KR20150097316A - Method for differentiation of mammary fat pad adipose stem cell to mammary epithelial cell with keratinocyte growth factor - Google Patents

Abstract

The present invention relates to a method for inducing a differentiation of a mammary fat pad adipose stem cells to a mammary epithelial cell by using a keratinocyte growth factor; a composition therefor; and a composition for treatment of breast diseases using the same. In present invention, it has been confirmed that the keratinocyte growth factor can induce a differentiation of a mammary fat pad adipose stem cell to a mammary epithelial cell. Therefore, the present invention can be effectively used for breast diseases caused by abnormal transformation or necrosis of a mammary epithelial cell.

Description

[0001] The present invention relates to a method for inducing the differentiation of mammary epithelial cells into mammary epithelial cells using a keratinocyte growth factor,

The present invention relates to a method for inducing differentiation of mammary fat pad adipose stem cells into mammary epithelial cells using keratinocyte growth factor (KGF), a composition therefor, and a breast using the same And to compositions for preventing or treating diseases.

Mammary glands are mammary glands that are secreted by milk and are one of the most important tissues in the body. In order for normal feeding to be possible, the mammary epithelial cells play an important role.

When mammary gland cells are transformed into cancerous carcinomas or are infected by pathogens, inflammation of the mammary gland leads to necrosis of the mammary epithelial cells. In the case of such a problem, it may be an important treatment method to continue inducing differentiation into normal mammary epithelial cells from mammary gland fat cells.

Therefore, it is urgently necessary to study the differentiation from mammary gland into mammary epithelial cells. However, the present invention is based on a mechanism related to the differentiation of mammary gland mesenchymal stem cells into mammary gland epithelial cells And to identify substances capable of inducing differentiation of mammary mesenchymal cells into mammary epithelial cells.

The epithelial-mesenchymal transition (EMT) and vice versa, the mesenchymal-epithelial transition (MET), are two processes required for organ formation and morphogenesis in vivo.

The conversion of epithelial cells into mesenchymal cells is called "EMT" and vice versa. Correlations between mammary tumor progression and EMT have been documented in many documents, and are now prevalent.

EMT generally causes loss of epithelial cell junctions, changes in actin cytoskeleton, downregulation of epithelial-specific gene expression, and subsequent upregulation of the mesenchymal markers. However, initially transdifferentiated cells have some degree of flexibility to switch back to the epithelial lineage. However, the assumption and hypothesis that there is a reversible transition from the mesenchyme to the epithelium, that is, MET, can contribute to finding a way to prevent clinical manifestations of primary carcinoma in the mammary gland is rarely proposed.

In the past, there have been many studies to investigate the mechanisms (including radiation, hormones, and growth factors) that affect the EMT mechanism and the up-regulation and down-regulation of EMT, and the effects on the mammary gland morphogenesis and disease metastasis of EMT However, studies on the reversal process (MET) are in short supply.

Korean Patent Laid-Open No. 10-2006-0110542 (published on October 25, 2006) discloses a method for producing a stem cell comprising: (a) separating breast cells from pluripotent stem cells derived from breast tissue and (a) (b) primary culturing the breast cells in a culture medium for stem cell culture; (c) collecting cells in suspension from said primary culture; And (d) dividing pluripotent stem cells by subculturing the suspended cells in a culture medium for stem cell culture, thereby producing pluripotent stem cells derived from breast tissue. Korean Patent Publication No. 10-2013-0109857 (published on Oct. 08, 2013) discloses a composition for inducing differentiation of mammary epithelial cells containing retinoic acid as an active ingredient and a composition for inducing differentiation of mammary epithelial cells A method of inducing differentiation into a cell is described.

The present invention discloses that mammary fat pad adipose stem cells can be differentiated into mammary epithelial cells, and a substance capable of inducing such differentiation is discovered and provided.

The present invention provides, as a first aspect, a composition for inducing differentiation into mammary epithelial cells, which comprises keratinocyte growth factor as an active ingredient.

In a first aspect of the present invention, said differentiation may be preferably transdifferentiation.

In the first aspect of the present invention, the mammary epithelial cells may be mammary epithelial cells selected from, for example, bovine, chlorine and positive mammals.

In a first aspect of the present invention, the composition may preferably induce the differentiation of mammary fat pad adipose stem cells into mammary epithelial cells.

Meanwhile, the present invention provides, as a second aspect, a composition for preventing or treating breast disease, which comprises keratinocyte growth factor as an active ingredient. The breast disease may be, for example, mastitis, breast cancer, or breast enlargement. At this time, the breast enlargement may be, for example, occurring in the breast mature stage or in the lactation stage. Further, the breast may be, for example, breast of any one selected from the group consisting of cow, goat, and sheep.

According to the present invention, since the differentiation of mammary glandular stem cells into mammary epithelial cells is confirmed, it can be applied to breast cancer caused by necrosis of mammary epithelial cells or breast cancer due to carcinogenesis of mammary epithelial cells. In addition, it induces the differentiation of mammary gland stem cells into mammary epithelial cells, which makes it possible to apply mammalian mammals to breast hypertrophy.

The composition of the present invention may be mixed with the feed of livestock according to a method which can be easily carried out by those skilled in the art, May be formulated into various formulations by mixing with excipients or adjuvants. Such formulations include, for example, oral preparations such as powders, granules, tablets, capsules, drenches and the like, emulsions and suspensions, and injections as parenteral preparations.

An animal injectable preparation containing the composition of the present invention is a pharmaceutically acceptable carrier such as distilled water, oleic acid, ethanol, propylene glycol, glycerin and the like; Ascorbic acid, sodium hydrogen sulfite, sodium pyruvate, tocopherol and the like; As the preservative, it can be produced by using phenyl mercury nitrate, thimerosal, benzalkonium chloride, phenol, cresol, p-oxybenzoic acid methyl, benzyl alcohol and the like.

On the other hand, animal powders and granules containing the composition of the present invention can be prepared by incorporating commonly used vitamins, glucose, lactose, and other saccharides, starch, horse powder, vermiculite, various powders, .

The feed of the composition prepared in the present invention can be generally applied to animals as a pellet feed additive, and the powders and granules can be mixed with water and feed. The dose may be fed in an amount of 5 to 500 mg / kg body weight per day of the animal on the basis of the keratinocyte growth factor as an active ingredient, but it is not limited thereto and may be increased or decreased depending on the symptom and the condition of the animal subject .

In addition, the feeding of the composition according to the present invention can be administered, for example, by injection into the nipple of an animal infected with mastitis. The dosage may be administered at a dose of 5 ng to 500 μg / mL, one to two times per day, per day, per keratin, depending on the type, age, and symptoms of the mammal to be treated, Can be different.

According to a third aspect of the present invention, there is provided a mammalian epithelial cell (mammalian epithelial cell), which comprises culturing mammary epithelial cells in a composition comprising keratinocyte growth factor as an active ingredient, ). ≪ / RTI >

In a third aspect of the present invention, the differentiation may be preferably transdifferentiation.

In the third aspect of the present invention, the composition preferably contains keratinocyte growth factor at a concentration of 1 to 100 ng / mL in the composition.

In the present invention, adipocyte stem cells were isolated from a mammary fat pad, and it was confirmed that they were differentiated into epidermal cell line by keratinocyte growth factor. After culturing in the mixture (5 μg / ml insulin, 1 μg / ml hydrocortisone and 10 ng / ml epidermal growth factor) and treated with 10 ng / ml keratocyte growth factor, It could be trans-differentiating into the epithelial cell line.

From the second day of the experiment of the present invention, the stem cell of the mammary body fat was changed into a rectangle (2-4 days) or cubic (8-10 days) due to the effect of keratinocyte growth factor, and Ayoub- , Which means that it was differentiated into the epithelial cell lineage. Expression of K8 and K18 was significantly (p <0.01), and expression of epithelial and epithelial specific antigens was significantly higher than that of day 0 (p <0.05).

In conclusion, the present invention confirms that mammary fat pad adipose stem cells can be induced to differentiate into mammary epithelial cells by keratinocyte growth factor.

Accordingly, the present invention can be effectively used for various breast diseases caused by abnormal transformation or necrosis of mammary epithelial cells.

Fig. 1 shows the results of calculation of the site of obtaining tissue, cell proliferation and doubling time used for the experiment. A: Photograph showing the surgical site at about 5 cm from the nipple bottom to obtain the breast fat body fat tissue (the white straight line indicates the distance from the nipple). B: Photograph showing the formation of dense colonies after 5 days of cell inoculation (x10). C: Consistent fibroblast-like morphology picture (x10) of MFPASC (mammary fat pad adipose stem cell) in subsequent passage. D: Graph showing the cell doubling time (DT) of MFPASC by line, bars indicate mean ± SEM. * p <0.05 and ** p <0.01 indicate significance.
FIG. 2 is a cell isolated from Korean black goat, showing the characteristics of stem cell of a second-line MFPASC (mammary fat pad adipose stem cell) cell. A: Relative gene expression, CD44 (p <0.01) and visentin (p <0.05) were significantly expressed in MFPASC versus CD13, but no expression of CD13, CD34 and CD106 was observed. Standardization is performed using GAPDH. B: The expression rates (%) of CD44 (p <0.01), CD106 (p <0.05) and visentin (p <0.05) in immunoblotting were significant compared to CD13 expression. At this time, CD13 and CD34 were not detected. C: Confocal microscope photograph showing positive expression of CD44, CD106 and visentin. Bars indicate mean ± SEM. * p <0.05 and ** p <0.01 indicate significance.
3 is Oil-Red-O staining and optical microscope photographs of mammary glandular fat stem cells (MFPASC). A: No lipid / fat droplets were formed in the MFPASC in the control (untreated group) at 10 days after differentiation. B: Results of poor Oil-Red-O staining of MFPASC maintained in the control medium. C: Fugitive fat droplets formed after 10 days of induction of adipocytes supplemented with 10 μM TZD. D: Positive Oil-Red-O staining results of MFPASC treated with 10 μM TZD. E: Fat droplets clustered at 10 days after induction of adipocytes supplemented with 10 μM TZD + 100 μM LA. F: Positive Oil-Red-O staining results of MFPASC treated with 10 μM TZD + 100 μM LA. The reference (corresponding to that described in FIG. 5) represents a magnification of × 20.
Figure 4 shows the quantitative results of relative gene expression at the differentiation stage of MFPASC using a thiazolidinedione (TZD) alone and a mixture of TZD and linolenic acid (LA). Adipo-Q (A), PPAR? (B), C / EBP? (C), LPL (D) and lecithin (E). Standardization is performed by the housekeeping gene GAPDH. Oil-Red-O Dissolution Index (mg / ml) (F) per culture day of MFPASC treated with various supplements. Bars indicate mean ± SEM. * p <0.05 and ** p <0.01 were significantly higher than 0 day cells not differentiated in each group.
Figure 5 shows the differentiation of luminal epithelial cell lineage of breast fat body fat stem cells (MFPASC). A: Ayoub-Shklar staining did not appear on day 0 of epithelialization induction (no red cell cytoplasm / no nucleated cells). B: After 10 days of differentiation, positive Ayoub-Shklar staining results (cells are reddish brown and judged to be differentiated). C: Ayoub-Shklar staining degree (%) by differentiation time (days). D: Results of relative quantification of breast epithelial-specific gene expression by epithelialization days during differentiation of MFPASC upon induction of epithelialization and subsequent exposure to 10 ng / ml KG. GAPDGH gene is used for standardization. The scale bar represents the magnification × 40 times. The bars represent the mean ± SEM. * p < 0.05 and ** p < 0.01 show significant values relative to cells not differentiated on day 0.

Mesenchymal stem cells (MSCs) are derived from epilepsy and are induced in different organs and tissues such as adipose tissue, placenta, and bone marrow. Fat tissue is basically abundant, easy to obtain and easy to obtain, making it an excellent source of MSC. MSCs obtained from adipose tissue are called adipose-derived stem cells (ASC). ASC was first reported in the 1960s, separated by Robdell and his colleagues, and has since been largely modified to report quality and quantity of ASC.

In the present invention, we examined the differentiation of ASC into the epithelial lineage, and under the assumption that the mesenchymal-epithelial transition (MET) could prevent the clinical manifestation of many diseases in mammary gland, Were selected to isolate mesenchymal cells.

According to Bunnel et al. (2008), we tried to isolate mammary fat pad adipose stem cell (MFPASC) from Korean immature black goat, according to the regulations designed and published by MFPASC in a high centrifugal force of 1,660 × g. .

The resultant MFPASC consistently showed a fibroblast-like morphology, which means that MFPASC retains fibroblast-like morphology as a highly typical adipose stem cell regardless of species.

In addition, the cell doubling time of MFPASC was in the normal range of 24 hours, and the doubling time tended to increase with the passage number. This indicates that the cells are mature stem cells and continue to differentiate in each passage.

On the other hand, α-linolenic acid (LA) was shown to promote adipocyte differentiation. The addition of TZD (thiazolidinedione) alone showed that MFPASC was changed to lipoblast in culture, but MFPASC did not produce adiponenctin at the early or late stage of differentiation. Adipo-Q, CEBP-α and LPL genes could not be up-regulated by TZD alone in MFPASC, but when LA was used together with TZD, MFPASC could initiate or recover Adipo-Q expression. Adipo-Q plays a role in the secretion of adiponectin secreted from adipose tissue. When TZD and LA are treated together, MFPASC can produce adiponectin. In addition, LA has also been shown to induce the expression of the PPAR-gamma gene, which is known to promote lipid absorption and adipocyte induction.

On the other hand, keratinocyte growth factor (KGF) induces differentiation into mammary epithelial cells. The mammary gland is a complex organ composed of a combination of different types of cells, and epithelial cells may be classified into several types. Among them, luminal epithelial cells are particularly involved in the synthesis and formation of milk, and surface antigens such as EMA, ESA, K8 and K18 have been reported to be highly specific to mammary epithelial cells. It was observed that K8, K18, EMA and ESA expression was upregulated when the keratinocyte growth factor (KGF) of the present invention was treated with a mixture of insulin, hydrocortisone and EGF. Morphological changes were identified by strong Ayoub-Shklar staining. In conclusion, KGF has been shown to contribute to the differentiation into epithelial cells.

Hereinafter, the present invention will be described in more detail through the following Production Examples, Experimental Examples or Examples. However, the scope of the present invention is not limited to the following production examples and examples, and includes modifications of equivalent technical ideas.

Cell culture media, antibodies, primers and other reagents used in the experiments used in the following experiments were purchased from various companies. Dulbecco's modified Eagle medium (DMEM), fetal bovine serum (FBS), horse serum (HS) and penicillin (100 IU / M1) -streptomycin (100 mg / , UT). The media and FBS used in this experiment were obtained from a single lot.

CD34, CD13, homing cell adhesion molecule (CD44), VCAM-1 (vascular cell adhesion molecule-1) / CD106, vimentin, donkey anti-goat IgG-FITC primary and secondary antibodies such as anti-goat IgG-FITC and biotin-treated donkey anti-goat IgG-biotinylated are products of Santa Cruz Biotechnology (Dallas, Tex.) and Opti 4 CN substrate kit The product was a product of Bio-Rad (Hercules, CA). The cDNA synthesis kit was a product of iNtRON Bio-technology (Seongnam, Korea) and the primer was Macrogen (Seoul, Korea). 4 ', 6-diamidino-2-phenylindole dihydrochloride (DAPI) and other analytical chemicals were purchased from Sigma-Aldrich (Saint Louis, Mo.) Respectively.

[ Manufacturing example  One: Mammalian body fat stem cells  ( mammary fat pad adipose stem cell , MFPASC )]

Korean Black Goat (weighing about 13 kg), which was 3 months old, was obtained and placed in the animal house of the Animal Life Science Department of Kangwon National University. A high fat diet was used to obtain mammary fat pads in a total of 8 goats relatively quickly and to separate the MFPASC according to guidelines and regulations related to animal experiment ethics of Kangwon National University.

After appropriate anesthesia and surgery, we obtained wired fat tissue from experimental chlorine. At this time, chlorine was fasted for 12 hours before the operation, and xylazine and ketamine were anesthetized by epidural injection (Fig. 1, A). Treatment and management were performed for one week under the supervision of a veterinarian. A skin flap about 6 cm away from the nipple was opened. Adipose tissue immediately below the skin was obtained and transferred to medium (DMEM + 5% P / S) under sterile conditions.

Ripoll, C. Adipose-derived stem cells: Isolation, expansion and differentiation Methods. 45: 115-120 (2008) And the MFPASC was separated. Briefly, peripheral connective tissue was appropriately trimmed and removed, and the adipose tissue was washed several times with phosphate buffered saline (PBS) containing 5% P / S. The tissue samples were then transferred to serum-free medium containing 0.075% collagenase type I and 2% P / S and cut into microparticles using a sterile surgical knife and scissors.

Then, the collagenase solution containing adipose tissue particles was incubated at 37 DEG C for 1 hour in a CO ₂ incubator. After culturing, the cell suspension was placed in a 50 mL centrifuge tube, centrifuged at 1,660 x g for 5 minutes, shaken vigorously to disrupt the cell pellet, and centrifuged again under the same conditions. Afterwards, the supernatant was removed and the remaining pellet was resuspended in 3 ml DMEM medium containing 20% FBS. The cell solution was further filtered using a 70 [mu] m cell strainer.

Finally, the cells were placed in a medium containing 1.1% P / S (1: 1 mixture of DMEM and FBS). Two hours after inoculation, giant cells were trypsinized and small cells were obtained as purified MFPASC.

[ Example  1: separated MFPASC Cell type ( morphology ) And Cell doubling time  ( cell  doubling time ) Confirm]

 (1) Separated MFPASC Identification of cell morphology

The purified MFPASC was small round globular shape, and it took several hours to confirm strong attachment to the culture plate after trypsin treatment. It was confirmed that more than 90% of the cells were attached after 24 hours. From the second day onwards, the cells prolonged and expanded due to the height of the newly formed cells. As the proliferation process continued, the cells had a spindle with extended nuclei. Some cells contained distinct nuclei with many nucleolus and many cytoplasm.

The survival rate of the cells at each proliferation stage was over 90%, and within 5 days, it began to form dense colonies (Fig. 1B). The cell colonies were removed and uniformly distributed, after which the cells grew relatively rapidly and resembled fibroblasts, reaching a confluent state of 80-90% within 2-3 days. The fibroblast-like morphology of the cells remained throughout the subsequent passage (FIG. 1C).

 (2) Cell doubling time  ( cell doubling time ) Confirm

 1) Experimental method

The cell doubling time was determined by the method of Vidal et al. (Vidal, M .; Kilroy, G .; Johnson, J .; Lopez, M .; Moore, R .; Gimble, J. Cell growth characteristics and differentiation frequency of adherent equine bone marrow- derived mesenchymal stromal cells: adipogenic and osteogenic capacity. Vet Surg 35: 601-610; 2006). To summarize, the cells collected after the initial inoculation were assigned to the first passage.

The cells were inoculated into a 60 mm culture dish at a concentration of 5 × 10 ³ cells / cm ² and cultured in DMEM containing 20% FBS and 1.1% P / S. Thereafter, the medium was freshly supplied to the cells every 72 hours. When cell confluence reached 80-90%, cells were harvested by trypsin treatment and counted by hemocytometer. DT and cell doubling number (CD) were calculated by using the number of cells collected in each passage and the time interval between passages according to the following equation (1).

[Equation 1]

CD  = ln ( N _f / Ni ₎ / ln  (2)

DT  = CT / CD

(Wherein DT represents the cell doubling time, CT represents the cell incubation time, CD represents the cell doubling number, N _f represents the final cell number, and N _i represents the initial cell number)

2) Experimental results

Cell doubling time was about 24 hours in the first two passages, and slightly increased in the next two passages (3 and 4). However, the cell doubling time was significantly increased until the fifth passage (D in Fig. 1) compared to the first passage (p < 0.01).

[ Example  2: Refined MFPASC Stem cell characteristics]

(1) Experimental method

  1) Immunostaining

For confocal microscopy analysis, cells grown on sterile glass cover slips were fixed with 4% paraformaldehyde for 30 minutes at room temperature. The immobilized cells were then immersed in 0.1% Triton X-100 in PBS for 15 minutes and then washed with cold PBS containing 2% BSA. The cells were then incubated with blocking buffer for 2 hours and then washed twice with cold PBS containing 2% BSA. Finally, cells were further incubated for 2 hours at refrigeration temperature with various primary antibodies (CD13, CD34, CD44, CD106 and Vimentin). Then all cells were further incubated with FITC-conjugated secondary antibodies for 2 hours at 4 ° C.

Finally, all samples were treated with DAPI for 30 minutes, then washed twice with PBS-BSA, and all covered slips treated with the mounting gel were fixed on a glass slide and then the cover slip was sealed with a manicure. Thereafter, a confocal microscope (Olympus FluoView ^TM FV 1000) was photographed.

  2) Immunity Blotting  ( Immunoblotting )

Cells were removed from the plate using a cell scraper, collected and washed with cold PBS. The cells were resuspended in 400 μl of the Pro-prep ^™ protein extraction solution (iNtRON Biotechnology, Seongnam, Korea) and the cell suspension was incubated at -20 ° C to induce cell lysis.

Centrifugation was carried out at 13,000 rpm for 5 minutes using a refrigerated centrifuge, and the supernatant was transferred to a new 1.5 mL Eppendorf vial. Then, the protein concentration was measured by Bradford protein analysis. Protein samples were heated at 100 占 폚 for 5 minutes and then loaded onto 10% SDS gel using loading dye (5x).

SDS-PAGE electrophoresis was performed to separate proteins having different molecular weights, and finally the protein band was transferred to a polyvinylidene difluoride (PVDF) membrane (Life Sciences: Grand Island, NY). After 30 minutes at 80 V, SDS-PAGE electrophoresis was carried out at 120 V for 140 minutes and the protein with different molecular weights was detected using tris-glycine running buffer (0.025 M Tris base, 0.192 M glycine; 1% SDS, pH 8.3) .

Protein bands were then transferred to the PVDF membrane by electrophoresis (100 V, 4 ° C overnight) using a mobile buffer of pH 8.3 containing 0.025 M Tris base, 0.192 M glycine and 0.1% SDS. The PVDF membrane was washed with PBS-tween 20 (PBST) and blocked with a 3% blocker at room temperature for 1 hour.

CD13, CD34, CD44 diluted at a ratio of 1: 500 in PBST containing 1% BSA. Antibodies against CD106 and visentin were incubated with PVDF membrane for 1 hour at room temperature. Subsequently, samples were incubated with biotin-treated donkey anti-goat antibody diluted 1: 2,000 in PBST containing 1% BSA for 1 hour and treated with streptavidin-HRP for 30 minutes.

Finally, the horseradish peroxidase activity was detected using the Opti 4 CN kit (Bio-Rad) as described by the manufacturer.

  3) Reverse transcriptase PCR

MRNA was isolated from all cell samples using TRIzol reagent (Invitrogen; Life Technologies Inc., Grand Island, NY) according to the manufacturer's instructions. RNA concentration was measured using a NanoDrop ^TM 2,000 UV-Vis spectrophotometer (Thermo Scientific, Wilmington, DE, absorbance at 260 nm).

First strand cDNA was synthesized using a power cDNA synthesis kit (kNtRON biotechnology). Containing 2 μg total RNA, 1 μl oligo DT, 1 μl RNAse inhibitor (10 U / μl), 4 μl 5x RT buffer, 2 μl dNTP, 2 μl DTT and 0.5 μl AMV RT enzyme (10 U / The reaction was carried out at a volume of 20 μl. The synthesized first strand cDNA sample was diluted by adding 50 μl of DEPC solution.

To determine the stem cell performance of MFPASC, differentiation into adipocytes and conversion into epithelial lineage, various gene expression was detected by reverse transcriptase-PCR using a specific primer on 1% agarose gel and gel document recording system Respectively. Table 1 lists the primers used.

Gene Accession number 5 ' sequence 3 ' sequence CD  13 AJ426050 .One 5'- GCCGTGTGCACAATCATCGCACT -3 ' 5'- CACCAGGGAGCCCTTGAGGTG -3 ' CD34 BC006607 5'- ATGCAGGTCCACAGGGACACG -3 ' 5'- CTGTCCTGAAGATCAAGTAG -3 ' CD44 NM _174013.3 5'- CAGACCTGCCCAATGCCTTTGATGGACC -3 ' 5'- CAAAGCCAAGGCCAAGAGGGATGCC -3 ' CD  106 M60335 .One 5'- GGAAGTGGAATTAATTATCCAA -3 ' 5'- CTACACTTTTGATTTCTGTG -3 ' Vimentin NM _003380.3 5'- AGGAAATGGCTCGTCACCTTCGTGAATA -3 ' 5'- GGAGTGTCGGTTGTTAAGAACTAGAGCT -3 ' Adipo  Q BC140488 5'- GATCCAGGTCTTGTTGGTCCTAA -3 ' 5'- GAGCGGTATACATAGGCACTTTCTC -3 ' LPL M16966 5'- TACCCTGCCTGAAGTTTCCAC -3 ' 5'- CCCAGTTTCAGCCAGACTTTC -3 ' UCP1 NM _012682.2 5'- AACACTGTGGAAAGGGACGAC -3 ' 5'- CATGGTCATTGCACAGCTG  -3 ' Resistin NM _183362.1 5'- AGTCCACAGAGAGGCACCTG -3 ' 5'- TGGTGACCTCCTGGATCTTC -3 ' PPAR gamma NM _001100921.1 5'- ACG GGA AAG ACG ACA GAC AAA -3 ' 5'- GAC GGA GCG AAA CTG ACA CC -3 ' C / EBP alpha BC149006 .One 5'- AGT CCG TGG ACA AGA ACA GC -3 ' 5'- GGT CAT TGT CAC TGG TCA GC -3 ' ap2 NM  024406 5'- CCG CAG ACG ACA GGA -3 ' 5'- CTC ATG CCC TTT CAT AAA CT -3 ' EMA AF399757 5'- CGC AGA ACT ACG CCA GTT TCC -3 ' 5'- AGA GCG GGT GGT CAT GGA TG -3 ' ESA BC014785 .One 5'- CACTCATTTTCTTCCCAAGAG -3 ' 5'- GAACTGGATAGAGGAACGTG -3 ' K8 NM _001256293.1 5'- GCGGCAGCTGCGTGAGTA -3 ' 5'- GCTGAGGCCGGGGCTTGTGAG -3 ' K18 NG _008351.1 5'- CCTGTCCTTTCTCTCTCCCC -3 ' 5'- TCCCTCCTACCCCTTACCTG -3 ' GAPDH NG _006129.5 5'- TGAACGGGAAGCTCACTGG -3 ' 5'- TCCACCACCCTGTTGCTGTA -3 '

 (2) Experimental results

Expression of visentin in MFPASC purified by reverse transcriptase PCR was significantly (p <0.05). CD44 was found to be significantly more significant (p < 0.01) than CD13 (Fig. 2A). However, genetic expression of CD13, CD34 and CD106 was not observed.

Immunostaining and immunoblotting analysis showed that CD44, CD106 and visentin were significantly (p <0.01 / p <0.05) as compared to CD13 (FIG. 2B, FIG. 2C). However, the expression of CD13 and CD34 was not genetically or immunologically confirmed in MFPASC.

From the above results, it was confirmed that stem cell ability was present in MFPASC.

[ Example  3: Refined MFPASC Of adipocyte differentiation]

 (1) Experimental method

  One) MFPASC Adipocyte differentiation

One million cells were inoculated into 60 mm culture dishes and grown in growth medium consisting of DMEM supplemented with 10% FBS and 1.1% P / S. The cells were incubated at 37 ° C in a 5% CO ₂ humidified incubator. A control experiment was conducted to exclude the influence of dimethylsulfoxide.

When the cells reached confluent stage (about 100% proximity), the cells were treated with 2% HS, 1.1% P / S, 50 μM ascorbic acid, 33 μM biotin, 10 μM acetic acid, 17 μM pantothenic acid, 0.5 μM IBMX, 1 μM Cells were cultured in induction medium consisting of DMEM medium containing dexamethasone, 10 [mu] M insulin and 10 [mu] M thiazolidinedione (TZD) for 48 hours.

After 2 days, the cells were cultured in a differentiation medium containing only TZD (10 μM) or a differentiation medium containing TZD (10 μM) and α-linolenic acid (LA; 100 μM), and then the medium was replaced Respectively. The control group was cultured only in the differentiation medium (DMEM medium containing 2% HS) and the whole experiment was carried out three times.

  2) oil - red By -O MFPASC Of differentiation of adipocytes

Dyes accumulated in adipoblasts were measured to determine the number or size of lipoblasts. The cells fixed with formalin were washed with 60% isopropanol and dried naturally. Cells were stained with freshly diluted oil-red-O (6 parts of oil-red-O stock solution and 4 parts of distilled water, where oil-red-O stock solution was 0.5% Oil-red-O solution in isopropanol) And excess dye was removed by washing with distilled water 4 to 5 times using a small dedicated pipette.

After that, the cells were dried and oil-red-O remaining was eluted by adding 100% isopropanol and incubating for 10 minutes. The optical density (eluted dye index) of the eluted dye was measured at 500 nm using 100% isopropanol as a blank test group in a 1.5 mL Eppendorf reagent bottle (McNeil 2005).

Oil-red-O staining was performed with slight modifications of the procedures described in Green and Kehinde (Green, H., Kehinde, O. Sublines of mouse 3T3 cells that accumulate lipid. Cell 1: 113-116; Briefly, cells fixed in formalin were washed twice with PBS for 15 minutes and then stained with freshly diluted oil-red-O for 1 hour. Then, the dye was removed and the cells were washed twice with distilled water for 5 minutes, with or without a control dye (Gill's hematoxylin, 5 minutes), and irradiated with an optical microscope.

 (2) Experimental results

MFPASC cells were cultured in adipocyte-derived medium, and 10 μM TZD was added to induce adipocyte differentiation of MFPASC, which was significantly (p <0.05) induced. However, when 10 μM of TZD alone was used, fat cell induction was 60%, which usually took more than 4 days.

However, the use of 10 μM TZD and 100 μM LA showed an increased likelihood of transfection and a 48-hour reduction in transfection time. The concurrent use of TZD and LA resulted in a significant (p <0.01) increase in adipocyte differentiation compared to unfractionated 0 day cells.

When MFPASC is transformed into an adipocyte lineage, it is similar to a typical lipoprotein-like cell, which has a very unusual nucleolar morphology distorted by a plasma membrane due to an increase in lipid content. This is also the case with the present invention. This increase in lipid content is due to increased biosynthesis or uptake of adipocyte-derived media.

On the other hand, dye uptake by adipocytes during differentiation increased with the use of TZD alone or with LA (p <0.05). However, the elution index was very high when TZD and LA were used together (p <0.01) (Fig. 3).

(P <0.05) and lecithin (p <0.01) were detected in the MFPASC treated with TZD by reverse transcription-polymerase chain reaction (PCR) Were significantly expressed.

However, the transcriptional expression of PPAR-γ and lecithin in MFPASC was very remarkable in combination with TZD and LA. Transcriptional expression of PPAR-γ and lecithin was very marked in MFPASC in the two treatments. The expression of PPAR-γ transcription factor was significantly better (p <0.05 / p <0.01) from day 2 to day 5 than day 0, and decreased thereafter. However, lecithin was notably expressed throughout the experimental period in cells treated with LA as well as TZD.

On the other hand, when MFPASC is exposed to TZD together with LA, Adipo-Q, CAAT-enhancer-binding proteins-alpha, CEBP-alpha, PPAR-gamma, lipoprotein lipase Upregulation of lecithin (p < 0.01) was observed (Fig. 4). However, the expression of adipocyte protein-2 (ap2) and MFPASC unconjugated protein-1 (UPC1) was found, and both TZD alone and treatment with LA did not affect the expression of ap2 and UPC1 in MFPASC cells I did not.

[ Example  4: Refined MFPASC &Lt; RTI ID = 0.0 &gt;

 (1) Experimental method

  One) MFPASC Of epithelial lining

For epithelial cell differentiation, one million cells were inoculated on a 60 mm culture dish and grown in growth medium. When cells become close to densities, cells are cultured in epithelial cell-derived medium (DMEM medium containing 2% HS, 1.1% P / S, 5 μg / ml insulin, 1 μg / ml hydrocortisone, and 10 ng / ml EGF) Were cultured for 48 hours.

Thereafter, differentiation medium containing keratinocyte growth factor (KGF; 10 ng / ml) was used for epithelial cell lineage differentiation. The medium was freshly provided at a 48 hour cycle and cultured for 10 days. The control group was cultured only in differentiation medium (DMEM medium containing 2% HS), and the whole experiment was performed three times.

  2) Ayoub - Shklar  By staining MFPASC of Epithelialization  judgment

The cells were fixed with 4% paraformaldehyde and stained with Ayoub-Shklar dye (fucic acid + aniline blue + orange G) to confirm that the adipose stem cells were differentiated into epithelial lineages (Ouji, Y .; Yoshikawa, M .; Shirol, A .; Ishizaka, S. Wnt-10b secreted from lymphocytes promoting differentiation of skin epithelial cells. Biochemical and Biophysical Research Communications 342: 1063-1069;

Briefly, after aspirating the media from the dish, the cells were rinsed three times with 1 x PBS. The cells were then fixed with 4% paraformaldehyde at room temperature for 30 minutes. Fixed cells were washed several more times with PBS and stained with fuchsin for 3 minutes. Then, it was stained with aniline blue and orange G for 45 minutes.

After washing with 95% ethanol, the plate was dried and photographed under a microscope. Using a predetermined criterion, a reddish brown-colored region was selected from a microphotograph to identify cells differentiated into epithelial lineages.

We obtained a histogram that converts the semi-quantified data obtained by using a digital video camera (JVC KY-F55B; Imaging Associates, Thame, UK) into a percentage and derives a significant comparison.

 (2) Experimental results

When exposed to the epithelial cell-derived medium for the first 48 hours, the cells showed a convex morphology. However, after treatment with 10 ng / ml KGF, all cells were flat, cubic, or columnar until the end of the differentiation period.

Cells that were completely treated with 10 ng / ml KGF formed colonies or clusters on about 4-5 days. These colonies and clusters have increased in density as time has elapsed and processing time has increased.

In addition, Ayoub-Shlkar staining showed that reddish brown coloring was remarkable in the cytoplasm of cells with cubic or columnar shape, and the cells were converted into epithelial lineages. Dark reddish brown pigmentation was observed from day 8 after differentiation, which means that it takes a longer time to transform into the epithelial lineage (FIG. 5B).

(P <0.01 / (p <0.05) of the genes (K8, K18, EMA and ESA) that specifically identify the cells were 10 ng / ml &lt; / RTI &gt; KGF (Fig. 5D).

Claims (11)

A composition for inducing differentiation into mammary epithelial cells, comprising keratinocyte growth factor as an active ingredient.
The method according to claim 1,
The above-
Wherein the composition is transdifferentiation.
The method according to claim 1,
The mammary gland epithelial cells,
Wherein the composition is mammary epithelial cells selected from the group consisting of bovine, ovine, amniotic, bovine, cow, goat, and sheep.
The method according to claim 1,
The composition may comprise,
A composition for inducing differentiation into mammary epithelial cells, which comprises inducing the differentiation of mammary fat pad adipose stem cells into mammary epithelial cells.
A composition for preventing or treating breast diseases, which comprises keratinocyte growth factor as an active ingredient.
6. The method of claim 5,
The above-
Mastitis, breast cancer, and breast hypertrophy.
The method according to claim 6,
The breast enlargement may include,
Wherein said disease occurs in the breast mature stage or the breast stage.
6. The method of claim 5,
The breast,
Wherein the mammal is a mammal selected from the group consisting of cow, goat, and sheep.
A method for inducing differentiation into mammary epithelial cells, which comprises culturing mammary epithelial cells in a mammalian epithelial cell, wherein the mammalian epithelial cells are cultured in a composition comprising keratinocyte growth factor as an active ingredient.
10. The method of claim 9,
The above-
The composition for inducing differentiation is characterized in that it is transdifferentiation
10. The method of claim 9,
The composition may comprise,
Wherein the composition comprises keratinocyte growth factor at a concentration of 1 to 100 ng / mL in the composition.

Images