KR20220083557A - Mutant ATP-dependent protease and method for producing L-amino acid using the same - Google Patents

Abstract

The present application relates to a mutant ATP-dependent protease and a method for producing L-amino acids using the same.

Description

Mutant ATP-dependent protease and method for producing L-amino acid using same {Mutant ATP-dependent protease and method for producing L-amino acid using the same}

The present application relates to a mutant ATP-dependent protease and a method for producing L-amino acids using the same.

L-amino acid is a basic structural unit of protein and is used as an important material for pharmaceutical raw materials, food additives, animal feeds, nutrients, pesticides, and disinfectants. In particular, branched chain amino acids (BCAA) are essential amino acids L-valine, L-leucine, and L-isoleucine. The branched chain amino acids have an antioxidant effect and directly promote protein synthesis in muscle cells. It is known to be effective.

On the other hand, the production of branched chain amino acids using microorganisms is mainly made through microorganisms of the genus Escherichia or microorganisms of the genus Corynebacterium, and biosynthesis of ketoisocaproate as a precursor through several steps from pyruvic acid It is known that (US registered patent US 9885093, US registered patent US 10351859, US registered patent US 8465962). However, the production of branched-chain amino acids through the microorganism has a problem in that it is not easy to mass-produce industrially.

However, as the demand for branched-chain amino acids increases, there is still a need for research to effectively increase the production capacity of branched-chain amino acids.

One object of the present application is to provide a microorganism of the genus Corynebacterium having an ATP-dependent protease activity weakened compared to an unmodified microorganism, preferably having a branched chain amino acid production ability.

Another object of the present application is to provide a ClpC variant in which the amino acid sequence corresponding to positions 431 to 433 is deleted based on the amino acid sequence shown in SEQ ID NO: 5.

Another object of the present application is to provide a polynucleotide encoding the ClpC variant of the present application.

Another object of the present application is Corynebacterium genus comprising any one or more of a microorganism of the genus Corynebacterium of the present application, or a ClpC variant of the present application, or a polynucleotide of the present application, or a vector comprising the same It is to provide a method for producing branched chain amino acids, comprising the step of culturing a microorganism in a medium.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present application fall within the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below. In addition, those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the present application described herein. Also, such equivalents are intended to be covered by this application.

The present application provides a microorganism of the genus Corynebacterium in which ATP-dependent protease activity is weakened compared to the unmodified microorganism in one embodiment.

As used herein, the term “ATP-dependent protease (EC 3.4.21.92)” refers to an enzyme that hydrolyzes proteins into small peptides in the presence of ATP and Mg ²⁺ . The ATP-dependent protease of the present application may be used interchangeably with endopeptidase Clp, ATP-dependent Clp protease, ClpP, Clp protease.

The ATP-dependent protease attenuation of the present application may be the attenuation of the activity of the ATP-dependent Clp protease ATP-binding subunit.

The ATP-dependent Clp protease ATP-binding subunit may be used in combination with AAA family ATPase or ClpC. In the present application, the sequence of the ATP-dependent Clp protease ATP-binding subunit can be obtained from GenBank of NCBI, a known database. Specifically, the subunit may be a polypeptide having an ATP-dependent Clp protease ATP-binding subunit activity encoded by clpC , but is not limited thereto.

The ATP-dependent Clp protease ATP-binding subunit of the present application may be from the genus Corynebacterium. As an example, the ATP-dependent Clp protease ATP-binding subunit of the present application may be derived from Corynebacterium glutamicum .

The ATP-dependent Clp protease ATP-binding subunit of the present application may include a polypeptide described in SEQ ID NO: 5 or an amino acid sequence having 90% or more identity thereto.

For example, the amino acid sequence having 90% or more identity with the amino acid sequence of SEQ ID NO: 5 of the present application is at least 91% or more, 92% or more, 93% or more, 94% or more, 95% or more with the amino acid sequence of SEQ ID NO: 5 of the present application % or more, 96% or more, 96.26% or more, 97% or more, 97.5% or more, 97.7% or more, 97.8% or more, 98% or more, 98.5% or more, 98.7% or more, 98.8% or more, 99% or more, 99.5% or more , 99.7% or more, 99.8% or more or more, and less than 100% homology or identity. In addition, if an amino acid sequence having such homology or identity and exhibiting the same or corresponding activity to the ATP-dependent Clp protease ATP-binding subunit, a protein having an amino acid sequence in which some sequence is deleted, modified, substituted or added is also provided It is obvious that it is included within the scope of the protein to be attenuated in the application.

In addition, the ATP-dependent Clp protease ATP-binding subunit of the present application has, or consists of, or consists essentially of the amino acid sequence of SEQ ID NO: 5 or an amino acid sequence having at least 90% identity therewith ( can consist essentially of). The ATP-dependent Clp protease ATP-binding subunit of the present application adds meaningless sequences before and after SEQ ID NO: 5 or an amino acid sequence having at least 90% identity (i.e., amino acid sequence N-terminus and/or C-terminus of the protein function (addition of a sequence that does not change the

The term “conservative substitution” means substituting an amino acid for another amino acid having similar structural and/or chemical properties. Such amino acid substitutions may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the protein or polypeptide.

The microorganism of the present application is a polypeptide in which amino acids corresponding to positions 431 to 433 are deleted based on the SEQ ID NO of the sequence shown in SEQ ID NO: 5, or 1,291 to 1,291 based on the SEQ ID NO of the sequence shown in SEQ ID NO: 6 It may include a polynucleotide in which the nucleotide corresponding to position 1299 is deleted.

As used herein, the term “corresponding to” means an amino acid residue or nucleotide residue at a listed position in a polypeptide or polynucleotide, or an amino acid residue similar, identical to, or homologous to a residue listed in a polypeptide or polynucleotide, or refers to nucleotide residues. Identifying an amino acid or nucleotide at a corresponding position may be determining a particular amino acid or nucleotide of a sequence that refers to a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

For example, any amino acid sequence is aligned with SEQ ID NO: 5 or SEQ ID NO: 6, and based on this, each amino acid residue of the amino acid sequence is an amino acid residue corresponding to an amino acid residue of SEQ ID NO: 6 or a nucleotide of SEQ ID NO: 6 Residues can be numbered with reference to the numerical position of the corresponding nucleotide residue. For example, a sequence alignment algorithm such as that described in this application can identify the position of an amino acid, or a position at which modifications, such as substitutions, insertions, or deletions, occur compared to a query sequence (also referred to as a "reference sequence").

Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277), but is not limited thereto, and a sequence alignment program, pairwise sequence comparison algorithm, etc. known in the art may be appropriately used.

As used herein, the term “attenuation” of polypeptide activity is a concept that includes both reduced or no activity compared to intrinsic activity. The attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, attenuation, and the like.

The attenuation is when the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide possessed by the original microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., inhibiting the expression of the gene encoding the polynucleotide or translation into a polypeptide When the overall polypeptide activity level and/or concentration (expression amount) in the cell is lower than that of the native strain due to (translation) inhibition, etc., when the expression of the polynucleotide is not made at all, and/or when the expression of the polynucleotide is Even if there is no activity of the polypeptide, it may also be included. The "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification". "Inactivation, deficiency, reduction, downregulation, reduction, attenuation" of the activity of a polypeptide compared to the intrinsic activity means that the activity of the specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation is lowered.

Attenuation of the activity of the polypeptide may be performed by any method known in the art, but is not limited thereto, and may be achieved by application of various methods well known in the art (eg, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

Specifically, the attenuation of the polypeptide activity of the present application is

1) deletion of all or part of a gene encoding a polypeptide;

2) modification of the expression control region (or expression control sequence) to reduce the expression of the gene encoding the polypeptide;

3) modification of the amino acid sequence constituting the polypeptide such that the activity of the polypeptide is eliminated or attenuated (eg, deletion/substitution/addition of one or more amino acids on the amino acid sequence);

4) modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or attenuated (eg, one or more nucleobases on the nucleotide sequence of the polypeptide gene to encode a polypeptide modified such that the activity of the polypeptide is eliminated or attenuated) deletion/replacement/addition of);

5) modification of the nucleotide sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide;

6) introduction of an antisense oligonucleotide (eg, antisense RNA) that complementarily binds to the transcript of said gene encoding the polypeptide;

7) addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of the gene encoding the polypeptide to form a secondary structure that cannot be attached to the ribosome;

8) addition of a promoter transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE); or

9) It may be a combination of two or more selected from 1) to 8) above, but is not particularly limited thereto.

for example,

1) The deletion of a part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide in which some nucleotides are deleted, or replacement with a marker gene.

In addition, the above 2) modification of the expression control region (or expression control sequence) is deletion, insertion, non-conservative or conservative substitution or a combination thereof, resulting in mutation in the expression control region (or expression control sequence), or weaker replacement with an active sequence. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

In addition, the modification of the amino acid sequence or polynucleotide sequence of 3) and 4) above is a deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide. Or a combination thereof may result in sequence mutation, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto. For example, by introducing a mutation in the polynucleotide sequence to form a stop codon, the expression of a gene may be inhibited or attenuated, but is not limited thereto.

In addition, 5) the base sequence modification encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base encoding another start codon having a lower polypeptide expression rate than the intrinsic start codon It may be substituted with a sequence, but is not limited thereto.

6) The introduction of an antisense oligonucleotide (eg, antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide is described, for example, in Weintraub, H. et al., Antisense-RNA as a molecular tool. for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

7) The addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of the gene encoding the polypeptide to form a secondary structure that cannot be attached to the ribosome is mRNA translation It may make it impossible or slow it down.

8) the addition of a promoter transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) is an antisense complementary to the transcript of the gene encoding the polypeptide It may be to attenuate activity by making nucleotides.

The microorganism of the present application may have the ability to produce branched chain amino acids. Specifically, the branched chain amino acid of the present application may be L-valine or L-isoleucine.

As used herein, the term "microorganism (or strain)" includes both wild-type microorganisms or microorganisms in which genetic modification has occurred naturally or artificially. Due to this, as a microorganism with a weakened or enhanced specific mechanism, it may be a microorganism containing genetic modification for the production of a desired polypeptide, protein or product.

Specifically, the strain of the present application is an ATP-dependent protease naturally present in a microorganism having a branched-chain amino acid production ability or a microorganism having a branched-chain amino acid production ability to a parent strain without branched-chain amino acid production ability. An ATP-dependent protease or a polynucleotide encoding the same (or a vector comprising the polynucleotide) may be introduced or modified with the attenuated ATP-dependent protease of the present application, but is not limited thereto.

In the present application, the ATP-dependent Clp protease ATP-binding subunit variant is expressed and the microorganism producing branched chain amino acids includes the polynucleotide of the present application, the ATP-dependent Clp protease ATP-binding subunit variant is It may be a microorganism characterized in that the branched chain amino acid production capacity is increased. Specifically, in the present application, a microorganism in which an ATP-dependent Clp protease ATP-binding subunit variant is expressed and produces branched-chain amino acids, or an ATP-dependent Clp protease ATP-binding subunit variant having an expression ability and branched-chain amino acid production ability In the microorganism, ATP-dependent Clp protease ATP-binding subunit activity is attenuated and a part of a gene in the branched-chain amino acid biosynthesis pathway is enhanced or attenuated, or ATP-dependent Clp protease ATP-binding subunit activity is attenuated and branched-chain amino acid degradation pathway Some of my genes may be enhanced or weakened microorganisms.

The microorganism of the genus Corynebacterium of the present application additionally has enhanced acetolactate synthase isozyme 1 small subunit activity, enhanced aspartokinase activity, and enhanced homoserine dehydrogenase (homoserine) activity. dehydrogenase) activity may be weakened and/or L-threonine dehydratase biosynthetic IlvA (L-threonine dehydratase biosynthetic IlvA) activity may be enhanced.

As used herein, the term “enhancement” of a polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The reinforcement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Herein, activation, enhancement, upregulation, overexpression, and increase may include all of those exhibiting an activity that was not originally possessed, or exhibiting an improved activity compared to intrinsic activity or activity before modification. The “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors. It can be used interchangeably.To “enhance”, “up-regulate”, “overexpress” or “increase” the activity of a polypeptide compared to its intrinsic activity means that the parent strain or unmodified microorganism originally had the activity of a specific polypeptide before transformation. And / or concentration (expression amount) means improved compared to.

The enrichment can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and/or concentration (expression amount) of an endogenous polypeptide. Whether or not the activity of the polypeptide is enhanced can be confirmed from the increase in the level of activity, expression level, or the amount of product excreted from the polypeptide.

The enhancement of the activity of the polypeptide can be applied by various methods well known in the art, and is not limited as long as it can enhance the activity of the target polypeptide compared to the microorganism before modification. Specifically, it may be one using genetic engineering and/or protein engineering well known to those skilled in the art, which is a routine method of molecular biology, but is not limited thereto (eg, Sitnicka et al. Functional Analysis of Genes. Advances in Cell). Biology 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

Specifically, the enhancement of the polypeptide activity of the present application is

1) increasing the intracellular copy number of a polynucleotide encoding the polypeptide;

2) replacing the gene expression control region on the chromosome encoding the polypeptide with a sequence with strong activity;

3) modification of the nucleotide sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide;

4) modification of the amino acid sequence of said polypeptide to enhance polypeptide activity;

5) modification of the polynucleotide sequence encoding the polypeptide to enhance the polypeptide activity (eg, modification of the polynucleotide sequence of the polypeptide gene to encode a polypeptide modified to enhance the activity of the polypeptide);

6) introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

7) codon optimization of the polynucleotide encoding the polypeptide;

8) by analyzing the tertiary structure of the polypeptide to select an exposed site for modification or chemical modification; or

9) It may be a combination of two or more selected from 1) to 8) above, but is not particularly limited thereto.

Such enhancement of polypeptide activity is to increase the activity or concentration of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild-type or pre-modified microbial strain, or increase the amount of product produced from the polypeptide. However, the present invention is not limited thereto.

Modification of part or all of the polynucleotide in the microorganism of the present application is (a) homologous recombination using a vector for chromosome insertion in the microorganism or genome editing using engineered nuclease (e.g., CRISPR-Cas9) and/or (b) It may be induced by light and/or chemical treatments such as, but not limited to, ultraviolet and radiation. The method for modifying part or all of the gene may include a method by DNA recombination technology. For example, by injecting a nucleotide sequence or a vector containing a nucleotide sequence homologous to a target gene into the microorganism to cause homologous recombination, a part or all of the gene may be deleted. The injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.

Corynebacterium genus microorganisms of the present application are Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ( Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium Corynebacterium efficiens , Corynebacterium callunae , Corynebacterium stationis , Corynebacterium singulare , Corynebacterium halotolelans ( Corynebacterium halotolerans , Corynebacterium striatum , Corynebacterium ammoniagenes , Corynebacterium pollutisoli , Corynebacterium imitans, Corynebacterium imitans It may be Corynebacterium testudinoris or Corynebacterium flavescens .

In another aspect, the present application provides a ClpC variant in which the amino acid sequence corresponding to positions 431 to 433 is deleted based on the amino acid sequence shown in SEQ ID NO: 5.

The ClpC variant may be an ATP-dependent Clp protease ATP-binding subunit variant. "ClpC" or "ATP-dependent Clp protease ATP-binding subunit" is as described above.

For example, the ClpC variant of the present application may include the amino acid sequence of SEQ ID NO: 1 or a polypeptide described as an amino acid sequence having 90% or more identity thereto.

As described above, the ClpC variant of the present application has a polypeptide described in the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 90% or more identity therewith, or consists of, or essentially consists of. . Specifically, the ClpC variant of the present application has the amino acid sequence set forth in SEQ ID NO: 1 and 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or It may comprise an amino acid sequence having at least 99.9% homology or identity. In addition, if an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the ClpC variant of the present application, a variant having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added is also within the scope of the present application. The inclusion is obvious.

As used herein, the term "variant" means that one or more amino acids are conservatively substituted and/or modified so that they differ from the amino acid sequence before the mutation of the variant, but have functions or properties refers to a polypeptide that is maintained. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. In addition, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, have been removed. Other variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein. The term "variant" may be used interchangeably with terms such as mutant, modified, mutant polypeptide, mutated protein, mutant and mutant (in English, modified, modified polypeptide, modified protein, mutant, mutein, divergent, etc.) and, as long as it is a term used in a mutated sense, it is not limited thereto.

In addition, variants may contain deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, a signal (or leader) sequence involved in protein translocation may be conjugated to the N-terminus of the mutant, either co-translationally or post-translationally. The variants may also be conjugated with other sequences or linkers for identification, purification, or synthesis.

As used herein, the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage. The terms homology and identity can often be used interchangeably.

Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of a sequence under moderate or high stringent conditions. It is apparent that hybridization also includes hybridization with a polynucleotide containing a common codon in a polynucleotide or a codon in consideration of codon degeneracy.

Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444, using a known computer algorithm such as the “FASTA” program. or, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine (GCG program package (Devereux, J., et al, Nucleic Acids) Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop , [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073).For example, BLAST of the National Center for Biotechnology Information Database, or ClustalW can be used to determine homology, similarity or identity.

Homology, similarity or identity of polynucleotides or polypeptides is described, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, eg, Needleman et al. (1970), J Mol Biol. can be determined by comparing sequence information using a GAP computer program such as 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.

As an example of the present application, the variant of the present application may have ATP-dependent Clp protease ATP-binding subunit activity. In addition, the variants of the present application may have an activity such that branched chain amino acid production is increased compared to a wild-type polypeptide having an ATP-dependent Clp protease ATP-binding subunit activity.

In another aspect, the present application provides a polynucleotide encoding the ClpC variant of the present application.

The "ClpC variant" and "ATP-dependent Clp protease ATP-binding subunit variant" are as described above.

As used herein, the term "polynucleotide" refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are linked in a long chain by covalent bonds, and more specifically, encoding the variant. polynucleotide fragments.

The polynucleotide encoding the ClpC variant of the present application may include the amino acid sequence of SEQ ID NO: 1 or a nucleotide sequence encoding a polypeptide described with an amino acid sequence having 90% or more identity thereto. As an example of the present application, the polynucleotide of the present application may have or include a polynucleotide described as SEQ ID NO: 2 or a nucleotide sequence having 90% or more identity thereto. In addition, the polynucleotide of the present application may consist of, or consist essentially of, the polynucleotide described in the nucleotide sequence of SEQ ID NO: 2.

In consideration of codon degeneracy or preferred codons in organisms that want to express the variants of the present application, the polynucleotides of the present application are various in the coding region within the range that does not change the amino acid sequence of the variants of the present application. Variations can be made.

In addition, the polynucleotide of the present application may be a probe that can be prepared from a known gene sequence, for example, a sequence capable of hybridizing under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application, without limitation. may be included. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, polynucleotides with high homology or identity, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or a condition in which polynucleotides having 99% or more homology or identity hybridize with each other and polynucleotides with lower homology or identity do not hybridize, or 60 ° C., which is a washing condition of conventional Southern hybridization; 1XSSC, 0.1% SDS, specifically 60°C, 0.1XSSC, 0.1% SDS, more specifically 68°C, 0.1XSSC, 0.1% SDS at a salt concentration and temperature equivalent to one wash, specifically two to three washes conditions can be enumerated.

Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the overall sequence.

Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using the hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by those skilled in the art depending on the purpose.

The appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (eg, J. Sambrook et al., supra).

In another aspect, the present application provides a vector comprising the polynucleotide of the present application.

The vector may be an expression vector for expressing the polynucleotide in a host cell, but is not limited thereto.

The vector of the present application refers to a DNA preparation containing a target polynucleotide sequence operably linked to a suitable regulatory sequence so that a target gene can be introduced in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself. For example, a target polynucleotide in a chromosome may be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into a chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.

The vector used in the present application is not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors may be used. , pBluescript II-based, pGEM-based, pTZ-based, pCL-based, pET-based and the like can be used. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.

For example, a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion. The insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted. The selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. Markers to be given can be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.

As used herein, the term “transformation” refers to introducing a vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located extrachromosomally, as long as they can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding a target protein. The polynucleotide may be introduced into a host cell and expressed in any form, as long as it can be expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression. The expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.

The method for transforming the vector of the present application includes any method of introducing a nucleic acid into a cell, and may be performed by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method and the like, but is not limited thereto.

In addition, the term “operably linked” in the present application means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target protein of the present application.

In another aspect, the present application provides a Corynebacterium sp. strain comprising any one or more of the variant of the present application, or the polynucleotide of the present application, or the vector of the present application in another aspect.

The strain of the present application includes a strain comprising any one or more of the variant of the present application, the polynucleotide of the present application, and a vector including the polynucleotide of the present application; a strain modified to express a variant of the present application or a polynucleotide of the present application; a strain of the present application, or a strain expressing the polynucleotide of the present application (eg, a recombinant strain); Or it may be a strain having the mutant activity of the present application (eg, a recombinant strain), but is not limited thereto.

For example, the strain of the present application is a cell or microorganism that is transformed with a vector containing the polynucleotide of the present application or a polynucleotide encoding the ClpC variant of the present application, and expresses the ClpC variant of the present application, for the purpose of the present application Phase The strain of the present application may include all microorganisms capable of producing branched chain amino acids, including the ClpC variant of the present application. For example, the strain of the present application may be a recombinant strain in which the ClpC variant is expressed by introducing a polynucleotide encoding the ClpC variant of the present application into a microorganism producing branched chain amino acids, thereby increasing branched chain amino acid production capacity. The recombinant strain with increased branched chain amino acid production capacity is a natural wild-type microorganism or ClpC unmodified microorganism (ie, a microorganism expressing wild-type aldehyde dehydrogenase (SEQ ID NO: 5) or a mutant (SEQ ID NO: 1) protein expression) It may be a microorganism having increased branched chain amino acid production capacity compared to microorganisms that do not), but is not limited thereto. For example, the target strain to compare whether the branched chain amino acid production capacity is increased, ClpC unmodified microorganism is CA08-0072 strain (KCCM11201P, US 8465962 B2) or KCJI-38 (KCCM11248P, Korean Patent No. 10-1335789 ), but is not limited thereto.

As used herein, the term "unmodified microorganism" does not exclude strains containing mutations that can occur naturally in microorganisms, and is either a wild-type strain or a natural-type strain itself, or a genetic mutation caused by natural or artificial factors. It may mean the strain before being changed. For example, the unmodified microorganism may refer to a strain in which the ClpC variant described herein has not been introduced or has been introduced. The "unmodified microorganism" may be used interchangeably with "strain before modification", "microbe before modification", "unmodified strain", "unmodified strain", "unmodified microorganism" or "reference microorganism".

In another aspect, the present application relates to a microorganism of the genus Corynebacterium in which the ATP-dependent protease activity of the present application is weakened compared to an unmodified microorganism, or a ClpC variant of the present application, or a polynucleotide encoding a ClpC variant of the present application Or, it provides a method for producing branched chain amino acids, comprising the step of culturing a microorganism of the genus Corynebacterium comprising the vector of the present application in a medium.

In the present application, the term "cultivation" means growing the microorganisms of the genus Corynebacterium of the present application in appropriately controlled environmental conditions. The culture process of the present application may be made according to an appropriate medium and culture conditions known in the art. Such a culturing process can be easily adjusted and used by those skilled in the art according to the selected strain. Specifically, the culture may be a batch, continuous, and/or fed-batch, but is not limited thereto.

As used herein, the term "medium" refers to a material in which nutrients required for culturing the microorganism of the genus Corynebacterium of the present application are mixed as a main component, and includes water essential for survival and development, as well as nutrients and development supplies, etc. Specifically, any medium and other culture conditions used for culturing the microorganisms of the genus Corynebacterium of the present application may be used without particular limitation as long as they are media used for culturing conventional microorganisms, but the genus Corynebacterium of the present application The microorganism may be cultured in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid and/or vitamin, etc. under aerobic conditions while controlling temperature, pH, and the like.

Specifically, the culture medium for the Corynebacterium sp. strain can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)].

As the carbon source in the present application, carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamic acid, methionine, lysine, and the like may be included. In addition, natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other suitable carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.

Examples of the nitrogen source include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.

The phosphorus may include potassium first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto. As the inorganic compound, sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.

In addition, during the culture of the microorganism of the genus Corynebacterium of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during culturing, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation. In addition, in order to maintain the aerobic state of the medium, oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without injection of gas or without gas to maintain anaerobic and microaerobic conditions. it is not

In the culture of the present application, the culture temperature may be maintained at 20 to 45° C., specifically, 25 to 40° C., and may be cultured for about 10 to 160 hours, but is not limited thereto.

The branched chain amino acids produced by the culture of the present application may be secreted into the medium or remain in the cells.

The branched chain amino acid production method of the present application includes the steps of preparing the microorganism of the genus Corynebacterium of the present application, preparing a medium for culturing the microorganism, or a combination thereof (regardless of the order), for example, , prior to the culturing step, may be further included.

The method for producing branched-chain amino acids of the present application may further include recovering branched-chain amino acids from the culture medium (the culture medium) or the microorganism of the genus Corynebacterium of the present application. The recovering step may be further included after the culturing step.

The recovery may be to collect the desired branched chain amino acids using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, etc. . For example, centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity Various chromatography such as island chromatography, HPLC, or a combination thereof may be used, and a desired branched-chain amino acid may be recovered from a medium or a microorganism using a suitable method known in the art.

In addition, the method for producing branched chain amino acids of the present application may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, when the method for producing branched chain amino acids of the present application includes both a recovery step and a purification step, the recovery step and the purification step are performed concurrently (or sequentially) regardless of the order, or simultaneously or in one step may be integrated and performed, but is not limited thereto.

In the method of the present application, variants, polynucleotides, vectors, microorganisms, branched chain amino acids, and the like are as described in the other aspects above.

The present application provides a variant of the present application in another embodiment, a polynucleotide encoding the variant, a vector comprising the polynucleotide, or a microorganism of the present application; Medium in which the microorganisms of the present application are cultured; Or it provides a composition for producing branched chain amino acids comprising a combination of two or more of them.

The composition of the present application may further include any suitable excipients commonly used in compositions for the production of branched chain amino acids, and these excipients include, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents. and the like, but is not limited thereto.

In the composition of the present application, variants, polynucleotides, vectors, strains, media and branched chain amino acids are the same as those described in the other aspects above.

In another aspect, the present application provides a use for producing branched-chain amino acids in a microorganism of the genus Corynebacterium, in which ATP-dependent protease activity is weakened compared to an unmodified microorganism.

In another embodiment, the present application relates to a ClpC variant in which the amino acid sequence corresponding to positions 431 to 433 is deleted based on the amino acid sequence shown in SEQ ID NO: 5, or a branched chain amino acid of a polynucleotide encoding the ClpC variant It provides production use.

The microorganism according to the present application can produce branched chain amino acids with high efficiency. In addition, the prepared branched chain amino acid can be applied to various products such as pharmaceutical raw materials, food additives, animal feed, nutrients, pesticides, and disinfectants.

Hereinafter, the present application will be described in more detail by way of Examples. However, the following examples are only preferred embodiments for illustrating the present application, and therefore, are not intended to limit the scope of the present application thereto. On the other hand, technical matters not described in this specification can be sufficiently understood and easily implemented by those skilled in the technical field of the present application or a similar technical field.

Example 1. Selection of mutants that increase L-valine production capacity through artificial mutation method

1-1. Artificial mutagenesis through UV irradiation

In order to select a mutant with increased L-valine-producing ability, L- valine-producing NTG strain, Corynebacterium glutamicum CA08-0072 (KCCM11201P, US 8465962 B2) was plated on a nutrient medium containing agar at 30°C. Incubated for 36 hours.

Hundreds of colonies obtained through this were irradiated with UV at room temperature to induce random mutations in the genome of the strain.

The composition of the nutrient medium is as follows.

<Nutrition medium (pH 7.2)>

Glucose 10g, broth 5g, polypeptone 10g, sodium chloride 2.5g, yeast extract 5g, agar 20g, urea 2g (based on 1 liter of distilled water)

1-2. Fermentation potency test of mutagenic strain and strain selection

In order to select a mutant having an increased L-valine production ability compared to Corynebacterium glutamicum CA08-0072 used as the parent strain in Example 1-1, a fermentation potency experiment was performed on strains induced by random mutations.

Specifically, each colony was subcultured in a nutrient medium, and then each strain was inoculated in a 250 ml corner-baffle flask containing 25 ml of the production medium, and cultured with shaking at 30° C. for 72 hours at 200 rpm. The composition of the nutrient medium and the production medium is as follows, respectively.

<Nutrition medium (pH 7.2)>

Glucose 10 g, broth 5 g, polypeptone 10 g, sodium chloride 2.5 g, yeast extract 5 g, agar 20 g, urea 2 g (based on 1 liter of distilled water)

<Production medium (pH 7.0)>

Glucose 100 g, Ammonium Sulfate 40 g, Soy Protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, Potassium Dibasic 1 g, Magnesium Sulfate 0.5 g, Biotin 100 μg, Thiamine-HCl 1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

Thereafter, the concentration of L-valine was analyzed using HPLC, and the analyzed concentrations of L-valine are shown in Table 1 below.

strain name L-valine (g/L) control CA08-0072 2.7 experimental group M1 3.0 M2 2.8 M3 2.5 M4 4.8 M5 3.5 M6 3.3 M7 2.9 M8 3.9 M9 3.5 M10 2.1 M11 1.1 M12 2.9 M13 2.5 M14 3.1 M15 4.7 M16 3.2

Referring to Table 1, the M4 strain with the highest L-valine production was selected compared to the control strain CA08-0072.

Example 2. Variation confirmation through gene sequencing

In Example 1, the major genes of the M4 strain with increased L-valine production ability were sequenced and compared with CA08-0072 strain and Corynebacterium glutamicum wild-type strain ATCC14067. As a result, the M4 strain contains a mutation at a specific position in the ORF (Open Reading Frame) of clpC, which is one of the hexameric ATPase-active chaperon subunits constituting the ATP-dependent protease. It was confirmed that Specifically, the M4 strain confirmed that the 1,291 to 1,299 nucleotides (SEQ ID NO: 4) in the sequence represented by SEQ ID NO: 6 were deleted. The sequence represented by SEQ ID NO: 6 is a sequence commonly included in the ORF of clpC of wild-type Corynebacterium glutamicum (ATCC14067, ATCC13032 and ATCC13869).

In the following examples, it was attempted to determine whether the mutation affects the production of amino acids in microorganisms of the genus Corynebacterium.

Example 3. Production of strains introduced with mutations and confirmation of L-valine production ability

3-1. Production of strains introduced with mutations in Corynebacterium glutamicum CA08-0072 and evaluation of L-valine production capacity

A vector for introducing a nucleotide (SEQ ID NO: 2) in which the 1,291 to 1,299 nucleotides (SEQ ID NO: 4) is deleted in the sequence represented by SEQ ID NO: 6 into the L-valine-producing NTG strain Corynebacterium glutamicum CA08-0072 produced. Specifically, the genomic DNA of the ATCC14067 strain, which is a wild-type Corynebacterium glutamicum, was extracted using a G-spin total DNA extraction mini kit (Intron, Cat. No 17045) according to the protocol provided in the kit. Using each of the genomic DNAs as a template, PCR was performed using primers of SEQ ID NOs: 7 and 8 and primers of SEQ ID NOs: 9 and 10 to obtain DNA fragments (A, B), respectively. The primer sequences used herein are shown in Table 2 below.

SEQ ID NO: sequence name order 7 P1 ctat tctaga tccagagaccctcaaggacaagcag 8 P2 ggacggtgcggtcatgcgcatgcgggcgcc 9 P3 ggcgcccgcatgcgcatgaccgcaccgtcc 10 P4 ctat tctaga tcgatttggatgagggaatcatcg

Overlapping PCR was performed using the primers of SEQ ID NOs: 7 and 10 using the two fragments as templates to obtain a PCR product of 1,040 bp (hereinafter, referred to as a "mutant introduction fragment"). PCR was performed after denaturation at 94°C for 5 minutes; After 25 repetitions of denaturation at 94° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 60 seconds; Polymerization was performed at 72° C. for 7 minutes.

The obtained mutated fragments were treated with a restriction enzyme XbaI (New England Biolabs, Beverly, Mass.), and then the pDZ vector (US Patent No. 9109242 and U.S. Patent No. 9109242 and International Patent Publication No. 2008-033001) and T4 ligase (New England Biolabs, Beverly, Mass.) was used for ligation. After transforming the produced gene into E. coli DH5α, it was selected in LB medium containing 25 mg/L kanamycin, and DNA was obtained using a DNA-spin plasmid DNA purification kit (Intron) to obtain the recombinant plasmid pDZ-clpC_M4 was prepared.

The prepared recombinant plasmid pDZ-clpC_M4 was transformed into L-valine-producing strain, Corynebacterium glutamicum CA08-0072, by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol). Biotechnol 52:541-545, 1999). The strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin. Thereafter, a strain in which a mutation was introduced into the ORF of clpC was prepared on the chromosome through PCR using the primers of SEQ ID NOs: 7 and 10 for the Corynebacterium glutamicum transformant on which the secondary recombination (cross-over) was completed. did The recombinant strain was named Corynebacterium glutamicum CA08-0072-clpC_M4.

Fermentation potency evaluation was performed to compare the L-valine producing ability of the prepared L-valine producing strains, Corynebacterium glutamicum CA08-0072 and CA08-0072-clpC_M4.

Specifically, after subculture of each strain in a nutrient medium, each strain was inoculated in a 250 ml corner-baffle flask containing 25 ml of the production medium, and cultured with shaking at 30° C. for 72 hours at 200 rpm. The composition of the nutrient medium and the production medium is as follows, respectively.

<Nutrition medium (pH 7.2)>

Glucose 10 g, broth 5 g, polypeptone 10 g, sodium chloride 2.5 g, yeast extract 5 g, agar 20 g, urea 2 g (based on 1 liter of distilled water)

<Production medium (pH 7.0)>

Glucose 100 g, Ammonium Sulfate 40 g, Soy Protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, Potassium Dibasic 1 g, Magnesium Sulfate 0.5 g, Biotin 100 μg, Thiamine-HCl 1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, calcium carbonate 30 g (based on 1 liter of distilled water)

Thereafter, the concentration of L-valine was analyzed using HPLC, and the analyzed concentrations of L-valine are shown in Table 3 below.

strain L-valine (g/L) batch 1 batch 2 batch 3 Average control CA08-0072 2.8 2.6 2.7 2.7 experimental group CA08-0072-clpC_M4 3.2 3.1 3.0 3.1

As shown in Table 3 above, it was confirmed that the L-valine production capacity of the CA08-0072-clpC_M4 strain was increased by 14% compared to the control.

As a result, it was confirmed that the production capacity of L-valine could be improved through ORF mutation of clpC.

The CA08-0072-clpC_M4 was named CA08-1542, and was deposited with the Korea Microorganism Conservation Center, a trustee institution under the Budapest Treaty on July 2, 2020, and was given an accession number KCCM12755P.

3-2. Production of strains introduced with mutations in Corynebacterium glutamicum CJ7V and evaluation of L-valine production capacity

In order to confirm whether the same effect as above in other strains belonging to Corynebacterium glutamicum producing L-valine, one mutation [ilvN (A42V) in the wild strain Corynebacterium glutamicum ATCC14067 ; Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467] was introduced to prepare a strain with improved L-valine production ability.

Specifically, the genomic DNA of the ATCC14067 strain, which is a wild type of Corynebacterium glutamicum, was extracted using a G-spin total 1 DNA extraction mini kit. Using the genomic DNA as a template, PCR was performed using primers of SEQ ID NOs: 11 and 12 and primers of SEQ ID NOs: 13 and 14 to construct a vector introducing A42V mutation into the ilvN gene to generate gene fragments (A, B) were obtained respectively. The primer sequences used herein are shown in Table 4 below.

SEQ ID NO: sequence name order 11 P5 aatttctagaggcagaccctattctatgaagg 12 P6 agtgtttcggtctttacagacacgagggac 13 P7 gtccctcgtgtctgtaaagaccgaaacact 14 P8 aatttctagacgtgggagtgtcactcgcttgg

Overlapping PCR was performed using the primers of SEQ ID NOs: 11 and 14 using the two fragments as templates to obtain a 1044 bp PCR product (hereinafter, referred to as a "mutant introduction fragment"). PCR was performed after denaturation at 94°C for 5 minutes; After 25 repetitions of denaturation at 94° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 60 seconds; Polymerization was performed at 72° C. for 7 minutes. As a result, polynucleotides of 537 bp were obtained for both fragments A and B.

The obtained mutated fragment was treated with a restriction enzyme XbaI, and then ligated with a pDZ vector treated with the same restriction enzyme using T4 ligase. After transforming the produced gene into E. coli DH5α, it was selected in LB medium containing 25 mg/L of kanamycin, and DNA was obtained using a DNA-spin plasmid DNA purification kit. The vector for the purpose of introducing the A42V mutation of the ilvN gene was named pDZ-ilvN (A42V).

Then, the recombinant plasmid pDZ-ilvN (A42V) constructed above was transformed into a wild-type Corynebacterium glutamicum ATCC14067 by homologous recombination on the chromosome. The strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin. After the second recombination was completed, the gene fragment was amplified through PCR using the primers of SEQ ID NOs: 11 and 14 for the Corynebacterium glutamicum transformant, and the mutant introduced strain was identified through gene sequence analysis. . The recombinant strain into which the mutation was introduced was named Corynebacterium glutamicum CJ7V.

For the Corynebacterium glutamicum CJ7V, pDZ-clpC_M4 was transformed in the same manner as in Example 3-1 to prepare a strain in which the mutation was introduced into the ORF of clpC, and this was named CJ7V-clpC_M4.

In order to compare the L-valine-producing ability of the prepared strains, the L-valine concentrations were analyzed by culturing in the same manner as in Example 3-1, and the analyzed L-valine concentrations are shown in Table 5 below.

strain L-valine (g/L) batch 1 batch 2 batch 3 Average control CJ7V 2.1 2.2 2.2 2.2 experimental group CJ7V-clpC_M4 2.6 2.4 2.5 2.5

As shown in Table 5 above, it was confirmed that the L-valine production capacity of the CJ7V-clpC_M4 strain was increased by 14% compared to the control group.

That is, it was confirmed once again that the production ability of L-valine can be improved through ORF mutation of the clpC gene in microorganisms of the genus Corynebacterium.

3-3. Production of strains introduced with mutations in Corynebacterium glutamicum CJ8V and evaluation of L-valine production ability

In order to confirm whether the same effect as above also in other strains belonging to Corynebacterium glutamicum producing L-valine, 1 to wild-type Corynebacterium glutamicum ATCC13869 in the same manner as in Example 3-2 A mutant strain having L-valine-producing ability was prepared by introducing a mutation [ilvN(A42V)] of the species, and the recombinant strain was named Corynebacterium glutamicum CJ8V.

To construct a strain into which the clpC mutation was introduced for Corynebacterium glutamicum CJ8V, the recombinant vector pDZ-clpC_M4 prepared in Example 3-1 was transformed into CJ8V. The strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin. Thereafter, the strain into which the clpC mutation was introduced was identified using the primers of SEQ ID NOs: 7 and 10 for the Corynebacterium glutamicum transformant on which the secondary recombination was completed. The identified recombinant strain was named Corynebacterium glutamicum CJ8V-clpC_M4.

To compare the L-valine-producing ability of the prepared strains, the L-valine concentrations were analyzed by culturing in the same manner as in Example 3-1, and the analyzed L-valine concentrations are shown in Table 6 below.

strain L-valine (g/L) batch 1 batch 2 batch 3 Average control CJ8V 1.8 1.9 1.9 1.9 experimental group CJ8V-clpC_M4-14067 2.2 2.1 2.1 2.13

As shown in Table 6 above, it was confirmed that the L-valine production capacity of the CJ8V-clpC_M4 strain was increased by 12% compared to the control group.

That is, it was confirmed once again that the production ability of L-valine can be improved through ORF mutation of the clpC gene in microorganisms of the genus Corynebacterium.

Example 4. Isoleucine-producing strain production and production capacity evaluation

4-1. Production and evaluation of the strain introduced with the clpC ORF mutation in the L-isoleucine-producing strain Corynebacterium glutamicum KCCM11248P strain

In the same manner as in Example 3, the recombinant plasmid pDZ-clpC_M4 prepared in Example 3-1 was transferred to Corynebacterium glutamicum KCJI-38 (KCCM11248P, US Patent US 9885093), which is an L-isoleucine-producing strain, on the chromosome. A strain introduced by homologous recombination of was prepared and named KCJI-38-clpC_M4. The produced strain was cultured in the following manner to compare isoleucine-producing ability.

Specifically, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium and cultured with shaking at 30° C. for 48 hours at 200 rpm. The composition of the species medium and the production medium is as follows, respectively.

<Species medium (pH 7.0)>

Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH ₂ PO ₄ 4 g, K ₂ HPO ₄ 8 g, MgSO ₄ 7H2O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 2000 μg (based on 1 liter of distilled water)

<Production medium (pH 7.0)>

Glucose 50 g, (NH ₄ ) ₂ SO ₄ 12.5 g, Soy Protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, KH ₂ PO ₄ 1 g, MgSO ₄ 7H ₂ O 0.5 g, Biotin 100 μg, thiamine hydrochloride 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 3000 μg, CaCO ₃ 30 g (based on 1 liter of distilled water)

After the end of the culture, the production ability of L-isoleucine was measured by HPLC. The concentrations of L-isoleucine in the culture medium for each strain tested are shown in Table 7 below.

strain L-isoleucine (g/L) batch 1 batch 2 batch 3 Average control KCJI-38 1.4 1.5 1.3 1.4 experimental group KCJI-38-clpC_M4 2.1 2.4 2.0 2.17

As shown in Table 7, it was confirmed that the concentration of L-isoleucine was increased by about 55% in KCJI-38-clpC_M4, into which the clpC mutation was introduced, compared to the L-isoleucine-producing strain KCJI-38. Through this, it was confirmed that the production ability of L-isoleucine can be improved through mutation of the clpC gene.

The above results indicated that the introduction of the clpC ORF mutation in the L-isoleucine-producing strain of the genus Corynebacterium was effective for the production of L-isoleucine.

The KCJI-38-clpC_M4 was named CA10-3123, and it was deposited with the Korea Microorganism Conservation Center, a trustee institution under the Budapest Treaty, on December 1, 2020, and was given an accession number KCCM12858P.

4-2. Construction of L-isoleucine strain introduced with clpC ORF mutation in Corynebacterium glutamicum wild strain ATCC13032 and evaluation of L-isoleucine production ability

In order to confirm the effect on the L-isoleucine production ability by introducing the clpC-M4 mutation, the known aspartokinase mutant (lysC(L377K)) based on the Corynebacterium glutamicum ATCC13032 (hereinafter WT) strain (lysC(L377K)) (US 10662450 B2), homoserine dehydrogenase variant (hom(R407H)) ( Appl. Microbiol. Biotechnol. 45, 612-620 (1996) ) and L-threonine dehydratase variant (ilvA) (V323A)) (Appl. Enviro. Microbiol., Dec. 1996, p.4345-4351) was prepared and the L-isoleucine-producing ability was compared.

Specifically, PCR was performed using primers of SEQ ID NOs: 15 and 16 or SEQ ID NOs: 17 and 18 using the WT chromosome as a template. The primer sequences used herein are shown in Table 8 below.

SEQ ID NO: sequence name base sequence 15 P9 tcc tctaga GCTGCGCAGTGTTGAATACG 16 P10 TGGAAATC tt TTCGATGTTCACGTTGACAT 17 P11 ACATCGAA aa GATTTCCACCTCTGAGATTC 18 P12 gac tctaga GTTCACCTCAGGAGACGATTA

PCR was performed at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 30 seconds repeated 30 times, followed by polymerization at 72°C for 7 minutes. As a result, a 509 bp DNA fragment at the 5' upper end and a 520 bp DNA fragment at the 3' lower end were obtained, respectively, centering on the mutation of the lysC gene.

Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NOs: 15 and 18. After denaturation at 95° C. for 5 minutes, denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 30 seconds were repeated 30 times, followed by polymerization at 72° C. for 7 minutes. As a result, a 1011 bp DNA fragment containing a mutation (L377K) of the lysC gene encoding an aspartokinase variant in which the leucine at position 377 was substituted with a lysine was amplified. The pDZ vector and the amplified 1011 bp DNA fragment were treated with restriction enzyme XbaI, ligated using a DNA conjugation enzyme, and then cloned to obtain a plasmid, which was named pDZ-lysC (L377K).

The pDZ-lysC (L377K) vector obtained above was introduced into the WT strain by an electric pulse method (Appl. Microbiol. Biothcenol. (1999, 52:541-545)), and then transformed in a selective medium containing 25 mg/L of kanamycin. strains were obtained. As a secondary recombination process, a strain, WT::lysC (L377K), in which a nucleotide mutation was introduced into the lysC gene by the DNA fragment inserted on the chromosome, was obtained.

In addition, in order to construct a vector introducing hom (R407H), PCR was performed using the primers of SEQ ID NOs: 19 and 20 and SEQ ID NOs: 21 and 22 using WT genomic DNA as a template. The primer sequences used herein are shown in Table 9 below.

SEQ ID NO: sequence name order 19 P13 tcc tctaga CTGGTCGCCTGATGTTCTAC 20 P14 CACGATCAGATGTGCATCATCAT 21 P15 ATGATGATGCACATCTGATCGTG 22 P16 gac tctaga TTAGTCCCTTTCGAGGCGGA

PCR was performed at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 30 seconds repeated 30 times, followed by polymerization at 72°C for 7 minutes. As a result, a 220 bp DNA fragment at the 5' upper end and a 220 bp DNA fragment at the 3' lower end were obtained centering on the mutation of the hom gene.

PCR was performed using the primers of SEQ ID NOs: 19 and 22 using the obtained two PCR products as templates. After denaturation at 95° C. for 5 minutes, denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 30 seconds were repeated 30 times, followed by polymerization at 72° C. for 7 minutes. As a result, a 440 bp DNA fragment containing the hom gene mutation was amplified. The pDZ vector and the amplified 440 bp DNA fragment used above were treated with restriction enzyme XbaI, ligated using a DNA conjugation enzyme, and then cloned to obtain a plasmid, which was named pDZ-hom (R407H).

The obtained pDZ-hom(R407H) vector was introduced into the WT::lysC(L377K) strain by an electric pulse method, and then the transformed strain was obtained in a selective medium containing 25 mg/L of kanamycin. As a secondary recombination process, a strain, WT::lysC(L377K)-hom(R407H), in which a nucleotide mutation was introduced into the hom gene by the DNA fragment inserted on the chromosome, was obtained.

The recombinant plasmid pDZ-clpC_M4 prepared in Example 3-1 was introduced into the WT::lysC(L377K)-hom(R407H) strain by homologous recombination on the chromosome in the same manner as in the previous example, and WT: :lysC(L377K)-hom(R407H)-clpC_M4 was named.

On the other hand, in order to construct a vector into which the previously known ilvA(V323A) mutation (S. Morbach et al., Appl. Enviro. Microbiol., 62(12): 4345-4351, 1996) is introduced targeting the ilvA gene, mutation A pair of primers (SEQ ID NOs: 23 and 24) for amplifying the 5' top region and a pair of primers (SEQ ID NOs: 25 and 26) for amplifying the 3' bottom region were designed based on the position. In the primers of SEQ ID NOs: 23 and 26, a BamHI restriction enzyme site (indicated by an underline) was inserted at each end, and the primers of SEQ ID NOs: 24 and 25 were designed to cross each other so that a nucleotide substitution mutation (indicated by an underline) was located. did. The primer sequences designed here are shown in Table 10 below.

SEQ ID NO: sequence name order 23 P17 AC GGATCC CAGACTCCAAAGCAAAAGCG 24 P18 ACACCACG g CAGAACCAGGTGCAAAGGACA 25 P19 CTGGTTCTG c CGTGGTGTGCATCATCTCTG 26 P20 AC GGATCC AACCAAACTTGCTCACACTC

PCR was performed using the primers of SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26 using the WT chromosome as a template. PCR was performed at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 30 seconds repeated 30 times, followed by polymerization at 72°C for 7 minutes. As a result, a 627 bp DNA fragment at the 5' upper end and a 608 bp DNA fragment at the 3' lower end were obtained centering on the mutation of the ilvA gene.

Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 23 and SEQ ID NO: 26. After denaturation at 95° C. for 5 minutes, denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 60 seconds were repeated 30 times, followed by polymerization at 72° C. for 7 minutes. As a result, a 1217 bp DNA fragment containing a mutation in the ilvA gene encoding the IlvA variant in which L-valine at position 323 was substituted with alanine was amplified. pECCG117 (Republic of Korea Patent No. 10-0057684) vector and a 1217 bp DNA fragment were treated with restriction enzyme BamHI, ligated using a DNA conjugation enzyme, and then cloned to obtain a plasmid, which was pECCG117-ilvA (V323A) named.

ATCC13032::hom(R407H)-lysC(L377K)-clpC/pECCG117-ilvA(V323A) strain introduced with pECCG117-ilvA(V323A) vector into ATCC13032::hom(R407H)-lysC(L377K)-clpC_M4 of the above example was produced. In addition, a strain in which only ilvA(V323A) mutation was introduced into ATCC13032::-hom(R407H)-lysC(L377K) as its control was also prepared.

The prepared strains were cultured in the same manner as in the flask culture method shown in Example 4-1, and the L-isoleucine concentration in the culture medium was analyzed. The concentrations of L-isoleucine in the culture medium for each strain tested are shown in Table 11 below.

strain L-isoleucine (g/L) batch 1 batch 2 batch 3 Average control ATCC13032::-hom(R407H)-lysC(L377K)/pECCG117-ilvA(V323A) 4.1 4.0 4.3 4.13 experimental group ATCC13032::hom(R407H)-lysC(L377K)-clpC/pECCG117-ilvA(V323A) 6.3 5.7 5.6 5.87

As shown in Table 11 above, ATCC13032::-hom(R407H)-lysC(L377K) introduced only ilvA(V323A) mutation ATCC13032::-hom(R407H)-lysC(L377K)/pECCG117-ilvA(V323A) In contrast, in ATCC13032::hom(R407H)-lysC(L377K)-clpC_M4/pECCG117-ilvA(V323A) into which the clpC_M4 mutation was additionally introduced, it was confirmed that the concentration of L-isoleucine increased by about 42%.

The above results indicated that the introduction of the clpC mutation in the L-isoleucine-producing strain of the genus Corynebacterium was effective for the production of L-isoleucine.

From the above description, those skilled in the art to which the present application pertains will be able to understand that the present application may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present application should be construed as including all changes or modifications derived from the meaning and scope of the claims to be described later rather than the above detailed description and equivalent concepts thereof.

Korea Microorganism Conservation Center (Overseas) KCCM12755P 20200702 Korea Microorganism Conservation Center (Overseas) KCCM12858P 20201201

<110> CJ CheilJedang Corporation <120> Mutant ATP-dependent protease and method for producing L-amino acid using the same <130> KPA181548-KR-P1 <150> KR 10-2020-0173802 <151> 2020-12-11 <160> 26 <170> KoPatentIn 3.0 <210> 1 <211> 922 <212> PRT <213> Artificial Sequence <220> <223> ClpC variant ORF AA <400> 1 Met Phe Glu Arg Phe Thr Asp Arg Ala Arg Arg Val Ile Val Leu Ala 1 5 10 15 Gln Glu Glu Ala Arg Met Leu Asn His Asn Tyr Ile Gly Thr Glu His 20 25 30 Ile Leu Leu Gly Leu Ile His Glu Gly Glu Gly Val Ala Ala Lys Ala 35 40 45 Leu Glu Ser Met Gly Ile Ser Leu Asp Ala Val Arg Gln Glu Val Glu 50 55 60 Glu Ile Ile Gly Gln Gly Ser Gln Pro Thr Thr Gly His Ile Pro Phe 65 70 75 80 Thr Pro Arg Ala Lys Lys Val Leu Glu Leu Ser Leu Arg Glu Gly Leu 85 90 95 Gln Met Gly His Lys Tyr Ile Gly Thr Glu Phe Leu Leu Leu Gly Leu 100 105 110 Ile Arg Glu Gly Glu Gly Val Ala Ala Gln Val Leu Val Lys Leu Gly 115 120 125 Ala Asp Leu Pro Ar g Val Arg Gln Gln Val Ile Gln Leu Leu Ser Gly 130 135 140 Tyr Glu Gly Gly Gln Gly Gly Ser Pro Glu Gly Gly Gln Gly Ala Pro 145 150 155 160 Thr Gly Gly Asp Ala Val Gly Ala Gly Ala Ala Pro Gly Gly Arg Pro 165 170 175 Ser Ser Gly Gly Pro Gly Glu Arg Ser Thr Ser Leu Val Leu Asp Gln 180 185 190 Phe Gly Arg Asn Leu Thr Gln Ala Ala Lys Asp Gly Lys Leu Asp Pro 195 200 205 Val Val Gly Arg Asp Lys Glu Ile Glu Arg Ile Met Gln Val Leu Ser 210 215 220 Arg Arg Thr Lys Asn Asn Pro Val Leu Ile Gly Glu Pro Gly Val Gly 225 230 235 240 Lys Thr Ala Val Val Glu Gly Leu Ala Leu Asp Ile Val Asn Gly Lys 245 250 255 Val Pro Glu Thr Leu Lys Asp Lys Gln Val Tyr Ser Leu Asp Leu Gly 260 265 270 Ser Le u Val Ala Gly Ser Arg Tyr Arg Gly Asp Phe Glu Glu Arg Leu 275 280 285 Lys Lys Val Leu Lys Glu Ile Asn Gln Arg Gly Asp Ile Ile Leu Phe 290 295 300 Ile Asp Glu Ile His Thr Leu Val Gly Ala Gly Ala Ala Glu Gly Ala 305 310 315 320 Ile Asp Ala Ala Ser Leu Leu Lys Pro Lys Leu Ala Arg Gly Glu Leu 325 330 335 Gln Thr Ile Gly Ala Thr Thr Leu Asp Glu Tyr Arg Lys His Ile Glu 340 345 350 Lys Asp Ala Ala Leu Glu Arg Arg Phe Gln Pro Val Gln Val Pro Glu 355 360 365 Pro Ser Val Asp Leu Thr Val Glu Ile Leu Lys Gly Leu Arg Asp Arg 370 375 380 Tyr Glu Ala His His Arg Val Ser Ile Thr Asp Gly Ala Leu Thr Ala 385 390 395 400 Ala Ala Gln Leu Ala Asp Arg Tyr Ile Asn Asp Arg Phe Leu Pro Asp 405 410 415 Lys Ala Val Asp Leu Ile Asp Glu Ala Gly Ala Arg Met Arg Met Thr 420 425 430 Ala Pro Ser Ser Leu Arg Glu Val Asp Glu Arg Ile Ala Asp Val Arg 435 440 445 Arg Glu Lys Glu Ala Ala Ile Asp Ala Gln Asp Phe Glu Lys Ala Ala 450 455 460 Gly Leu Arg Asp Lys Glu Arg Lys Leu Gly Glu Glu Arg Ser Glu Lys 465 470 475 480 Glu Lys Gln Trp Arg Ser Gly Asp Leu Glu Asp Ile Ala Glu Val Gly 485 490 495 Glu Glu Gln Ile Ala Glu Val Leu Ala Asn Trp Thr Gly Ile Pro Val 500 505 510 Phe Lys Leu Thr Glu Ala Glu Ser Ser Arg Leu Leu Asn Met Glu Glu 515 520 525 Glu Leu His Lys Arg Ile Ile Gly Gln Asp Glu Ala Val Lys Ala Val 530 535 540 Ser Arg Ala Ile Arg Arg Thr Arg Ala Gly Leu Lys Asp Pro Lys Arg 545 550 555 560 Pro Ser Gly Ser Phe Ile Phe Ala Gly Pro Ser Gly Val Gly Lys Thr 565 570 575 Glu Leu Ser Lys Ala Leu Ala Gly Phe Leu Phe Gly Asp Asp Asp Ser 580 585 590 Leu Ile Gln Ile Asp Met Gly Glu Phe His Asp Arg Phe Thr Ala Ser 595 600 605 Arg Leu Phe Gly Ala Pro Pro Gly Tyr Val Gly Tyr Glu Glu Gly Gly 610 615 620 Gln Leu Thr Glu Lys Val Arg Arg Lys Pro Phe Ser Val Val Leu Phe 625 630 635 640 Asp Glu Ile Glu Lys Ala His Lys Glu Ile Tyr Asn Thr Leu Leu Gln 645 650 655 Val Leu Glu Asp Gly Arg Leu Thr Asp Gly Gln Gly Arg Ile Val Asp 660 665 670 Phe Lys Asn Thr Val Leu Ile Phe Thr Ser Asn Leu Gly Thr Ser Asp 675 680 685 Ile Ser Lys Ala Val Gly Leu Gly Phe Ser Gly Ser Ser Glu Thr Asp 690 695 700 Ser Asp Ala Gln Tyr Asp Arg Met Lys Asn Lys Val His Asp Glu Leu 705 710 715 720 Lys Lys His Phe Arg Pro Glu Phe Leu Asn Arg Ile Asp Glu Ile Val 725 730 735 Val Phe His Gln Leu Thr Lys Asp Gln Ile Val Gln Met Val Asp Leu 740 745 750 Leu Ile Gly Arg Val Ser Asn Ala Leu Ala Glu Lys Asp Met Ser Ile 755 760 765 Glu Leu Thr Glu Lys Ala Lys Asp Leu Leu Ala Ser Arg Gly Phe Asp 770 775 780 Pro Val Leu Gly Ala Arg Pro Leu Arg Arg Thr Ile Gln Arg Glu Ile 785 790 795 800 Glu Asp Gln Met Ser Glu Lys Ile Leu Phe Gly Glu Ile Gly Ala Gly 805 810 815 Glu Ile Val Thr Val Asp Val Glu Gly Trp Asp Gly Glu Ser Lys Asp 820 825 830 Thr Asp Arg Ala Lys Phe Thr Phe Thr Pro Arg Pro Lys Pro Met Pro 835 84 0 845 Glu Gly Lys Phe Ser Glu Ile Ser Val Gln Ala Ala Glu Ala Ile Gln 850 855 860 Asp Val Asp Ser Ala Ala Asp Gly Asp Val Pro Glu Thr Asp Ser Leu 865 870 875 880 Ser Asp Ile Asp Leu Glu Thr Leu Glu Lys Phe Glu Glu Asp Val Glu 885 890 895 Asn Gly Thr Asp Ile Asp Gln Val Ser Gly Asp Tyr Tyr Gly Thr Asp 900 905 910 Asp Gln Gly Gly Thr Ala Pro Ser Lys Glu 915 920 <210> 2 <211> 2769 < 212> DNA <213> Artificial Sequence <220> <223> clpC variant ORF NT <400> 2 atgttcgaga ggtttaccga tcgtgcacgc cgcgtgattg tgctcgcgca ggaagaggcg 60 cgcatgctca accacaatta catcggcacg gagcacattc tcctcggcct cattcacgag 120 ggcgagggcg ttgcagccaa ggctttggaa tccatgggaa tttccctgga cgccgtccgc 180 caggaagtcg aagagattat cggccagggc tcccagccca ccaccggcca cattcctttt 240 actccacgtg ccaagaaggt cctggagctc agcctccgcg agggactaca gatgggacac 300 aagtacatcg gtactga gtt cctgcttctc ggtttgatcc gtgagggcga gggcgttgct 360 gcccaggtcc tggtcaagct tggtgctgat ctgccacgcg tgcgtcagca agttattcag 420 cttctctccg gctacgaagg tggccagggc ggatccccag agggcggtca gggcgcccct 480 actggcggtg acgctgttgg tgcaggagct gctcctggcg gtcgtccatc ttcgggcggc 540 ccaggcgagc gttctacctc tttggttctt gaccagttcg gccgcaacct cacccaggcc 600 gcaaaggacg gcaagctgga cccagttgtt ggtcgtgata aggaaatcga gcgcatcatg 660 caggtgctct cccgtcgtac caagaacaac ccagttctta ttggtgagcc aggtgttggt 720 aagaccgcag ttgttgaagg tcttgcacta gacattgtta acggcaaggt tccagagacc 780 ctcaaggaca agcaggttta ctcccttgac ttaggttcac tggttgcagg ttcccgttac 840 cgcggtgact tcgaagagcg cctgaagaag gtcctcaagg agattaacca gcgcggcgac 900 atcatcctgt ttatcgatga gatccacacc ctcgtgggtg caggtgcagc agaaggcgca 960 atcgacgccg cctccctgct taagccaaag cttgcccgcg gtgaactgca gaccattggt 1020 gcaaccacct tggacgagta ccgtaagcac attgaaaagg acgcagctct tgagcgtcgt 1080 ttccagccag tgcaggttcc agagccttcg gttgatctca ccgttgagat cttgaagggt 1140 ctgcgcgacc gctacgaagc tcaccaccgc gt atccatca ccgatggtgc tcttaccgca 1200 gcagctcagc ttgctgatcg ctacattaac gaccgcttct tgccagataa ggccgttgac 1260 ctcatcgatg aggctggcgc ccgcatgcgc atgaccgcac cgtcctccct ccgcgaggtt 1320 gatgagcgca tcgctgatgt tcgccgtgag aaggaagcag cgatcgatgc tcaggacttt 1380 gagaaggcag caggtcttcg cgataaggag cgcaagctcg gcgaagagcg ttcagagaag 1440 gaaaagcagt ggcgctccgg cgacctcgag gacattgctg aggttggcga agagcagatc 1500 gcagaagtac tggccaactg gactggtatt cctgtcttca agctcaccga agctgagtct 1560 tcccgcctgc tcaacatgga agaagagttg cacaagcgca tcatcggaca ggatgaagct 1620 gtcaaggctg tctcccgtgc gatccgtcgt acccgtgcag gtctgaagga tcctaagcgt 1680 ccttccggct ccttcatctt cgctggtcca tccggtgttg gtaagaccga gctgtccaag 1740 gcacttgctg gattcctctt cggtgacgat gattccctca tccaaatcga catgggtgaa 1800 ttccacgacc gcttcaccgc gtcccgactc ttcggtgccc ctccgggata cgttggctac 1860 gaagaaggtg gccagctgac cgagaaggtt cgccgtaagc cattctccgt tgtgcttttc 1920 gacgagatcg agaaggccca caaggagatc tacaacacct tgctgcaggt gttggaagat 1980 ggtcgcctta ccgatggtca gggtcgcatt gtggactt ca agaacaccgt cctgatcttc 2040 acctccaacc tgggcacctc tgacatctcc aaggctgttg gcctgggctt ctccggatcc 2100 tctgagactg acagcgatgc tcagtacgac cgcatgaaga acaaggtcca cgacgagctg 2160 aagaagcact tccgccctga gttcctgaac cgtattgatg agatcgtggt cttccaccag 2220 ctcaccaagg atcagatcgt tcagatggtc gaccttctta ttggccgcgt gtccaacgca 2280 ctggctgaga aggacatgag catcgaactg actgagaagg ctaaggatct ccttgccagc 2340 cgcggcttcg atccagttct gggtgcacga ccattgcgtc gcaccattca gcgcgaaatc 2400 gaagaccaga tgtccgagaa gatcctcttc ggagaaatcg gtgctggcga gatcgtcacc 2460 gtcgacgtcg aaggctggga cggcgagtcc aaggacaccg accgtgcgaa gttcaccttc 2520 acaccacgtc caaagccaat gccagaaggt aagttctctg agatctccgt acaggctgca 2580 gaagcaatcc aagatgtaga ttccgcagct gacggcgatg tcccagaaac cgattcactt 2640 tccgacattg accttgaaac ccttgagaag ttcgaggaag atgtagaaaa cggcaccgac 2700 attgatcagg tatccggtga ctactacggc accgatgatc agggaggcac tgctccaagc 2760 aaggagtag 2769 <210> 3 <211> 3 <212 > PRT <213> Artificial Sequence <220> <223> 431~433 AA <400> 3 Ile Lys Arg 1 <210> 4 <211> 9 <212> DNA <213> Artificial Sequence <220> <223> 1,291~1,299 NT <400> 4 atcaagcgc 9 <210> 5 <211> 925 <212> PRT <213> Unknown <220> < 223> ClpC ORF WT AA <400> 5 Met Phe Glu Arg Phe Thr Asp Arg Ala Arg Arg Val Ile Val Leu Ala 1 5 10 15 Gln Glu Glu Ala Arg Met Leu Asn His Asn Tyr Ile Gly Thr Glu His 20 25 30 Ile Leu Leu Gly Leu Ile His Glu Gly Glu Gly Val Ala Ala Lys Ala 35 40 45 Leu Glu Ser Met Gly Ile Ser Leu Asp Ala Val Arg Gln Glu Val Glu 50 55 60 Glu Ile Ile Gly Gly Gly Ser Gln Pro Thr Thr Gly His Ile Pro Phe 65 70 75 80 Thr Pro Arg Ala Lys Lys Val Leu Glu Leu Ser Leu Arg Glu Gly Leu 85 90 95 Gln Met Gly His Lys Tyr Ile Gly Thr Glu Phe Leu Leu Leu Gly Leu 100 105 110 Ile Arg Glu Gly Glu Gly Val Ala Ala Gln Val Leu Val Lys Leu Gly 115 120 125 Ala Asp Leu Pro Arg Val Arg Gln Gln Val Ile Gln Leu Leu Ser Gly 130 135 140 Tyr Glu Gly Gly Gln Gly Gly Gly Ser Pro Glu Gly Gly Gl n Gly Ala Pro 145 150 155 160 Thr Gly Gly Asp Ala Val Gly Ala Gly Ala Ala Pro Gly Gly Arg Pro 165 170 175 Ser Ser Gly Gly Gly Pro Gly Glu Arg Ser Thr Ser Leu Val Leu Asp Gln 180 185 190 Phe Gly Arg Asn Leu Thr Gln Ala Ala Lys Asp Gly Lys Leu Asp Pro 195 200 205 Val Val Gly Arg Asp Lys Glu Ile Glu Arg Ile Met Gln Val Leu Ser 210 215 220 Arg Arg Thr Lys Asn Asn Pro Val Leu Ile Gly Glu Pro Gly Val Gly 225 230 235 240 Lys Thr Ala Val Val Glu Gly Leu Ala Leu Asp Ile Val Asn Gly Lys 245 250 255 Val Pro Glu Thr Leu Lys Asp Lys Gln Val Tyr Ser Leu Asp Leu Gly 260 265 270 Ser Leu Val Ala Gly Ser Arg Tyr Arg Gly Asp Phe Glu Glu Arg Leu 275 280 285 Lys Lys Val Leu Lys Glu Ile Asn Gln Ar g Gly Asp Ile Ile Leu Phe 290 295 300 Ile Asp Glu Ile His Thr Leu Val Gly Ala Gly Ala Ala Glu Gly Ala 305 310 315 320 Ile Asp Ala Ala Ser Leu Leu Lys Pro Lys Leu Ala Arg Gly Glu Leu 325 330 335 Gln Thr Ile Gly Ala Thr Thr Leu Asp Glu Tyr Arg Lys His Ile Glu 340 345 350 Lys Asp Ala Ala Leu Glu Arg Arg Phe Gln Pro Val Gln Val Pro Glu 355 360 365 Pro Ser Val Asp Leu Thr Val Glu Ile Leu Lys Gly Leu Arg Asp Arg 370 375 380 Tyr Glu Ala His Arg Val Ser Ile Thr Asp Gly Ala Leu Thr Ala 385 390 395 400 Ala Ala Gln Leu Ala Asp Arg Tyr Ile Asn Asp Arg Phe Leu Pro Asp 405 410 415 Lys Ala Val Asp Leu Ile Asp Glu Ala Gly Ala Arg Met Arg Ile Lys 420 425 430 Arg Met Thr Ala Pro Ser Se r Leu Arg Glu Val Asp Glu Arg Ile Ala 435 440 445 Asp Val Arg Arg Glu Lys Glu Ala Ala Ile Asp Ala Gln Asp Phe Glu 450 455 460 Lys Ala Ala Gly Leu Arg Asp Lys Glu Arg Lys Leu Gly Glu Glu Arg 465 470 475 480 Ser Glu Lys Glu Lys Gln Trp Arg Ser Gly Asp Leu Glu Asp Ile Ala 485 490 495 Glu Val Gly Glu Glu Gln Ile Ala Glu Val Leu Ala Asn Trp Thr Gly 500 505 510 Ile Pro Val Phe Lys Leu Thr Glu Ala Glu Ser Ser Arg Leu Leu Asn 515 520 525 Met Glu Glu Glu Leu His Lys Arg Ile Ile Gly Gln Asp Glu Ala Val 530 535 540 Lys Ala Val Ser Arg Ala Ile Arg Arg Thr Arg Ala Gly Leu Lys Asp 545 550 555 560 Pro Lys Arg Pro Ser Gly Ser Phe Ile Phe Ala Gly Pro Ser Gly Val 565 570 575 Gly Lys Thr Gl u Leu Ser Lys Ala Leu Ala Gly Phe Leu Phe Gly Asp 580 585 590 Asp Asp Ser Leu Ile Gln Ile Asp Met Gly Glu Phe His Asp Arg Phe 595 600 605 Thr Ala Ser Arg Leu Phe Gly Ala Pro Pro Gly Tyr Val Gly Tyr Glu 610 615 620 Glu Gly Gly Gln Leu Thr Glu Lys Val Arg Arg Lys Pro Phe Ser Val 625 630 635 640 Val Leu Phe Asp Glu Ile Glu Lys Ala His Lys Glu Ile Tyr Asn Thr 645 650 655 Leu Leu Gln Val Leu Glu Asp Gly Arg Leu Thr Asp Gly Gln Gly Arg 660 665 670 Ile Val Asp Phe Lys Asn Thr Val Leu Ile Phe Thr Ser Asn Leu Gly 675 680 685 Thr Ser Asp Ile Ser Lys Ala Val Gly Leu Gly Phe Ser Gly Ser Ser 690 695 700 Glu Thr Asp Ser Asp Ala Gln Tyr Asp Arg Met Lys Asn Lys Val His 705 710 715 720 As p Glu Leu Lys Lys His Phe Arg Pro Glu Phe Leu Asn Arg Ile Asp 725 730 735 Glu Ile Val Val Phe His Gln Leu Thr Lys Asp Gln Ile Val Gln Met 740 745 750 Val Asp Leu Leu Ile Gly Arg Val Ser Asn Ala Leu Ala Glu Lys Asp 755 760 765 Met Ser Ile Glu Leu Thr Glu Lys Ala Lys Asp Leu Leu Ala Ser Arg 770 775 780 Gly Phe Asp Pro Val Leu Gly Ala Arg Pro Leu Arg Arg Thr Ile Gln 785 790 795 800 Arg Glu Ile Glu Asp Gln Met Ser Glu Lys Ile Leu Phe Gly Glu Ile 805 810 815 Gly Ala Gly Glu Ile Val Thr Val Asp Val Glu Gly Trp Asp Gly Glu 820 825 830 Ser Lys Asp Thr Asp Arg Ala Lys Phe Thr Phe Thr Pro Arg Pro Lys 835 840 845 Pro Met Pro Glu Gly Lys Phe Ser Glu Ile Ser Val Gln Ala Ala Glu 850 855 860 Ala Ile Gl n Asp Val Asp Ser Ala Ala Asp Gly Asp Val Pro Glu Thr 865 870 875 880 Asp Ser Leu Ser Asp Ile Asp Leu Glu Thr Leu Glu Lys Phe Glu Glu 885 890 895 Asp Val Glu Asn Gly Thr Asp Ile Asp Gln Val Ser Gly Asp Tyr Tyr 900 905 910 Gly Thr Asp Asp Gln Gly Gly Thr Ala Pro Ser Lys Glu 915 920 925 <210> 6 <211> 2778 <212> DNA <213> Unknown <220> <223> clpC ORF WT NT <400> 6 atgttcgaga ggtttaccga tcgtgcacgc cgcgtgattg tgctcgcgca ggaagaggcg 60 cgcatgctca accacaatta catcggcacg gagcacattc tcctcggcct cattcacgag 120 ggcgagggcg ttgcagccaa ggctttggaa tccatgggaa tttccctgga cgccgtccgc 180 caggaagtcg aagagattat cggccagggc tcccagccca ccaccggcca cattcctttt 240 actccacgtg ccaagaaggt cctggagctc agcctccgcg agggactaca gatgggacac 300 aagtacatcg gtactgagtt cctgcttctc ggtttgatcc gtgagggcga gggcgttgct 360 gcccaggtcc tggtcaagct tggtgctgat ctgccacgcg tgcgtcagca agttattcag 420 cttctctccg gctacgaagg tggccagggc ggatccccag agggcggtca gggcgcccct 480 actggcggtg acgctgttgg tgcaggagct gctcctggcg gtcgtccatc ttcgggcggc 540 ccaggcgagc gttctacctc tttggttctt gaccagttcg gccgcaacct cacccaggcc 600 gcaaaggacg gcaagctg ga cccagttgtt ggtcgtgata aggaaatcga gcgcatcatg 660 caggtgctct cccgtcgtac caagaacaac ccagttctta ttggtgagcc aggtgttggt 720 aagaccgcag ttgttgaagg tcttgcacta gacattgtta acggcaaggt tccagagacc 780 ctcaaggaca agcaggttta ctcccttgac ttaggttcac tggttgcagg ttcccgttac 840 cgcggtgact tcgaagagcg cctgaagaag gtcctcaagg agattaacca gcgcggcgac 900 atcatcctgt ttatcgatga gatccacacc ctcgtgggtg caggtgcagc agaaggcgca 960 atcgacgccg cctccctgct taagccaaag cttgcccgcg gtgaactgca gaccattggt 1020 gcaaccacct tggacgagta ccgtaagcac attgaaaagg acgcagctct tgagcgtcgt 1080 ttccagccag tgcaggttcc agagccttcg gttgatctca ccgttgagat cttgaagggt 1140 ctgcgcgacc gctacgaagc tcaccaccgc gtatccatca ccgatggtgc tcttaccgca 1200 gcagctcagc ttgctgatcg ctacattaac gaccgcttct tgccagataa ggccgttgac 1260 ctcatcgatg aggctggcgc ccgcatgcgc atcaagcgca tgaccgcacc gtcctccctc 1320 cgcgaggttg atgagcgcat cgctgatgtt cgccgtgaga aggaagcagc gatcgatgct 1380 caggactttg agaaggcagc aggtcttcgc gataaggagc gcaagctcgg cgaagagcgt 1440 tcagagaagg aaaagcagtg gcgctccgg c gacctcgagg acattgctga ggttggcgaa 1500 gagcagatcg cagaagtact ggccaactgg actggtattc ctgtcttcaa gctcaccgaa 1560 gctgagtctt cccgcctgct caacatggaa gaagagttgc acaagcgcat catcggacag 1620 gatgaagctg tcaaggctgt ctcccgtgcg atccgtcgta cccgtgcagg tctgaaggat 1680 cctaagcgtc cttccggctc cttcatcttc gctggtccat ccggtgttgg taagaccgag 1740 ctgtccaagg cacttgctgg attcctcttc ggtgacgatg attccctcat ccaaatcgac 1800 atgggtgaat tccacgaccg cttcaccgcg tcccgactct tcggtgcccc tccgggatac 1860 gttggctacg aagaaggtgg ccagctgacc gagaaggttc gccgtaagcc attctccgtt 1920 gtgcttttcg acgagatcga gaaggcccac aaggagatct acaacacctt gctgcaggtg 1980 ttggaagatg gtcgccttac cgatggtcag ggtcgcattg tggacttcaa gaacaccgtc 2040 ctgatcttca cctccaacct gggcacctct gacatctcca aggctgttgg cctgggcttc 2100 tccggatcct ctgagactga cagcgatgct cagtacgacc gcatgaagaa caaggtccac 2160 gacgagctga agaagcactt ccgccctgag ttcctgaacc gtattgatga gatcgtggtc 2220 ttccaccagc tcaccaagga tcagatcgtt cagatggtcg accttcttat tggccgcgtg 2280 tccaacgcac tggctgagaa ggacatgagc atcg aactga ctgagaaggc taaggatctc 2340 cttgccagcc gcggcttcga tccagttctg ggtgcacgac cattgcgtcg caccattcag 2400 cgcgaaatcg aagaccagat gtccgagaag atcctcttcg gagaaatcgg tgctggcgag 2460 atcgtcaccg tcgacgtcga aggctgggac ggcgagtcca aggacaccga ccgtgcgaag 2520 ttcaccttca caccacgtcc aaagccaatg ccagaaggta agttctctga gatctccgta 2580 caggctgcag aagcaatcca agatgtagat tccgcagctg acggcgatgt cccagaaacc 2640 gattcacttt ccgacattga ccttgaaacc cttgagaagt tcgaggaaga tgtagaaaac 2700 ggcaccgaca ttgatcaggt atccggtgac tactacggca ccgatgatca gggaggcact 2760 gctccaagca aggagtag 2778 <210> 7 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> P1 <400> 7 ctattctaga tccagagacc ctcaaggaca agcag 35 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> P2 <400> 8 ggacggtgcg gtcatgcgca tgcgggcgcc 30 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> P3 <400> 9 ggcgcccgca tgcgcatgac cgcaccgtcc 30 <210> 10 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> P4 <400> 10 ctattctaga tcgatttgga tg agggaatc atcg 34 <210> 11 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> P5 <400> 11 aatttctaga ggcagaccct attctatgaa gg 32 <210> 12 <211> 30 <212> DNA <213 > Artificial Sequence <220> <223> P6 <400> 12 agtgtttcgg tctttacaga cacgagggac 30 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> P7 <400> 13 gtccctcgtg tctgtaaaga ccgaaacact 30 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> P8 <400> 14 aatttctaga cgtgggagtg tcactcgctt gg 32 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> P9 <400> 15 tcctctagag ctgcgcagtg ttgaatacg 29 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> P10 <400> 16 tggaaatctt ttcgatgttc acgttgacat 30 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> P11 <400> 17 acatcgaaaa gatttccacc tctgagattc 30 <210> 18 <211> 29 <212> DNA <213> Artificial Sequence <220> < 223> P12 <400> 18 gactctagag ttcacctcag agacgatta 29 <210> 19 <211> 29 <212> DNA <213> Artificial Sequence <220> <223 > P13 <400> 19 tcctctagac tggtcgcctg atgttctac 29 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> P14 <400> 20 cacgatcaga tgtgcatcat cat 23 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> P15 <400> 21 atgatgatgc acatctgatc gtg 23 <210> 22 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> P16 <400 > 22 gactctagat tagtcccttt cgaggcgga 29 <210> 23 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P17 <400> 23 acggatccca gactccaaag caaaagcg 28 <210> 24 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> P18 <400> 24 acaccacggc agaaccaggt gcaaaggaca 30 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> P19 <400> 25 ctggttctgc cgtggtgtgc atcatctctg 30 <210> 26 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P20<400> 26 acggatccaa ccaaacttgc tcacactc 28

Claims (13)

A microorganism of the genus Corynebacterium, wherein the ATP-dependent protease activity is attenuated compared to the unmodified microorganism.
The microorganism of the genus Corynebacterium according to claim 1, wherein the microorganism has the ability to produce branched chain amino acids.
The microorganism of the genus Corynebacterium according to claim 2, wherein the branched chain amino acid is L-valine or L-isoleucine.
The microorganism of the genus Corynebacterium according to claim 1, wherein the attenuation is attenuation of the ATP-dependent Clp protease ATP-binding subunit activity.
The microorganism of the genus Corynebacterium according to claim 4, wherein the ATP-dependent Clp protease ATP-binding subunit is derived from the genus Corynebacterium.
The microorganism of the genus Corynebacterium according to claim 4, wherein the ATP-dependent Clp protease ATP-binding subunit comprises SEQ ID NO: 5 or a polypeptide described with an amino acid sequence having 90% or more identity thereto.
According to claim 1, wherein the microorganism is based on the SEQ ID NO: 431 to 433 positions based on the SEQ ID NO of the sequence shown in SEQ ID NO: 5 based on the amino acid deletion polypeptide, or the sequence shown in SEQ ID NO: 6 A microorganism of the genus Corynebacterium comprising a polynucleotide in which the nucleotides corresponding to positions 1,291 to 1299 are deleted.
According to claim 1, wherein the Corynebacterium genus microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum ) Will, the microorganism.
Based on the amino acid sequence shown in SEQ ID NO: 5, the amino acid sequence corresponding to positions 431 to 433 is deleted, ClpC variant.
The ClpC variant according to claim 9, wherein the variant comprises a polypeptide described with the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90% identity therewith.
A polynucleotide encoding the ClpC variant of claim 9 .
A microorganism of the genus Corynebacterium whose ATP-dependent protease activity is weakened compared to an unmodified microorganism, or a ClpC variant in which the amino acid sequence corresponding to positions 431 to 433 is deleted based on the amino acid sequence shown in SEQ ID NO: 5, or A method for producing branched chain amino acids, comprising the step of culturing a microorganism of the genus Corynebacterium comprising a polynucleotide encoding the ClpC variant in a medium.
13. The method of claim 12, further comprising the step of recovering the branched chain amino acids from the medium or microorganisms after the culturing step, branched chain amino acid production method.