KR20150075717A - Recombinant vector comprising start codon derived from Coryne form bacteria, transformed host cell and method for producing amino acid using the same - Google Patents

Abstract

The present invention relates to a method for producing amino acid, in particular L-lysine, using microorganisms and recombinant vectors including reformed initiation codons wherein the initiation codons can control expressions of each gene and are reformed by replacing the initiation codons of glucose 6phosphate dehydrogenase (zwf), transketolase (tkt), aspartokinase (lysC), pyruvate carboxylase (pycA), sucrose 6-phosphate hydrolase (scrB), glutamate dehydrogenase (gdh) and isocyanurate dehydrogenase (icd) at the same time among important genes which are related to biosynthesis metabolism of lysine in Corynebacterium sp. microorganisms.

Description

[0001] The present invention relates to a recombinant vector comprising a coryneform bacterium-derived substituted initiation codon, a transformed host cell and a method for producing an amino acid using the recombinant vector. same}

The present invention relates to a recombinant vector comprising a substituted initiation codon derived from a coryneform bacterium, a transformed host cell and a method for producing an amino acid using the transformed host cell, and more particularly, to a method for producing a lycin gene from Corynebacterium sp. Among important genes involved in biosynthetic metabolism are glucose 6-phosphate dehydrogenase (zwf), transketolase (tkt), aspartokinase (lysC), pyruvate carboxylase (pycA) The initiation codon of the genes of 6-phosphate hydrolase (scrB), glutamate dehydrogenase (gdh), and isocitrate dehydrogenase (icd) was simultaneously replaced to include an improved initiation codon whose expression of each gene was regulated Preferably L-lysine, using a microorganism and a recombinant vector.

Coryneform microorganisms are traditionally the most widely used industrial microorganisms for the production of amino acids and nucleic acid-related substances. They are mainly L-lysine, L-threonine, L-arginine, and glutamic acid, And the like, and is produced through a fermentation process using the above-mentioned microorganisms.

Among them, L-lysine is an essential amino acid which is not synthesized in human or animal body, and is used for foods, medicines and feed additives. Since industrial production of L-lysine is an economically important industrial process, various methods for increasing L-lysine production efficiency have been studied.

As a method for improving the lysine production efficiency, there has been used a method of amplifying the gene on the lysine biosynthetic pathway or modifying the promoter of the gene to increase the enzyme activity on the biosynthetic pathway. Conventionally, a Corynebacterium strain having enhanced lysine biosynthesis-related genes and a method for producing L-lysine using the strain have been known.

For example, in Korean Patent Publication Nos. 2008-10073, 2008-8620 and 2010-20140, aspartate aminotransferase, which is a gene involved in L-lysine production, and pyruvate carboxylase (Korean Patent Publication No. 2008-0025355), and the effect of lysine production was confirmed by replacing an improved promoter with that of the intrinsic promoter (US Patent Application No. 13 / 037,790).

In addition, U.S. Patent No. 6,221,636 discloses a DNA sequence encoding an aspotokinase that is substantially desensitized to feedback inhibition by L-lysine and L-threonine, and a DNA sequence encoding a diaminopimelate decarboxylase Corynebacteria transformed with recombinant DNA containing DNA sequences are disclosed.

In addition, the initiation codon of a specific gene in bacterial Escherichia coli was replaced with ATG to induce protein expression (Korean Patent Publication No. 2002-0066075). Also, in the initiation codon, the initiation codon of the adenylate cyclase gene was designated as TTG, When comparing the level of translation initiation with the substitution of GTG and ATG, it was found that the codon of ATG had the highest translation initiation efficiency (Reddy et al., 1985. Proc. Nadl. Acad. Sci. 82: 5656) .

The genes coding for ICD in C. glutamicum have also been identified and cloned by Eikmanns et al. And characterized (Eikmanns, B. et al., J. Bacteriol. (1995) 177: 774 -782), especially by replacing the initiation codon of this gene (ATG-> GTG) by reducing the activity of the gene, leading to an increase in the production of aspartate amino acid by inducing carbon flow through the aspartate production-related pathway (Korean Patent Publication No. 2012-0108040).

In order to express the gene in the organism, the ribosomal subunit and the initiation factor bind to the initiation codon AUG of the mRNA to initiate translation. At this time, if the start codon of the gene is other codon than AUG, the level of translation can be controlled. Also, it has been reported that the ATG translation initiation sequence regulating the initiation codon is preferable as an optimal sequence (Korean Patent Publication No. 2007-0090151).

In particular, the present inventors have identified genes that do not use ATG as translation initiation codons among the genes involved in lysine biosynthesis and substitute the translation initiation sequence of ATG or GTG with the translation initiation sequence of the major genes involved in lysine biosynthesis, By optimizing the enzyme activity, it was confirmed that lysine production could be increased.

It is an object of the present invention to increase and / or reduce the activity of enzymes involved in the biosynthesis of amino acids of a host cell, preferably L-lysine, to convert the flow of the ambiguous precursor into an amino acid, preferably biosynthesis of L-lysine Lt; / RTI >

It is another object of the present invention to provide a method for producing a recombinant vector which is capable of increasing and / or reducing the activity of enzymes involved in the biosynthesis of amino acids, preferably L-lysine, To a biosynthesis of lysine.

It is yet another object of the present invention to provide a method for producing an amino acid, preferably L-lysine, using the host cell.

In order to solve the above problems, the present invention provides a gene-initiating codon variant comprising the nucleotide sequence of SEQ ID NO: 30, wherein the start codon of the transketolase-encoding gene (tkt) is substituted with ATG.

The present invention also provides a recombinant vector comprising said gene-initiating codon variant.

The present invention also provides a host cell transformed with the recombinant vector.

The present invention also provides a method of producing an amino acid comprising the step of culturing using the host cell.

When an amino acid, preferably L-lysine, is produced using a host cell transformed with a recombinant vector containing the mutant according to the present invention, the translation initiation efficiency of genes involved in the biosynthesis of amino acids, preferably L-lysine L-lysine by decreasing the activity of the gene by decreasing the translation initiation efficiency of the genes involved in the increase of the activity of the gene through the increase of the gene and / or the biosynthesis of the amino acid, preferably L-lysine. .

In the present invention, "nucleic acid" refers to DNA, RNA or derivatives or analog molecules (strands) composed of nucleobases. For example, the nucleotide base may include naturally occurring or derived purine or pyrimidine bases (such as adenine "A", guanine "G", thymine "T" or cytosine "C") or RNA , G, uracil "U" or C).

Three of the bases are mated to make one codon, and the three base codons thus generated are the basic unit of the genetic code to determine one amino acid on the messenger RNA (mRNA), that is, a protein.

In the present invention, the term "initiation codon " means a codon corresponding to a starting point when translating a nucleotide sequence, which is genetic information, on a mRNA into a protein. Most of the initiation codons found in most organisms use ATG (mRNA: AUG). In particular, according to the present invention, whole genome sequence analysis of Corynebacterium glutamicum shows that the initiation codon of microorganisms belonging to the genus Corynebacterium The codon is as follows.

C. glutamicum ATCC13032 analyzed by Kyowa Hakko used the initiation codon at a ratio of AUG 62.5%, GUG 24.3%, UUG 13.2%, and C. glutamicum by Degussa AG It has been reported that ATCC13032 uses an initiation codon of AUG 66.5%, GUG 23.1% UUG 10.3%, and C. epissant by Ajinomoto uses an initiation codon of AUG 53.8% GUG 32.5% UUG 13.7% (Handbook of Corynebacterium glutamicum, Lothar Eggeling & Michael Bott, 2005).

In the present invention, the term " initiation codon variant " means a gene mutant in which the initiation codon of a gene involved in biosynthesis of L-lysine is substituted with ATG or GTG.

The present inventors confirmed that lysC, tkt, zwf, pycA and scrB genes using the initiation codon as a GTG but not the ATG among the main genes related to lysine biosynthesis through NCBI ( http://www.ncbi.nlm.nih.gov ) Respectively.

Furthermore, the term "vector" in the present invention refers to an expression vector capable of expressing a desired protein in a suitable host cell, which gene construct contains an essential regulatory element operatively linked to the expression of the gene insert.

As used herein, the term " regulatory element "includes promoters for performing transcription, any operator sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling transcription and translation termination.

The "recombinant vector" of the present invention can be cloned not only in coryneform bacteria but also in a suitable host cell, and then replicable regardless of the genome of the host cell or sealed in the genome itself. Here, the "suitable host cell" may include a replication origin which is a specific nucleic acid sequence from which the vector is replicable.

In the present invention, "host cell" may be a receptor of any recombinant vector (s) or isolated polynucleotide of the present invention, or includes individual cells or cell cultures that are receptors. The host cell may be a progeny of a single host cell and the progeny may not be completely identical to the original parent cell in terms of morphology or total DNA complementation due to natural, accidental or artificial mutations and / or alterations.

The host cell includes cells transfected, transformed or infected with a recombinant vector or polynucleotide of the present invention in vivo or in vitro. A host cell comprising the recombinant vector of the present invention is a recombinant host cell, a recombinant cell, or a recombinant microorganism.

In addition, the "recombinant vector" according to the present invention may include a selection marker, which is used to select a transformant (host cell) transformed with a vector, Since only the cells expressing the selection marker in the treated medium can survive, selection of the transformed cells is possible.

Typical examples of the selection marker include kanamycin, streptomycin, chloramphenicol, etc. In the present invention, kanamycin can be used, but the present invention is not limited thereto.

The genes inserted into the recombinant vector for transformation of the present invention may be substituted into host cells such as Corynebacterium sp. Microorganisms due to homologous recombination crossings.

In the present invention, the term " encoded by "or" encoding "refers to a nucleic acid sequence encoding a polypeptide sequence, wherein the polypeptide sequence is a polypeptide encoded by the nucleic acid sequence of at least 3-5 More preferably at least 8 to 10 amino acids, and even more preferably at least 15 to 20 amino acids. Also encompassed is an immunologically identifiable polypeptide sequence using the polypeptide encoded by the sequence.

Thus, an antigen "polypeptide "," protein "or" amino acid "sequence refers to a polypeptide having an identity of at least 70%, preferably at least about 80%, more preferably at least about 90-95% And most preferably about 99% similarity.

In the present invention, a "gene" is a nucleotide sequence of a nucleic acid molecule (chromosome, plasmid, etc.) to which a genetic function is related. A gene is a genetic unit of an organism, including, for example, a polynucleotide sequence (e. G., A mammalian DNA sequence) that occupies a particular physical location in the genome of the organism. The gene may encode an expression product, such as a polypeptide or polynucleotide.

Generally, the gene comprises a coding sequence such as a polypeptide coding sequence and a non-coding sequence such as a promoter sequence, a polyadenylation sequence, a transcription control sequence (e.g., an enhancer sequence). Many eukaryotic genes have an "exon" (coding sequence) in which an "intron" (noncoding sequence) is interposed.

In the present invention, "primer" is used to hybridize to a complementary RNA or DNA-target polynucleotide, and is used as a starting point for the stepwise synthesis of a polynucleotide from a mononucleotide, for example, by the action of a nucleotide- ≪ RTI ID = 0.0 > oligonucleotide < / RTI >

In the present invention, "transformation or transfection" means that DNA is introduced into a host and the DNA becomes replicable as an extrachromosomal factor or by insertion into a chromosome.

In the present invention, the term "biological synthesis path", also referred to as "metabolic pathway", refers to a set of anabolic or catabolic biochemical actions for transmuting one species to another species . The gene product may act on the same substrate in parallel or in series to produce the same product or produce or produce a metabolic intermediate product (i.e., a metabolite) between the same substrate and the metabolic end product, .

Hereinafter, the present invention will be described in detail.

The present invention relates to a gene-initiating codon variant comprising the nucleotide sequence of SEQ ID NO: 30, wherein the start codon of the gene (tkt) encoding transketolase is substituted with ATG.

In the present invention, the gene-initiating codon variant may be derived from a microorganism belonging to the genus Corynebacterium, but is not limited thereto.

The present invention relates to a recombinant vector comprising said gene-initiating codon variant.

In the recombinant vector of the present invention, (a) a gene-initiating codon variant encoding a glucose 6-phosphate dehydrogenase (zwf) derived from a microorganism of the genus Corynebacterium, (b) (C) a gene-initiating codon variant encoding a pyruvate carboxylase (pycA) derived from a microorganism belonging to the genus Corynebacterium, (d) a gene encoding a mutant of Corynebacterium (E) a gene-initiating codon variant encoding glutamate dehydrogenase (gdh) derived from Corynebacterium genus microorganism, and (c) a gene-encoding mutant encoding sucrose-6-phosphate hydrolase (f) a mutation of any one or more of the gene-initiating codon variants encoding icosity dehydrogenase (icd) derived from Corynebacterium genus microorganism Here is disclosed the recombinant vector, and preferably further comprises a codon variant may be a recombinant vector further comprises the gene start codon variants of the above (a) to (f).

In the above recombinant vector, (a) the gene-initiating codon mutant is composed of the nucleotide sequence of SEQ ID NO: 29, (b) the gene-initiating codon variant is composed of the nucleotide sequence of SEQ ID NO: 31, (D) the gene start codon mutant is composed of the nucleotide sequence of SEQ ID NO: 33, and (e) the gene start codon mutant is the nucleotide sequence of SEQ ID NO: 34 (F) the gene-initiating codon variant may consist of the nucleotide sequence of SEQ ID NO: 35.

That is, the recombinant vector of the present invention can be produced by using a gene coding for glucose 6-phosphate dehydrogenase (zwf) (Gene ID: 3345621), a gene encoding transketolase (tkt) (Gene ID: 3343601) (Gene ID: 3345161), a gene encoding pyruvate carboxylase (pycA) (Gene ID: 3344537), or sucrose 6-phosphate hydrolase (scrB) (Gene ID: 3343980) and isocitrate dehydrogenase (Gene ID: 3343980), which encode the mutated ATG and / or glutamate dehydrogenase (gdh) icd) gene (Gene ID: 3345662) can be used as a recombinant vector capable of regulating the expression of the genes using a mutant in which the start codon is substituted with GTG.

In particular, the recombinant vector according to the present invention is characterized in that the genes zwf (gtg-> atg), tkt (ttg-> atg), lysC (gtg-> atg), pycA (gtg-> atg) (atg-> gtg), icd (atg-> gtg), which is a pathway gene that is interfered with lysine biosynthetic metabolism, is changed by changing the translation initiation codon of gdh (atg-> atg) Have you reduced translation initiation efficiency? By including the initiation codon variant, it is possible to effectively produce an amino acid such as L-lysine by controlling the expression of the genes of the genus Corynebacterium.

The genes that can be used in the present invention can be used without any limitation as far as they are functionally equivalent, but more preferably they can be derived from Corynebacterium glutamicum, C. glutamicum. Most preferably a gluco 6-phosphate dehydrogenase comprising the nucleotide sequence of SEQ ID NO: 29 derived from C. glutamicum, a transketolase consisting of the nucleotide sequence of SEQ ID NO: 30, and a nucleotide sequence of SEQ ID NO: 31 32, and / or sucrose 6-phosphate hydrolase consisting of the nucleotide sequence of SEQ ID NO: 33, the nucleotide sequence of SEQ ID NO: 34, the nucleotide sequence of SEQ ID NO: , And a gene sequence encoding an isocitrate dehydrogenase comprising the nucleotide sequence of SEQ ID NO: 35, as preferable specific examples, as mutants of the initiation codon of the gene sequence, SEQ ID NO: 29 to SEQ ID NO: The nucleotide sequence represented by SEQ ID NO: 35 can be used.

The present invention relates to a host cell transformed with said recombinant vector.

The microorganisms used in the transformed host cells of the present invention include the reduction, disruption or knockout of genes found in wild type organisms and the introduction of heterologous polynucleotides do.

The method of transforming the recombinant vector of the present invention into a host cell includes any method of introducing a nucleic acid into a cell and may be carried out by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, -DMSO method or the like can be used.

The transformants transformed with the recombinant vectors of the present invention have an improved initiation codon by replacing the initiation codon of the genes of the Corynebacterium sp. Microorganism with mutated sequences through homologous recombination. The activity may be increased or decreased compared to the wild type.

In the present invention, the "microorganism belonging to the genus Corynebacterium" is a microorganism belonging to the genus Brevibacterium, Corynebacterium, Arthrobacter sp. And Microbacterium sp. It is a concept that includes microorganisms.

Preferably microorganisms belonging to the genus Corynebacterium, more preferably Corynebacterium glutamicum (e.g., ATCC 13032), Corynebacterium ammoniagenes (e.g., ATCC 6872), Brevibacterium lacto Brevibacterium lactofermentum (eg ATCC 13869), Brevibacterium flavum (eg ATCC 14067), Corynebacterium thermoaminogenes (eg FERM BP 1539), Corynebacterium lactofermentum Corynebacterium efficiens (e.g., C. elegans str. YS-314), and the like, and most preferably, Corynebacterium glutamicum or Corynebacterium episodes are used. In one embodiment of the present invention, Corynebacterium glutamicum KCTC12307BP can be used.

In the present invention, the transformed host cell is a microorganism of the genus Corynebacterium, preferably Corynebacterium glutamicum (Corynebacterium glutamicum ) or Corynebacterium ( Corynebacterium < RTI ID = 0.0 > efficiens ), but is not limited thereto.

In the present invention, the host cell is Corynebacterium glutamicum KCTC12307BP-ZTCPS-GI (KCTC 12536BP) Lt; / RTI >

In the present invention, the host cell may contain a gene-initiating codon variant consisting of the nucleotide sequence of SEQ ID NO: 29 to SEQ ID NO: 35.

The present invention relates to a method for producing an amino acid comprising culturing using a host cell.

In the present invention, examples of the amino acid include L-lysine, L-threonine, L-methionine and the like, with L-lysine being preferred, but not limited thereto.

In the present invention, culturing of the transformed host cells can be carried out according to well-known methods, and the conditions such as the culture temperature, the culture time and the pH of the culture medium can be appropriately adjusted. These known culture methods are described in Chmiel et al. Bioprozesstechnik 1.Einfuhrung in Die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991), and Storhas; Bioreaktorenund periphere Einrichtungen (Vieweg Verlag, Braunschweig / Wiesbaden, 1994).

In the present invention, the culture medium of the transformed host cells should contain a suitable carbon substrate, which may be a carbon source selected from the group consisting of monosaccharides, oligosaccharides, polysaccharide substrates or mixtures thereof.

Examples of the monosaccharide include glucose and fructose. Examples of the oligosaccharide include lactose and sucrose. Examples of the polysaccharide include starch, cellulose or a mixture thereof, But are not limited thereto. As the most preferable carbon substrate, glucose, fructose, sucrose and the like can be used.

In addition to a suitable carbon source, the fermentation medium may include suitable minerals, salts, cofactors, buffers and other ingredients known to those skilled in the art which are suitable for the promotion of the enzyme pathway necessary for lysine production and for the growth of the culture.

In the present invention, the culture conditions of the transformed host cells are grown in a suitable medium at a temperature ranging from about 25 ° C to about 40 ° C. Suitable growth media for the present invention include, but are not limited to, commercially available media such as Luria Bertani (LB) liquid medium, Sabouraud Dextrose (SD) liquid medium or Yeast Medium (YM) Can be used.

Suitable pH ranges for culture are pH 5.0 to pH 9.0, wherein pH 6.0 to pH 8.0 is preferred for the initial conditions. The pH of the culture medium can be adjusted by appropriately using basic compounds (eg sodium hydroxide, potassium hydroxide or ammonia) or acidic compounds (eg phosphoric acid or sulfuric acid). Foaming can be controlled using a foaming agent such as a fatty acid polyglycol ester.

The culture can be carried out under aerobic conditions or anaerobic conditions, and oxygen or an oxygen-containing gas mixture, such as air, can be introduced into the culture medium to maintain aerobic conditions.

Culture continues until the desired amount of L-amino acid is produced. Usually for 10 to 160 hours for this purpose. L-lysine may be released into the culture medium or contained in the cells.

The culture method also includes a batch culture, a continuous culture, and a fed-batch culture, preferably a batch process or an injection batch or a batch batch process but are not limited to, continuous fed batch process.

The method of producing the amino acid of the present invention may further include a method of recovering the lysine produced in the culturing step. The method of recovering amino acids, particularly L-lysine, can be carried out by separating L-lysine from cells or culture medium by methods well known in the art.

Examples of the L-lysine recovery method include filtration, ion exchange chromatography, crystallization and HPLC, but the present invention is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.

<Examples>

The strains used in the following examples were Corynebacterium glutamicum KCTC12307BP and E. coli DH5a.

The Corynebacterium glutamicum KCTC12307BP was prepared by adding 5 g of glucose, 2.5 g of NaCl, 5.0 g of yeast extract, 1.0 g of urea, 10.0 g of polypeptone and 5.0 g of beef extract to CM-broth medium pH 6.8) at 30 &lt; 0 &gt; C.

The E. coli DH5a was cultured at 37 DEG C on an LB medium of 10.0 g of tryptone, 10.0 g of NaCl and 5.0 g of yeast extract (in 1 L of distilled water).

Antibiotics (Ampicillin, Kanamycin, Chloramphenicol) were purchased from Sigma, and DNA sequencing analysis was performed with Macrogen.

&Lt; Example 1 >

1-1. Corynebacterium Glutamicum KCTC12307BP  origin zwf of The initiation codon ATG Of the gene Cloning  And production of recombinant vectors

In this example, the chromosomal DNA of C. glutamicum KCTC12307BP was used as a template, the nucleotide sequence of the zwf gene (Gene ID: 3345621) was secured based on NCBI, and primers for substituting the initiation codon were prepared as shown in Table 1 Respectively.

First, PCR was performed with SEQ ID NO: 1 and SEQ ID NO: 2 to obtain a fragment of 800 bp in size. PCR was performed with SEQ ID NO: 3 and SEQ ID NO: 4 to obtain a fragment of 4 kb in size. , And a 4.8 kb fragment was obtained by performing overlapping PCR with SEQ ID NOS: 1 and 4.

primer Base sequence SEQ ID NO: PKz-1F GCTCTAGA GACGTTGAGATCGACAAG One PKz-1R CACTACCATCATGAGCAC 2 PKz-2F GTGCTCATGATGGTAGTG 3 PKz-2R GGGGTACC GAGTTGCACGCTCTGAAG 4

The obtained fragments were subjected to restriction enzyme treatment with XbaI and KpnI, respectively, and digested with restriction enzymes using the same XbaI and KpnI in pCGI vector (Kim et al., 2011., J. Microbiol. Qiagen, Hilden, Germany), cloned with T4 DNA ligase, and transformed into E. coli DH5a.

Selection of plasmid-containing cells was carried out on LB (Luria-Bertani) agar plates containing kanamycin (50 占 퐂 / ml) and allowed to stand at 37 占 폚 for 18 hours.

Plasmid identification of the resulting colonies was performed using a plasmid miniprep kit (Qiagen, Hilden, Germany) and treated with XbaI and KpnI restriction enzymes used for cloning to identify the gene fragments, , And this vector was named PKz.

1-2. vector PKz Transformed with Corynebacterium Glutamicum  Lysine Production strain  making

In order to transform C. glutamicum into a vector in which the zwf gene inserted in the pCGI vector (Kim et al., 2011., J. Microbiol., Methods) was replaced with an initiation codon, C. glutamicum KCTC12307BP was transfected into a water- competent cell.

The cells were cultured in 10 ml of CM-broth medium at 30 ° C overnight. The pre-cultured cells were inoculated in 100 ml of BHIS medium (37 g of BHI, 100 ml of 2 M sorbitol (based on 1 L of distilled water)] to an OD (600 nm) of 0.2-0.3, and OD (600 nm) And incubated for 6 hours until it reached 0.9.

The culture solution was placed in a prechilled tube and washed repeatedly with 3-4 times 10% glycerol at 4 ° C at 5000 rpm to recover the cells. The cells were suspended in 10% glycerol, Lt; RTI ID = 0.0 &gt; -70 C. &lt; / RTI &gt;

The construct made using the water-soluble cells was transformed with a 0.2 cm cuvet of electroporation with a pulser of BIO-RAD. Thereafter, 1 ml of CM-broth medium was added, followed by shaking culture at 200 rpm and 30 ° C for 2 hours. The cells were plated on BHIS (Brain Heart Infusion) agar plates containing kanamycin (25 μg / ml) And allowed to stand for 40 hours.

The resulting colonies were cultured in 200 B BHIS medium at 30 째 C and 200 rpm overnight to be used for secondary recombination, and the culture was diluted to 1: 1000 and added to a CM agar plate containing streptomycin (40 / / ml) After allowing to stand at 30 ° C for 72 hours, the resulting colonies were again confirmed to be resistant to kanamycin, confirmed by PCR, and confirmed by DNA sequencing. The prepared strain was named KCTC12307BP-Z.

&Lt; Example 2 >

2-1. Corynebacterium Glutamicum KCTC12307BP  origin tkt of The initiation codon ATG Of the gene Cloning  And production of recombinant vectors

In this example, the chromosomal DNA of C. glutamicum (KCTC12307BP) was used as a template, the nucleotide sequence of the tkt gene (Gene ID: 3343601) was secured based on NCBI, Respectively.

First, PCR was performed with SEQ ID NO: 5 and SEQ ID NO: 6 to obtain a fragment of 1 kb in size. PCR was performed with SEQ ID NO: 7 and SEQ ID NO: 8 to obtain a fragment of about 1 kb in size. , And a 2 kb fragment was obtained by performing overlapping PCR with SEQ ID NOS: 5 and 8.

primer Base sequence SEQ ID NO: PKt-1F ACGCGTCGACGGCGACCTGGATTCCTACCTC 5 PKt-1R CAGCGTCAAGGTGGTCATGGGTAAAAAATCCTTTCG 6 PKt-2F CGAAAGGATTTTTTACCCATGACCACCTTGACGCTG 7 PKt-2R GCTCTAGACCGATGATGGTGCGAACG 8

The obtained fragments were subjected to restriction enzyme treatment with SalI and XbaI, respectively, and digested with restriction enzymes using the same SalI and XbaI in a pCGI vector (Kim et al., 2011., J. Microbiol. Qiagen, Hilden, Germany), cloned with T4 DNA ligase, and transformed into E. coli DH5a.

Selection of plasmid-containing cells was carried out on LB (Luria-Bertani) agar plates containing kanamycin (50 占 퐂 / ml) and allowed to stand at 37 占 폚 for 18 hours.

Plasmid identification of the resulting colonies was performed using a plasmid miniprep kit (Qiagen, Hilden, Germany) and treated with SalI and XbaI restriction enzymes used for cloning to identify the gene fragments, , And this vector was named PKt.

2-2. vector PKt Transformed with Corynebacterium Glutamicum  Lysine Production strain  making

KCTC12307BP-Z was prepared as a competent cell in order to transform a vector having the inserted tkt gene inserted into the pCGI vector (Kim et al., 2011., J. Microbiol.

And cultured in 10 ml of CM-broth medium at a temperature of 30 DEG C overnight. The pre-cultured cells were inoculated in 100 ml of BHIS medium at 0.2-0.3, and cultured at 30 DEG C and 180 rpm for 6 hours until OD (600 nm) reached 0.8-0.9.

The cells were washed with 10% glycerol at 3-4 times at 5000 rpm at 4 ° C, and the cells were recovered. The cells were suspended in 10% glycerol and dispensed into 100 μl aliquots. Lt; 0 &gt; C.

The construct made using the water-soluble cells was transformed with a 0.2 cm cuvet of electroporation with a pulser of BIO-RAD. Thereafter, 1 ml of CM-broth medium was added, followed by shaking culture at 200 rpm and 30 ° C for 2 hours. The culture was applied to a BHIS (Brain Heart Infusion) agar plate containing kanamycin (25 μg / ml) Lt; / RTI &gt; for 40 hours.

The resulting colonies were cultured in 200 B BHIS medium at 30 째 C and 200 rpm overnight to be used for secondary recombination, and the culture was diluted to 1: 1000 and added to a CM agar plate containing streptomycin (40 / / ml) After staining and incubation at 30 ° C for 72 hours, the resulting colonies were again confirmed to be resistant to kanamycin and confirmed by PCR and confirmed by DNA sequencing. The prepared strain was named KCTC12307BP-ZT.

       &Lt; Example 3 >

3-1. Corynebacterium Glutamicum KCTC12307BP  origin lysC of The initiation codon ATG Of the gene Cloning  And production of recombinant vectors

In this example, the chromosomal DNA of C. glutamicum (KCTC12307BP) was used as a template, the nucleotide sequence of the lysC gene (Gene ID: 3345161) was secured based on NCBI, Respectively.

First, PCR was performed with SEQ ID NO: 9 and SEQ ID NO: 10 to obtain a fragment of about 1000 bp. PCR was performed by SEQ ID NO: 11 and SEQ ID NO: 12 to obtain a fragment of about 750 bp. Nested PCR was performed with SEQ ID NOS: 9 and 12 as template to obtain a fragment of 1.8 kb in size.

primer Base sequence SEQ ID NO: PKc-1F CAAGCTTGGTAGCCCAGAAGATTTCAGTTC 9 PKc-1R TACGACCAGGGCCATGGGTAAAAAATCCTTTCGTAGG 10 PKc-2F ATTTTTTACCCATGGCCCTGGTCGTACAGAAATATG 11 PKc-2R CGAATTCGGTCAGCGGTATACACACCGTCAAC 12

The obtained fragments were subjected to restriction enzyme treatment with HindIII and EcoRI, respectively, and digested with restriction enzymes using the same HindIII and EcoRI to a pCGI vector (Kim et al., 2011., J. Microbiol. Qiagen, Hilden, Germany), cloned with T4 DNA ligase, and transformed into E. coli DH5a.

Selection of plasmid-containing cells was carried out on LB (Luria-Bertani) agar plates containing kanamycin (50 占 퐂 / ml) and allowed to stand at 37 占 폚 for 18 hours.

Plasmid identification of the resulting colonies was performed using a plasmid miniprep kit (Qiagen, Hilden, Germany) and the fragment was digested with HindIII and EcoRI restriction enzymes used for cloning, , And this vector was named PKc.

3-2. vector PKc Transformed with Corynebacterium Glutamicum  Lysine Production strain  making

A vector having the inserted tkt gene inserted into the pCGI vector (Kim et al., 2011., J. Microbiol., Methods) was inserted into a KCTC12307BP-ZT competent cell for transformation.

And cultured in 10 ml of CM-broth medium at a temperature of 30 DEG C overnight. The pre-cultured cells were inoculated in 100 ml of BHIS medium to an OD (600 nm) of 0.2-0.3, and cultured at 30 ° C and 180 rpm for 6 hours until OD (600 nm) reached 0.8-0.9.

The culture solution was placed in a prechilled tube and washed repeatedly with 3-4 times 10% glycerol at 5000 rpm at 4 ° C to recover the cells. The cells were suspended in 10% glycerol, And stored at -70 &lt; 0 &gt; C.

The construct made using the water-soluble cells was transformed with a 0.2 cm cuvet of electroporation with a pulser of BIO-RAD. Thereafter, 1 ml of CM-broth medium was added, followed by shaking culture at 200 rpm and 30 ° C for 2 hours. The cells were plated on BHIS (Brain Heart Infusion) agar plates containing kanamycin (25 μg / ml) And allowed to stand for 40 hours.

The resulting colonies were cultured in 200 B BHIS medium at 30 째 C and 200 rpm overnight to be used for secondary recombination, and the culture was diluted to 1: 1000 and added to a CM agar plate containing streptomycin (40 / / ml) After staining and incubation at 30 ° C for 72 hours, the resulting colonies were again confirmed to be resistant to kanamycin, confirmed by PCR, and confirmed by DNA sequencing. The prepared strain was named KCTC12307BP-ZTC.

<Example 4>

4-1. Corynebacterium Glutamicum KCTC12307BP  origin pycA of The initiation codon ATG Of the gene Cloning  And production of recombinant vectors

In this example, the chromosomal DNA of C. glutamicum (KCTC12307BP) was used as a template, the nucleotide sequence of pycA gene (Gene ID: 3344537) was obtained based on NCBI, Respectively.

First, PCR was performed with SEQ ID NO: 13 and SEQ ID NO: 14 to obtain a fragment of about 800 bp. PCR was performed with SEQ ID NO: 15 and SEQ ID NO: 16 to obtain a fragment of about 620 bp. Overlapping PCR was carried out with SEQ ID NOS: 13 and 16 as templates and a fragment of 1.3 kb in size was obtained.

primer Base sequence SEQ ID NO: PKp-1F GGCTCTAGAGCCACGGTTTTGTGAAGC 13 PKp-1R GTGTGAGTCGACATTAGAGT 14 PKp-2F ACTCTAATGTCGACTCACAC 15 PKp-2R TGTGAATTCACATATACCGCGCCATCG 16

The obtained fragments were subjected to restriction enzyme treatment with XbaI and EcoRI, respectively, and digested with restriction enzymes using the same XbaI and EcoRI in a pCGI vector (Kim et al., 2011., J. Microbiol. (Qiagen), Hilden, Germany), cloned using T4 DNA ligase, and transformed into E. coli DH5a.

Selection of plasmid-containing cells was carried out on LB (Luria-Bertani) agar plates containing kanamycin (50 占 퐂 / ml) and allowed to stand at 37 占 폚 for 18 hours.

Plasmid identification of the resulting colonies was performed using a plasmid miniprep kit (Qiagen, Hilden, Germany), and XbaI and EcoRI restriction enzymes used for cloning were used to identify the gene fragments, The nucleotide sequence of the gene was confirmed, and this vector was named PKp.

4-2. vector PKp Transformed with Corynebacterium Glutamicum  Lysine Production strain  making

A KCTC12307BP-ZTC competent cell was constructed to transform the vector into which the pyc gene inserted with the initiation codon was confirmed in the pCGI vector (Kim et al., 2011., J. Microbiol.

And cultured in 10 ml of CM-broth medium at a temperature of 30 DEG C overnight. The pre-cultured cells were inoculated in 100 ml of BHIS medium to an OD (600 nm) of 0.2-0.3, and cultured at 30 ° C and 180 rpm for 6 hours until OD (600 nm) reached 0.8-0.9.

The culture solution was placed in a prechilled tube and washed repeatedly with 3-4 times 10% glycerol at 5000 rpm at 4 ° C to recover the cells. The cells were suspended in 10% glycerol, And stored at -70 &lt; 0 &gt; C.

The construct made using the water-soluble cells was transformed with a 0.2 cm cuvet of electroporation with a pulser of BIO-RAD. Thereafter, 1 ml of CM-broth medium was added, followed by shaking culture at 200 rpm and 30 ° C for 2 hours. The cells were plated on BHIS (Brain Heart Infusion) agar plates containing kanamycin (25 μg / ml) And allowed to stand for 40 hours.

The resulting colonies were cultured in 200 B BHIS medium at 30 째 C and 200 rpm overnight to be used for secondary recombination, and the culture was diluted to 1: 1000 and added to a CM agar plate containing streptomycin (40 / / ml) After staining and incubation at 30 ° C for 72 hours, the resulting colonies were again confirmed to be resistant to kanamycin and confirmed by PCR and confirmed by DNA sequencing. The prepared strain was named KCTC12307BP-ZTCP.

&Lt; Example 5 >

5-1. Corynebacterium Glutamicum KCTC12307BP  origin scrB of The initiation codon ATG Of the gene Cloning  And production of recombinant vectors

In this example, the chromosomal DNA of C. glutamicum KCTC12307BP was used as a template, the nucleotide sequence of the scrB gene (Gene ID: 3345082) was secured based on NCBI, and the primers for substituting the initiation codon were prepared as shown in Table 5 Respectively.

First, PCR was performed with SEQ ID NO: 17 and SEQ ID NO: 18 to obtain a fragment of about 750 bp. PCR was performed by SEQ ID NO: 19 and SEQ ID NO: 20 to obtain a fragment of about 600 bp in size. Overlapping PCR was carried out with SEQ ID NOS: 16 and 20 as templates and a fragment of 1.3 kb in size was obtained.

primer Base sequence SEQ ID NO: PKs-1F GGATCCACAGCTACTTCAAAACCA 17 PKs-1R AGCCCCACACATTACTTTCC 18 PKs-2F AGGAAAGTAATGTGTGGGGC 19 PKs-2R GAATTCTGCACCGGTGAGGTTTTCG 20

The obtained fragments were subjected to restriction enzyme treatment with BamHI and EcoRI, respectively, and digested with restriction enzymes using the same BamHI and EcoRI as in pCGI vector (Kim et al., 2011., J. Microbiol. Qiagen, Hilden, Germany), cloned with T4 DNA ligase, and transformed into E. coli DH5a.

Selection of plasmid-containing cells was carried out on LB (Luria-Bertani) agar plates containing kanamycin (50 占 퐂 / ml) and allowed to stand at 37 占 폚 for 18 hours.

Plasmid identification of the resulting colonies was performed using a plasmid miniprep kit (Qiagen, Hilden, Germany), treated with BamHI and EcoRI restriction enzymes used for cloning to identify fragments of the gene, , And this vector was named PKs.

5-2. vector PKs Lt; / RTI &gt; Glutamicum  Lysine Production strain  making

A vector having the scrB gene inserted with the initiation codon substituted in the pCGI vector (Kim et al., 2011., J. Microbiol., Methods) was transformed into KCTC12307BP-ZTCP competent cells.

And cultured in 10 ml of CM-broth medium at a temperature of 30 DEG C overnight. The pre-cultured cells were inoculated in 100 ml of BHIS medium to an OD (600 nm) of 0.2-0.3, and cultured at 30 ° C and 180 rpm for 6 hours until OD (600 nm) reached 0.8-0.9.

The culture solution was placed in a prechilled tube and washed repeatedly with 3-4 times 10% glycerol at 5000 rpm at 4 ° C to recover the cells. The cells were suspended in 10% glycerol, And stored at -70 &lt; 0 &gt; C.

The construct made using the water-soluble cells was transformed with a 0.2 cm cuvet of electroporation with a pulser of BIO-RAD. Thereafter, 1 ml of CM-broth medium was added, followed by shaking culture at 200 rpm and 30 ° C for 2 hours. The cells were plated on BHIS (Brain Heart Infusion) agar plates containing kanamycin (25 μg / ml) And allowed to stand for 40 hours.

The resulting colonies were cultured in 200 B BHIS medium at 30 째 C and 200 rpm overnight to be used for secondary recombination, and the culture was diluted to 1: 1000 and added to a CM agar plate containing streptomycin (40 / / ml) After staining and incubation at 30 ° C for 72 hours, the resulting colonies were again confirmed to be resistant to kanamycin and confirmed by PCR and confirmed by DNA sequencing. The prepared strain was named KCTC12307BP-ZTCPS.

&Lt; Example 6 >

One. Corynebacterium Glutamicum KCTC12307BP  origin gdh of The initiation codon GTG Of the gene Cloning  And production of recombinant vectors

In this example, the chromosomal DNA of C. glutamicum KCTC12307BP was used as a template, the nucleotide sequence of the gdh gene (Gene ID: 3343980) was secured based on NCBI, and primers for substituting the initiation codon were prepared as shown in Table 6 Respectively.

First, PCR was performed with SEQ ID NO: 21 and SEQ ID NO: 22 to obtain a fragment of about 730 bp. PCR was performed by SEQ ID NO: 23 and SEQ ID NO: 24 to obtain a fragment of about 550 bp. Overlapping PCR was carried out with SEQ ID NOS: 21 and 24 as templates and a fragment of 1.3 kb in size was obtained.

primer Base sequence SEQ ID NO: PKg-1F AAGCTTTGTTTCAAGTCTAAC 21 PKg-1R CAACTGTCACGATTTCCTCG 22 PKg-2F CGAGGAAATCGTGACAGTT 23 PKg-2R GAATTCGTAACCGATCTCGCGGC 24

The obtained fragments were subjected to restriction enzyme treatment with HindIII and EcoRI, respectively, and digested with restriction enzymes using the same HindIII and EcoRI to a pCGI vector (Kim et al., 2011., J. Microbiol. Qiagen, Hilden, Germany), cloned with T4 DNA ligase, and transformed into E. coli DH5a.

Selection of plasmid-containing cells was carried out on LB (Luria-Bertani) agar plates containing kanamycin (50 占 퐂 / ml) and allowed to stand at 37 占 폚 for 18 hours.

Plasmid identification of the resulting colonies was performed using a plasmid miniprep kit (Qiagen, Hilden, Germany), and the fragment was identified by HindIII and EcoRI restriction enzymes used for cloning, The nucleotide sequence of the gene was confirmed, and this vector was named PKg.

6-2. vector PKg Lt; / RTI &gt; Glutamicum  Lysine Production strain  making

A vector having the inserted gdh gene in which the initiation codon was substituted in the pCGI vector (Kim et al., 2011., J. Microbiol., Methods) was transformed into KCTC12307BP-ZTCPS competent cells for transformation.

And cultured in 10 ml of CM-broth medium at a temperature of 30 DEG C overnight. The pre-cultured cells were inoculated in 100 ml of BHIS medium to an OD (600 nm) of 0.2-0.3, and cultured at 30 ° C and 180 rpm for 6 hours until OD (600 nm) reached 0.8-0.9.

The culture solution was placed in a prechilled tube and washed repeatedly with 3-4 times 10% glycerol at 4 ° C at 5000 rpm to recover the cells. The cells were suspended in 10% glycerol, Lt; RTI ID = 0.0 &gt; -70 C. &lt; / RTI &gt;

The construct made using the water-soluble cells was transformed with a 0.2 cm cuvet of electroporation with a pulser of BIO-RAD. Thereafter, 1 ml of CM-broth medium was added, followed by shaking culture at 200 rpm and 30 ° C for 2 hours. The cells were plated on BHIS (Brain Heart Infusion) agar plates containing kanamycin (25 μg / ml) And allowed to stand for 40 hours.

The resulting colonies were cultured in 200 B BHIS medium at 30 째 C and 200 rpm overnight to be used for secondary recombination, and the culture was diluted to 1: 1000 and added to a CM agar plate containing streptomycin (40 / / ml) After staining and incubation at 30 ° C for 72 hours, the resulting colonies were again confirmed to be resistant to kanamycin and confirmed by PCR and confirmed by DNA sequencing. The prepared strain was named KCTC12307BP-ZTCPS-G.

&Lt; Example 7 >

7-1. Corynebacterium Glutamicum KCTC12307BP  origin icd of The initiation codon GTG Of the gene Cloning  And production of recombinant vectors

In this example, the chromosomal DNA of C. glutamicum KCTC12307BP was used as a template, the nucleotide sequence of the icd gene (Gene ID: 3345662) was obtained based on NCBI, and the primers for substituting the initiation codon were prepared as shown in Table 7 Respectively.

First, PCR was performed with SEQ ID NO: 25 and SEQ ID NO: 26 to obtain a fragment of about 800 bp. PCR was performed by SEQ ID NO: 27 and SEQ ID NO: 28 to obtain a fragment of about 750 bp. Overlapping PCR was carried out with SEQ ID NOS: 25 and 28 as templates and a fragment of 1.5 kb in size was obtained.

primer Base sequence SEQ ID NO: PK1-1F GTCGACGCCAAACTTCCCGAAGACTC 25 PKi-1R ATGATCTTAGCCATGAGTCTCCTTGGTTG 26 PKi-2F CAACCAAGGAGACTCATGGCTAAGATCATC 27 PKi-2R GAGCTCGGAGAAGAGGATACCTTCTGCCTTTG 28

The obtained fragments were subjected to restriction enzyme treatment with SalI and SacI, respectively, and digested with restriction enzymes using the same SalI and SacI as in pCGI vector (Kim et al., 2011., J. Microbiol. Qiagen, Hilden, Germany), then cloned using T4 DNA ligase and transformed into E. coli DH5a.

Selection of plasmid-containing cells was carried out on LB (Luria-Bertani) agar plates containing kanamycin (50 占 퐂 / ml) and allowed to stand at 37 占 폚 for 18 hours.

Plasmid identification of the resulting colonies was performed using a plasmid miniprep kit (Qiagen, Hilden, Germany) and treated with SalI and SacI restriction enzymes used for cloning to identify fragments of the gene, The nucleotide sequence of the gene was confirmed, and this vector was named PKi.

7-2. vector PKi Lt; / RTI &gt; Glutamicum  Lysine Production strain  making

In order to transform a vector in which an icd gene inserted with the initiation codon was inserted into the pCGI vector (Kim et al., 2011., J. Microbiol. Methods), KCTC12307BP-ZTCPS-G was prepared as a competent cell Respectively.

And cultured in 10 ml of CM-broth medium at a temperature of 30 DEG C overnight. The pre-cultured cells were inoculated in 100 ml of BHIS medium to an OD (600 nm) of 0.2-0.3, and cultured at 30 ° C and 180 rpm for 6 hours until OD (600 nm) reached 0.8-0.9.

The culture solution was placed in a prechilled tube and washed repeatedly with 3-4 times 10% glycerol at 5000 rpm at 4 ° C to recover the cells. The cells were suspended in 10% glycerol, And stored at -70 &lt; 0 &gt; C.

The construct made using the water-soluble cells was transformed with a 0.2 cm cuvet of electroporation with a pulser of BIO-RAD. Thereafter, 1 ml of CM-broth medium was added, followed by shaking culture at 200 rpm and 30 ° C for 2 hours. The cells were plated on BHIS (Brain Heart Infusion) agar plates containing kanamycin (25 μg / ml) And allowed to stand for 40 hours.

The resulting colonies were cultured in 200 B BHIS medium at 30 째 C and 200 rpm overnight to be used for secondary recombination, and the culture broth was diluted 1: 1000 and added to CM agar plates containing streptomycin (40 / / ml) After incubation at 30 DEG C for 72 hours, the resulting colonies were again confirmed to be resistant to kanamycin, confirmed by PCR, confirmed by DNA sequencing, and the finally produced lysine producing strain was designated &quot; Corynebacterium glue Tumicum KCTC12307BP-ZTCPS-GI &quot;, deposited with KCTC, Korea Research Institute of Bioscience & Biotechnology on Dec. 24, 2013 under accession number KCTC 12536BP.

< Example  8> Production of L-lysine

L-lysine production of Corynebacterium glutamicum KCTC12307BP strain and Corynebacterium glutamicum KCTC12307BP-ZTCPS-GI, a lysine producing strain produced in Example 7, was carried out as follows.

Corynebacterium glutamicum KFCC12307BP and Corynebacterium glutamicum KCTC12307BP-ZTCPS-GI were inoculated into 250 ml flasks containing 50 ml of CM medium and shaken at 30 DEG C for 16 hours at 180 rpm. Lt; / RTI &gt;

50 ml of the following L-lysine medium was added to a 250 ml flask, and 5 ml of shake-cultured cells were inoculated in CM medium and cultured under shaking conditions at 30 DEG C and 180 rpm for 70 hours. After completion of the incubation, lysine analysis was carried out by derivatization with o- phthalaldehyde (Hill DW et al., 1979. Anal Chem 51: 1338) and the amount of L-lysine produced was measured by HPLC (Shimazu, Japan) 8.

As shown in Table 8 below, it was confirmed that L-lysine of KCTC12307BP-ZTCPS-GI in which PKz, PKt, PKc, PKp, PKs, PKg and PKi were simultaneously inserted was increased by 7.4% than that of the parent strain KFCC12307BP .

[L-lysine medium composition (pH 7.0)]

(63 g of raw sugar, 35 g of (NH4) 2SO4, 0.6 g of KH2PO4, 0.4 g of MgSO4 占 O 2O, 2 mg of MnSO4 占 H2O, 2 mg of FeSO4 占 O 2O, 0.3 mg of Thiamine 占 H HCl, 1 mg of Biotin, )

Strain L-lysine (g / l) ratio KCTC12307BP 31.2 100 KCTC12307BP-ZTCPS 33.5 107.4 KCTC12307BP-ZTCPS-GI 36.1 115.7

As described above, it was confirmed that the L-lysine production amount of KCTC12307BP-ZTCPS substituted with the optimal translation initiation sequence (ATG) for enhancing the lysine biosynthetic pathway was increased by 7.4% than that of the parent strain.

On the other hand, when the initiation sequence of the gdh and icd gene related to the by-product production in the strain KCTC12307BP-ZTCPS, which is substituted with ATG and enhanced the substrate flow to the biosynthetic pathway, was replaced with GTG having low translational efficiency, And 15.7%, respectively.

Korea Biotechnology Research Institute KCTC12536BP 20131224

<110> Paik Kwang Ind. Co. Ltd <120> Recombinant vector comprising start codon derived from Coryne          form bacteria, transformed host cell and method for producing          amino acid using the same <130> 9398 <160> 35 <170> Kopatentin 2.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 gctctagaga cgttgagatc gacaag 26 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 cactaccatc atgagcac 18 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 3 gtgctcatga tggtagtg 18 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 4 ggggtaccga gttgcacgct ctgaag 26 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 5 acgcgtcgac ggcgacctgg attcctacct c 31 <210> 6 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 6 cagcgtcaag gtggtcatgg gtaaaaaatc ctttcg 36 <210> 7 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 7 cgaaaggatt ttttacccat gaccaccttg acgctg 36 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 8 gctctagacc gatgatggtg cgaacg 26 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 9 caagcttggt agcccagaag atttcagttc 30 <210> 10 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 10 tacgaccagg gccatgggta aaaaatcctt tcgtagg 37 <210> 11 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 11 attttttacc catggccctg gtcgtacaga aatatg 36 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 12 cgaattcggt cagcggtata cacaccgtca ac 32 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 13 ggctctagag ccacggtttt gtgaagc 27 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 14 gtgtgagtcg acattagagt 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 15 actctaatgt cgactcacac 20 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 16 tgtgaattca catataccgc gccatcg 27 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 17 ggatccacag ctacttcaaa acca 24 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 18 agccccacac attactttcc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 19 aggaaagtaa tgtgtggggc 20 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 20 gaattctgca ccggtgaggt tttcg 25 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 21 aagctttgtt tcaagtctaa c 21 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 22 caactgtcac gatttcctcg 20 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 23 cgaggaaatc gtgacagtt 19 <210> 24 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 24 gaattcgtaa ccgatctcgc ggc 23 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 25 gtcgacgcca aacttcccga agactc 26 <210> 26 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 26 atgatcttag ccatgagtct ccttggttg 29 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 27 caaccaagga gactcatggc taagatcatc 30 <210> 28 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 28 gagctcggag aagaggatac cttctgcctt tg 32 <210> 29 <211> 1545 <212> DNA <213> Artificial Sequence <220> <223> zwf with substituted start codon <400> 29 atgagcacaa acacgacccc ctccagctgg acaaacccac tgcgcgaccc gcaggataaa 60 cgactccccc gcatcgctgg cccttccggc atggtgatct tcggtgtcac tggcgacttg 120 gctcgaaaga agctgctccc cgccatttat gatctagcaa accgcggatt gctgccccca 180 ggattctcgt tggtaggtta cggccgccgc gaatggtcca aagaagactt tgaaaaatac 240 gtacgcgatg ccgcaagtgc tggtgctcgt acggaattcc gtgaaaatgt ttgggagcgc 300 ctcgccgagg gtatggaatt tgttcgcggc aactttgatg atgatgcagc tttcgacaac 360 ctcgctgcaa cactcaagcg catcgacaaa acccgcggca ccgccggcaa ctgggcttac 420 tacctgtcca ttccaccaga ttccttcaca gcggtctgcc accagctgga gcgttccggc 480 atggctgaat ccaccgaaga agcatggcgc cgcgtgatca tcgagaagcc tttcggccac 540 aacctcgaat ccgcacacga gctcaaccag ctggtcaacg cagtcttccc agaatcttct 600 gtgttccgca tcgaccacta tttgggcaag gaaacagttc aaaacatcct ggctctgcgt 660 tttgctaacc agctgtttga gccactgtgg aactccaact acgttgacca cgtccagatc 720 accatggctg aagatattgg cttgggtgga cgtgctggtt actacgacgg catcggcgca 780 gcccgcgacg tcatccagaa ccacctgatc cagctcttgg ctctggttgc catggaagaa 840 ccaatttctt tcgtgccagc gcagctgcag gcagaaaaga tcaaggtgct ctctgcgaca 900 aagccgtgct acccattgga taaaacctcc gctcgtggtc agtacgctgc cggttggcag 960 ggctctgagt tagtcaaggg acttcgcgaa gaagatggct tcaaccctga gtccaccact 1020 gagacttttg cggcttgtac cttagagatc acgtctcgtc gctgggctgg tgtgccgttc 1080 tacctgcgca ccggtaagcg tcttggtcgc cgtgttactg agattgccgt ggtgtttaaa 1140 gacgcaccac accagccttt cgacggcgac atgactgtat cccttggcca aaacgccatc 1200 gtgattcgcg tgcagcctga tgaaggtgtg ctcatccgct tcggttccaa ggttccaggt 1260 tctgccatgg aagtccgtga cgtcaacatg gacttctcct actcagaatc cttcactgaa 1320 gaatcacctg aagcatacga gcgcctcatt ttggatgcgc tgttagatga atccagcctc 1380 ttccctacca acgaggaagt ggaactgagc tggaagattc tggatccaat tcttgaagca 1440 tgggatgccg atggagaacc agaggattac ccagcgggta cgtggggtcc aaagagcgct 1500 gatgaaatgc tttcccgcaa cggtcacacc tggcgcaggc cataa 1545 <210> 30 <211> 2103 <212> DNA <213> Artificial Sequence <220> <223> tkt with substituted start codon <400> 30 atgaccacct tgacgctgtc acctgaactt caggcgctca ctgtacgcaa ttacccctct 60 gattggtccg atgtggacac caaggctgta gacactgttc gtgtcctcgc tgcagacgct 120 gtagaaaact gtggctccgg ccacccaggc accgcaatga gcctggctcc ccttgcatac 180 accttgtacc agcgggttat gaacgtagat ccacaggaca ccaactgggc aggccgtgac 240 cgcttcgttc tttcttgtgg ccactcctct ttgacccagt acatccagct ttacttgggt 300 ggattcggcc ttgagatgga tgacctgaag gctctgcgca cctgggattc cttgacccca 360 ggacaccctg agtaccgcca caccaagggc gttgagatca ccactggccc tcttggccag 420 ggtcttgcat ctgcagttgg tatggccatg gctgctcgtc gtgagcgtgg cctattcgac 480 ccaaccgctg ctgagggcga atccccattc gaccaccaca tctacgtcat tgcttctgat 540 ggtgacctgc aggaaggtgt cacctctgag gcatcctcca tcgctggcac ccagcagctg 600 ggcaacctca tcgtgttctg ggatgacaac cgcatctcca tcgaagacaa cactgagatc 660 gctttcaacg aggacgttgt tgctcgttac aaggcttacg gctggcagac cattgaggtt 720 gaggctggcg aggacgttgc agcaatcgaa gctgcagtgg ctgaggctaa gaaggacacc 780 aagcgaccta ccttcatccg cgttcgcacc atcatcggct tcccagctcc aactatgatg 840 aacaccggtg ctgtgcacgg tgctgctctt ggcgcagctg aggttgcagc aaccaagact 900 gagcttggat tcgatcctga ggctcacttc gcgatcgacg atgaggttat cgctcacacc 960 cgctccctcg cagagcgcgc tgcacagaag aaggctgcat ggcaggtcaa gttcgatgag 1020 tgggcagctg ccaaccctga gaacaaggct ctgttcgatc gcctgaactc ccgtgagctt 1080 ccagcgggct acgctgacga gctcccaaca tgggatgcag atgagaaggg cgtcgcaact 1140 cgtaaggctt ccgaggctgc acttcaggca ctgggcaaga cccttcctga gctgtggggc 1200 ggttccgctg acctcgcagg ttccaacaac accgtgatca agggctcccc ttccttcggc 1260 cctgagtcca tctccaccga gacctggtct gctgagcctt acggccgtaa cctgcacttc 1320 ggtatccgtg agcacgctat gggatccatc ctcaacggca tttccctcca cggtggcacc 1380 cgcccatacg gcggaacctt cctcatcttc tccgactaca tgcgtcctgc agttcgtctt 1440 gcagctctca tggagaccga cgcttactac gtctggaccc acgactccat cggtctgggc 1500 gaagatggcc caacccacca gcctgttgaa accttggctg cactgcgcgc catcccaggt 1560 ctgtccgtcc tgcgtcctgc agatgcgaac gagaccgccc aggcttgggc tgcagcactt 1620 gagtacaagg aaggccctaa gggtcttgca ctgacccgcc agaacgttcc tgttctggaa 1680 ggcaccaagg agaaggctgc tgaaggcgtt cgccgcggtg gctacgtcct ggttgagggt 1740 tccaaggaaa ccccagatgt gatcctcatg ggctccggct ccgaggttca gcttgcagtt 1800 aacgctgcga aggctctgga agctgagggc gttgcagctc gcgttgtttc cgttccttgc 1860 tgcaggagg accgctcgtg tgtctgttga agctggcatc gcaatgcctt ggtaccgctt cttgggcacc 1980 cagggccgtg ctgtctccct tgagcacttc ggtgcttctg cggattacca gaccctgttt 2040 gagaagttcg gcatcaccac cgatgcagtc gtggcagcgg ccaaggactc cattaacggt 2100 taa 2103 <210> 31 <211> 1266 <212> DNA <213> Artificial Sequence <220> <223> lysC with substituted start codon <400> 31 atggccctgg tcgtacagaa atatggcggt tcctcgcttg agagtgcgga acgcattaga 60 aacgtcgctg aacggatcgt tgccaccaag aaggctggaa atgatgtcgt ggttgtctgc 120 tccgcaatgg gagacaccac ggatgaactt ctagaacttg cagcggcagt gaatcccgtt 180 ccgccagctc gtgaaatgga tatgctcctg actgctggtg agcgtatttc taacgctctc 240 gtcgccatgg ctattgagtc ccttggcgca gaagcccaat ctttcacggg ctctcaggct 300 ggtgtgctca ccaccgagcg ccacggaaac gcacgcattg ttgatgtcac tccaggtcgt 360 gtgcgtgaag cactcgatga gggcaagatc tgcattgttg ctggtttcca gggtgttaat 420 aaagaaaccc gcgatgtcac cacgttgggt cgtggtggtt ctgacaccac tgcagttgcg 480 ttggcagctg ctttgaacgc tgatgtgtgt gagatttact cggacgttga cggtgtgtat 540 accgctgacc cgcgcatcgt tcctaatgca cagaagctgg aaaagctcag cttcgaagaa 600 atgctggaac ttgctgctgt tggctccaag attttggtgc tgcgcagtgt tgaatacgct 660 cgtgcattca atgtgccact tcgcgtacgc tcgtcttata gtaatgatcc cggcactttg 720 attgccggct ctatggagga tattcctgtg gaagaagcag tccttaccgg tgtcgcaacc 780 gacaagtccg aagccaaagt aaccgttctg ggtatttccg ataagccagg cgaggctgcg 840 aaggttttcc gtgcgttggc tgatgcagaa atcaacattg acatggttct gcagaacgtc 900 tcttctgtag aagacggcac caccgacatc accttcacct gccctcgttc cgacggccgc 960 cgcgcgatgg agatcttgaa gaagcttcag gttcagggca actggaccaa tgtgctttac 1020 gacgaccagg tcggcaaagt ctccctcgtg ggtgctggca tgaagtctca cccaggtgtt 1080 accgcagagt tcatggaagc tctgcgcgat gtcaacgtga acatcgaatt gatttccacc 1140 tctgagattc gtatttccgt gctgatccgt gaagatgatc tggatgctgc tgcacgtgca 1200 ttgcatgagc agttccagct gggcggcgaa gacgaagccg tcgtttatgc aggcaccgga 1260 cgctaa 1266 <210> 32 <211> 3423 <212> DNA <213> Artificial Sequence <220> <223> pycA with substituted start codon <400> 32 atgtcgactc acacatcttc aacgcttcca gcattcaaaa agatcttggt agcaaaccgc 60 ggcgaaatcg cggtccgtgc tttccgtgca gcactcgaaa ccggtgcagc cacggtagct 120 atttaccccc gtgaagatcg gggatcattc caccgctctt ttgcttctga agctgtccgc 180 attggtaccg aaggctcacc agtcaaggcg tacctggaca tcgatgaaat tatcggtgca 240 gctaaaaaag ttaaagcaga tgccatttac ccgggatacg gcttcctgtc tgaaaatgcc 300 cagcttgccc gcgagtgtgc ggaaaacggc attactttta ttggcccaac cccagaggtt 360 cttgatctca ccggtgataa gtctcgcgcg gtaaccgccg cgaagaaggc tggtctgcca 420 gtttggcgg aatccacccc gagcaaaaac atcgatgaga tcgttaaaag cgctgaaggc 480 cagacttacc ccatctttgt gaaggcagtt gccggtggtg gcggacgcgg tatgcgtttt 540 gttgcttcac ctgatgagct tcgcaaatta gcaacagaag catctcgtga agctgaagcg 600 gctttcggcg atggcgcggt atatgtcgaa cgtgctgtga ttaaccctca gcatattgaa 660 gtgcagatcc ttggcgatca cactggagaa gttgtacacc tttatgaacg tgactgctca 720 ctgcagcgtc gtcaccaaaa agttgtcgaa attgcgccag cacagcattt ggatccagaa 780 ctgcgtgatc gcatttgtgc ggatgcagta aagttctgcc gctccattgg ttaccagggc 840 gcgggaaccg tggaattctt ggtcgatgaa aagggcaacc acgtcttcat cgaaatgaac 900 ccacgtatcc aggttgagca caccgtgact gaagaagtca ccgaggtgga cctggtgaag 960 gcgcagatgc gcttggctgc tggtgcaacc ttgaaggaat tgggtctgac ccaagataag 1020 atcaagaccc acggtgcagc actgcagtgc cgcatcacca cggaagatcc aaacaacggc 1080 ttccgcccag ataccggaac tatcaccgcg taccgctcac caggcggagc tggcgttcgt 1140 cttgacggtg cagctcagct cggtggcgaa atcaccgcac actttgactc catgctggtg 1200 aaaatgacct gccgtggttc cgactttgaa actgctgttg ctcgtgcaca gcgcgcgttg 1260 gctgagttca ccgtgtctgg tgttgcaacc aacattggtt tcttgcgtgc gttgctgcgg 1320 gaagaggact tcacttccaa gcgcatcgcc accggattca ttgccgatca cccgcacctc 1380 cttcaggctc cacctgctga tgatgagcag ggacgcatcc tggattactt ggcagatgtc 1440 accgtgaaca agcctcatgg tgtgcgtcca aaggatgttg cagctcctat cgataagctg 1500 cctaacatca aggatctgcc actgccacgc ggttcccgtg accgcctgaa gcagcttggc 1560 ccagccgcgt ttgctcgtga tctccgtgag caggacgcac tggcagttac tgataccacc 1620 ttccgcgatg cacaccagtc tttgcttgcg acccgagtcc gctcattcgc actgaagcct 1680 gcggcagagg ccgtcgcaaa gctgactcct gagcttttgt ccgtggaggc ctggggcggc 1740 gcgacctacg atgtggcgat gcgtttcctc tttgaggatc cgtgggacag gctcgacgag 1800 ctgcgcgagg cgatgccgaa tgtaaacatt cagatgctgc ttcgcggccg caacaccgtg 1860 ggatacaccc cgtacccaga ctccgtctgc cgcgcgtttg ttaaggaagc tgccagctcc 1920 ggcgtggaca tcttccgcat cttcgacgcg cttaacgacg tctcccagat gcgtccagca 1980 atcgacgcag tcctggagac caacaccgcg gtagccgagg tggctatggc ttattctggt 2040 gatctctctg atccaaatga aaagctctac accctggatt actacctaaa gatggcagag 2100 gagatcgtca agtctggcgc tcacatcttg gccattaagg atatggctgg tctgcttcgc 2160 ccagctgcgg taaccaagct ggtcaccgca ctgcgccgtg aattcgatct gccagtgcac 2220 gtgcacaccc acgacactgc gggtggccag ctggcaacct actttgctgc agctcaagct 2280 ggtgcagatg ctgttgacgg tgcttccgca ccactgtctg gcaccacctc ccagccatcc 2340 ctgtctgcca ttgttgctgc attcgcgcac acccgtcgcg ataccggttt gagcctcgag 2400 gctgtttctg acctcgagcc gtactgggaa gcagtgcgcg gactgtacct gccatttgag 2460 tctggaaccc caggcccaac cggtcgcgtc taccgccacg aaatcccagg cggacagttg 2520 tccaacctgc gtgcacaggc caccgcactg ggccttgcgg atcgtttcga actcatcgaa 2580 gacaactacg cagccgttaa tgagatgctg ggacgcccaa ccaaggtcac cccatcctcc 2640 aaggttgttg gcgacctcgc actccacctc gttggtgcgg gtgtggatcc agcagacttt 2700 gctgccgatc cacaaaagta cgacatccca gactctgtca tcgcgttcct gcgcggcgag 2760 cttggtaacc ctccaggtgg ctggccagag ccactgcgca cccgcgcact ggaaggccgc 2820 tccgaaggca aggcacctct gacggaagtt cctgaggaag agcaggcgca cctcgacgct 2880 gatgattcca aggaacgtcg caatagcctc aaccgcctgc tgttcccgaa gccaaccgaa 2940 gagttcctcg agcaccgtcg ccgcttcggc aacacctctg cgctggatga tcgtgaattc 3000 ttctacggcc tggtcgaagg ccgcgagact ttgatccgcc tgccagatgt gcgcacccca 3060 ctgcttgttc gcctggatgc gatctctgag ccagacgata agggtatgcg caatgttgtg 3120 gccaacgtca acggccagat ccgcccaatg cgtgtgcgtg accgctccgt tgagtctgtc 3180 accaccaaccg cagaaaaggc agattcctcc aacaagggcc atgttgctgc accattcgct 3240 ggtgttgtca ccgtgactgt tgctgaaggt gatgaggtca aggctggaga tgcagtcgca 3300 atcatcgagg ctatgaagat ggaagcaaca atcactgctt ctgttgacgg caaaatcgat 3360 cgcgttgtgg ttcctgctgc aacgaaggtg gaaggtggcg acttgatcgt cgtcgtttcc 3420 taa 3423 <210> 33 <211> 3438 <212> DNA <213> Artificial Sequence <220> <223> scrB with substituted start codon <400> 33 atgtgtgggg ctatgcacac agaactttcc agtttgcgcc ctgcgtacca tgtgactcct 60 ccgcagggca ggctcaatga tcccaacgga atgtacgtcg atggcgatac cctccacgtc 120 tactaccagc acgatccagg tttccccttc gcaccaaagc gcaccggctg ggctcacacc 180 accacgccgt tgaccggacc gcagcgattg cagtggacgc acctgcccga cgctctttac 240 ccggatgcat cctatgacct ggatggatgc tattccggtg gagccgtatt tactgacggc 300 ccccccaca 360 aacctcgtcg aagtcgagga cccaactggg ctgatgggcg gcattcatcg ccgttcgcct 420 aaaaatccgc ttatcgacgg acccgccagc ggtttcacac cccattaccg cgatcccatg 480 atcagccctg atggtgatgg ttggaaaatg gttcttgggg cccaacgcga aaacctcacc 540 ggtgcagcgg ttctataccg ctcgacagat cttgaaaact gggaattctc cggtgaaatc 600 acctttgacc tcagtgatgc acaacctggt tctgctcctg atctcgttcc cggtggctac 660 atgtgggaat gccccaacct ttttacgctt cgcgatgaag aaactggcga agatctcgac 720 gtgctgattt tctgtccaca aggattggac cgaatccacg atgaggttac tcactacgca 780 agctctgacc agtgcggata tgtcgtcggc aagcttgaag gaacgacctt ccgcgtcttg 840 cgaggattca gcgagctgga tttcggccat gaattctacg caccgcaggt tgcagtaaac 900 ggttctgatg cctggctcgt gggctggatg gggctgcccg cgcaggatga tcacccaaca 960 gttgcacggg aaggatgggt gcactgcctg actgtgcccc gcaagcttca tttgcgcaac 1020 cacgcgatct atcaagagct tcttctccca gagggggagt caggggtaat cagatctgta 1080 ttaggttctg aacctgtccg agtagacatc cgaggcaata tttccctcga gtgggatggt 1140 gtccgtttgt ctgtggatcg tggtggtgat cgtcgcgtag ctgaggtaaa acctggcgaa 1200 ttagtgatcg cggacgataa tacagccatt gagataactg caggtgatgg acaggtttca 1260 ttcgctttcc gggctttcaa aggtgacact attgagagat aagtcataaa aaagggtctt 1320 ttgtggcgaa ttgtacaaat acttcgcaaa atcccttgat cggacacaaa taaacaggtt 1380 taatgttgtt tagcttttga acaaacattc atgtctgaat atttttgctt cttcccggtt 1440 aaggagaaat tcatggacca taaggacctc gcgcaacgca tcctgcgcga cattggcggc 1500 gaagacaaca ttgtcgccgc cgcacactgt gcaacgcgtt tacgcctcgt gctcaaagac 1560 accaaggatg tggatcgcca aagtctggat gatgatccag atctgaaagg cacgtttgaa 1620 acgggtggta tgttccagat catcgtcggg ccaggcgatg tggatcatgt tttcaaagaa 1680 ctcgatgacg caacctccaa agacatcgct gtgtccacag agcagctcaa agatgttgtg 1740 gctaacaacg ccaactggtt cagccgtgct gtgaaggtat tggcggacat tttcgtcccg 1800 ctgattccaa tcttggttgg tggcggtctg ctcatggcta tcaacaatgt gttggttgcg 1860 caggatctgt tcggtccgca atcactggtg gagatgttcc ctcagatcag cggtgttgct 1920 gagatgatca acctcatggc atctgcgccg ttcgcgttct tgccagtgtt ggttggtttc 1980 accgcaacca agcgtttcgg cggcaatgag ttcctgggcg ccggtattgg tatggcgatg 2040 gtgttcccga gcttggtgaa cggctacgac gtggccgcca ccatggctgc gggcgaaatg 2100 ccaatgtggt ccctgtttgg tttagatgtt gcccaagccg gttaccaggg caccgtgctt 2160 cctgtgctgg tggtttcttg gattctggca acgatcgaga agttcctgca caagcgactc 2220 aagggcactg cagacttcct gatcactcca gtgctgacgt tgctgctcac cggattcctt 2280 acattcatcg ccattggccc agcaatgcgc tgggtgggcg atgtgctggc acacggtcta 2340 cagggacttt atgatttcgg tggtccagtc ggcggtctgc tcttcggtct ggtctactca 2400 ccaatcgtca tcactggtct gcaccagtcc ttcccgccaa ttgagctgga gctgtttaac 2460 cagggtggat ccttcatctt cgcaacggca tctatggcta atatcgccca gggtgcggca 2520 tgtttggcag tgttcttcct ggcgaagagt gaaaagctca agggccttgc aggtgcttca 2580 ggtgtctccg ctgttcttgg tattacggag cctgcgatct tcggtgtgaa ccttcgcctg 2640 cgctggccgt tcttcatcgg tatcggtacc gcagctatcg gtggcgcttt gattgcactc 2700 tttaatatca aggcagttgc gttgggcgct gcaggtttct tgggtgttgt ttctattgat 2760 gctccagata tggtcatgtt cttggtgtgt gcagttgtta ccttcttcat cgcattcggc 2820 gcagcgattg cttatggcct ttacttggtt cgccgcaacg gcagcattga tccagatgca 2880 accgctgctc cagtgcctgc aggaacgacc aaagccgaag cagaagcacc cgcagaattt 2940 tcaaacgatt ccaccatcat ccaggcacct ttgaccggtg aagctattgc actgagcagc 3000 gtcagcgatg ccatgtttgc cagcggaaag cttggctcgg gcgttgccat cgtcccaacc 3060 aaggggcagt tagtttctcc ggtgagtgga aagattgtgg tggcattccc atctggccat 3120 gctttcgcag ttcgcaccaa ggctgaggat ggttccaatg tggatatctt gatgcacatt 3180 ggtttcgaca cagtaaacct caacggcacg cactttaacc cgctgaagaa gcagggcgat 3240 gaagtcaaag caggggagct gctgtgtgaa ttcgatattg atgccattaa ggctgcaggt 3300 tatgaggtaa ccacgccgat tgttgtttcg aattacaaga aaaccggacc tgtaaacact 3360 tacggtttgg gcgaaattga agcgggagcc aacctgctca acgtcgcaaa gaaagaagcg 3420 gtgccagcaa caccataa 3438 <210> 34 <211> 1344 <212> DNA <213> Artificial Sequence <220> <223> gdh with substituted start codon <400> 34 ttgacagttg atgagcaggt ctctaactat tacgacatgc ttctgaagcg caatgctggc 60 gagcctgaat ttcaccaggc agtggcagag gttttggaat ctttgaagat cgtcctggaa 120 aaggaccctc attacgctga ttacggtctc atccagcgcc tgtgcgagcc tgagcgtcag 180 ctcatcttcc gtgtgccttg ggttgatgac cagggccagg tccacgtcaa ccgtggtttc 240 cgcgtgcagt tcaactctgc acttggacca tacaagggcg gcctgcgctt ccacccatct 300 gtaaacctgg gcattgtgaa gttcctgggc tttgagcaga tctttaaaaa ctccctaacc 360 ggcctgccaa tcggtggtgg caagggtgga tccgacttcg accctaaggg caagtccgat 420 ctggaaatca tgcgtttctg ccagtccttc atgaccgagc tacaccgcca catcggtgag 480 taccgcgacg ttcctgcagg tgacatcgga gttggtggcc gcgagatcgg ttacctgttt 540 ggccactacc gtcgcatggc taaccagcac gagtccggcg ttttgaccgg taagggcctg 600 acctggggtg gatccctggt ccgcaccgag gcaactggct acggctgcgt ttacttcgtg 660 agtgaaatga tcaaggctaa gggcgagagc atcagcggcc agaagatcat cgtttccggt 720 tccggcaacg tagcaaccta cgcgattgaa aaggctcagg aactcggcgc aaccgttatt 780 ggtttctccg attccagcgg ttgggttcat acccctaacg gcgttgacgt ggctaagctc 840 cgcgaaatca aggaagttcg tcgcgcacgc gtatccgtgt acgccgacga agttgaaggc 900 gcaacctacc acaccgacgg ttccatctgg gatctcaagt gcgatatcgc tcttccttgt 960 gcaactcaga acgagctcaa cggcgagaac gctaagactc ttgcagacaa cggctgccgt 1020 ttcgttgctg aaggcgcgaa catgccttcc acccctgagg ctgttgaggt cttccgtgag 1080 cgcgacatcc gcttcggacc aggcaaggca gctaacgctg gtggcgttgc aacctccgct 1140 ctggagatgc agcagaacgc ttcgcgcgat tcctggagct tcgagtacac cgacgagcgc 1200 ctccaggtga tcatgaagaa catcttcaag acctgtgcag agaccgcagc agagtatgga 1260 cacgagaacg attacgttgt cggcgctaac attgctggct tcaagaaggt agctgacgcg 1320 atgctggcac agggcgtcat ctaa 1344 <210> 35 <211> 2217 <212> DNA <213> Artificial Sequence <220> <223> icd with substituted start codon <400> 35 ttggctaaga tcatctggac ccgcaccgac gaagcaccgc tgctcgcgac ctactcgctg 60 aagccggtcg tcgaggcatt tgctgctacc gcgggcattg aggtcgagac ccgggacatt 120 tcactcgctg gacgcatcct cgcccagttc ccagagcgcc tcaccgaaga tcagaaggta 180 ggcaacgcac tcgcagaact cggcgagctt gctaagactc ctgaagcaaa catcattaag 240 cttccaaaca tctccgcttc tgttccacag ctcaaggctg ctattaagga actgcaggac 300 cagggctacg acatcccaga actgcctgat aacgccacca ccgacgagga aaaagacatc 360 ctcgcacgct acaacgctgt taagggttcc gctgtgaacc cagtgctgcg tgaaggcaac 420 tctgaccgcc gcgcaccaat cgctgtcaag aactttgtta agaagttccc acaccgcatg 480 ggcgagtggt ctgcagattc caagaccaac gttgcaacca tggatgcaaa cgacttccgc 540 cacaacgaga agtccatcat cctcgacgct gctgatgaag ttcagatcaa gcacatcgca 600 gctgacggca ccgagaccat cctcaaggac agcctcaagc ttcttgaagg cgaagttcta 660 gacggaaccg ttctgtccgc aaaggcactg gacgcattcc ttctcgagca ggtcgctcgc 720 gcaaaggcag aaggtatcct cttctccgca cacctgaagg ccaccatgat gaaggtctcc 780 gacccaatca tcttcggcca cgttgtgcgc gcttacttcg cagacgtttt cgcacagtac 840 ggtgagcagc tgctcgcagc tggcctcaac ggcgaaaacg gcctcgctgc aatcctctcc 900 ggcttggagt ccctggacaa cggcgaagaa atcaaggctg cattcgagaa gggcttggaa 960 gacggcccag acctggccat ggttaactcc gctcgcggca tcaccaacct gcatgtccct 1020 tccgatgtca tcgtggacgc ttccatgcca gcaatgattc gtacctccgg ccacatgtgg 1080 aacaaagacg accaggagca ggacaccctg gcaatcatcc cagactcctc ctacgctggc 1140 gtctaccaga ccgttatcga agactgccgc aagaacggcg cattcgatcc aaccaccatg 1200 ggtaccgtcc ctaacgttgg tctgatggct cagaaggctg aagagtacgg ctcccatgac 1260 aagaccttcc gcatcgaagc agacggtgtg gttcaggttg tttcctccaa cggcgacgtt 1320 ctcatcgagc acgacgttga ggcaaatgac atctggcgtg catgccaggt caaggatgcc 1380 ccaatccagg attgggtaaa gcttgctgtc acccgctccc gtctctccgg aatgcctgca 1440 gtgttctggt tggatccaga gcgcgcacac gaccgcaacc tggcttccct cgttgagaag 1500 tacctggctg accacgacac cgagggcctg gacatccaga tcctctcccc tgttgaggca 1560 acccagctct ccatcgaccg catccgccgt ggcgaggaca ccatctctgt caccggtaac 1620 gttctgcgtg actacaacac cgacctcttc ccaatcctgg agctgggcac ctctgcaaag 1680 atgctgtctg tcgttccttt gatggctggc ggcggactgt tcgagaccgg tgctggtgga 1740 tctgctccta agcacgtcca gcaggttcag gaagaaaacc acctgcgttg ggattccctc 1800 ggtgagttcc tcgcactggc tgagtccttc cgccacgagc tcaacaacaa cggcaacacc 1860 aaggccggcg ttctggctga cgctctggac aaggcaactg agaagctgct gaacgaagag 1920 aagtccccat cccgcaaggt tggcgagatc gacaaccgtg gctcccactt ctggctgacc 1980 aagttctggg ctgacgagct cgctgctcag accgaggacg cagatctggc tgctaccttc 2040 gcaccagtcg cagaagcact gaacacaggc gctgcagaca tcgatgctgc actgctcgca 2100 gttcagggtg gagcaactga ccttggtggc tactactccc ctaacgagga gaagctcacc 2160 aacatcatgc gcccagtcgc acagttcaac gagatcgttg acgcactgaa gaagtaa 2217

Claims (13)

A gene-initiating codon variant consisting of the nucleotide sequence of SEQ ID NO: 30, wherein the start codon of the transketolase-encoding gene (tkt) is substituted with ATG. The gene-initiating codon variant according to claim 1, wherein the mutant is derived from a microorganism belonging to the genus Corynebacterium. A recombinant vector comprising the gene-initiating codon variant of claim 1. 4. The recombinant vector according to claim 3, further comprising any one or more of the following gene start codon variants (a) to (f):
(a) a gene-initiating codon variant encoding a glucose 6-phosphate dehydrogenase (zwf) derived from a microorganism belonging to the genus Corynebacterium,
(b) a gene-initiating codon variant encoding an aspartokinase (lysC) derived from a microorganism belonging to the genus Corynebacterium,
(c) a gene-initiating codon variant encoding a pyruvate carboxylase (pycA) derived from a microorganism belonging to the genus Corynebacterium,
(d) Sucrose 6-phosphate hydrolase derived from Corynebacterium genus microorganism (gene-initiating codon mutant encoding scrB,
(e) a gene-initiating codon variant encoding glutamate dehydrogenase (gdh) derived from a genus of Corynebacterium sp., and
(f) a gene-initiating codon variant encoding isocitrate dehydrogenase (icd) derived from a microorganism belonging to the genus Corynebacterium. 5. The recombinant vector according to claim 4, further comprising the gene-initiating codon variants of (a) to (f). 6. The method of claim 5,
The gene-initiating codon variant (a) comprises the nucleotide sequence of SEQ ID NO: 29,
The gene-initiating codon variant (b) comprises the nucleotide sequence of SEQ ID NO: 31,
The (c) gene-initiating codon variant is composed of the nucleotide sequence of SEQ ID NO: 32,
The (d) gene-initiating codon variant comprises the nucleotide sequence of SEQ ID NO: 33,
(E) the gene-initiating codon variant comprises the nucleotide sequence of SEQ ID NO: 34,
(F) the gene-initiating codon variant is composed of the nucleotide sequence of SEQ ID NO: 35. A host cell transformed with the recombinant vector of any one of claims 3 to 6. 8. The host cell according to claim 7, wherein the host cell is a Corynebacterium sp. Microorganism. The method of claim 8, wherein said microorganism of the genus Corynebacterium is Corynebacterium glutamicum (Corynebacterium glutamicum ) or Corynebacterium efficiens . 10. The method of claim 9, wherein the Corynebacterium glutamicum KCTC12307BP-ZTCPS-GI (KCTC 12536BP) Wherein the host cell is a mammalian cell. 11. The host cell according to claim 10, wherein the host cell comprises a gene-initiating codon variant consisting of the nucleotide sequence of SEQ ID NO: 29 to SEQ ID NO: 35. A method for producing an amino acid comprising the step of culturing using the host cell of claim 7. 13. The method according to claim 12, wherein the amino acid is L-lysine.