination (see Table 2).

tube 11 kb MS pDNA Stock solution concentration (ng / ul) 124.27 1/10 dilution concentration (ng / ul) 12.21 230 1.123 260 2.485 280 1.29 Protein incorporation (260/280) 1.93 Carbohydrate incorporation (260/230) 2.21

In order to confirm the concentration of the plasmid DNA, a method of measuring the concentration of ds-DNA using a fluorescent dye Pico Green ( ^TM) (Invitrogen, Carlsbad, Calif.) That specifically binds to ds-DNA Specifically, the amount of DNA in the solution was determined by obtaining a calibration curve for the fluorescence value using a lambda DNA calibrator already contained in the kit, and substituting the fluorescence value of the sample into the calibration curve, (Fig. 4). As a result, the extracted plasmid DNA was qualitatively purity suitable and quantitatively sufficient to be used in the next step.

4. Manufacture of standard plasmid stock

After calculating the concentration of plasmid DNA by fluorescence quantification, the number of copies is calculated by substituting the known plasmid DNA size (base pair, bp) into the following equation, and the number of copies of the plasmid DNA of the final standard plasmid stock And diluted with 10 mM Tris to a concentration of 4.00 × 10 ⁸ cp / μl.

Number of copies (cp / ul) = amount x 6.022 x 10 ²³ / plasmid DNA size (bp) x 1 x 10 ⁹ x 650

After filtration in a clean bench to remove impurities, 50 μl of each was added to approximately 450 cryo tubes (Nunc).

A preliminary test was performed using real-time PCR to determine if the number of copies match the expected number of copies. In this experiment, all experiments were carried out using ABI 7900HT (Applied Biosystems, USA). The basic design of the experiment and the experimental components such as primers and probes were taken from the specifications of the Food and Drug Administration.

5. Identification of homogeneity of standard plasmids

A total of 450 tubes were selected and 10 tubes were selected at uniform intervals to confirm homogeneity between the tubes.

The ratio of the transgene: endogen (GM gene: endogenous gene) of the plasmid DNA in 10 tubes analyzed to check the homogeneity of the pathogens was measured (transgene and endogen are recombined to 1: 1 each). The measured values were 0.930 to 0.955 and the average value was 0.945 ± 0.008 (see FIG. 5).

6. Confirm stability of standard plasmid

In order to confirm whether the sample is stable during transport, it was tested at three different temperatures (-20 ° C, 4 ° C, 60 ° C) at regular intervals (2 weeks, 4 weeks) Were analyzed to see if there was a change in the ratio of the two genes.

The measured values of the transgene: endogen ratio of the samples analyzed for short-term stability were 0.953 ± 0.004 (0 time), 0.963 ± 0.003 (2 weeks, -20 ° C), 0.955 ± 0.006 (2 weeks, 4 ℃), 0.964 ± 0.005 (4 weeks, 4 ℃), 0.953 ± 0.002 (2 weeks, room temperature), 0.950 ± 0.003 (2 weeks, 60 ° C) for 4 weeks at -20 ° C, 4 ° C and room temperature, the GM gene and the intrinsic gene ratio were similar to those of the homogeneity test, and it was confirmed that the sample was stable at the above temperatures (6 months, -20 ° C) and 0.973 ± 0.003 (12 months, -20 ° C, respectively) in the storage period of 6 months, 12 months, -70 ° C and -20 ° C ), 0.956 ± 0.004 (6 months, -70 ° C) and 0.955 ± 0.007 (12 months, -70 ° C), and the GM% of the samples were consistent with the analysis results of homogeneity and short-term stability. Based on this, it was found that the sample was stable at the stored low temperatures of -70 ° C and -20 ° C, and it was judged that the samples could be stored for a long period from -20 ° C to 12 months (see FIGS. 6 and 7).

7. Confirmation of quantification using standard plasmids

Real-time PCR was performed using the DNA obtained by diluting the pBlunt-11kbMS plasmid with a copy number of 6 steps as a template, and a standard quantitative curve was calculated using the result, and quantitative analysis was performed on the unknown sample.

As a result, the correlation coefficient (R ^) of the pBlunt-11kbMS plasmid was 0.9994 ( ssIIb ) and 0.9977 ( cry3Bb1 ), and the value was 0.99 or more, indicating that the plasmid according to the present invention was usable as a standard plasmid for quantitative analysis I could confirm. As shown in FIGS. 8 and 9, it was confirmed that the plasmid could be used as a standard plasmid for quantitative analysis to know the% of introduced gene (GM) of unknown sample.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> RURAL DEVELOPMENT ADMINISTRATION <120> FfPNG1 gene-specific primer and method for detection of bakanae          disease using the same <130> P131061 <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FfPNG1_232F <400> 1 ctgcgacatc tccccaagat c 21 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> FfPNG1_355R <400> 2 caacagaccg gggttctc 18 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Taqman_FfPNG1 <400> 3 gatcgcgatt ctcaaaaatt cagaaac 27 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> M13 reverse priming site <400> 4 cagggttttc ccagtcacg 19 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> M13 forward (-20) priming site <400> 5 tcacacagga aacagctatg ac 22

Claims (8)

A standard plasmid for assaying transgenic plants comprising a gene consisting of a nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 2; 2. The standard plasmid for assaying transgenic plants according to claim 1, wherein the gene consisting of the nucleotide sequence of SEQ ID NO: 1 is the ssIIb gene, and the gene consisting of the nucleotide sequence of SEQ ID NO: 2 is the cry3Bb1 gene. 2. The plasmid according to claim 1, wherein said transgenic plant is a maize MON863 strain. I) preparing a standard plasmid according to claim 1 by dilution by concentration;
Ii) performing real-time PCR using a PCR primer set for assay and a probe using the standard plasmid diluted by the concentration and the DNA obtained from the biological sample as templates, respectively;
Iii) calculating a standard quantitative curve by measuring the amount of the PCR product performed on the diluted standard plasmid; And
And iv) introducing the amount of the PCR product performed on the DNA obtained from the biological sample into the standard quantitative curve to calculate the incorporation rate of the foreign introduced gene, and quantifying the foreign introduced gene incorporated in the transgenic plant Analysis method. 5. The method of claim 4, wherein the PCR primer set is a primer set consisting of the base sequences of SEQ ID NOS: 3 and 4 and a primer set consisting of the base sequences of SEQ ID NOS: 6 and 7, Wherein the probe is a probe comprising a nucleotide sequence of SEQ ID NO: 5. The method according to claim 4, wherein the transgenic plant is a maize MON863 strain. A kit for assaying transgenic plants comprising the standard plasmid of claim 1. A kit for assaying transgenic plants comprising a protein expressed from the standard plasmid of claim 1.

Images