KR20150085700A - Composition for detecting biomarker comprising target-specific probe and detectable labeling agent-antibody composite and using method of the same - Google Patents

Abstract

The present invention relates to a composition comprising: a target-specific probe comprising a ferritin protein, a superparamagnetic nanoparticle combined with the ferritin protein, and a targeting antibody combined on the surface of the superparamagnetic nanoparticle; and a labeling agent-antibody composite comprising a detecting antibody combined on the target-specific probe and a detectable labeling agent for detecting a biomarker, and to a method for detecting a biomarker using the same or a detecting kit.

Description

 TECHNICAL FIELD [0001] The present invention relates to a composition for detecting a biomarker including a target-specific probe and a labeling substance-antibody complex, and a method of using the same. More particularly, the present invention relates to a composition for detecting a biomarker,

The present invention relates to a target-specific probe comprising a ferritin protein, a super-magnetic nanoparticle bound to the ferritin protein and a targeting antibody bound to the surface of the super-magnetic nanoparticle, a target-specific probe and detection An antibody complex containing a detection antibody bound to a detectable labeling agent, and a method or kit for detecting a biomarker using the composition.

A biomarker is a type of biomolecule present in biological or medical specimens that can be used to diagnose the condition of a disease by qualitatively and / or quantitatively detecting changes in structure or concentration thereof, And to make a comprehensive judgment of the relevance of the relationship. For the early diagnosis of diseases, it is essential to quantitatively analyze the biomarkers that appear at the early stages of the disease. This is because the technologies currently used for disease monitoring are not adequately addressing the technical requirements for early diagnosis of the disease due to limitations such as sensitivity, quarantine rate, and cost.

Enzyme-linked immunosorbent assay (ELISA) and Western blotting and mass spectrometry are commonly used to quantitatively analyze biomarkers. In the case of ELISA, the reaction is inhibited by the polysaccharide or phenol compounds present in the test sample, or the concentration of bacteriophage present in the tissue is low, which is difficult to detect accurately. The method using mass spectrometer is very sensitive and can be applied to trace amount of biomarker analysis. However, it is difficult to obtain reproducibility due to the experimental method that is mainly analyzed by chromatography method, and there is a disadvantage in that there is a large deviation of analysis data due to device error . Also, these methods are labor-intensive and time-consuming.

In addition, the detectable concentration of the biomarker for diagnosis of various diseases such as cancer and infectious diseases is very irregular. Currently, diagnostic methods that are widely used are capable of detection only when the concentration of the biomarker is above a certain threshold value. In many cases, the disease has generally progressed or propagated seriously at a concentration at which the biomarker can be detected, There is a need for a technique for detecting a biomarker concentration below a critical value, that is, detecting a disease biomarker at an early stage to increase the survival rate of the patient and to prevent the spread of infectious diseases.

In order to construct a system capable of detecting a low-concentration biomarker, development of an ultra-high-sensitivity detection probe capable of effectively detecting a disease-specific marker protein and technology capable of amplifying a detection signal generated through a trace amount of biomarker detection Development is essential.

In the related patent, a probe (WO 2008-053229) capable of detecting a biomarker by expressing only a plurality of Fabs of an antibody on the surface of ferritin (WO 2008-053229) is an antibody that binds to ferritin surface in various conditions to detect a biomarker There is a problem that the number can not be easily controlled, and there is a technology of detecting a biomarker using the magnetic nanoparticle coated with PEG (WO 2012-105794), but PEG is a polyethyl glycol There is a problem in that accurate detection is required.

It is an object of the present invention to provide a target-specific superparamagnetic probe comprising a ferritin protein, a superparamagnetic nanoparticle bound to the ferritin protein, and a targeting antibody bound to the surface of the superparamagnetic nanoparticle.

It is yet another object of the present invention to provide a composition for detecting biomarkers, comprising a target substance-antibody complex comprising the target-specific superparamagnetic probe and the detection antibody bound to the detectable label substance.

It is still another object of the present invention to provide a method for detecting a biomarker, which comprises mixing a sample containing a biomarker with a composition for detecting the biomarker, collecting a biomarker to which a superparamagnetic probe is bound by applying a magnetic field to the mixture, And detecting the target labeled substance of the labeled substance-antibody complex.

To achieve the above object, the present inventors have found that binding of a ferritin protein to a target-specific probe comprising a superparamagnetic nanoparticle bonded to the ferritin protein and a targeting antibody bound to the surface of the superparamagnetic nanoparticle and a detectable labeling substance In the case of using the labeling substance-antibody complex containing the detection antibody, the binding solution is bound only to the desired biomarker without aggregation in the dispersion solution, and the bound nanoprobe is completely separated using the magnetic force to maximize the detection efficiency And that the absolute quantification of the biomarker is possible, thus completing the present invention.

Hereinafter, the present invention will be described in more detail.

The present invention relates to a target-specific probe comprising a ferritin protein, a superparamagnetic nanoparticle bound to the ferritin protein, and a targeting antibody bound to the surface of the superparamagnetic nanoparticle.

The target-specific probe according to the present invention can be easily collected and separated using magnetic separation by immobilizing the antibody on the surface of the ferritin-bound superparamagnetic nanoparticle to target the biomarker. In addition, by using superparamagnetic nanoparticles without residual magnetization, nano-probes can be bound only to the target biomarker without being clustered at the time of disease biomarker detection, and can be easily collected using magnetic separation, And the detection efficiency can be maximized.

In a specific embodiment of the present invention, a target-specific probe comprising a ferritin protein, a superparamagnetic nanoparticle bound to the ferritin protein and a targeting antibody bound to the surface of the superparamagnetic nanoparticle is prepared and bound to a detectable labeling substance Antibody complex containing the detection antibody was prepared to prepare a composition for detecting a biomarker. It was confirmed that the composition for detecting a biomarker can be detected and detected by the concentration of the biomarker using the prepared composition for detecting a biomarker, As a result, it was confirmed that the higher the concentration of the biomarker, the stronger the fluorescence intensity (Example 3). In addition, a target-specific probe and a labeling substance-antibody complex in which a biomarker was targeted with a sandwich were separated using a magnet, and then the intensity of fluorescence was measured by irradiating ultraviolet light. As a result, it was confirmed that the detection result of the biomarker is more effective because the intensity of the fluorescence becomes more clearly distinguishable as a band form (Example 4).

As used herein, the ferritin protein includes the ferritin protein itself, the heavy chain of ferritin, the light chain of ferritin, analogues thereof, and apoferritin. Ferritin is a protein aggregate that exists extensively in the extracellular matrix. It consists of 24 single subunits and forms a cage-line nanostructure with an outer diameter of 12 nm and an inner diameter of 8 nm. do. The ferritin cage has an internal void size of about 8 nm and contains about 4,500 Fe atoms in the form of ferric oxide and serves to supply these iron atoms during the metabolic process.

As used herein, the term "superpowder nanoparticle" means a material having strong magnetism when a magnetic field is externally applied. Specifically, it may include at least one kind selected from the group consisting of Fe (III), Mg, Mn, Ni, Zn, and Co. The super-magnetic nanoparticles according to the present invention may have an average particle size of 3 to 100 nm and may be particles having 4 to 30 nm. In addition, the super magnet nanoparticles may have an average magnetizing power of 60 emu / g to 150 emu / g, and 80 emu / g to 130 emu / g.

A method for synthesizing a superpowder magnetic nanoparticle is a method of heating a raw material solution containing a substance selected from the group consisting of Fe (III), Mg, Mn, Ni, Zn, and Co in a flask at 190 ° C to 195 ° C The particles are held for 30 minutes to produce nuclei. The raw material solution obtained in the nucleation step may be heated to the boiling point of the solvent and then kept at the same temperature for 30 to 50 minutes to grow the particles, but the present invention is not limited thereto.

According to the present invention, a linker is expressed on the surface of ferritin to bind a large amount of magnetic nanoparticles showing superparamagnetism, thereby maximizing the surface area without aggregation and facilitating the detection of a trace amount of disease biomarkers. Specifically, the ratio of the super-magnetic nanoparticles bonded to the surface of ferritin may be ferritin: super magnetic nanoparticles = 1: 1 to 1: 6 based on the molar ratio, but is not limited thereto. Thus, by maximizing the surface area by binding a large amount of the superparamagnetic nanoparticles to the surface of the ferritin, it is possible to maximize the reaction with the target biomarker.

The super-magnetic nanoparticle may include, but is not limited to, a surface layer comprising an amphiphilic substance having a hydrophilic group and a hydrophobic group. For example, the amphiphilic substance may be 1-Myristoyl-2-Hydroxy-sn-Glycero-3-phosphocholine (MHPC) , 1,2-distyroyl-ene-glycero-3-phosphoethanolamine-ene-methoxypolyethylene glycol-2000 (1,2-Distearoyl-sn-Glycero-3-Phosphoethanolamine- N- glycol-2000 (DPPE-PEG2000), 1,2-diorail-ene-glycero-3-ene-5-amino-1-phenylpentyliminodiacetic acid succinylmethoxide (Ni-NTA), but an amphiphilic substance having a hydrophilic group and a hydrophobic group, the surface of the super-magnetic nanoparticle is hydrophilic The scope of the present invention is not limited as long as it is a functional material.

As used herein, a targeting antibody is an antibody having a targeting ability specific for a biomarker to be detected or quantified, and specifically includes, for example, a monoclonal or polyclonal antibody, an immunologically active fragment (for example, Fab or (Fab) 2 But are not limited to, aptamers, aptamers, and the like, which have a targeting ability specific for a biomarker to be detected or quantified, such as, for example, a fragment of an antibody, an antibody heavy chain, an antibody light chain, a genetically engineered single chain molecule, a chimeric antibody, Or a peptide.

In one embodiment of the present invention, a first linker may be further included between the ferritin protein and the superparamagnetic nanoparticles, wherein the first linker is linked to the C-terminus or N-terminus of the ferritin protein, Or a protein or peptide that does not inhibit the formation of the structure. The ferritin protein and the superparamagnetic nanoparticles can be directly linked or linked using a linker consisting of preferably 15 to 25 amino acids, including up to 30 amino acids.

In another embodiment of the present invention, the ferritin protein and the first linker may be composed of one fusion protein. For example, the first linker may be expressed on the surface of the ferritin protein.

Methods for binding ferritin protein to superparamagnetic nanoparticles include: i) incorporating a hexahistidine sequence on the surface of the ferritin protein of 24 identical protein subunits consisting of a heavy chain and a lightchain; Expressing at least one linker protein selected from the group consisting of a protein G, a protein A, a protein A / G and an Fc receptor which is selected from the group consisting of MHPC, DPPE-PEG2000 and Ni-NTA Converting the surface of the superpowder magnetic nanoparticles to hydrophilicity to function; and iii) fixing the linker protein comprising the hexa-histidine sequence on the surface of the superpowder nanoparticles using a nickel-histidine binding reaction. .

Further, a second linker may be further included between the supernatant magnetic nanoparticle and the targeting antibody, and the second linker may be bound to a portion of the surface of the super-magnetic nanoparticle not connected to the ferritin protein. The superpowder nanoparticles and the targeting antibody can be linked directly or linked using a linker consisting of preferably 15 to 25 amino acids, including up to 30 amino acids.

The superparamagnetic nanoparticles and the targeting antibody may be directly bound or bound to each other through a second linker. Specifically, i) the second linker may be a nickel -Histidine binding reaction, and ii) immobilizing the targeting antibody on the surface of the superparamagnetic nanoparticles bound to the surface of the ferritin to activate the Fab of the targeting antibody.

The term "linker" used in the present invention refers to a link between a ferritin protein and a superparamagnetic nanoparticle, a link between a superpowder nanoparticle and a targeting antibody, or a link between a detectable labeling substance and a detectable antibody. But are not limited to, protein A, protein A / G, Fc receptor, biotin, avidin, histidine, Ni-NTA, or streptavidin.

The structure of the target-specific probe according to an embodiment of the present invention may include a ferritin protein core, superparamagnetic nanoparticles surrounding the ferritin protein, and a targeting antibody immobilized outside the superparamagnetic nanoparticle. When the ferritin protein is referred to as a core, the superpowder nanoparticle and the target antibody can be seen as the surface, and the core-surface layer structure is not limited thereto.

In addition, the ratio of the ferritin protein, the superpowder nanoparticle, and the targeting antibody in the target-specific probe may be 1: 1: 1 to 1: 6: 6 based on the molar ratio, but is not limited thereto.

In one embodiment, the present invention provides a composition for detecting biomarkers, comprising a target substance-antibody complex comprising a target-specific probe of the present invention and a detection antibody bound to a detectable label substance.

The composition for detecting biomarkers according to the present invention can easily collect and isolate biomarkers by immobilizing antibodies on the surfaces of ferritin-bound superparamagnetic nanoparticles using magnetic separation. By using a labeling substance-antibody complex, specific antigens can be detected by a sandwich method using quantum dots and fluorescence. In addition, it is possible to obtain the amplified detection signal through a large quantum dot bound to the labeling substance-antibody complex, thereby minimizing the error in detecting a very small amount of biomarker. Can be quantified.

The target antibody of the target-specific superparamagnetic probe and the detection antibody of the labeling substance-antibody complex may be the same or different, and may be appropriately selected depending on the biomarker to be detected. Specifically, the targeting antibody and the detection antibody may be a monoclonal antibody or a polyclonal antibody. For example, the targeting antibody may be a monoclonal antibody, and the detection antibody may be a polyclonal antibody, or a portion that binds to the biomarker may be a monoclonal antibody different from the targeting antibody.

The detection antibody can target different portions of the same biomarker as the targeting antibody contained in the target-specific probe. Specifically, the portion of the biomarker targeted by the detection antibody and the portion of the biomarker targeted by the targeting antibody may be a portion sufficiently distant from the binding with the biomarker.

In addition, the present invention may further comprise a third linker between the detectable labeling substance and the detection antibody.

In one embodiment of the present invention, the detectable labeling material may be a quantum dot, a magnetic bead nanoparticle, a gold nanoparticle, a fluorescent dye, a fluorescent protein, a nanophosphor, or a silicon nanoparticle. The labeling substance itself can bind to protein G, protein A, protein A / G, Fc receptor, biotin, avidin, histidine, Ni-NTA or streptavidin, To the linker after chemical treatment. Specifically, the quantum dot may have a hydrophilic surface by using a substance containing an amphipatic substance. For example, the amphipatic material may be at least one selected from the group consisting of MHPC, DPPE-PEG2000, Ni-NTA, and mixtures thereof.

Specifically, the quantum dot and the detection antibody may be directly bound or bound through a third linker. For example, i) converting the surface of the quantum dots into hydrophilicity using at least one selected from the group consisting of MHPC, DPPE-PEG2000, Ni-NTA and mixtures thereof, ii) introducing a hexa histidine sequence into the surface of the quantum dots Immobilized using a nickel-histidine binding reaction, and iii) immobilizing the detection antibody on the third linker. Fab of the detection antibody can always be activated by the third linker.

The superpowder nanoparticles and the surfaces of the quantum dots may be made of at least one selected from the group consisting of MHPC, DPPE-PEG2000, Ni-NTA, and mixtures thereof. For example, a certain amount of MHPC, DPPE-PEG2000 and Ni- Can be mixed with the nanoparticles in order to form an emulsion state, and treated with ultrasonic waves to form a functional lipid layer on the surface of the nanoparticles. In this case, hydrophobic binding of the lipid on the surface of the nanoparticles by the hydrophobic bonding allows the hydrophilic portion of the lipid to be coated on the nanoparticle surface while facing the hydrophilic portion of the lipid, so that the surface of the nanoparticle can be hydrophilized.

Since MHPC is a single acyl chain lipid, it can be densely coated on the spherical surface of the supernatant nanoparticles and quantum dots. DPPE-PEG2000 can also impart dispersion stability to lipid-coated nanoparticles. And Ni-NTA binds histidine in protein G to bind hydrophilic superparamagnetic nanoparticles and quantum dots to protein G, and when imidazole is added in subsequent steps for the separation of superpowder nanoparticles and quantum dots, It can play a role of separating.

In the present invention, the first linker positioned between the ferritin protein and the superparamagnetic nanoparticles, the second linker positioned between the superpowder nanoparticle and the targeting antibody, and the third linker positioned between the labeling substance and the detection antibody are the same Can be different.

In one aspect of the present invention, the present invention provides a method for detecting a biomarker comprising the steps of mixing a sample containing a biomarker with a composition for detecting a biomarker of the present invention, and detecting the labeled substance of the labeled substance- And detecting the biomarker. For example, the detecting step may be performed by measuring fluorescence intensity emitted from the quantum dot. In the present invention, the fluorescence intensity value is a relative value and is Arbitrary unit (au).

For example, mixing the biomarker detection composition may include adding the target-specific probe to the vessel, mixing the sample containing the biomarker into a vessel to which the target-specific probe has been added, Mixing the labeling substance-antibody complex into the container, and separating the biomarker bound with the supernatant magnetic nanoparticles by applying a magnetic field outside the container. Specifically, the ratio of the concentration of the target-specific probe and the labeling substance-antibody complex may be 1: 1 to 1: 5 the concentration of the target-specific probe: labeling substance-antibody complex on the basis of the molar ratio, It does not.

In addition, the method of applying the magnetic field can be simply performed using a magnet, but not limited thereto, and any method capable of exhibiting attracting force to superparamagnetic nanoparticles is included in the scope of the present invention.

In one embodiment of the method for detecting a biomarker, it may further include determining that a biomarker is present in the sample when the labeling substance is detected.

More specifically, the method for detecting a biomarker of the present invention comprises the steps of: i) providing a target-specific probe of the present invention; ii) providing a labeling substance-antibody complex of the present invention; iii) Subjecting the biomarker to a sandwich target by the probe and the labeling substance-antibody complex, and iv) measuring the absorbance or fluorescence intensity of the quantum dots to quantify the concentration of the biomarker.

For example, as can be seen from FIG. 3, the ferritin solution containing ferritin is mixed with the tabular antibody (target antibody) and the target nanoparticle is mixed with the target-detecting probe according to the present invention And an antibody-bound probe) is prepared, and the prepared target-detection probe and labeling substance-antibody complex (detection antibody combined with quantum dots) are mixed in a container containing a biomarker. In this process, the target-detection probe and the labeling material-antibody complex can be used to sandwich the biomarker. Thereafter, the sandwich-targeted biomarker can be easily separated using a magnet, and the amount of the biomarker can be quantitatively analyzed.

As shown in FIG. 1, the sandwich-targeted biomarker has a structure in which a part of the biomarker is bound to a targeting antibody bound to the surface of the superparamagnetic nanoparticle to ferritin protein, and a part other than the part to which the targeting antibody binds Antibody complexes so that different portions of the biomarker can be detected and detected by the target-detection probe and the labeling material-antibody complex.

In addition, the present invention relates to a method for detecting the presence of a labeled substance contained in a labeled substance-antibody complex targeted to a biomarker detected through a detection method of the biomarker of the present invention and a standard curve prepared by measuring the absorbance or fluorescence intensity at various concentrations of the labeled substance The biomarker in the sample can be quantified by comparing the absorbance of the labeled substance or the intensity of fluorescence.

Specifically, a method for quantifying a biomarker comprises the steps of: i) providing a plurality of solutions comprising different quantum dots having different concentrations, ii) measuring the absorbance or fluorescence intensity of the plurality of solutions at a wavelength of 350 nm, iii) comparing the concentration of the other quantum dots with the intensity of the absorbance or fluorescence to provide a standard curve, iv) measuring the intensity of the absorbance or fluorescence at the 350 nm wavelength of the separated quantum dot, v) Comparing the absorbance or fluorescence intensity at a wavelength of 350 nm with a standard curve to calculate the concentration of the separated quantum dots, and vi) quantifying the concentration of the biomarker proportional to the concentration of the separated quantum dots .

In another aspect of the present invention, the present invention relates to a diagnostic kit for a biomarker comprising a detector for detecting a labeling substance of a composition for detecting biomarkers of the present invention. Specifically, the detector may be an ultraviolet ray emitter, an ultraviolet lamp, a fluorescence detector, or the like. However, the present invention is not limited thereto. For example, as shown in FIG. 8, the diagnostic kit of the biomarker of the present invention comprises a target-specific probe solution (FIG. 8A), a labeling substance- antibody complex solution (FIG. 8B) C), and a separating magnet (D in Fig. 8).

The present invention can detect a low concentration of biomarkers with ultrahigh sensitivity using a maximized surface area by combining the super magnetic magnetic nanoparticles and the first tabular antibody on the surface of ferritin protein particles. Also, in the present invention, by using the super-magnetic nanoparticles, it is possible to easily collect nanoprobe through application of an external magnetic field without aggregation and efficiently detect the biomarker.

Disclosure of the Invention The present invention relates to a magnetic nanoparticle comprising ferrite nanoparticles bound to ferritin, an antibody for detecting a biomarker attached to the nanoparticle is concentrated to increase the sensitivity, the superpowder nanoparticles are magnetically separated using the property of reacting with external magnetic field, The present invention relates to a novel biomarker detection composition capable of up to signal amplification and absolute quantification of detected viruses using fluorescence and absorbance of quantum dots. By using this composition, it is possible to detect various infectious diseases and diseases early, It can contribute to the dramatic reduction of treatment costs.

Brief Description of the Drawings Fig. 1 is a conceptual diagram showing a sandwich-targeted biomarker targeted by a target-specific probe and a labeling substance-antibody complex of the present invention.
Fig. 2 shows a gene map of a fusion protein of ferritin protein and protein G. Fig.
FIG. 3 is a schematic diagram showing the process of developing a target-specific probe in which superparamagnetic nanoparticles are bound to the surface of ferritin protein and a first labeled antibody is bound to the surface of the ferritin protein, and the labeled target- (For quantitative analysis of biomarkers), and then sandwiching the biomarkers using the above-mentioned two.
FIG. 4 shows DLS results obtained by measuring the size of each of the nanoprobes prepared in accordance with an embodiment of the present invention. In the middle (orange), the size of the complex in which the superficial magnetic nanoparticle and the fusion protein are bound, and the bottom (blue) indicates the size of the target antibody Lt; / RTI > probe-immobilized probe-specific probe.
Figure 5 shows the optical properties of quantum dots for absolute quantitation after detection of biomarkers using the composition of the present invention.
6A shows an electron micrograph of a target-specific probe of the present invention.
6B shows the magnetic force separation efficiency of the nano-probe.
FIG. 6C shows a sample containing biomarkers at various concentrations (8.3 ng / ml, 33.3 ng / ml, 83.3 ng / ml, and 166.7 ng / ml) using the composition for detecting biomarkers of the present invention Top), and the photo is confirmed using ultraviolet light (top right). The sample is collected using a magnet (lower left) and irradiated with ultraviolet light (lower right).
Figure 7a is a standard curve showing the fluorescence intensities of the quantum dots of various concentrations (0.024, 0.048, 0.097, 0.195, 0.39, 0.78, 1.56, 3.13, 6.25 and 12.5 nM) As shown in FIG. FIG. 7B shows a sample containing biomarkers of various concentrations (5.0, 8.3, 33.3, 83.3, 166.7 ng / mL) detected using the composition for detecting biomarkers of the present invention, And the number of biomarkers detected by the method is in agreement with the number of quantum dots of the nanoprobe, and quantitative analysis is possible.
8 shows a biomarker detection kit using the nanoprobe developed in the present invention. A is the target-specific probe solution of the present invention, B is the label substance-antibody complex solution of the present invention, C is the reaction container, and D is the magnet for separation.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1: target-specific Of the probe  Produce

1-1: Preparation of a fusion protein in which protein G is expressed on the surface of ferritin

In order to link the ferritin protein and the gene of Protein G purchased from Genescript, PCR was carried out using a total of three primers (Table 1) consisting of five primers. The primers were purchased from Cosmogenetech (Seoul, Korea). Restriction enzymes Nde I, BamH I and Xho I were also purchased from New England Biolabs (Ipswich, Mass., USA).

denomination Sequence 5 '→ 3' SEQ ID NO: Forward primer 1 CATATGACGACCGCGTCCACCTCG One Reverse primer 2 ACTGCCACCTCCAGTACCGCCTCCGCTTTCATTATCACTGTC 2 Forward primer 1 CATATGACGACCGCGTCCACCTCG One Reverse primer 3 GGATCCTCCACCGCTTCCACCGCCTGTTCCACCGCCACTGCCACCTCCAGTACC 3 Forward primer 4 GGATCCACTTACAAATTAATCCTT 4 Reverse primer 5 CTCGAGATTAGTGATGGTGATGGTGATGTTCAGTTACCGTAAAGGT 5

Ferritin and protein G were ligated using a linker of 54 bp and PCR was performed by dividing the linker into two fragments. First, the ferritin moiety was linked to NdeI, ferritin, and linker 1 using primer 1 (SEQ ID NO: 1) and primer 2 (SEQ ID NO: 2).

Primer 1 (SEQ ID NO: 1) and primer 3 (SEQ ID NO: 3) were then used to link the PCR product (Nde I + ferritin + Linker 1) with Linker 2 + BamH I.

The protein G portion was ligated with BamHI and Protein G, and XhoI was primer ④ (SEQ ID NO: 4) and primer ⑤ (SEQ ID NO: 5). PCR was carried out under the conditions as shown in Table 2 below. Each of the PCR products was confirmed by electrophoresis of the PCR product in agarose gel.

segment Number of cycles Temperature time One 30 95 ℃ 4 min, 30 sec 2 30 55 ° C 30 sec 3 30 72 ℃ 40 sec 4 One 72 ℃ 7 min 5 One 4 ℃ ∞

The end portion of each gene is cleaved by using BamHI, a restriction enzyme, in the ferritin portion and the protein G portion produced by PCR. Two genes cut with sticky ends were fused with ferritin and protein G using a ligation enzyme, and a gene map of the fusion protein of ferritin protein and protein G was shown in Fig.

Ferritin and protein G were linked by using an amino acid linker to allow ferritin and protein G to function independently without affecting each other.

1-2 Super magnetic  Synthesis of nanoparticles

A raw material solution containing a material selected from the group consisting of Fe (III), Mg, Mn, Ni, Zn, and Co was heated to 200 ° C in a flask, and the particles were maintained for 30 minutes to form nuclei . It was then heated to 295 ° C to allow the raw material solution to reach the boiling point and then kept at the same temperature for 45 minutes to allow the particles to grow. At the end of the reaction, slowly wait until the temperature of the solution has dropped below 50 ° C. The synthesized solution was washed well using anhydrous ethyl alcohol (99.9%). Add 30 ml of anhydrous ethyl alcohol and 15 ml of hexane solution, sonicate for 30 minutes, centrifuge at 7000 rpm for 10 minutes and discard the supernatant. Then, anhydrous ethyl alcohol was added, and the mixture was poured into a cherry, completely dried, and then dispersed in hexane to synthesize a supercritical nanoparticle.

The size of the superparamagnetic nanoparticles synthesized as the final product was observed with a transmission electron microscope (TEM), and the average particle diameter was observed to be 7 nm (5 to 13 nm) and measured with a VSM (vibrating sample magnetometer) As a result, the average magnetizing power was 71 emu / g.

Therefore, the super-magnetic nanoparticles produced according to the embodiment 1-2 of the present invention exhibit an average magnetizing force capable of sufficiently exerting attractive force with a general magnet, and thus the target nanoparticles of the present invention, to which the super- A biomarker that is sandwich-targeted to a probe or a target-specific probe and a labeling-antibody complex can be simply separated using a magnet.

1-3. Fused to ferritin protein Super magnetic  Combination of nanoparticles

The superparamagnetic nanoparticles synthesized in Example 1-2 were coated on the surface in the following manner for bonding with ferritin. Place a beaker containing 3.5 ml of deionized water on a sonicator with a water temperature of 85. Add 150 μl of lipid combination (270 μl of MHPC, 151.2 μl of DPPE-PEG2000, 47.7 μl of Ni-NTA) into 70 μl of superparamagnetic nanoparticles (20 mg / ml) synthesized at 1-2 and mix and drop by drop on a beaker in the sonicator . After sonication for 1 hour, centrifugation was carried out at 10,000 G for 10 minutes. The supernatant was collected and filtered with a 0.2 μm filter, and the buffer was changed with PBS (phosphate buffered saline, pH 7.4).

30 μl of a 0.5 μM ferritin solution containing ferritin expressed on the surface of the protein G prepared in Example 1-1 was mixed with 10 μl of the superficial magnetic nanoparticle solution coated on the surface of the reaction container and incubated at room temperature for 1 hour . Histidine on the surface of the fusion ferritin protein G and Ni-NTA coated on the superparamagnetic nanoparticles were bound to bind the superparamagnetic nanoparticles to the surface of the fused ferritin, thereby binding the superparamagnetic nanoparticles to the surface of the ferritin protein.

As can be seen from FIG. 4, the upper graph (green) shows the average particle size (13.43 nm) of the ferritin protein and the protein G fusion protein, and the discontinuation graph (orange) shows the average of the complex of the superficial magnetic nanoparticles and the fusion protein The particle diameter (17.16 nm) is shown. The superparamagnetic nanoparticle binds to the ferritin protein, which indicates that the average particle size increases by 3.73 nm. This shows that the superparamagnetic nanoparticles bind to the ferritin protein.

1-4. On ferritin protein surface Combined Super magnetic  On nanoparticles Targeting  Binding of antibodies

To the ferritin-bound superparamagnetic nanoparticles prepared in Example 1-3, 3 μl of a solution of protein G at a concentration of 100 μg / ml was added, and the mixture was allowed to react at room temperature for 1 hour, whereby the histidine portion of the protein G And bound to Ni-NTA coated on the superparamagnetic nanoparticles. To this, 1.8 μl of a 1 μg / ml hepatitis B biomarker (HBs) antibody solution was mixed and reacted at room temperature for 1 hour to bind the protein G and the Fc portion of the antibody-target antibody. Excess HBs antibody was washed three times with phosphate buffer solution at pH 7.4 to bind the targeted antibody to the superpowder nanoparticles (FIGS. 4 and 6A).

As shown in Fig. 4, The top graph (green) shows the size of the ferritin protein and the protein G fusion protein, and the discontinuation graph (orange) shows the results of the DLS measurement of the sizes of the nanoprobes applied to the table. The size of the combined complexes and the bottom graph (blue) indicate the size of the target-specific probe immobilized on the surface of the supernatant nanoparticles. Figure 6a shows electron micrographs of the target-specific probe of the present invention.

As can be seen from the figure, the mean particle size of the complex of the superparamagnetic nanoparticle and the fusion protein bound thereto was 17.16 nm, and the average particle size of the target-specific probe immobilized on the surface of the supernatant nanoparticles was 20.60 nm, it can be confirmed that the average particle size is increased by 3.44 nm due to immobilization of the antibody on the complex in which the superparamagnetic nanoparticles and the fusion protein are bound. As a result, it is confirmed that the antibody is immobilized on the complex comprising the superparamagnetic nanoparticle and the fusion protein .

Example  2: Biomarker  Preparation of Detection Composition

2-1: HBs  Detection antibody and hydrophilicity Quantum dot  Combination

To prepare a composition for detecting biomarkers, a surface-treated quantum dot was used as a detectable labeling substance. Specifically, quantum dots (20 mg / ml, 70 μl) were coated with lipid combination (MHPC 300ul + DPPE-PEG2000 170ul + Ni-NTA 53ul) in the same manner as 1-3 of the above Examples. After mixing 3 μl of 100 μl / ml protein G solution with 50 μl of surface-coated 0.2421 μM quantum dots and incubating at room temperature for 1 hour, the binding of histidine on the surface of protein G and Ni-NTA coated on the quantum dot To combine the quantum dots with protein G. After addition of 1.8 μl of HBs antibody (targeting antibody) at a concentration of 1 mg / ml, the protein G was bound to the Fc portion of the detection antibody by reacting at room temperature for 1 hour.

In FIG. 6C, fluorescence was different depending on the concentration of HBs, and it was confirmed that the detection antibody and the quantum dot were well coupled.

2-2: HBs  Antigen target

To the solution containing the target-specific probe prepared in Example 1-4, 27 μl of HBs antigen at a concentration of 6 μg / ml and a phosphate buffer solution at pH 7.4 were added to make a final volume of 400 μl, And reacted for 1 hour. To this was added 55 μl of a solution containing the quantum dot-bound HBs detection antibody prepared in Example 2-1, and the collected HBs antigen was sandwiched. HBs detection antibody bound to excess quantum dots was completely removed by washing 5 times with phosphate buffer solution of pH 7.4.

2-3: Quantitative analysis

FIG. 7A is a graph showing the fluorescence intensities of the quantum dot solutions at concentrations of 0.024, 0.048, 0.097, 0.195, 0.39, 0.78, 1.56, 3.13, 6.25 and 12.5 nM, The fluorescence intensity of the 166.7 ng / mL quantum dot solution was measured to make a standard curve. Figs. 7A and 7B are linearly proportional, which is a graph showing that the quantum dot concentration and the fluorescence intensity are linearly proportional. Through this, it was proved that the number of HBs can be quantitatively determined through the same number of quantum dots as the number of target HBs antigens.

2-4: Biomarker  Preparation of Detection Composition

The target-specific probe obtained in Example 1-4 and the HBsAg-detecting antibody obtained in Example 2-2 and the labeling substance-antibody complex conjugated with the hydrophilic quantum dot were mixed to prepare a composition for detecting biomarkers. The target-specific probe and the labeling substance-antibody complex were mixed at a molar concentration of 1: 1, and a phosphate buffer solution of pH 7.4 was added to adjust the final volume to 400 μl, followed by reaction at room temperature for 1 hour .

2-5: Confirm detection and detection efficiency

In order to confirm the excellent detection and detection efficiency of the composition for detecting biomarkers according to the present invention, it was confirmed that when the HBs were detected using the composition for detecting biomarkers of the present invention, the fluorescence intensity value was 13810 When the nanoparticles alone were used, the fluorescence intensity value was 801, and when the magnetic beads were used, the fluorescence intensity value was 2450. Therefore, it was found that the quantitative analysis using the probe for detecting a biomarker according to the present invention is about 17.4 times as efficient as that using only nanoparticles and 5.8 times as efficient as that of magnetic beads.

Example  3: Biomarker  Detection using detection composition

As can be seen from Fig. 6C, a solution containing biomarkers (HBs) at various concentrations (8.3 ng / ml, 33.3 ng / ml, 83.3 ng / ml, 166.7 ng / ml) The detection of the biomarker was confirmed by detecting the fluorescence of the target substance-specific probe and the labeling substance in which the labeling substance-antibody complex detected the biomarker as a sandwich by irradiating ultraviolet rays.

Specifically, a composition for detecting a biomarker was injected to subject a HBs biomarker to a sandwich using a target-specific probe and a labeling substance-antibody complex, and then 200 μl of a 1 M imidazole solution was added thereto. Only the quantum dots were isolated. Using a magnet, the probe except for the quantum dots was collected on one side, and the quantum dot solution floating in the supernatant was placed in a 96-well and the fluorescence intensity was measured with a microplate reader (manufacturer: TECAN, model: Infinite F200).

As a result, as shown in FIG. 6C, it was confirmed that the intensity of the fluorescence becomes stronger as the concentration of the biomarker becomes higher, and can be easily separated by the magnet. Therefore, the composition for detecting biomarkers of the present invention has proved that biomarkers can be detected and detected accurately according to their concentrations.

Example  4: Biomarker  Detection composition Biomarker  detach

A biomarker detected by a sandwich of a target-specific probe and a labeling substance-antibody complex was collected by using a magnet in a solution in which the biomarker was detected, and then the intensity of fluorescence was measured by irradiating it with ultraviolet light.

As can be seen from FIG. 6C, the biomarkers detected by the sandwich of the target-specific probe and the labeling substance-antibody complex by the magnetic force are effectively collected to show a band shape in which the intensity of fluorescence is more clearly distinguished, It was confirmed that the marker detection result is more effective.

Example  5: Biomarker Diagnostic Kit  Detection using

In the present invention, it was confirmed that a biomarker can be quantitatively analyzed by measuring the fluorescence intensity of a quantum dot by sandwiching the biomarker using nanoprobes and quantum dots combined with ferritin and superparamagnetic nanoparticles, A prototype quantitative analysis kit was developed. As shown in FIG. 8, the diagnostic kit of the present invention is a kit for detecting the target-specific probe of the present invention in a solution (A of FIG. 8), a quantitative analysis solution containing the labeling substance- antibody complex of the present invention ), A reaction vessel (C in Fig. 8), and a magnet for magnetic particle separation (Fig. 8D).

 The biomarker diagnostic kit was used in the following manner. First, 100 μl of the target-specific probe obtained in Example 2-2 was placed in a reaction vessel. Next, 10 μl of a biomarker (HBs) sample to be quantitatively diagnosed was placed in a reaction vessel and reacted for 1 hour. Then, 100 μl of the solution for quantitative analysis was added, and the reaction was allowed to proceed at room temperature for 1 hour.

The magnet for magnetic particle separation was brought close to the reaction vessel, and the target-specific probe and the labeling material-antibody complex in which the biomarker was sandwicely targeted by magnetic separation were separated, and then the excess solution was removed.

Biomarkers were quantitatively analyzed by measuring fluorescence intensity values using a fluorescence measurement device and comparing them with a given standard curve.

<110> KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY <120> COMPOSITION FOR DETECTING BIOMAKER COMPRISING TARGET-SPECIFIC          PROBE AND DETECTABLE LABELING AGENT-ANTIBODY COMPOSITE AND USING          METHOD OF THE SAME <130> DPP20135768KR <160> 5 <170> Kopatentin 1.71 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer 1 for connecting protein G gene <400> 1 catatgacga ccgcgtccac ctcg 24 <210> 2 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer 2 for connecting protein G gene <400> 2 actgccacct ccagtaccgc ctccgctttc attatcactg tc 42 <210> 3 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer 3 for connecting protein G gene <400> 3 ggatcctcca ccgcttccac cgcctgttcc accgccactg ccacctccag tacc 54 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer 4 for connecting protein G gene <400> 4 ggatccactt acaaattaat cctt 24 <210> 5 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer 5 for connecting protein G gene <400> 5 ctcgagatta gtgatggtga tggtgatgtt cagttaccgt aaaggt 46

Claims (22)

Ferritin protein,
Superparamagnetic nanoparticles bound to the ferritin protein, and
And a targeting antibody bound to the surface of said superpowder nanoparticles.
The method according to claim 1, further comprising a first linker positioned between the ferritin protein and the superpowder nanoparticles,
Wherein the linker is a protein or peptide that is linked to the C-terminal or N-terminus of the ferritin protein and does not inhibit the ferritin structure formation of the ferritin protein.
3. The target-specific probe according to claim 2, wherein the ferritin protein and the linker are composed of one fusion protein.
The method of claim 1, wherein the ratio of the ferritin protein, the supernatant nanoparticles, and the targeting antibody in the target-specific probe is from 1: 1: 1 to 1: 6: 6,
The target-specific superparamagnetic probe according to claim 1, wherein the super-magnetic nanoparticle comprises at least one selected from the group consisting of Fe (III), Mg, Mn, Ni, Zn and Co.
The target-specific superparamagnetic probe according to claim 1, wherein the super-magnetic nanoparticle comprises a surface layer comprising an amphiphilic substance having a hydrophilic group and a hydrophobic group.
7. The method of claim 6, wherein the amphiphile is selected from the group consisting of 1-Myristoyl-2-Hydroxy-sn-Glycero-3-phosphocholine ( MHPC), 1,2-distyroyl-ene-glycero-3-phosphoethanolamine-ene-methoxypolyethylene glycol-2000 (1,2-Distearoyl- sn-Glycero-3-Phosphoethanolamine- Methoxy polyethylene glycol) -2000 (DPPE-PEG2000) and 1,2-dioleyl-ene-glycero-3-ene-5-amino-1-phenylpentyliminodiacetic acid succinyl- 2-dioleoyl-snglycero-3-N- {5-amino-1-carboxypentyl} iminodiacetic acid succinyl nickel salt (Ni-NTA).
2. The method of claim 1, further comprising a second linker positioned between the superpowder nanoparticle and the targeting antibody, wherein the second linker binds to a portion of the surface of the superpowder nanoparticle not connected to the ferritin protein A target-specific superparamagnetic probe.
9. A composition according to any one of claims 2, 3 and 8, wherein the linker is selected from the group consisting of protein G, protein A, protein A / G, Fc receptor, biotin, avidin, histidine, Ni-NTA, or streptavidin / RTI &gt; probe selected from the group consisting of: &lt; RTI ID = 0.0 &gt;
A target-specific superparamagnetic probe according to any one of claims 1 to 8 and
Antibody complex comprising a detection antibody coupled to a detectable labeling agent. &Lt; RTI ID = 0.0 &gt;
Compositions for detecting biomarkers.
11. The composition of claim 10, wherein the targeting antibody and the detection antibody bind to different portions of the same biomarker.
11. The method of claim 10, further comprising a third linker located between the detectable labeling substance and the detection antibody,
Wherein the linker is at least one selected from the group consisting of protein G, protein A, protein A / G, Fc receptor, biotin, avidin, histidine, Ni-NTA, and streptavidin.
11. The composition of claim 10, wherein the detectable labeling material is a quantum dot, a magnetic bead nanoparticle, a gold nanoparticle, a fluorescent dye, a fluorescent protein, a nanophosphor, or a silicon nanoparticle.
14. The composition for detecting biomarkers according to claim 13, wherein the quantum dots include a hydrophilic surface layer containing an amphiphilic substance having a hydrophilic group and a hydrophobic group.
15. The composition according to claim 14, wherein the amphipat is at least one selected from the group consisting of MHPC, DPPE-PEG2000, Ni-NTA and mixtures thereof.
Mixing the composition for detecting a biomarker according to claim 10, and
And detecting the labeling substance of the labeling substance-antibody complex targeted to the biomarker.
17. The method of claim 16,
Mixing the target-specific probe with a sample containing a biomarker,
Adding the label substance-antibody complex, and
And applying a magnetic field to the mixture to separate the biomarker.
17. The method of claim 16, wherein the concentration ratio of the target-specific probe and the labeling material-antibody complex is from 1: 1 to 1: 5.
17. The method of claim 16, further comprising determining that a biomarker is present in the sample when the labeling material is detected.
17. The method of claim 16, wherein the labeling substance is measured by comparing absorbance or fluorescence intensity of a labeled substance included in the labeled substance-antibody complex targeted to the biomarker by comparing the standard curve prepared by measuring the absorbance or fluorescence intensity at various concentrations Thereby quantifying the biomarker in the sample. &Lt; Desc / Clms Page number 19 &gt;
17. The method of detecting a biomarker according to claim 16, wherein the detecting step detects fluorescence intensity emitted from quantum dots as a labeling substance.
A diagnostic kit for a biomarker comprising the composition for detecting a biomarker according to claim 10 and a detector for detecting a labeling substance contained in the biomarker detection composition.

Images