KR20150085691A - Cosmetic or pharmaceutical composition for promoting hair growth containing breviscapin - Google Patents

Cosmetic or pharmaceutical composition for promoting hair growth containing breviscapin Download PDF

Info

Publication number
KR20150085691A
KR20150085691A KR1020140005651A KR20140005651A KR20150085691A KR 20150085691 A KR20150085691 A KR 20150085691A KR 1020140005651 A KR1020140005651 A KR 1020140005651A KR 20140005651 A KR20140005651 A KR 20140005651A KR 20150085691 A KR20150085691 A KR 20150085691A
Authority
KR
South Korea
Prior art keywords
hair
composition
hair growth
present
pharmaceutically acceptable
Prior art date
Application number
KR1020140005651A
Other languages
Korean (ko)
Other versions
KR101593628B1 (en
Inventor
이슬기
조호성
이상화
Original Assignee
주식회사 엘지생활건강
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 엘지생활건강 filed Critical 주식회사 엘지생활건강
Priority to KR1020140005651A priority Critical patent/KR101593628B1/en
Publication of KR20150085691A publication Critical patent/KR20150085691A/en
Application granted granted Critical
Publication of KR101593628B1 publication Critical patent/KR101593628B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/49Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q7/00Preparations for affecting hair growth

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Dermatology (AREA)
  • Cosmetics (AREA)

Abstract

Provided in the present invention is a cosmetic or pharmaceutical composition preventing hair loss, growing hair, or promoting hair growth including a compound of chemical formula 1 or a pharmaceutically acceptable salt of the same. The cosmetic or pharmaceutical composition of the present invention has less side effects thereby having excellent hair growth or hair growth promotion effect while being safe to a human body.

Description

브레비스카핀을 포함하는 모발 성장 촉진용 화장료 또는 약학 조성물{Cosmetic or pharmaceutical composition for promoting hair growth containing breviscapin}[0001] The present invention relates to a cosmetic or pharmaceutical composition for promoting hair growth comprising Breviscapin,

본 발명은 모발 성장 촉진을 위한 조성물에 관한 것으로, 모발의 신규성장 또는 성장 촉진을 유도하는 성분을 함유하는 모발 성장 촉진을 위한 화장료 또는 약학 조성물에 관한 것이다. The present invention relates to a composition for promoting hair growth, and more particularly, to a cosmetic or pharmaceutical composition for promoting hair growth containing a component that induces new growth or promotion of hair growth.

시대가 변하면서 미용에 대한 관심이 날로 높아가는 과정에 모발은 중요한 한 부분을 차지하고 있다. 모발은 피부 표면에서 생산된 가늘고 각질화된 구조다. 이것은 외부충격에 대한 쿠션 역할과 더불어 직사광선, 한냉, 마찰, 위험 등 외부 자극으로부터 인체를 보호하고 신체에 유해한 비소, 수은, 아연 등의 중금속이 체외로 배출되는 기능을 하며 현대에 와서는 장식의 미용 측면도 강조되고 있다. Hair is an important part of the process of increasing interest in beauty as the age changes. Hair is a thin, exfoliated structure produced from the surface of the skin. It acts as a cushion against external impact, protects the human body from external stimuli such as direct sunlight, cold, friction, danger, and discharges the heavy metals such as arsenic, mercury and zinc harmful to the body to the outside of the body. The side is also being emphasized.

그러나 식생활 변화나 내외적 스트레스 증가를 비롯하여 여러 원인에 의해 탈모를 호소하는 사람들이 늘어나고 있다.However, many people are complaining of hair loss due to various causes, including dietary changes and increased internal and external stress.

사람의 모발은 약 10만-15만개 정도이며, 각각의 모발은 서로 다른 성장주기를 가진다. 모발성장주기는 3단계로 구성되는데, 모발이 가장 활발하게 성장하는 성장기(anagen stage), 모발의 퇴화가 시작되는 퇴화기(catagen stage) 및 모발의 성장이 멈추거나 휴식에 접어드는 휴지기(telogen stage)로 분류된다. Human hair has about 100,000 to 150,000 hairs, and each hair has a different growth period. The hair growth cycle consists of three stages: the anagen stage where hair grows most actively, the catagen stage where hair starts to degenerate, and the telogen stage where hair growth stops or rests. .

일반적으로 탈모증이라 함은 이러한 주기 중에서 성장기의 모발 비율이 짧아지고 퇴행기 또는 휴지기의 모발이 많아져 비정상적으로 모발이 탈락하는 숫자가 많아지는 것을 일컫는다.In general, alopecia refers to an increase in the number of abnormal hair loss due to shortening of hair growth rate in the growing period and increased number of hair in the retrogressive or resting period among these cycles.

모낭의 사멸과 탈락에는 남성호르몬이 매우 중요하게 작용하고 있는데 남성호르몬에 의해 모낭에서 발현되는 인자들 중, DKK-1(Dickkopf-related protein 1)은 모낭성장 저해와 사멸에 중요한 역할을 한다. Male hormones play an important role in the death and elimination of hair follicles. DKK-1 (Dickkopf-related protein 1) plays an important role in hair follicle growth inhibition and death, among the factors expressed in hair follicles by male hormone.

한편, 주기적인 모발성장을 위해선 모낭의 재생과 줄기세포의 활성화가 이루어져야 하며 이는 Wnt/β-카테닌(catenin)의 생성, 활성화에 의해 이루어지는 것으로 알려져 있다. 또한, 앞서 언급된 DKK-1은 Wnt/β-catenin의 길항제로 알려져 있어 모발성장을 조절하는데 있어 상기의 신호체계가 매우 중요함을 알 수 있다.On the other hand, for periodic hair growth, hair follicle regeneration and stem cell activation must be performed, which is known to be caused by the production and activation of Wnt / β-catenin. In addition, DKK-1 mentioned above is known to be an antagonist of Wnt / [beta] -catenin, so that the above signal system is very important for controlling hair growth.

현재까지 개발된 탈모증의 치료 또는 예방용 제제로는 혈행 촉진, 모근 기능 강화, 두피보습 및 남성호르몬 억제를 위한 여성호르몬을 주성분으로 한 제제나 미녹시딜(minoxidil), 피나스트라이드(finasteride), 트리코사카라이드(trichosaccharide) 등을 함유한 제제 등이 있지만, 성기능장애, 기형아 출산 가능성, 전신 발모 등의 부작용으로 인하여 사용에 많은 제약이 있다.The herbal remedy for the treatment or prevention of alopecia that has been developed so far includes female hormone-based preparations such as minoxidil, finasteride, tricosaccharide, etc. for promoting blood circulation, enhancing hair follicle function, scalp moisturizing and male hormone suppression, (trichosaccharide), etc., but there are many limitations in use due to adverse effects such as sexual dysfunction, possibility of birth of deformed baby, and general hair growth.

따라서 본 발명은 위와 같은 문제점을 해결하고, 부작용이 적고 인체에 안전하면서도 모발성장 또는 발모 촉진에 효과적으로 작용할 수 있는 새로운 활성 성분, 즉 활성 성분의 새로운 유용한 용도를 제공하고자 한다. Accordingly, the present invention aims to solve the above-mentioned problems, and to provide a new useful use of a new active ingredient, i.e., an active ingredient, which is less harmful to the human body and can act effectively for promoting hair growth or hair growth.

다시 말해, 본 발명이 해결하고자 하는 과제는 상기 효능이 우수한 활성 성분을 유효성분으로 포함하는 조성물을 제공하고자 한다. In other words, a problem to be solved by the present invention is to provide a composition comprising the active ingredient having excellent efficacy as an active ingredient.

상기 과제를 해결하기 위하여, 본 발명은 하기 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 모발 성장 또는 발모 촉진을 위한 조성물, 바람직하게는 화장료 조성물 또는 약학 조성물을 제공한다. In order to solve the above problems, the present invention provides a composition for accelerating hair growth or hair growth, preferably a cosmetic composition or a pharmaceutical composition comprising a compound represented by the following formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient do.

[화학식 1][Chemical Formula 1]

Figure pat00001
Figure pat00001

즉, 본 발명은 상기 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염의 모발 성장 또는 발모 촉진용이라는 새로운 용도를 제공한다. That is, the present invention provides a new use for promoting hair growth or hair growth of the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.

본 발명의 발명자들은 상기 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염이 Wnt/β-catenin signal pathway 활성화에 영향을 미친다는 사실을 실험을 통하여 확인하였다.The inventors of the present invention have confirmed through experiments that the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof affects the activation of the Wnt / β-catenin signal pathway.

또한 본 발명의 조성물은 모낭성장 저해와 사멸에 중요한 역할을 하는 DKK-1 유전자 발현을 감소시킬 수 있다.In addition, the composition of the present invention can reduce the expression of DKK-1 gene, which plays an important role in hair follicle growth inhibition and death.

또한 본 발명의 상기 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염이 포함된 조성물은 Wnt/β-catenin 신호 전달 체계를 활성화시켜 멜라닌의 생성을 유도할 수 있으며, 흉터 개선에 효과를 나타낼 수 있다. In addition, the composition of the present invention represented by Formula 1 or a pharmaceutically acceptable salt thereof can induce the production of melanin by activating the Wnt / β-catenin signaling system, .

본 발명의 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염이 포함된 조성물은 멜라닌 생성을 유도하여 백모, 백반증 등을 예방, 완화 또는 개선할 수 있다. The composition containing the compound represented by the formula (1) of the present invention or a pharmaceutically acceptable salt thereof may induce melanin production to prevent, alleviate or ameliorate white moth, vitiligo and the like.

본 명세서에서 사용된 용어 "백반증"은 멜라닌 세포의 파괴로 인하여 피부에 백색 반점이 나타나는 탈색소성 질환을 의미하며, "백모(白毛)"는 머리카락이 하얗게 변화하는 것으로, 노화의 진행으로 나타나는 것이 대부분이나 이러한 원인에 한정되지 않는다.As used herein, the term " vitiligo "means a decolorizing disease in which white spots appear on the skin due to the destruction of melanocytes, and" white hair "means that the hair turns white, Most are not limited to these causes.

본 발명의 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염이 포함된 조성물은 화상이나 여드름 등의 흉터 개선에 우수한 효과를 나타낼 수 있다. The composition containing the compound represented by the formula (1) of the present invention or a pharmaceutically acceptable salt thereof can exert an excellent effect for improving scars such as burns and acne.

본 발명에 있어서, "탈모 방지"라 함은 모낭 또는 두피에서 모발이 탈락되는 현상이 저지되거나 약화되는 것을 의미한다.In the present invention, "hair loss prevention" means that the phenomenon of hair falling off the hair follicle or scalp is inhibited or weakened.

본 발명에 있어서, "모발 성장"이라 함은 생성된 모발(머리카락)의 굵기가 증가되거나 길이 자람 속도에 영향을 미치는 것을 의미한다. In the present invention, the term "hair growth" means that the thickness of the hair (hair) generated increases or affects the speed of growth of the hair.

본 발명에서 "발모 촉진"이라 함은 모발이 생성되는 것을 의미하며, 모발 생성 속도 및 생성량을 증가시키는 넓은 의미로 사용된다. 또한 모근 기능이 강화되거나, 모발의 탈락 및 생성 주기가 짧아져 모낭에서 자라는 모발의 수가 증가되는 것을 의미한다. In the present invention, the term " promoting hair growth "means that hair is produced, and is used in a broad sense to increase the hair generation rate and production amount. It also means that the hair follicle function is strengthened, the hair dropping and generation cycle is shortened, and the number of hairs growing in the hair follicle is increased.

상기 화학식 1로 대표되는 화합물은 4H-1-benzopyran-4-one, 7-(beta-D-glucopyranuronosyloxy)-5,6-dihydroxy-2-(4-hydroxyphenyl)-; 5,6-Dihydroxy-2-(4-hydroxyphenyl)-4-oxo-4H-chromen-7-yl beta-D-glucopyranosiduronic acid 라 하며, 일명 브레비스카핀(breviscapin)이라 한다. 본 발명은 상기 브레비스카핀의 획득 방법에 특별히 한정되지 않으며, 당 업계에 공지된 방법으로 화학적으로 합성하거나 시판되는 물질을 사용할 수 있다. The compound represented by Formula 1 is 4H-1-benzopyran-4-one, 7- (beta-D-glucopyranuronosyloxy) -5,6-dihydroxy-2- (4-hydroxyphenyl) -; It is called breviscapin and is called 5,6-Dihydroxy-2- (4-hydroxyphenyl) -4-oxo-4H-chromen-7-yl beta-D-glucopyranosiduronic acid. The present invention is not particularly limited to the method for obtaining Breviscaffin, and chemically synthesized or commercially available materials can be used by methods known in the art.

본 발명의 "약학적으로 허용 가능한 염"은 유기산 또는 무기산을 이용하여 형성된 산 부가염일 수 있으며, 상기 유기산은, 예를 들면 포름산, 아세트산, 프로피온산, 락트산, 부티르산, 이소부티르산, 트리플루오로아세트산, 말산, 말레산, 말론산, 푸마르산, 숙신산, 숙신산 모노아미드, 글루탐산, 타르타르산, 옥살산, 시트르산, 글리콜산, 글루쿠론산, 아스코르브산, 벤조산, 프탈산, 살리실산, 안트라닐산, 디클로로아세트산, 아미노옥시 아세트산, 벤젠술폰산, p-톨루엔술폰산 및 메탄술폰산계 염을 포함하며 무기산은 예를 들면 염산, 브롬산, 황산, 인산, 질산, 탄산 및 붕산계 염을 포함한다. 바람직하게는 염산염 또는 아세트산염 형태일 수 있으며, 보다 바람직하게는 염산염 형태일 수 있다. The "pharmaceutically acceptable salt" of the present invention may be an acid addition salt formed using an organic acid or inorganic acid, and the organic acid may be, for example, formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, trifluoroacetic acid, The present invention also relates to the use of a compound selected from the group consisting of malic acid, maleic acid, malonic acid, fumaric acid, succinic acid, succinic acid monoamide, glutamic acid, tartaric acid, oxalic acid, citric acid, glycolic acid, gluconic acid, ascorbic acid, benzoic acid, phthalic acid, salicylic acid, anthranilic acid, Benzenesulfonic acid, p-toluenesulfonic acid and methanesulfonic acid-based salts, and inorganic acids include, for example, hydrochloric acid, bromic acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid and boric acid-based salts. Preferably in the hydrochloride or acetate form, more preferably in the hydrochloride form.

상기 언급된 산 부가염은 a) 상기 화학식 1의 화합물 및 산을 직접 혼합하거나, b) 이들 중 한 가지를 용매 또는 함수 용매 중에 용해시키고 혼합시키거나, 또는 c) 화학식 1의 화합물을 용매 또는 수하 용매 중의 산에 위치시키고 이들을 혼합하는 일반적인 염 제조방법으로 제조된다. The above-mentioned acid addition salts may be obtained by a) directly mixing the compound of formula 1 and an acid, or b) dissolving and mixing one of them in a solvent or a water solvent, or c) Lt; RTI ID = 0.0 > acid < / RTI > in a solvent and mixing them.

본 발명은 상기 화학식 1의 화합물, 이의 유도체 및 이의 약학적으로 허용가능한 염뿐 아니라 이로부터 제조될 수 있는 가능한 용매화물, 수화물 및 입체이성질체도 모두 발명의 범주 내로 포함할 수 있다.The present invention includes all of the solvates, hydrates and stereoisomers thereof, as well as the compounds of the above formula (I), derivatives thereof and pharmaceutically acceptable salts thereof, which may be prepared therefrom.

또한 본 발명의 브레비스카핀은 수화물, 에탄올화물 등의 형태를 포함하는 용매화된 형태뿐만 아니라 비-용매화된(unsolvated) 형태로 존재할 수도 있다. 본 발명의 브레비스카핀은 결정형 또는 무정형 형태로 존재할 수 있으며, 이러한 모든 물리적 형태는 본 발명의 범위에 포함된다.In addition, the present breviscope may be present in unsolvated form as well as solvated form including form of hydrate, ethanol, and the like. Breviscaffin of the present invention may exist in crystalline or amorphous form, and all such physical forms are included within the scope of the present invention.

또한, 본 발명의 상기 화학식 1의 화합물을 의약품으로 사용하는 경우, 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다. 예컨대, 공지의 모발 성장 촉진 또는 발모 촉진 성분을 포함할 수 있을 것이다. 이 경우 본 발명의 조성물의 모발 성장 촉진 또는 발모 촉진 효과는 더욱 증진될 수 있을 것이다. 상기 성분 추가 시에는 복합 사용에 따른 피부 안전성, 제형화의 용이성, 유효성분들의 안정성을 고려할 수 있다. When the compound of Chemical Formula 1 of the present invention is used as a medicine, it may further contain one or more active ingredients showing the same or similar functions. For example, a known hair growth promoting or hair growth promoting component may be included. In this case, the effect of promoting hair growth or promoting hair growth of the composition of the present invention may be further enhanced. When the above ingredients are added, skin safety, easiness of formulation, and stability of effective ingredients can be considered according to the combined use.

또한, 본 발명의 탈모 방지, 모발 성장 또는 발모 촉진용 약학 조성물 조성물은 약학적으로 허용 가능한 담체를 더 포함할 수 있다.In addition, the pharmaceutical composition composition for preventing hair loss, promoting hair growth or hair growth of the present invention may further comprise a pharmaceutically acceptable carrier.

본 발명의 용어 "약학적으로 허용 가능한"은 생리학적으로 허용가능하며 전형적으로 인간에게 투여되었을 때 예상 밖의 반응을 일으키지 않는 조성물 및 분자들을 의미한다. 바람직하게, 여기서 사용되는 바와 같이, 상기 용어 "약학적으로 허용가능한"은 포유동물 및 특히 인간에의 사용에 관해 다른 일반적으로 알려진 약전에 의해 승인되는 것을 의미한다.The term "pharmaceutically acceptable" of the present invention refers to compositions and molecules that are physiologically acceptable and typically do not cause unexpected reactions when administered to humans. Preferably, as used herein, the term " pharmaceutically acceptable "means that it is approved by other commonly known pharmacopoeias for use in mammals and especially humans.

약학적으로 허용되는 담체는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등과 같은 여러 성분을 함유할 수 있다.Pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose , Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil, and the like.

본 발명의 약학적 조성물은 비경구로 투여할 수 있으며, 일반 의약품 제제의 형태, 예를 들어, 임상 투여 시 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다.The pharmaceutical composition of the present invention can be administered parenterally, and can be administered in the form of a general pharmaceutical preparation, for example, various forms of parenteral administration at the time of clinical administration. In the case of formulation, the filler, , A wetting agent, a disintegrant, a surfactant, and the like.

비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 또는 동결건조제제가 포함된다. 비수성용제, 현탁용제로는 프로필렌 글리콜(Propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, or lyophilisers. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent.

본 발명의 약학적 조성물은 유효량의 상기 화학식 1의 화합물을 포함할 때 바람직한 모발 성장 효과 또는 발모 촉진 효과를 제공할 수 있다. 본 발명에 있어서, 유효량이라 함은 모발 성장 촉진 효과, 발모 효과 또는 탈모 방지 효과를 나타낼 수 있는 화합물의 양을 의미한다. 본 발명의 조성물에 포함되는 상기 화학식 1의 화합물의 유효량은 조성물이 제품화되는 형태, 상기 화합물이 피부에 적용되는 방법 및 피부에 머무르는 시간 등에 따라 달라질 것이다. 예컨대, 상기 조성물이 의약품으로 제품화되는 경우에는 일상적으로 피부에 적용하게 되는 샴푸, 헤어 컨디셔너, 헤어팩 등의 제품으로 제품화되는 경우에 비해 높은 농도로 상기 화학식 1의 화합물을 포함할 수 있을 것이다. 따라서, 일일 투여량은 상기 화학식 1의 화합물의 양을 기준으로 0.1 내지 100 ㎎/㎏이고, 바람직하게는 1 내지 50 ㎎/㎏이고, 더욱 바람직하게는 5 내지 20 mg/kg이며, 하루 1 ∼ 6 회 투여될 수 있다. The pharmaceutical composition of the present invention can provide a desirable hair growth effect or hair growth promoting effect when an effective amount of the compound of Formula 1 is included. In the present invention, the effective amount means the amount of the compound capable of exhibiting hair growth promoting effect, hair growth effect or hair loss prevention effect. An effective amount of the compound of formula (1) contained in the composition of the present invention will vary depending on the form in which the composition is commercialized, how the compound is applied to the skin, and the time on the skin. For example, when the composition is commercialized as a medicine, the composition of the present invention may contain the compound of formula (1) at a higher concentration than a product such as a shampoo, a hair conditioner, and a hair pack that is routinely applied to skin. Therefore, the daily dosage is 0.1 to 100 mg / kg, preferably 1 to 50 mg / kg, more preferably 5 to 20 mg / kg, based on the amount of the compound of formula (1) 6 times a day.

본 발명의 약학적 조성물은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응조절제를 사용하는 방법들과 병용하여 사용할 수 있다.The pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

본 발명은 또한 상기 화학식 1의 화합물을 유효성분으로 포함하는 모발 성장 또는 발모 촉진을 위한 피부 외용제의 제형으로 제공할 수 있다.The present invention can also provide a formulation for external skin preparation for promoting hair growth or hair growth comprising the compound of formula (1) as an active ingredient.

상기 화학식 1의 화합물을 피부외용제로 사용하는 경우, 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 또는 친유성 활성제, 지질 소낭 또는 피부용 외용제에 통상적으로 사용되는 임의의 다른 성분과 같은 피부 과학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있다. 또한 상기 성분들은 피부 과학 분야에서 일반적으로 사용되는 양으로 도입될 수 있다. When the compound of formula (1) is used as an external preparation for skin, it may further comprise at least one selected from the group consisting of fatty substances, organic solvents, solubilizers, thickeners and gelling agents, softeners, antioxidants, suspending agents, stabilizers, foaming agents, , Water, ionic or nonionic emulsifiers, fillers, sequestering agents and chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or external preparations for skin And any other ingredients used in the skin sciences. The components can also be introduced in amounts commonly used in the field of dermatology.

상기 화학식 1의 화합물이 피부 외용제 제형으로 제공될 경우, 이에 제한되는 것은 아니나, 겔, 크림, 패치 또는 분무제와 같이 모발에 적용이 가능한 제형을 가질 수 있다.When the compound of Formula 1 is provided as an external preparation for skin, it may have a formulation that is applicable to hair, such as, but not limited to, gel, cream, patch, or spray.

본 발명은 또한 상기 화학식 1의 화합물을 유효성분으로 포함하는 모발 성장 촉진을 위한 화장료 조성물의 제형으로 제공할 수 있다.The present invention can also provide a cosmetic composition for promoting hair growth comprising the compound of Formula 1 as an active ingredient.

상기 화학식 1의 화합물을 화장품으로 사용하는 경우, 상기 화학식 1의 화합물을 유효성분으로 함유하여 제조되는 화장품은 일반적인 유화 제형 및 가용화 제형의 형태로 제조할 수 있다. 예컨대, 스프레이, 헤어젤, 헤어팩, 샴푸, 헤어컨디셔너, 헤어로션, 헤어에센스, 패취 또는 분무제 등과 같은 제형을 가질 수 있다. When the compound of Chemical Formula 1 is used as a cosmetic, the cosmetic product containing the compound of Chemical Formula 1 as an active ingredient may be prepared in the form of a general emulsified formulation and a solubilized formulation. For example, they may have formulations such as sprays, hair gels, hair packs, shampoos, hair conditioners, hair lotions, hair essences, patches or sprays.

또한, 상기 화장품은 상기 화학식 1의 화합물에 추가로 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 친수성 또는 친유성 활성제, 지질 소낭 또는 화장품에 통상적으로 사용되는 임의의 다른 성분과 같은 화장품학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있다.The cosmetic composition may further contain, in addition to the compound of Formula 1, a lipid, an organic solvent, a solubilizing agent, a thickening agent and a gelling agent, a softening agent, an antioxidant, a suspending agent, a stabilizer, a foaming agent, a fragrance, , Ionic or nonionic emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, barrier agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or cosmetics And may contain adjuvants commonly used in the cosmetics field, such as any of the other ingredients.

바람직하게 본 발명의 조성물은 액상, 크림상, 페이스트상, 또는 고체상 등 두피에 적용시킬 수 있는 모든 제형으로 제조할 수 있고, 통상의 첨가제를 가하여 모발 성장 촉진을 위한 샴푸, 헤어컨디셔너, 헤어로션, 액상의 발모제 타입 등의 조성물로 제조될 수 있으며, 여기에는 이들 제형의 에어졸 타입도 포함된다.Preferably, the composition of the present invention can be prepared in any form that can be applied to the scalp, such as liquid, cream, paste, or solid, and can be prepared by adding ordinary additives such as shampoo, hair conditioner, hair lotion, Liquid type hair growth type, and the like, including aerosol types of these formulations.

본 발명의 조성물은 상기 화학식 1의 화합물 또는 이의 약학적으로 허용 가능한 염을 전체 조성물 총 중량 대비 0.001 내지 10 중량% 포함하며, 바람직하게는 0.005 내지 5 중량%, 더욱 바람직하게는 0.01 내지 3 중량% 포함할 수 있다. The composition of the present invention contains 0.001 to 10% by weight, preferably 0.005 to 5% by weight, more preferably 0.01 to 3% by weight, of the compound of Formula 1 or a pharmaceutically acceptable salt thereof, .

상기 화학식 1의 화합물의 함량이 0.001 중량% 미만일 경우, 모발 성장기 유도 촉진 효과가 만족스럽지 않을 수 있으며, 10 중량%를 초과하는 경우 용량에 비해서 작용 효과가 충분하게 나타나지 않아 바람직하지 않을 수 있다. If the content of the compound of formula (1) is less than 0.001% by weight, the effect of promoting induction of hair growth may not be satisfactory, and if it exceeds 10% by weight, the effect may not be sufficiently exhibited.

본 발명의 브레비스카핀 또는 이의 약학적으로 허용 가능한 염을 함유하는 조성물은 모발 성장 촉진 효과를 나타낸다. The composition containing the breviscapine of the present invention or a pharmaceutically acceptable salt thereof exhibits hair growth promoting effect.

또한 발모 촉진 효과를 나타낼 뿐만 아니라, 탈모 방지에도 우수한 효과를 나타낸다. In addition, it exhibits an effect of promoting hair growth as well as an effect of preventing hair loss.

본 발명의 브레비스카핀 또는 이의 약학적으로 허용 가능한 염을 함유하는 조성물은 안전하면서도 우수한 화장품 원료, 약학 성분으로 이용될 수 있다. The composition containing the breviscapine of the present invention or a pharmaceutically acceptable salt thereof can be used as safe and excellent cosmetic ingredients and pharmaceutical ingredients.

그리고 본 발명의 조성물은 종래 탈모치료제의 부작용 등이 없고 인체에 안전하면서도 우수한 발모 또는 탈모방지 효과를 제공한다.In addition, the composition of the present invention is free from side effects of conventional hair loss treatment agents and provides a superior hair growth or hair loss prevention effect while being safe for human body.

도 1은 브레비스카핀, 디하이드로테스토스테론 및 이들을 함께 처리할 때 DKK-1 발현의 정도를 나타낸 그래프이다. 도 1에 나타난 결과에 따르면 브레비스카핀의 처리는 디하이드로테스토스테론 처리에 의해 증가된 DKK-1 발현을 감소시키는 효과가 있는 것을 알 수 있다.Figure 1 is a graph showing the degree of DKK-1 expression when treated with Breviscapine, dihydrotestosterone and their combination. According to the results shown in Fig. 1, treatment of Breviscapin has an effect of decreasing DKK-1 expression, which is increased by dihydrotestosterone treatment.

이하, 본 발명을 보다 구체적으로 설명하기 위하여 하기 실시예 등을 들어 설명한다. 그러나, 본 발명에 따른 실시예들은 여러 가지 다른 형태로 변형될 수 있으며 본 발명의 범위가 아래에서 상술하는 실시예들에 한정되는 것으로 해석되어서는 안 된다. 본 발명의 실시예들은 본 발명의 구체적 이해를 돕기 위해 예시적으로 제공되는 것이다.
Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the above-described embodiments. The embodiments of the present invention are provided by way of example to facilitate a specific understanding of the present invention.

본 발명의 브레비스카핀은 Xi'an Guanyu Bio-tech Co., Ltd(西安冠宇生物技術有限公司)에서 구입하였다.
Breviscaffin of the present invention was purchased from Xi'an Guanyu Bio-tech Co., Ltd.

<< 실시예Example 1>  1> 브레비스카핀의Brevis Kaffin 세포독성 평가  Cytotoxicity Assessment

본 실시예에서 브레비스카핀의 세포독성 평가를 위해 Follicle Dermal Papilla(Promocell, 독일)의 세포분열 변화를 Cell Counting Kit-8(Dojindo Lab, 미국)을 사용하여 측정하였다. In this example, cell division of Follicle Dermal Papilla (Promocell, Germany) was measured using Cell Counting Kit-8 (Dojindo Lab, USA) for the evaluation of the cytotoxicity of Breviscaffin.

먼저, 균일한 수의 세포를 96 well plate에 깔아준 뒤 안정화 시킨 후 브레비스카핀을 10, 20 ug/ml이 되도록 처리한 후 48시간 동안 추가배양 하였다. 이후 CCK-8을 처리하여 2시간 뒤 450nm에서 흡광도를 측정하였다. 무처리 대비 브레비스카핀을 처리한 세포의 상대적인 세포 생존율을 아래와 같이 분석, 그 결과를 하기 표 1 에 나타내었다. First, a uniform number of cells were plated on a 96-well plate and stabilized, followed by treatment with 10 or 20 μg / ml of Breviscapine and further incubation for 48 hours. Thereafter, CCK-8 was treated and the absorbance was measured at 450 nm for 2 hours. The relative cell viability of cells treated with Breviscapin versus no treatment was analyzed as follows, and the results are shown in Table 1 below.

상대적인 세포 생존율 = (화합물 처리군)/(무처리군) X 100Relative cell viability = (compound treated group) / (untreated group) X 100

시료sample 무처리No treatment BIO
1uM
BIO
1uM
브레비스카핀
10ug/ml
Brevis Kaffin
10 [mu] g / ml
브레비스카핀
20ug/ml
Brevis Kaffin
20ug / ml
생존율(%)Survival rate (%) 100 100 103 103 103 103 102 102

상기 표 1 에서와 같이, 브레비스카핀 처리에 의해 세포의 수가 크게 변화하지 않는 것을 알 수 있다.
As shown in Table 1, it can be seen that the number of cells does not change greatly by treatment with Breviscapin.

<< 실시예Example 2>  2> 브레비스카핀의Brevis Kaffin WntWnt /β-/ β- catenincatenin signalsignal pathwaypathway 활성 효과 조사 Investigate the activity effect

브레비스카핀이 Wnt/β-catenin signal pathway 활성화에 미치는 영향을 조사하기 위해 TOPflash reporter(Millipore, 미국)를 이용하였다. 인간 모유두세포를 24 웰 플레이트에 2 x 105/웰로 접종하고 24시간 동안 배양한 다음 브레비스카핀을 10, 20 ug/ml이 되도록 처리한 후 15시간 동안 추가 배양하여 듀얼 루시퍼레이즈 어세이 키트(Promega, 미국)를 사용하여 파이어플라이 루시퍼레이즈 (firefly luciferase)활성을 측정하였다. To investigate the effect of Breviscapin on Wnt / β-catenin signal pathway activation, TOPflash reporter (Millipore, USA) was used. Human dermal papilla cells were inoculated in a 24-well plate at 2 x 10 &lt; 5 &gt; / well and cultured for 24 hours. Breviscaffin was treated to 10, 20 ug / ml and then further cultured for 15 hours to obtain a dual luciferase assay kit , USA) was used to measure the firefly luciferase activity.

루시퍼레이즈 활성을 정확하게 측정하기 위하여 각각의 시료에 대하여 3회 실시하였으며 대조군에 대한 상대적인 활성을 증가율(%)로 계산하고 하기 표 2에 나타내었다. 대조군은 무처리군이다. 양성대조군으로는 6-bromoindirubin-3'-oxime (BIO)를 사용했으며 Wnt 신호전달 체계에서 GSK-3를 억제하는 것으로 알려져 있는 물질이다. In order to accurately measure the activity of luciferase, the activity of each sample was measured three times, and the activity relative to the control group was calculated as an increase rate (%). The control group is untreated group. The positive control was 6-bromoindirubin-3'-oxime (BIO) and is known to inhibit GSK-3 in the Wnt signaling pathway.

시료sample 대조군Control group BIO
1uM
BIO
1uM
브레비스카핀
10ug/ml
Brevis Kaffin
10 [mu] g / ml
브레비스카핀
20ug/ml
Brevis Kaffin
20ug / ml
증가율(%)Growth rate (%) 100 100 152 152 130 130 176 176

상기 표 2에 나타나는 바와 같이, 본 발명에 브레비스카핀은 농도 의존적으로 TOPflash reporter 활성을 증가시켜 Wnt/β-catenin 신호전달에 대하여 선택적이며 우수한 활성능이 있음을 알 수 있었다. 해당 측정값은 firefly luciferase 수치를 renilla luciferase 수치로 보정해 주었다.
As shown in Table 2, in the present invention, it was found that Breviscaffin increased TOPflash reporter activity in a concentration-dependent manner and was selective for Wnt / β-catenin signaling and had excellent bowing performance. The measurements corrected firefly luciferase levels to renilla luciferase levels.

<< 실시예Example 3>  3> DHTDHT 에 의해 유도되는 Induced by DKKDKK -1 억제 효과 조사-1 inhibition effect investigation

Wnt/β-catenin의 활성화는 모발성장을 촉진하는 반면, 남성호르몬 또는 디하이드로테스토스테론(Dihydrotestosterone; WAKO, 일본)는 DKK-1 유전자의 발현촉진을 통하여 Wnt/β-catenin의 길항제로 작용한다. Activation of Wnt / β-catenin promotes hair growth while male hormone or dihydrotestosterone (WAKO, Japan) acts as an antagonist of Wnt / β-catenin through the promotion of DKK-1 gene expression.

따라서 브레비스카핀이 Wnt/β-catenin의 길항제인 DKK-1유전자를 억제하여 모발성장을 촉진할 수 있는지 알아보고자 인간 모유두세포에 브레비스카핀 20ug/ml과 디하이드로테스토스테론 100nM을 24시간 동안 함께 처리한 후, 하기 표 3의 프라이머(바이오니아, 한국)를 이용하여 DKK-1의 발현을 역전사 증폭기법(RT-PCR)으로 확인하였다. 이때 사용한 프라이머를 표 3에 나타내었다.To investigate whether Breviscapine inhibits DKK-1 gene, which is an antagonist of Wnt / β-catenin, hair growth can be promoted. Human dermal papilla cells were treated with 20 ug / ml of Breviscapine and 100 nM of dihydrotestosterone for 24 h , And the expression of DKK-1 was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) using primers (Bioneer, Korea) shown in Table 3 below. The primers used at this time are shown in Table 3.

서 열Standing column 정방향Forward TGATGAGTACTGCGCTAGTCTGATGAGTACTGCGCTAGTC 역방향Reverse CTCCTATGCTTGGTACACACCTCCTATGCTTGGTACACAC

실험결과, 브레비스카핀의 처리는 디하이드로테스토스테론 처리에 의해 증가된 DKK-1의 발현을 현저하게 감소시켰으며, 이를 통해 모발성장을 촉진할 수 있음을 알 수 있었다. 결과 분석은 Comparative CT(ΔΔCT) Experiment((Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods, 25, 402-408(2001))로 진행하였으며 internal control은 GAPDH를 사용하였고, 그 결과는 도 1에 나타내었다.
Experimental results showed that treatment with Breviscapin significantly reduced the expression of DKK-1 by dihydrotestosterone treatment, thereby promoting hair growth. The results were analyzed by using a comparative CT (ΔΔCT) Experiment (Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2-Delta Delta C (T) (2001)). Internal control was performed using GAPDH, and the results are shown in FIG.

이상과 같은 효과시험 결과를 근거로 하여, 본 발명에 따른 조성물의 여러 가지 제형 예를 구체적으로 설명한다. 단, 이들 제형 예는 본 발명 조성물의 예시일 뿐, 본 발명 조성물의 범위가 이들 제형만으로 한정되지 않는다는 것은 당 업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
Various formulation examples of the composition according to the present invention will be described in detail based on the above-mentioned effect test results. It should be apparent to those skilled in the art, however, that these formulation examples are merely examples of the composition of the present invention and that the composition of the present invention is not limited to these formulations only.

제형 1 : 발모용 조성물 1 (Formulation 1: Hairy composition 1 ( 헤어hair 토닉tonic ))

아래 처방에 따라 통상의 방법으로 헤어 토닉을 제조하였다.Hair tonics were prepared according to the following prescriptions in a conventional manner.

배합성분Compounding ingredient 중량비(%)Weight ratio (%) 에탄올ethanol 5555 피마자유Castor oil 55 글리세린glycerin 33 피로톤올아민Pyrrotonol amine 0.10.1 브레비스카핀Brevis Kaffin 0.50.5 향로 및 색소Incense and pigment 적량Suitable amount 정제수Purified water 잔액 (총 100)Balance (100 total)

제형 예 2 : 발모용 조성물 2 (샴푸)Formulation Example 2: Hair growth composition 2 (shampoo)

아래 처방에 따라 통상의 방법으로 샴푸를 제조하였다. The shampoo was prepared in the usual manner according to the prescription below.

배합성분Compounding ingredient 중량비(%)Weight ratio (%) 폴리 쿼터니움Polyquaternium 0.50.5 라우릴황산나트륨(30%)Sodium lauryl sulfate (30%) 2020 폴리옥시에틸렌 라우릴황산 나트륨Sodium polyoxyethylene lauryl sulfate 3030 야자유지방산 디에탄올아미드Coconut oil fatty acid diethanolamide 33 4급 암모늄 양이온 계면활성제Quaternary ammonium cationic surfactant 22 Carbopol-1342Carbopol-1342 0.30.3 파라옥시안식향산에스텔Paraoxybenzoic acid ester 0.20.2 브레비스카핀Brevis Kaffin 0.50.5 향로 및 색소Incense and pigment 적량Suitable amount 정제수Purified water 잔액 (총 100)Balance (100 total)

제형 예 3 : 발모용 조성물 3 (Formulation Example 3: Hairy composition 3 ( 헤어hair 로션) Lotion)

아래 처방에 따라 통상의 방법으로 헤어 로션을 제조하였다.The hair lotion was prepared in a conventional manner according to the following prescription.

배합성분Compounding ingredient 중량비(%)Weight ratio (%) 세토스테아릴알코올Cetostearyl alcohol 22 염화스테아릴트리에틸암모늄Stearyltriethylammonium chloride 22 히드록시에틸 셀룰로오즈Hydroxyethyl cellulose 0.50.5 피록톤올아민Pyrrothonol amine 0.10.1 브레비스카핀Brevis Kaffin 0.50.5 향로 및 색소Incense and pigment 적량Suitable amount 정제수Purified water 잔액 (총 100)Balance (100 total)

<< 실시예Example 4> 본 발명의 발모용 조성물의 발모효과 확인 시험 4> The hair growth inhibitory effect of the hair growth composition of the present invention

본 발명의 발모용 조성물 1을 모발의 수가 정상에 비해 현저히 적거나, 탈모증상이 보이며 모발이 약한 남녀 총 20명을 대상으로 하여 1주에 5회씩 6개월 동안 모발 및 두피에 사용하였다. 사용 후, 평가는 모발의 굵기, 밀집 정도, 탄력성 및 전체적 평가 항목에 대하여 개선정도(매우 좋아짐;+5, 조금 좋아짐;+4, 변화없음;3, 조금 나빠짐;2, 매우 나빠짐;1)를 3개월. 6개월 경과 후 사용자 문진하여 평균값을 표 7 에 나타내었다.Hairy composition 1 of the present invention was used for hair and scalp for 6 months, 5 times a week for a total of 20 men and women in which the number of hair was significantly lower than that of normal hair, hair loss symptoms were shown, and hair was weak. After the use, the evaluation showed improvement (very good: +5, slightly better; +4, no change; 3, slightly worse; 2, very poor; 1) to the thickness of hair, density, elasticity and overall evaluation items 3 months. After 6 months, the average value is shown in Table 7.

모발의 굵기Thickness of hair 밀집 정도Density 탄력성Resilience 전체 평가Overall rating 3개월 후
평균 점수
Three months later
Average score
4.00 4.00 4.05 4.05 4.05 4.05 4.10 4.10
6개월 후
평균 점수
6 months later
Average score
4.40 4.40 4.45 4.45 4.35 4.35 4.40 4.40

상기 표 7에 나타난 바에 따르면 본 발명의 발모용 조성물을 3개월 이상 사용한 결과, 모발의 굵기, 밀집도, 및 탄력성 면에서 시험 대상자들의 만족도가 우수한 것을 알 수 있다. 또한 6개월 동안 사용한 결과 이러한 만족도는 더욱 우수한 것으로 나타나 지속적인 사용으로 더욱 우수한 효과를 기대할 수 있을 것으로 생각되었다.
According to the results shown in Table 7, when the hair growth composition of the present invention was used for 3 months or more, it was found that the subjects were satisfied with the thickness, density, and elasticity of the hair. In addition, the results of the 6-month follow-up showed that this satisfaction was even better.

<< 실시예Example 5>  5> 눈썹성장제Eyebrow growth agent 조성물의 성장효과 확인 시험 Test for confirming the growth effect of the composition

제형 4 : 눈썹성장 Formulation 4: eyebrow growth 토닉tonic

아래 처방에 따라 통상의 방법으로 눈썹성장 토닉을 제조하였다.Eyebrow growth tonics were prepared in the usual manner according to the prescription below.

배합성분Compounding ingredient 중량비(%)Weight ratio (%) 에탄올ethanol 4040 초산토코페롤Tocopheryl acetate 0.10.1 살리실산Salicylic acid 0.30.3 L-멘톨L-menthol 0.30.3 브레비스카핀Brevis Kaffin 0.50.5 트윈 20Twin 20 적량Suitable amount 정제수Purified water 잔액 (총 100)Balance (100 total)

제형 예 5 : 눈썹성장 크림Formulation Example 5: eyebrow growth cream

아래 처방에 따라 통상의 방법으로 샴푸를 제조하였다. The shampoo was prepared in the usual manner according to the prescription below.

배합성분Compounding ingredient 중량비(%)Weight ratio (%) 파라핀paraffin 55 세토스테아릴알코올Cetostearyl alcohol 5.55.5 페트로라툼Petrogradum 5.55.5 글리세린모노스테아레이트Glycerin monostearate 33 폴리옥시에틸렌옥틸도데실에테르Polyoxyethylene octyldodecyl ether 33 프로필파라벤Propylparaben 0.30.3 글리세린glycerin 77 브레비스카핀Brevis Kaffin 0.50.5 디프로필렌글리콜Dipropylene glycol 2020 폴리에틸렌글리콜Polyethylene glycol 55 향료Spices 적량Suitable amount 정제수Purified water 잔액 (총 100)Balance (100 total)

본 발명의 발모용 조성물 4를 속눈썹의 수가 정상에 비해 현저히 적거나, 짧은 남녀 총 15명을 대상으로 하여 1주에 5회씩 3개월 동안 사용하였다. 사용 후, 평가는 속눈썹의 굵기, 밀집 정도, 길이, 탄력성 및 전체적 평가 항목에 대하여 개선정도(매우 좋아짐;+5, 조금 좋아짐;+4, 변화없음;3, 조금 나빠짐;2, 매우 나빠짐;1)를 3개월 경과 후 사용자 문진하여 평균값을 표 10 에 나타내었다.The hair growth composition 4 of the present invention was used for 15 months in a total of 15 men and women, each of which had significantly fewer or less eyelashes than normal, five times a week for 3 months. After the use, the evaluation showed that the degree of improvement (very good, +5, slightly better, +4, no change; 3, slightly worse; 2, worse; 1, worse) on the thickness of eyelashes, density, length, elasticity and overall evaluation items ) Was measured after 3 months, and the average value was shown in Table 10.

속눈썹길이Eyelash length 속눈썹의 굵기Thickness of Eyelashes 속눈썹
밀집 정도
Eyelashes
Density
속눈썹
탄력성
Eyelashes
Resilience
전체 평가Overall rating
3개월 후,
평균 점수
Three months later,
Average score
4.35 4.35 4.40 4.40 4.35 4.35 4.30 4.30 4.30 4.30

상기 표 10에 나타난 결과에 따르면, 본 발명의 발모용 조성물을 사용한 실험참가자들은 모든 항목에 대해서 만족스러운 평가를 하였다. 특히, 속눈썹 길이 변화에 대한 평가는 가장 우수한 것으로 나타났다.According to the results shown in Table 10 above, the experiment participants using the hair growth composition of the present invention gave satisfactory evaluation for all items. Especially, the evaluation of eyelash length change was the best.

Claims (8)

하기 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 탈모 방지, 모발 성장 또는 발모 촉진용 화장료 조성물.
[화학식 1]
Figure pat00002
A cosmetic composition for preventing hair loss, promoting hair growth or hair growth, comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]
Figure pat00002
제1항에 있어서, 상기 조성물은 상기 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염을 조성물 전체 중량 대비 0.001 내지 10 중량% 포함하는 것을 특징으로 하는 화장료 조성물.[Claim 2] The cosmetic composition according to claim 1, wherein the composition comprises 0.001 to 10% by weight of the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof, based on the total weight of the composition. 하기 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 탈모 방지, 모발 성장 또는 발모 촉진용 약학 조성물.
[화학식 1]
Figure pat00003
A pharmaceutical composition for preventing hair loss, promoting hair growth or hair growth, comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]
Figure pat00003
제3항에 있어서, 상기 조성물은 상기 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염을 조성물 전체 중량 대비 0.001 내지 10 중량% 포함하는 것을 특징으로 하는 약학 조성물.4. The pharmaceutical composition according to claim 3, wherein the composition comprises 0.001 to 10% by weight of the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof, based on the total weight of the composition. 제1항 내지 제4항 중 어느 하나의 항에 있어서, 상기 화장료 조성물 또는 약학 조성물은 Wnt/β-카테닌(catenin) 신호 전달 체계를 활성화시키는 것을 특징으로 하는 조성물. The composition according to any one of claims 1 to 4, wherein the cosmetic composition or pharmaceutical composition activates the Wnt /? - catenin signaling system. 하기 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 DKK-1 유전자 발현 감소용 조성물.
[화학식 1]
Figure pat00004
1. A composition for reducing DKK-1 gene expression comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]
Figure pat00004
하기 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 백모 또는 백반증 예방, 완화 또는 개선용 조성물.
[화학식 1]
Figure pat00005
A composition for preventing, alleviating or ameliorating white moth or alleviation comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]
Figure pat00005
하기 화학식 1로 표현되는 화합물 또는 이의 약학적으로 허용 가능한 염을 유효성분으로 포함하는 흉터 개선용 조성물.
[화학식 1]
Figure pat00006
A composition for improving scarring comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]
Figure pat00006
KR1020140005651A 2014-01-16 2014-01-16 Cosmetic or pharmaceutical composition for promoting hair growth containing breviscapin KR101593628B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140005651A KR101593628B1 (en) 2014-01-16 2014-01-16 Cosmetic or pharmaceutical composition for promoting hair growth containing breviscapin

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140005651A KR101593628B1 (en) 2014-01-16 2014-01-16 Cosmetic or pharmaceutical composition for promoting hair growth containing breviscapin

Publications (2)

Publication Number Publication Date
KR20150085691A true KR20150085691A (en) 2015-07-24
KR101593628B1 KR101593628B1 (en) 2016-02-12

Family

ID=53875895

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140005651A KR101593628B1 (en) 2014-01-16 2014-01-16 Cosmetic or pharmaceutical composition for promoting hair growth containing breviscapin

Country Status (1)

Country Link
KR (1) KR101593628B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130005616A (en) * 2011-07-07 2013-01-16 주식회사 알엔에스 Skin whitening agent

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130005616A (en) * 2011-07-07 2013-01-16 주식회사 알엔에스 Skin whitening agent

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Biochem. Biophys. Res. Commun., Vol. 400, No. 1, pp. 151-156 (2010.09.10.)* *

Also Published As

Publication number Publication date
KR101593628B1 (en) 2016-02-12

Similar Documents

Publication Publication Date Title
KR101670865B1 (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Sinomenine Hydrochloride
KR102023021B1 (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Hydroxydecanoic acid
KR101792402B1 (en) Hair growth stimulants comprising nicotinic acid adenine dinucleotide phosphate and its derivatives
KR101618349B1 (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Dehydroandrographolide
KR101651248B1 (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Forsythin
KR101602468B1 (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Hydroxydecanoic acid
KR101569773B1 (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Artemether
KR101578849B1 (en) Shampoo or conditioner composition containing Ginsenoside C-Mx1 for promoting hair growth by strengthen the scalp and the hair roots
KR102000934B1 (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Dehydroandrographolide
KR102000935B1 (en) Cosmetic or pharmaceutical composition for promoting hair growth containing 5-hydroxytryptophan
KR20150085964A (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Wogonin
KR101593628B1 (en) Cosmetic or pharmaceutical composition for promoting hair growth containing breviscapin
KR20150085963A (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Protocatechualdehyde
KR20150085686A (en) Cosmetic or pharmaceutical composition for promoting hair growth containing protopanaxadiol
KR20150085961A (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Aloe-emodin
KR101618350B1 (en) Cosmetic or pharmaceutical composition for promoting hair growth containing 5-hydroxytryptophan
KR102106712B1 (en) Composition comprising phellandrene for preventing hair loss or stimulating hair growth
KR102530037B1 (en) Composition for promoting the hair growth comprising Tabersonine
KR20150085688A (en) Cosmetic or pharmaceutical composition for promoting hair growth containing lupeol
KR20150085967A (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Puerarin
KR20150085696A (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Hyperoside
KR20150085693A (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Polydatin
KR20150085695A (en) Cosmetic or pharmaceutical composition for promoting hair growth containing Galanthamine
KR20150085690A (en) Cosmetic or pharmaceutical composition for promoting hair growth containing trillin
KR20150085697A (en) Cosmetic or pharmaceutical composition for promoting hair growth containing phytic acid

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20190103

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20200102

Year of fee payment: 5