KR20150115244A - Aptamer binding to antibody with specificity and production method thereof - Google Patents

Abstract

The present invention relates to an aptamer specifically binding to antibody and a production method thereof and, more specifically, to a DNA aptamer specifically binding to antibody selected from a random DNA library, and to a production method thereof. According to the present invention, the aptamer candidate groups, which are developed based on systematic evolution of ligands by exponential enrichment (SELEX), can be effectively used in a composition for detecting antibody, a sorbent column for refining antibody, or production of antibody chips. Moreover, the the aptamer candidate groups can be used in antibody application of a drug binding-type aptamer for targeted drug therapy or application of aptamer bound with fluorescent material as a marker for antibody for an life science study and medical diagnosis.

Description

[0001] The present invention relates to an aptamer specifically binding to an antibody,

The present invention relates to an aptamer specifically binding to an antibody and a method for producing the same, and more particularly, to a DNA aptamer that specifically binds to an antibody selected from a random DNA library and a method for producing the same.

 Antibody and biosimilar technology development process

    - Since 1986, OrthoClone OKT3 has been launched as the first monoclonal antibody in the US Johnson & Johnson Company. Approximately 30 antibody drugs have been launched, and they are mainly divided into anticancer drugs, immunosuppressants, and inflammation drugs.

    - Developed humanized chimeric antibody and further developed humanized antibody technology to use it as a human medicine after the development of mouse monoclonal antibody. In addition to this complete antibody development, Fab , scFv, Domain Antibody, Diabody, and Bispecific Antibody.

    - In the late 2000s, biosimilar antibody medicines and their remediation technologies have been actively under way due to the imminent expiration of the first-generation antibody drug patents.

    Antibody-drug conjugate (ADC) technology has been developed to overcome the inefficiency of the therapeutic function of the antibody itself by binding the chemical to the antibody to maximize its efficiency.

    - Due to the growth of the global antibody drug market, domestic companies have a lot of interest, but there is no significant progress in the development of antibody drugs in Korea due to differences compared to the level of global companies in developed countries. However, Miller is making intensive efforts to mass-produce and develop improved antibodies. In addition, Lego Chem Biotechnology has developed the next generation ADC source technology in the domestic company, and it shows possibility of development in the future.

   Antibody purification technology status

   - In order to improve the productivity due to the expansion of the antibody drug market, highly specific vectors, cell line selection, medium development and culture process technology are being developed.

   - Technologies that can purify the expressed antibodies with high quality and high yield have also been developed. They are developed by companies in developed countries and supply nearly all of them in Korea. Protein A and its modifications, synthetic ligands, and cation / anion exchange resins are used for purification, but Protein A adsorption columns are the mainstream.

   problem

   - Protein A-based column is a protein-based material that is not durable due to antibody purification and strong column washing conditions for quality control and can not be used continuously (resulting in stability problems and high cost).

   - Possible to contain toxic substances harmful to human body after microbial manufacturing process. Possible to decrease antibody activity by using strong acidic conditions when eluting antibody from column, possibility of protein A leaching from column.

   - Problems of column contamination due to ineffective antibody elution and remaining in the column.

   Outlook

   - Although the Protein A variant is mainly used in the antibody refining market, the development of the next generation of refined column materials is under way due to the fact that it accounts for more than 30% of the antibody purification and formulation market (more than $ 100 million) et al., 2007, J CHROMATOGR B).

   - Although the development of cell culture technology has seen the effect of cost reduction of mass production of antibodies, cost reduction is required in antibody refining part.

- Synthetic ligands, peptide taps, ion exchange resins, Aqueous two-phase systems (ATPS), and crystallization have been studied as alternative refining materials. It will be continued.

  Development Needs

    - Antibody drug production to lead the future drug market

      · Large-scale antibody production as the biosimilar industry grows

      · 50-80% of antibody production cost is spent on separation purification

    - Column for antibody purification essential for separation and purification of antibody

      · Protein A variant, which binds primarily to the Fc region of the antibody, is used as the adsorbent material

       Mab Select and Mab Select SuRe (GE Healthcare)

       POROS Protein A (Life Technologies)

      · Commercialization of synthetic ligands: Refining efficiency is lower than Protein A product line

       Mimetic dyes (MabsorbentA1P and A2P, Prometic Biosciences), Multimodal ligands (MEP Hypercel, Pall), a prototype ligand (Millipore) and CaptureSelect (BAC)

      · Cation and anion exchange resin (GE Healthcare)

    - Development need

      · Products using existing Protein A are derived from Escherichia coli, and the endotoxin inherent to the product, the modification of the antibody due to the elution conditions (strong acidity), and the durability problems caused by the column washing conditions

      · Due to the weakness of domestic technology, most columns depend on imports.

· The need to develop a new type of column to overcome the limitation of Protein A

Accordingly, a main object of the present invention is to provide an aptamer which can detect or purify an antibody widely used in the field of diagnosis and treatment of diseases, and exhibits a specifically high affinity for an antibody and a method for producing the same. .

It is another object of the present invention to provide a composition for detecting an antibody using the aptamer.

It is another object of the present invention to provide an adsorption column for antibody purification using the aptamer.

It is another object of the present invention to provide an antibody chip comprising an antibody group using the aptamer.

According to one aspect of the present invention, the present invention provides an aptamer capable of specifically binding to an antibody.

In the present invention, the aptamer can be specifically bound to the Fc region, the Fab region, the scFv, or the third generation antibody fragment (e.g., single domain) of the antibody.

In the present invention, the aptamer has the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 4.

<Fc binding Aptamer sequences>

Ap5

CCCGTCTAACCTACCACCTCTCCAGGAATGTATTGCTTTCTCGCG CAAAAGTGCACGCTACTTTGCTAA

Ap8-9

CCACCCACGCCTGTGCCCGCATTCACCCTCGCGCCCGTACTCGCC CAAAAGTGCACGCTACTTTGCTAA

Ap11

CACCCGGGGCCTGTCGCTGCTTGGTCAGGGTTGCATCGTTTGTGC CAAAAGTGCACGCTACTTTGCTAA

Ap15

CCTGGACCCCGCAGGCTCGTAACGCAAAGATACATGGTCTGCCGA CAAAAGTGCACGCTACTTTGCTAA

In the present invention, the aptamer is a DNA aptamer or an RNA aptamer in which a 2 'OH group of the DNA aptamer is modified with methoxy or the like.

According to another aspect of the present invention, the present invention provides a method of preparing an aptamer capable of specifically binding to an antibody comprising the steps of:

a) preparing a human antibody Fc expression vector comprising the gene of the Fc region of a human antibody;

b) expressing the human antibody Fc protein after the expression vector is injected into an animal cell and separating and purifying the same;

c) securing an aptamer candidate group to a randomized DNA library using the purified Fc as a candidate for an aptamer candidate group, SELEX (Systematic Evolution of Ligands by Exponential Enrichment); And

d) confirming antibody binding characteristics through an enzyme-linked immunosorbent assay (ELISA) test of the aptamer candidate group.

According to the present invention, there is provided a method for preparing an aptamer, wherein the Fc-ssDNA complex is screened using the Ni-NTA resin in the SELEX.

According to another aspect of the present invention, the present invention provides a method of preparing an aptamer capable of specifically binding to an antibody comprising the steps of:

a) reacting the antibody and the magnetic beads in a borate buffer solution to induce covalent bonding;

b) introducing a DNA pool having a primer region for PCR at both ends and 30 to 50 arbitrary bases in the center and antibody-magnetic beads obtained by the covalent bond in a buffer solution to induce binding at room temperature;

c) separating the DNA bound to the antibody-magnetic beads using a magnet;

d) separating the DNA from the separated antibody-magnetic beads; And

e) PCR is performed using a primer pair complementary to the primer region for PCR to amplify DNA that specifically binds to the antibody.

According to another aspect of the present invention, there is provided a composition for detecting an antibody comprising an aptamer capable of specifically binding to an antibody according to the present invention.

In the present invention, the aptamer can be permanently stored at room temperature by the addition of a divalent metal ion treatment agent (EDTA, EGTA, etc.).

According to another aspect of the present invention, there is provided an adsorption column for purification of antibodies comprising an aptamer capable of specifically binding to the antibody according to the present invention.

In the present invention, the aptamers are adsorbed on a resin by attaching a chemical reactor (amine [-NH 2], thiol [-SH], biotin or the like) to the terminal thereof, and binding to the resin.

The present invention provides an adsorption column for purification of antibodies, characterized in that the aptamer has a very low possibility of denaturation after column washing and is semi-permanently usable.

According to another aspect of the present invention, there is provided an antibody chip in which an antibody group is attached to a surface using an aptamer according to the present invention.

Detection and characterization of aptamer candidates selectively binding to human antibody Fc region

    - The addition of SELEX to the four app trams discovered in the past, ensuring a good characteristic of the app tamer

    - Comparison of binding strength of aptamer through ELISA and Biacore and measurement of binding capacity (Kd value)

- Study of binding sites in Fc of each aptamer found: Establish binding site map through Fc fragmentation or competition binding assay between aptamers.

  Attachment of aptamer with low Kd value to Fc

    - Preparation of aptamer with good properties and preparation using a synthesizer: A chemical reactor (amine [-NH2], thiol [-SH], biotin, etc.) is attached to the end of the aptamer

    - Chemically synthesized aptamer using oligo-synthesizer to solve the contamination problem of toxic substances such as Protein A using microorganism

    - A class in which the mutually exclusive binding sites between the aptamers are present in the Fc are linked to each other by a linker (in the case of poly T) during the oligosynthesis, thereby seeking a superior increase in binding ability upon attachment to the resin

    - Maintain the activity of the aptamer through site-specific binding by attaching the prepared aptamer to a resin attached to a chemical reaction unit that specifically reacts to the end of the aptamer.

    - When attaching to the resin, the density of the aptamer is adjusted to the given resin volume by adjusting the concentration of the reaction aptamer, and the density of the resin aptamer is measured accurately by measuring the solution aptamer concentration before and after the reaction. ) Technique

  Human antibody purification test and purification optimization condition establishment

    - Establishment of optimized aptamer resin, purification optimization condition, reuse condition (including storage and washing condition) by applying human antibody (human immunoglobulin G)

    - Priority of the purification condition is mild condition that does not affect the activity of the antibody by changing the secondary structure of the aptamer through controlling the salt concentration by monovalent ion or divalent metal ion concentration: Protein A: The stability of the purified antibody and the durability of the resin are maintained (because of the price competitiveness)

    - By comparing the Protein A column developed by our company (which is the same in terms of quality as existing foreign products) and the direct purification efficiency and durability,

  Study of secondary antibody substitution through chemical attachment of fluorescent markers to excavated aptamers

    - Attachment of fluorescent markers to the end of a functional aptamer: A fluorescent antibody is used as a substitute for a fluorescent antibody.

- Application of HRP (Horseradish peroxidase) to aptamer for Western blotting

   The originality and conductivity of the present invention technique

    - In order to overcome the problems of Protein A, which is a material for purification of existing antibodies, a new material, nucleic acid-based aptamer

      · Mass production and specific chemical attachment to resin is very easy

      · Solve toxic substances caused by microorganisms by enabling chemical production

      · Ensuring consistency of column activity by using nucleic acid-based materials

       Protease resistance, heat resistance (> 100 C), small size and stable to biological solutions

      · Semi-permanent use due to very low possibility of denaturation after washing the column

· Divalent metal ion treatment agent (EDTA, EGTA, etc.) can be added to keep it permanently at room temperature.

    - Development of Fc site binding aptamer of antibody

      · To develop an aptamer targeting only the Fc region, which is not a specific site of the antibody binding to the antigen, the Fc region is expressed in animal cells to separate and purify

      · Obtained four candidates for aptamer (patent pending) by conducting 15 steps of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) in a randomized DNA library targeting purified Fc.

· ELISA (Enzyme-linked Immunosorbent Assay) test of four candidates showed superior antibody binding characteristics.

    - Development of Korean new material for antibody purification

      · Introduced into domestic antibody manufacturing process of new materials with low cost, high efficiency and durability

      · Contributing to economic development through future export

      · Antibody purification as well as application as a marker for antibodies and its application to medical diagnosis and targeted therapy (Targeted Drug Therapy)

Figure 1. Types of modified antibodies Philipp Holliger & Peter J Hudson (2005)

  The technical effect of the present invention

    - Identification of SELAM-based app tamer candidates

      Detection of aptamers for antibodies, such as Fab, single-chain antibody fragments (scFv) and third-generation antibody fragments (eg, single domains) as well as aptamers for Fc site binding of antibodies Multiple changes in antibody purification column through

      · To improve the function of the extracted aptamers, column preparation using RNA analogues in which the 2 'OH group was modified with Methoxy etc.

    - Applications other than antibody purification

      · Application of aptamer conjugated with a fluorescent substance as a marker of antibodies for medical diagnosis and life science research

      Application of Drug-conjugated aptamers for Targeted Drug Therapy

      · Production of antibody chip with antibody group attached to the surface using aptamer

Figure 2. Antibody excision and antibody drug manufacturing process www.biomedcentral.com

According to the present invention, the aptamer candidates developed on the basis of SELEX can be effectively used for the production of compositions for antibody detection, adsorption columns for antibody purification, or antibody chips, as well as for the production of antibodies May be used for the application of aptamer conjugated with a fluorescent substance as a marker or for the application of an antibody to a drug-conjugated aptamer for targeted drug therapy.

Figure 1. Types of modified antibodies Philipp Holliger & Peter J Hudson (2005)
Figure 2. Antibody excision and antibody drug manufacturing process www.biomedcentral.com
Figure 3 (A) Immunoglobulin and B region pcDNA-based Fc expression vector (C) pBABE-based retroviral Fc expression vector and Fc amino acid sequence
Figure 4. Fc cleavage purification using retroviral expression system and aptamer digestion method using SELEX
Figure 5. Results of western blotting by Fc purification step
6a. Secondary structure of human antibody Fc region binding aptamer candidate group (Fc Ap5)
6b. Secondary structure of human antibody Fc region binding aptamer candidate group (Fc Ap8-9)
6c. Secondary structure of human antibody Fc region binding aptamer candidate group (Fc Ap11)
6d. Secondary structure of human antibody Fc region binding aptamer candidate group (Fc Ap15)
Figure 7. ELISA assay for each SELEX step

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and thus the scope of the present invention is not construed as being limited by these embodiments.

Example  summary

      · Production of human antibody Fc expression vector (pcDNA system) / retroviral system (pBABE system)

      · After injecting the retroviral expression vector into CHO-K1 cells, human Fc protein expression and purification

      SELEX progression of DNA with random sequences targeting purified Fc

      · After four rounds of 15 rounds, four aptamer candidates are uncovered.

Figure 3 (A) Immunoglobulin and B region pcDNA-based Fc expression vector (C) pBABE-based retroviral Fc expression vector and Fc amino acid sequence

Example  1. Human antibody Fc  Expression vector ( pcDNA system ) / retroviral system ( pBABE system ) Produce

      The Fc portion of the human antibody (Immunoglobulin G) clone was introduced into the pcDNA vector, the same Fc portion was introduced into the retroviral vector pBABEpuro, and 6Histag was ligated to the end of the fragment for purification.

Figure 4. Fc cleavage purification using retroviral expression system and aptamer digestion method using SELEX

Example  2. Human body Fc  Protein expression and purification

      • Each Fc expression vector is transfected into CHO-K1 cell line and cell line is selected to obtain stable cell line.

      After the cell culture, the presence of human Fc protein expressed in the medium was confirmed by Western blotting (using His-probe), and the Fc protein purified from the retroviral system with a good expression amount (Ni-NTA column chromatography )

Figure 5. Results of western blotting by Fc purification step

Example  3. SELEX Through Fc  Combinable Of app tamer  Produce

      · SELEX was performed to target purified Fc protein. A total of 88mers of ssDNA with 45 nucleotide (N45) sequences were randomly selected in the middle, and 5 μg of this ssDNA was reacted with Ni-NTA resin Samples were reacted with Fc first. After the reaction, the Fc-ssDNA complex was screened with Ni-NTA resin, and the amplified ssDNA was amplified by PCR and lamdba exonuclease was used to obtain a sufficient amount of ssDNA. The reaction and subsequent treatment were continued 15 times.

      · ELISA (Enzyme-linked Immunosorbent Assay) was performed using Fc protein per each round of treatment, and it was found that the target binding ability was significantly improved from the result after 15 times SELEX. As shown in the figure, all of the four aptamer candidates were found from DNA sequencing, and all of them were found to form a specific secondary structure.

6a. Secondary structure of human antibody Fc region binding aptamer candidate group (Fc Ap5)

6b. Secondary structure of human antibody Fc region binding aptamer candidate group (Fc Ap8-9)

6c. Secondary structure of human antibody Fc region binding aptamer candidate group (Fc Ap11)

6d. Secondary structure of human antibody Fc region binding aptamer candidate group (Fc Ap15)

Figure 7. ELISA assay for each SELEX step

Claims (13)

An aptamer capable of specifically binding to an antibody.
2. The aptamer of claim 1, wherein the aptamer is capable of specifically binding to the Fc region, the Fab region, the scFv, or the third generation antibody fragment (e.g., single domain) of the antibody.
2. The aptamer according to claim 1, wherein the aptamer has a nucleotide sequence of any one of SEQ ID NOS: 1 to 4.
The aptamer according to claim 1, wherein the aptamer is a DNA aptamer or an RNA aptamer in which a 2 'OH group of the DNA aptamer is modified with methoxy or the like.
A method of preparing an aptamer capable of specifically binding to an antibody comprising the steps of:
a) preparing a human antibody Fc expression vector comprising the gene of the Fc region of a human antibody;
b) expressing the human antibody Fc protein after the expression vector is injected into an animal cell and separating and purifying the same;
c) securing an aptamer candidate group to a randomized DNA library using the purified Fc as a candidate for an aptamer candidate group, SELEX (Systematic Evolution of Ligands by Exponential Enrichment); And
d) confirming antibody binding characteristics through an enzyme-linked immunosorbent assay (ELISA) test of the aptamer candidate group.
6. The method of claim 5, wherein the Fc-ssDNA complex is screened using the Ni-NTA resin in the SELEX.
A method of preparing an aptamer capable of specifically binding to an antibody comprising the steps of:
a) reacting the antibody and the magnetic beads in a borate buffer solution to induce covalent bonding;
b) introducing a DNA pool having a primer region for PCR at both ends and 30 to 50 arbitrary bases in the center and antibody-magnetic beads obtained by the covalent bond in a buffer solution to induce binding at room temperature;
c) separating the DNA bound to the antibody-magnetic beads using a magnet;
d) separating the DNA from the separated antibody-magnetic beads; And
e) PCR is performed using a primer pair complementary to the primer region for PCR to amplify DNA that specifically binds to the antibody.
A composition for detecting an antibody comprising an aptamer capable of specifically binding to an antibody according to claim 1.
9. The composition according to claim 8, wherein the aptamer is permanently stored at room temperature by the addition of a divalent metal ion treatment agent (EDTA, EGTA, etc.).

An adsorption column for antibody purification comprising an aptamer capable of specifically binding to the antibody according to claim 1.
[Claim 11] The adsorption column for purification of antibodies according to claim 10, wherein the aptamer is bound to a resin by attaching a chemical reactor (amine [-NH2], thiol [-SH], biotin or the like) to the terminal.
[Claim 11] The adsorption column for antibody purification according to claim 10, wherein the aptamer is semi-permanently usable because the possibility of denaturation after the column washing is very low.
An antibody chip wherein an antibody group is attached to a surface using an aptamer according to claim 1.

Images