KR20150085693A - Cosmetic or pharmaceutical composition for promoting hair growth containing Polydatin - Google Patents

Abstract

Provided in the present invention is a cosmetic or pharmaceutical composition preventing hair loss, growing hair, or promoting hair growth including a compound of chemical formula 1 or a pharmaceutically acceptable salt of the same. The cosmetic or pharmaceutical composition of the present invention has less side effects thereby having excellent hair growth or hair growth promotion effect while being safe to a human body.

Description

[0001] The present invention relates to a cosmetic or pharmaceutical composition for promoting hair growth comprising polyadin,

The present invention relates to a composition for promoting hair growth, and more particularly, to a cosmetic or pharmaceutical composition for promoting hair growth containing a component that induces new growth or promotion of hair growth.

Hair is an important part of the process of increasing interest in beauty as the age changes. Hair is a thin, exfoliated structure produced from the surface of the skin. It acts as a cushion against external impact, protects the human body from external stimuli such as direct sunlight, cold, friction, danger, and discharges the heavy metals such as arsenic, mercury and zinc harmful to the body to the outside of the body. The side is also being emphasized.

However, many people are complaining of hair loss due to various causes, including dietary changes and increased internal and external stress.

Human hair has about 100,000 to 150,000 hairs, and each hair has a different growth period. The hair growth cycle consists of three stages: the anagen stage where hair grows most actively, the catagen stage where hair starts to degenerate, and the telogen stage where hair growth stops or rests. .

In general, alopecia refers to an increase in the number of abnormal hair loss due to shortening of hair growth rate in the growing period and increased number of hair in the retrogressive or resting period among these cycles.

Male hormones play an important role in the death and elimination of hair follicles. DKK-1 (Dickkopf-related protein 1) plays an important role in hair follicle growth inhibition and death, among the factors expressed in hair follicles by male hormone.

On the other hand, for periodic hair growth, hair follicle regeneration and stem cell activation must be performed, which is known to be caused by the production and activation of Wnt / β-catenin. In addition, DKK-1 mentioned above is known to be an antagonist of Wnt / [beta] -catenin, so that the above signal system is very important for controlling hair growth.

The herbal remedy for the treatment or prevention of alopecia that has been developed so far includes female hormone-based preparations such as minoxidil, finasteride, tricosaccharide, etc. for promoting blood circulation, enhancing hair follicle function, scalp moisturizing and male hormone suppression, (trichosaccharide), etc., but there are many limitations in use due to adverse effects such as sexual dysfunction, possibility of birth of deformed baby, and general hair growth.

Accordingly, the present invention aims to solve the above-mentioned problems, and to provide a new useful use of a new active ingredient, i.e., an active ingredient, which is less harmful to the human body and can act effectively for promoting hair growth or hair growth.

In other words, a problem to be solved by the present invention is to provide a composition comprising the active ingredient having excellent efficacy as an active ingredient.

In order to solve the above problems, the present invention provides a composition for accelerating hair growth or hair growth, preferably a cosmetic composition or a pharmaceutical composition comprising a compound represented by the following formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient do.

[Chemical Formula 1]

That is, the present invention provides a new use for promoting hair growth or hair growth of the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof.

The inventors of the present invention have confirmed through experiments that the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof affects the activation of the Wnt / β-catenin signal pathway.

In addition, the composition of the present invention can reduce the expression of DKK-1 gene, which plays an important role in hair follicle growth inhibition and death.

In addition, the composition of the present invention represented by Formula 1 or a pharmaceutically acceptable salt thereof can induce the production of melanin by activating the Wnt / β-catenin signaling system, .

The composition containing the compound represented by the formula (1) of the present invention or a pharmaceutically acceptable salt thereof may induce melanin production to prevent, alleviate or ameliorate white moth, vitiligo and the like.

As used herein, the term " vitiligo "means a decolorizing disease in which white spots appear on the skin due to the destruction of melanocytes, and" white hair "means that the hair turns white, Most are not limited to these causes.

The composition containing the compound represented by the formula (1) of the present invention or a pharmaceutically acceptable salt thereof can exert an excellent effect for improving scars such as burns and acne.

In the present invention, "hair loss prevention" means that the phenomenon of hair falling off the hair follicle or scalp is inhibited or weakened.

In the present invention, the term "hair growth" means that the thickness of the hair (hair) generated increases or affects the speed of growth of the hair.

In the present invention, the term " promoting hair growth "means that hair is produced, and is used in a broad sense to increase the hair generation rate and production amount. It also means that the hair follicle function is strengthened, the hair dropping and generation cycle is shortened, and the number of hairs growing in the hair follicle is increased.

The compound represented by the formula (1) is referred to as 3, 5, 4'-trihydroxystilbene 3-glucoside, and is also called polydatin. The present invention is not particularly limited to the method for obtaining the polyadin, but may be chemically synthesized or commercially available materials by methods known in the art.

The "pharmaceutically acceptable salt" of the present invention may be an acid addition salt formed using an organic acid or inorganic acid, and the organic acid may be, for example, formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, trifluoroacetic acid, The present invention also relates to the use of a compound selected from the group consisting of malic acid, maleic acid, malonic acid, fumaric acid, succinic acid, succinic acid monoamide, glutamic acid, tartaric acid, oxalic acid, citric acid, glycolic acid, gluconic acid, ascorbic acid, benzoic acid, phthalic acid, salicylic acid, anthranilic acid, Benzenesulfonic acid, p-toluenesulfonic acid and methanesulfonic acid-based salts, and inorganic acids include, for example, hydrochloric acid, bromic acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid and boric acid-based salts. Preferably in the hydrochloride or acetate form, more preferably in the hydrochloride form.

The above-mentioned acid addition salts may be obtained by a) directly mixing the compound of formula 1 and an acid, or b) dissolving and mixing one of them in a solvent or a water solvent, or c) Lt; RTI ID = 0.0 > acid < / RTI > in a solvent and mixing them.

The present invention includes all of the solvates, hydrates and stereoisomers thereof, as well as the compounds of the above formula (I), derivatives thereof and pharmaceutically acceptable salts thereof, which may be prepared therefrom.

The polyadin of the present invention may also be present in unsolvated form as well as solvated form including form of hydrate, ethanol, and the like. The polyadin of the present invention may exist in crystalline or amorphous form, and all such physical forms are included within the scope of the present invention.

When the compound of Chemical Formula 1 of the present invention is used as a medicine, it may further contain one or more active ingredients showing the same or similar functions. For example, a known hair growth promoting or hair growth promoting component may be included. In this case, the effect of promoting hair growth or promoting hair growth of the composition of the present invention may be further enhanced. When the above ingredients are added, skin safety, easiness of formulation, and stability of effective ingredients can be considered according to the combined use.

In addition, the pharmaceutical composition composition for preventing hair loss, promoting hair growth or hair growth of the present invention may further comprise a pharmaceutically acceptable carrier.

The term "pharmaceutically acceptable" of the present invention refers to compositions and molecules that are physiologically acceptable and typically do not cause unexpected reactions when administered to humans. Preferably, as used herein, the term " pharmaceutically acceptable "means that it is approved by other commonly known pharmacopoeias for use in mammals and especially humans.

Pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose , Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil, and the like.

The pharmaceutical composition of the present invention can be administered parenterally, and can be administered in the form of a general pharmaceutical preparation, for example, various forms of parenteral administration at the time of clinical administration. In the case of formulation, the filler, , A wetting agent, a disintegrant, a surfactant, and the like.

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, or lyophilisers. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent.

The pharmaceutical composition of the present invention can provide a desirable hair growth effect or hair growth promoting effect when an effective amount of the compound of Formula 1 is included. In the present invention, the effective amount means the amount of the compound capable of exhibiting hair growth promoting effect, hair growth effect or hair loss prevention effect. An effective amount of the compound of formula (1) contained in the composition of the present invention will vary depending on the form in which the composition is commercialized, how the compound is applied to the skin, and the time on the skin. For example, when the composition is commercialized as a medicine, the composition of the present invention may contain the compound of formula (1) at a higher concentration than a product such as a shampoo, a hair conditioner, and a hair pack that is routinely applied to skin. Therefore, the daily dosage is 0.1 to 100 mg / kg, preferably 1 to 50 mg / kg, more preferably 5 to 20 mg / kg, based on the amount of the compound of formula (1) 6 times a day.

The pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

The present invention can also provide a formulation for external skin preparation for promoting hair growth or hair growth comprising the compound of formula (1) as an active ingredient.

When the compound of formula (1) is used as an external preparation for skin, it may further comprise at least one selected from the group consisting of fatty substances, organic solvents, solubilizers, thickeners and gelling agents, softeners, antioxidants, suspending agents, stabilizers, foaming agents, , Water, ionic or nonionic emulsifiers, fillers, sequestering agents and chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or external preparations for skin And any other ingredients used in the skin sciences. The components can also be introduced in amounts commonly used in the field of dermatology.

When the compound of Formula 1 is provided as an external preparation for skin, it may have a formulation that is applicable to hair, such as, but not limited to, gel, cream, patch, or spray.

The present invention can also provide a cosmetic composition for promoting hair growth comprising the compound of Formula 1 as an active ingredient.

When the compound of Chemical Formula 1 is used as a cosmetic, the cosmetic product containing the compound of Chemical Formula 1 as an active ingredient may be prepared in the form of a general emulsified formulation and a solubilized formulation. For example, they may have formulations such as sprays, hair gels, hair packs, shampoos, hair conditioners, hair lotions, hair essences, patches or sprays.

The cosmetic composition may further contain, in addition to the compound of Formula 1, a lipid, an organic solvent, a solubilizing agent, a thickening agent and a gelling agent, a softening agent, an antioxidant, a suspending agent, a stabilizer, a foaming agent, a fragrance, , Ionic or nonionic emulsifiers, fillers, sequestering and chelating agents, preservatives, vitamins, barrier agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or cosmetics And may contain adjuvants commonly used in the cosmetics field, such as any of the other ingredients.

Preferably, the composition of the present invention can be prepared in any form that can be applied to the scalp, such as liquid, cream, paste, or solid, and can be prepared by adding ordinary additives such as shampoo, hair conditioner, hair lotion, Liquid type hair growth type, and the like, including aerosol types of these formulations.

The composition of the present invention contains 0.001 to 10% by weight, preferably 0.005 to 5% by weight, more preferably 0.01 to 3% by weight, of the compound of Formula 1 or a pharmaceutically acceptable salt thereof, .

If the content of the compound of formula (1) is less than 0.001% by weight, the effect of promoting induction of hair growth may not be satisfactory, and if it exceeds 10% by weight, the effect may not be sufficiently exhibited.

The composition containing the polyadin of the present invention or a pharmaceutically acceptable salt thereof exhibits hair growth promoting effect.

In addition, it exhibits an effect of promoting hair growth as well as an effect of preventing hair loss.

The composition containing the polyadin or the pharmaceutically acceptable salt thereof of the present invention can be used as safe and excellent cosmetic raw materials and pharmaceutical ingredients.

In addition, the composition of the present invention is free from side effects of conventional hair loss treatment agents and provides a superior hair growth or hair loss prevention effect while being safe for human body.

1 is a graph showing the degree of DKK-1 expression when treating polyadin, dihydrotestosterone, The results shown in Fig. 1 show that the treatment of polyadultin has an effect of decreasing DKK-1 expression, which is increased by dihydrotestosterone treatment.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the above-described embodiments. The embodiments of the present invention are provided by way of example to facilitate a specific understanding of the present invention.

The polyadin of the present invention was purchased from Xi'an Guanyu Bio-tech Co., Ltd.

< Example  1> Of polyadin  Cytotoxicity Assessment

For evaluation of cytotoxicity of polydatine in this Example, cell division changes of Follicle Dermal Papilla (Promocell, Germany) were measured using Cell Counting Kit-8 (Dojindo Lab, USA).

First, a uniform number of cells were plated on a 96-well plate and then stabilized. The cells were treated with polyadultin 10, 20 ug / ml for 48 hours. Thereafter, CCK-8 was treated and the absorbance was measured at 450 nm for 2 hours. The relative cell viability of the cells treated with polyadatin versus untreated was analyzed as follows, and the results are shown in Table 1 below.

Relative cell viability = (compound treated group) / (untreated group) X 100

sample No treatment BIO
1uM Polyartin
10 [mu] g / ml Polyartin
20ug / ml Survival rate (%) 100 103 102 97

As shown in Table 1, it can be seen that the number of cells does not change greatly by the treatment with polyadatine.

< Example  2> Of polyadin Wnt / β- catenin signal pathway  Investigate the activity effect

A TOPflash reporter (Millipore, USA) was used to investigate the effect of polyadultin on Wnt / β-catenin signal pathway activation. Human dermal papilla cells were inoculated in a 24-well plate at 2 x 10 &lt; ⁵ &gt; / well and cultured for 24 hours. Polyadin was treated to 10, 20 ug / ml and then further cultured for 15 hours to obtain a dual luciferase assay kit , USA) was used to measure the firefly luciferase activity.

In order to accurately measure the activity of luciferase, the activity of each sample was measured three times, and the activity relative to the control group was calculated as an increase rate (%). The control group is untreated group. The positive control was 6-bromoindirubin-3'-oxime (BIO) and is known to inhibit GSK-3 in the Wnt signaling pathway.

sample Control group BIO
1uM Polyartin
10 [mu] g / ml Polyartin
20ug / ml Growth rate (%) 100 152 140 257

As shown in Table 2, the present invention shows that polydatin increases TOPflash reporter activity in a concentration-dependent manner and is selective for Wnt / β-catenin signal transduction and exhibits excellent bacteriostatic performance. The measurements corrected firefly luciferase levels to renilla luciferase levels.

< Example  3> DHT Induced by DKK -1 inhibition effect investigation

Activation of Wnt / β-catenin promotes hair growth while male hormone or dihydrotestosterone (WAKO, Japan) acts as an antagonist of Wnt / β-catenin through the promotion of DKK-1 gene expression.

Therefore, in order to investigate whether polydatin can inhibit DKK-1 gene, which is an antagonist of Wnt / β-catenin, to promote hair growth, human dermal papilla cells were treated with 20 ug / ml polyadin and 100 nM dihydrotestosterone for 24 h , And the expression of DKK-1 was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) using primers (Bioneer, Korea) shown in Table 3 below. The primers used at this time are shown in Table 3.

Standing column Forward TGATGAGTACTGCGCTAGTC Reverse CTCCTATGCTTGGTACACAC

As a result of the experiment, it was found that treatment of polyadultin significantly reduced the expression of DKK-1, which was increased by treatment with dihydrotestosterone, thereby promoting hair growth. The results were analyzed by using a comparative CT (ΔΔCT) Experiment (Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2-Delta Delta C (T) (2001)). Internal control was performed using GAPDH, and the results are shown in FIG.

Various formulation examples of the composition according to the present invention will be described in detail based on the above-mentioned effect test results. It should be apparent to those skilled in the art, however, that these formulation examples are merely examples of the composition of the present invention and that the composition of the present invention is not limited to these formulations only.

Formulation 1: Hairy composition 1 ( hair tonic )

Hair tonics were prepared according to the following prescriptions in a conventional manner.

Compounding ingredient Weight ratio (%) ethanol 55 Castor oil 5 glycerin 3 Pyrrotonol amine 0.1 Polyartin 0.5 Incense and pigment Suitable amount Purified water Balance (100 total)

Formulation Example 2: Hair growth composition 2 (shampoo)

The shampoo was prepared in the usual manner according to the prescription below.

Compounding ingredient Weight ratio (%) Polyquaternium 0.5 Sodium lauryl sulfate (30%) 20 Sodium polyoxyethylene lauryl sulfate 30 Coconut oil fatty acid diethanolamide 3 Quaternary ammonium cationic surfactant 2 Carbopol-1342 0.3 Paraoxybenzoic acid ester 0.2 Polyartin 0.5 Incense and pigment Suitable amount Purified water Balance (100 total)

Formulation Example 3: Hairy composition 3 ( hair  Lotion)

The hair lotion was prepared in a conventional manner according to the following prescription.

Compounding ingredient Weight ratio (%) Cetostearyl alcohol 2 Stearyltriethylammonium chloride 2 Hydroxyethyl cellulose 0.5 Pyrrothonol amine 0.1 Polyartin 0.5 Incense and pigment Suitable amount Purified water Balance (100 total)

< Example  4> The hair growth inhibitory effect of the hair growth composition of the present invention

Hairy composition 1 of the present invention was used for hair and scalp for 6 months, 5 times a week for a total of 20 men and women in which the number of hair was significantly lower than that of normal hair, hair loss symptoms were shown, and hair was weak. After the use, the evaluation showed improvement (very good: +5, slightly better; +4, no change; 3, slightly worse; 2, very poor; 1) to the thickness of hair, density, elasticity and overall evaluation items 3 months. After 6 months, the average value is shown in Table 7.

Thickness of hair Density Resilience Overall rating Three months later
Average score 4.05 4.10 4.00 4.05 6 months later
Average score 4.20 4.15 4.10 4.20

According to the results shown in Table 7, when the hair growth composition of the present invention was used for 3 months or more, it was found that the subjects were satisfied with the thickness, density, and elasticity of the hair. In addition, the results of the 6-month follow-up showed that this satisfaction was even better.

< Example  5> Eyebrow growth agent  Test for confirming the growth effect of the composition

Formulation 4: eyebrow growth tonic

Eyebrow growth tonics were prepared in the usual manner according to the prescription below.

Compounding ingredient Weight ratio (%) ethanol 40 Tocopheryl acetate 0.1 Salicylic acid 0.3 L-menthol 0.3 Polyartin 0.5 Twin 20 Suitable amount Purified water Balance (100 total)

Formulation Example 5: eyebrow growth cream

The shampoo was prepared in the usual manner according to the prescription below.

Compounding ingredient Weight ratio (%) paraffin 5 Cetostearyl alcohol 5.5 Petrogradum 5.5 Glycerin monostearate 3 Polyoxyethylene octyldodecyl ether 3 Propylparaben 0.3 glycerin 7 Polyartin 0.5 Dipropylene glycol 20 Polyethylene glycol 5 Spices Suitable amount Purified water Balance (100 total)

The hair growth composition 4 of the present invention was used for 15 months in a total of 15 men and women, each of which had significantly fewer or less eyelashes than normal, five times a week for 3 months. After the use, the evaluation showed that the degree of improvement (very good, +5, slightly better, +4, no change; 3, slightly worse; 2, worse; 1, worse) on the thickness of eyelashes, density, length, elasticity and overall evaluation items ) Was measured after 3 months, and the average value was shown in Table 10.

Eyelash length Thickness of Eyelashes Eyelashes
Density Eyelashes
Resilience Overall rating Three months later,
Average score 4.20 4.15 4.05 4.10 4.20

According to the results shown in Table 10 above, the experiment participants using the hair growth composition of the present invention gave satisfactory evaluation for all items. Especially, the evaluation of eyelash length change was the best.

Claims (8)

A cosmetic composition for preventing hair loss, promoting hair growth or hair growth, comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]

[Claim 2] The cosmetic composition according to claim 1, wherein the composition comprises 0.001 to 10% by weight of the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof, based on the total weight of the composition. A pharmaceutical composition for preventing hair loss, promoting hair growth or hair growth, comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]

4. The pharmaceutical composition according to claim 3, wherein the composition comprises 0.001 to 10% by weight of the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof, based on the total weight of the composition. The composition according to any one of claims 1 to 4, wherein the cosmetic composition or pharmaceutical composition activates the Wnt /? - catenin signaling system. 1. A composition for reducing DKK-1 gene expression comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]

A composition for preventing, alleviating or ameliorating white moth or alleviation comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]

A composition for improving scarring comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]

Images