KR20150069248A - Novel Pleurotus eryngii var. ferulae Strain P48-24s and its descendants - Google Patents

Abstract

The present invention relates to a Pleurotus eryngii var. ferulae. More specifically, the present invention relates to a novel Pleurotus eryngii var. ferulae strain P48-24s which follows a line of DDL01 (Accession number: KACC93085P) which can be obtained by selecting conventionally known Pleurotus eryngii var. ferulae strains and then cross breeding the selected Pleurotus eryngii var. ferulae strains with the Pleurotus eryngii var. ferulae DDL01 (KACC93085P). The present invention also relates to a Pleurotus eryngii var. ferulae strain, which follows a line of P48-24s and which is a descendant of the P48-24s and which can be obtained by crossing breeding a strain, which is developed from the novel Pleurotus eryngii var. ferulae strain P48-24s, and a second strain developed therefrom.

Description

The novel strain P48-24s and its offspring {Novel Pleurotus eryngii var. ferulae Strain P48-24s and its descendants}

(KACC93085P) obtained by cross-breeding a selected strain of aviforme mushroom strain and a strain selected from the previously known strains and a strain of avirulent mushroom DDL01 (accession number: KACC93085P) And a strain P48-24s, which is a progeny of P48-24s, produced by hybridizing a strain developed from the strain with a second strain of the strain.

It is classified as Pleurotus eryngii var. Ferulae (Pleurotus eryngii var. Ferulae) or Pleurotus ferulae (Pleurotus ferulae) of pleurototaceae. Because it is wild in the arid tree of Xinjiang province of China, which is a dry area, it is called "

Research on artificial cultivation began in 1958 in India, France and Germany. In 1958, Kalmer was the first to succeed in artificial cultivation. In 1983, artificially cultivated artificial cultivation of sawdust, cottonseed, and bran in China. (1990), which has been widely used in Fujian Province and Sinjangseong Province (Dong-hee, 2005) and secures excellent strains by crossing monocotyledonous mushroom (Hong Gi-hyung, 2004).

As for the morphological characteristics of the fruiting body of the eggplant mushroom, it is 15-100 mm in size and 20-50 mm in the optimum. It is hemispherical at the beginning, the end of the egg is curved inward, and when it grows, it becomes semi-spherical, used flat or flat It spreads. The optimum is hemispherical. The surface is smooth. In the younger period, it is gray (5D2, brownish gray, Methuen Handbook of Color) and grows to grayish orange (5B3, greyish orange). When it is wet, it becomes hygroscopic. The tissue is soft and resilient, meaty and milky. Taste is sweet and has an aroma similar to that of sugarcane. Especially when you chew chewy texture is very good. The wrinkles are wrinkles on the stool, 15-35 × 1-3 mm, 4-shape, and somewhat dense. It is milky white at the beginning and 4A2 (yellowish white) when it grows. The wrinkle blade is smooth. The size of the pedestal is 50-150 × 15-35㎜, the optimum is a cylindrical form of 15-40 × 70-90㎜, and the base side is somewhat thick or swollen. The surface is milky white and the surface is smooth. There is a car inside. It is very strong in the longitudinal direction and thinly torn in the lateral direction. The color of the spores is white. The spores are cylindrical with a size of 5 ~ 6 × 7 ~ 9㎛. The volcano is 24-39 × 5-7 μm long and has a long club style, mostly 4-spore type, with a clamp on the base. The size of the epidermidis is 25-35 × 5-8 μm, with club, fusiform, clublike fusiform shape. Generally, there are 1-3 rhyolitic projections at the top, and the cell wall is thin and colorless. There is no sidesteadia. The fascial layer structure is parallel mycelial-crossover type and is the first mycelial tissue type and there is a clamp on the diaphragm of mycelia

It is known that Ai outerium mushrooms having such morphological characteristics are superior in morphology and rich in flavor compared with other mushrooms, and have high anti-tumor and hypoglycemic effect while having high edible value (Hong et al., 2004). In addition, it has been known that the medicinal efficacy of controlling gynecologic diseases by stopping stomach and kidney disorders and coughs and eliminating inflammation is known (Kim Dae-sik, 2002), and also contains a large amount of dietary fiber, amino acid and other vitamins, Its value as medicinal mushroom is high. Recently, it has been studied in Korea since 2001 due to its high popularity as an edible mushroom in Korea. However, it has not been commercialized since 2001, and it has been confirmed by the Applicant that DDU01 (Accession No. KACC93085P) Is currently being commercialized and sold.

The mushroom DDU01 (accession number: KACC93085P) is short in cultivation period, has good taste and shape, and has high commerciality.

However, in the United States, US consumers are more likely to have a fresh white color near the surface of fruiting bodies, but as shown in FIG. 1, the reddish mushroom DDL01 has a brown leaf pattern, In order to create a higher value added in the US, which is a consuming place, than the aviator mushroom DDL01, it was necessary to develop a newly improved strain in terms of coloring and other morphological characteristics of gut.

As a result of efforts to solve these problems, the present inventors have succeeded in breeding the A. myrtle mushroom strain, which is more commercial than the commercialized DDL01 (KACC93085P) strain and has a strain of DDL01 (KACC93085P) strain, and completed the present invention.

Accordingly, an object of the present invention is to provide a method of producing a strain of DDU01 (KACC93085P) having a morphological characteristic capable of bringing a favorable feeling of consumers closer to white than the commercialized DDL01 (KACC93085P) The strain P48-24s (accession number: KCCM11288P) and the strain developed from the strain are hybridized with the second strain of the above-mentioned species to produce P48-24s strain Pseudomonas aeruginosa strain, which is a progeny of P48-24s.

It is another object of the present invention to provide a novel strain P48-24s which has a color of freshly white surface but which has no habit-like mottled pattern and which has a favorable color tone and which is superior in quality and commerciality to a strain of DDL01 (KACC93085P) Which is a progeny of P48-24s produced by hybridizing a strain developed from a strain with a second strain of the above-mentioned species.

The objects of the present invention are not limited to the above-mentioned objects, and other objects not mentioned can be clearly understood by those skilled in the art from the following description.

In order to achieve the above object of the present invention, first, the present invention provides a spore obtained from a new strain Pseudomonas aeruginosa P48-24s (accession number: KCCM11288P) deposited on June 25, 2012 at the Korean Microorganism Conservation Center do.

In addition, the present invention provides an inoculum comprising the novel strain Aiuteridium mushroom P48-24s (Accession No .: KCCM11288P).

In addition, the present invention provides a mushroom spawn comprising the new strain Pseudomonas aeruginosa P48-24s (Accession No. KCCM11288P).

In addition, the present invention provides homokaryons of the new strain Pseudomonas aeruginosa P48-24s obtained from the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).

In addition, the present invention provides a mushroom produced by fruiting of the novel strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).

In addition, the present invention relates to a method of propagating somatic cells or a method of propagation of somatic cells or cultured cells by a single-spore culture method or a multi-spore culture method of a new bacterial strain Aiuterium mushroom P48-24s (accession number: KCCM11288P) Lt; RTI ID = 0.0 > P48-24s < / RTI > strain produced by screening.

The present invention also relates to a method for producing a strain of P48-24s strain of the strain P48-24s produced by regeneration and screening of a strain from a mushroom tissue section of a strain of the novel strain Pichia mushroom P48-24s (accession number: KCCM11288P) Mushroom strain.

In addition, the present invention provides a Pseudomonas aeruginosa strain of the P48-24s series produced by the selection of mushroom-bearing basidiospores of the new strain Pseudomonas aeruginosa P48-24s (accession number: KCCM11288P) or a strain developed therefrom.

In addition, the present invention relates to a method for producing a microorganism which is produced by hybridizing two strains of avian oyster mushroom P48-24s from one or two avium oyster mushrooms P48-24s (accession number: KCCM11288P) Pseudomonas aeruginosa strain P48-24s.

The present invention also provides a mushroom produced by the fruiting of any of the above-mentioned P48-24s strains of A. aeruginosa.

The present invention has the following excellent effects.

That is, according to the present invention, a strain of the genus Agilentum mushroom (KACC93085P), which has a morphological characteristic that can bring out the favorable feeling of the consumers by approaching the white color of the fresh surface of the commercial DDL01 (KACC93085P) strain, P48-24s (Accession No .: KCCM11288P) and a strain developed from the strain can be provided with a strain of P48-24s strain Pseudomonas aeruginosa, which is a progeny of P48-24s produced by hybridization with the second strain of the above species.

In addition, the fungus body of the pseudomonas mushroom strain P48-24s of the present invention and the strain developed from the strain of the present invention are hybridized with the second strain of the above-mentioned species, The mushrooms produced by fruiting are fresh white color with no whiteness and no habit-like mottled pattern.

Fig. 1 is a photograph of a fruit body cultivated with a commercialized strain of Pleurotus eryngii var. Ferulae DDL01 (KACC93085P).
FIG. 2 is a fluorescence microscope photograph showing the nuclei of spores of the avian oyster mushroom new strain P48-24s (accession number: KCCM11288P) and P48-24S family avirulent mushroom strains 1 to 5 of the present invention.
Fig. 3 shows the systematic relationship of a new strain of Pseudomonas aeruginosa strain P48-24s (accession number: KCCM11288P) according to the present invention by the UPGMA method.
Fig. 4 is a photograph showing that a fruiting body grown with a new strain P4-24s (accession number: KCCM11288P) according to the present invention is in the form of a two-spore type in a vertebrate.
FIG. 5 is a photograph of a mushroom having a fruit body formed by cultivating a new strain of avifolium mushroom P48-24s (accession number: KCCM11288P) according to an embodiment of the present invention.
FIG. 6 is a photograph of a mushroom of which a strain (Pseudomonas aeruginosa 1) of the genus Pseudomonas aeruginosa strain P48-24s according to another embodiment of the present invention is cultivated and a fruit body is formed.

Although the terms used in the present invention have been selected as general terms that are widely used at present, there are some terms selected arbitrarily by the applicant in a specific case. In this case, the meaning described or used in the detailed description part of the invention The meaning must be grasped.

Hereinafter, the technical structure of the present invention will be described in detail with reference to the accompanying drawings and preferred embodiments.

However, the present invention is not limited to the embodiments described herein but may be embodied in other forms.

The present invention relates broadly to a group of P. aeruginosa strains, including a newly developed avian oyster mushroom new strain P48-24s and a strain developed or descended therein. Specifically, the present invention relates to a method for producing a microorganism by hybridizing a second strain of the above species with a strain of Pseudomonas aeruginosa strain P48-24s, a strain directly grown from the P48-24s, and a strain derived from the P48-24s strain itself or the P48-24s strain Which is a progeny of the produced P48-24s strain P48-24s.

The term " descended "as used herein refers to a genealogically from a strain rather than to an evolutionarily systematic line, which means a natural developmental process of genetic divergence, typically involving at least several hundred generations and thousands of years. It is especially considered to have come down. The term " developed from "may mean that it includes any sorting or manipulating means of any element of the starting material (in this case a strain of Asteraceae). The term "hybridization" may mean that two different strains are achieved in close proximity, preferably on a sterile medium, by causing them to grow together until anastomosis (i. E., Mycelia or cell fusion) is induced. When two compatible nuclei (i.e., two nuclei have different alleles at the Mat locus determining the mating type) are present in the fusion cell, they proliferate together and establish a growing heterokaryotic strain do. This process is commonly known as crossing. When each of the two nuclei in the resulting heterologous strain is contributed by different parental strains involved in the fusion process, the new heterologous nucleotide is a first-generation outcrossed hybrid offspring of the two parents. For example, if the P48-24s strain is one of the parent strains and it crosses with other parent strains of the avian oyster mushroom, the resulting hybrid is a first generation crossbreeding hybrid, Lt; / RTI >

 Thus, the present invention encompasses all strains developed from this strain by the novel strain aviforme mushroom P48-24s and by all means, including but not limited to single-spore culture, multi-spore culture and somatic cell sorting And includes all hybrid strains from the P48-24s lineage, including first generation hybrid strains and any hybrid strains produced by the offspring of P48-24s.

 In a more preferred embodiment of the present invention, the strain strains P48-24s or strains from this strain are strains of the DDL01 (KACC93085P) strain group or strains from said strain to further form a unique new hybrid strain This can be hybridized or crossed with the strain.

A preferred hybridization method utilizes two haploid strains (i. E., Homologs) obtained from each of the non-haploid (i.e., heterologous) parental strains. Haploid strains containing a single nucleus hybridize with a higher success rate and, in contrast to fusion involving a heterologous nucleus, produce only one, predictable, offspring with a nucleotide genotype. Homologues can be developed from parental strains or from germinated spores by a variety of methods including the production of protoplasts, isolation of mycelium tips. The latter method provides a homologue with various genotypes as a result of meiosis recombination during sporogenesis. In addition, all of the above-described methods can be used to develop a P48-24s heterologous selection culture, which can produce mushroom crops and achieve various aspects of the present invention.

The advantages of the present invention over the existing prior art with respect to the P. aeruginosa strain P48-24s or the strain P48-24s family of P. aeruginosa strains from which the strain is derived will be clear from the description below, Is achieved by the present invention.

The present invention can be accomplished by hybrid fungal culturing of the avian oyster mushroom strain represented by the strain P48-24s, and a representative strain of the fungal strain is deposited with the Korean Society for Microbiological Biology as a deposit number KCCM11288P on June 25, 2012 .

The present invention can be achieved by a hybrid fungal strain of aviforme mushroom produced by crossing a first strain of aviforme mushroom with a second strain of aviforme mushroom, wherein at least 1 of the first and second strains of the aviforme mushroom Is a fungal strain represented by P48-24s or a fungal strain derived or developed from the above strain P48-24s.

The present invention relates to a method for the production of a somatic cell subculture (including a protoplast regeneration product), a fermentation product of fermentation broth (fermentation broth) from a hybrid fungal strain of the genus Pseudomonas aeruginosa strain represented by strain P48-24s or a strain cultured or developed from strain P48-24s, Tissue sections, single-chambered horticulture, or multi-chambered horticultural strains.

As described above, the technical feature of the present invention is that the strains of DDL01 (KACC93085P) strains crossed to improve the morphological characteristics so as to attract consumers' preference than the commercialized strain DDL01 (KACC93085P) (Accession No .: KCCM11288P) and a strain developed from the strain, which is a progeny of P48-24s produced by hybridization with the second strain of the above-mentioned species.

That is, the mushrooms produced by the fruiting of the pseudomonas aeruginosa strains P48-24s and P48-24s of the new strain of the present invention have a whitish and / or hoof-shaped mottling pattern Because it is close to white.

On the other hand, it will be understood that strains of A. manganese can only produce mushrooms under appropriate conditions. These conditions necessary to produce mushrooms from such cultures are well known to those skilled in the art and can be determined without undue experimentation. In the present invention, avaine mushroom may be used in any method known in the art for fruiting strains. In particular, it can be produced usually according to the following procedure. Pure cultures containing a single mushroom strain are clonally grown on sterile medium. This culture is a mycelium containing very fine, threadlike components called mycelia composed of cellular constituents. For commercial purposes, a portion of the pure culture is transferred to a more bulky, suitable medium and, if sufficiently grown, to be used as an inoculum for the production of commercial products such as a spawn and casinginoculant (In principle, all forms of pure culture are broadly inoculated). Mushroom hyphae are generally produced from sterilized and cooked grains such as rye, wheat or millet, which can be corrected with other materials such as chalk. The casing inoculum typically consists of certain materials such as peat moss, vermiculite, and / or culture soil mixed with a nutrient and wetted with water. A small volume of inoculum is mixed with larger volumes of sterilized cereal (bacterial) or other substrates (for casing inoculum). When the pure culture mycelium grows and most of the sterilized substrate is completely clustered, the mass of substrate and mycelium combined becomes a typical commercial product (hyphae or casing inoculum).

Among the known strains of avium oyster mushroom strain P48-24s according to the present invention, selected strains DDC01 (KACC93085P) and DAC7322 and DAC7421 were selected among the preserved strains of the agar plant, , Which was used as a transgenic strain of breeding seedlings.

EXAMPLES Example 1 Breeding of a new strain of avium oyster mushroom P48-24s

For the present invention, DDL01 (KACC93085P), DAC7322 and DAC7421 were used as the parent strains among the preserved strains of the Institute of Agricultural Research,

(1) Isolation of monospore

After dropping the bag of DDU01, DAC7322 and DAC7421 on the petri dish with the wrinkles of the mushroom facing downward, after 24 hours, remove the freshly harvested mushrooms The spores were diluted to an appropriate concentration through sterilized water, and then plated on a potato agar medium and cultured at 25 ° C. The first germination germinated from 7 days after cultivation was separated by toothpick, and each primary mycelium was inoculated again on potato agar medium. The inoculated potato agar broth was incubated at 25 ℃ for 14 days. The mycelium was partially removed, and the presence or absence of the clamp was confirmed by a microscope. Only the mycelium with no clamp was put in a 10% glycerol solution and used for the test.

(2) Crossing

Mating of monocotyledonous (monocotyledonous) mycelia and monocotyledonous (mycorrhizal) hyphae of hybrids of each of the different Aeweuteri mushroom strains isolated from each other and hyphae of monocotyledonous hyphae and hyphal mycelium . Each of them was inoculated on a potato agar medium and cultured at 25 ° C for 14 days. Only those with good growth and high mycelium were selected for crossing breeding. Mycelium grown on a potato agar medium was cut into 1 cm round size, and each mycelium block was replaced with a new potato agar medium petri dish at intervals of 3 cm to perform crossing breeding. The inoculated potato agar medium petri dish was incubated at 25 ℃ for 21 ~ 28 days. Mycelia were removed and examined with a microscope to isolate strains which were clamped on the mycelial block side of mononuclear cells.

(3) Crossbreeding Cultivation Test

Sawdust: Mixed rice bran at a ratio of 8: 2 to adjust the water content to 64%. 580g of rice was put into a 850cc mushroom cultivation bottle and then pestle with a 2cm rod to the bottom at the center and sterilized at 121 ° C for 60 minutes. After cooling to 20 캜 after sterilization, the selected strain was inoculated and cultured in the dark state at 24 캜 for 30 days. After completion of the cultivation, bacterial scratching was carried out, and cultivation tests such as foot and growth were carried out at 14 to 18 ° C, 80 to 95% in humidity and 100 to 200 lux at the illuminance.

(4) Selection of new strain Pseudomonas aeruginosa mushroom strain P48-24s

Mongrel strains obtained through single-spore mating were tested and screened to select the spore strains P7329W, P7330W and P7332W of DDL01 (KACC93085P), which induces the color of the fruit body gum to be light white. Among them, P7332W was selected as DAC7322 The mating strain of DAC7348 was selected through the first mating. Again, the strain of DAC7348 was crossed with the monoclonal of DAC7421. Finally, the mature hybrid of the color of the gut was selected, and the hatching pattern , And named it as P48-24s, and deposited it on June 25, 2012 at the Korean Center for Microbial Conservation (Accession No .: KCCM11288P).

Example 2 Breeding of Pseudomonas aeruginosa strains 1 to 5 of the P48-24S series

(1) separation of monocotyledonous spores, (2) mating, and (3) crossing cultivation test were carried out in the same manner as in Example 1, except that the new strain P48-24s selected in Example 1 was used as a parent strain, Pigeon strains 1 to 5 of the P48-24S strain obtained through crosses of the strain P48-24s were obtained.

EXPERIMENTAL EXAMPLE 1. Mycological characteristics of fresh mating strain P48-24s and P48-24S strains of aviforme mushroom strains 1 to 5

The mycological characteristics of the novel crossbreeding strain P48-24s obtained in Example 1 and the P48-24S strain Aventus mushroom strains 1 to 5 obtained in Example 2 were investigated as follows.

1) Growth condition (25 占 폚) on potato dextrose agar (PDA) medium: Colony diameter on day 7 was 40.7 mm. Mycelium is dense with white, and the amount of air hypha grows normally and linearly.

2) Growth condition (25 占 폚) on mushroom complex agar (MCM) medium: Colony diameter on the 7th day is 36.1 mm. Mycelium is dense with white, and the amount of air hypha grows normally and linearly.

3) Growth condition (25 占 폚) on the Maiko Cultural Agar (MA) medium: The colony diameter on the 7th day is 40.3 mm. Mycelium is dense with white, and the amount of air hypha grows normally and linearly.

4) Growth condition (25 ° C) on a medium of agar (CMA) on the agar: the colony diameter on the 7th day is 39.3 mm. Mycelium is very thin in white, the amount of air hypha is very small, grows linearly.

5) Growth condition (25 占 폚) on a medium of SDA broth: The diameter of colonies on the 7th day is 38.5 mm. Mycelium is dense with white, and the color of mycelium is partially reddish yellow in the latter period. The amount of mycelium in the air is usually linear.

6) Optimum temperature of mycelial growth: 5 mm diameter seedlings were inoculated on the PDA medium, cultured at each temperature zone, and 7 days later, the optimum temperature for mycelial growth was around 26 ° C.

7) Optimum pH of mycelial growth: 25 ml of glucose-peptone-yeast extract liquid medium was sterilized, adjusted to each pH, inoculated with seed bacterium, allowed to stand at 25 ° C for 12 days, The optimum pH for mycelial growth was around 5.5.

Experimental Example 2. Monoclonal characteristics of fresh mating strain P48-24s and P48-24S strains of aviforme mushroom strains 1 to 5

The spore characteristics of the strains obtained in the examples were examined. Characteristically, the yield of monospore was very low. In the case of the primary mycelium which is mostly single-colony and clamped, the nuclei in the spores were observed by fluorescence microscopy, and as shown in FIG. 2, there existed a mixture of a nucleus having two nuclei and a nucleus having one nucleus .

Experimental Example 3: Genetic characteristics of fresh mating strain P48-24s and P48-24S strains of A. myrtaceae strains 1 to 5

In order to investigate the genetic characteristics of the strains obtained in the examples, the mycelia are different from each other if they are different from each other. Based on the mycological findings of mycelium, And the adult was determined by confluent culture. The seeds were inoculated with each other at intervals of 3 centimeters on a potato dextrose agar medium and incubated at 25 ° C for 14 to 21 days, and it was judged whether or not an election would occur at the boundary between the two colonies (-), and the results are shown in Table 1. Herein, the strain of P48-24S as a host strain means a strain obtained by culturing single spores of the new strain P48-24S as the P48-24S strain of aviforme mushroom strain 1 to 5 obtained in Example 2.

 Strains P48-24S Pseudomonas aeruginosa with P48-24S as the mother strain 5 P.nebrodensis (China) + + P.nebrodensis (Empress mushroom) + + P. ferulae var. Fuscus (KCTC 26065) + + P. eryngii (cultivated) + + P.ferulae (China) + + P. eryngii var. Ferulae (DAC 7322) + + P. eryngii var. Ferulae (DAC 7421) + + P. eryngii var. Ferulae (DDL01) + + P48-24s - - Mycobacterium strain P48-24S as a parent strain 1 - - Pyridoxal 2 as a parent strain of P48-24S - - Pyridoxine 3 as a parent strain of P48-24S - - Mycobacterium 4 as the parent strain of P48-24S - -

EXPERIMENTAL EXAMPLE 4. Molecular Biological Identification of New Crossbred P48-24s

(1) Determination of the nucleotide sequence of the ITS region

ITS1 (TCCGTAGGTGAACCTGCGG; SEQ ID NO: 1) / ITS4 (TCCTCCGCTTATTGATATGC; SEQ ID NO: 1) was used to amplify an internal transcribed ITS (Internal Transcribed Spacer) by PCR using a bead beating method from a culture medium. 2) were amplified using the primer sets, respectively, and then subjected to sequencing by the Macrogen Co. (SEQ ID NO: 3) through purification.

> P48-24s

GGAAGGATCATTAATGAATTCACTATGGAGTTGTTGCTGGCCTCTAGGGGCATGTGCACGCTTCACTAGTCTTTCAACCACCTGTGAACTTTTGATAGATCTGTGAAGTCGTCTCTCAAGTCGTTAGACTTGGTTTGCTGGGATGTAAACGTCTCGGTGTGACTACGCAGTCTATTTACTTATAACACCCCAAATGTATGTCTACGAATGTCATTTAAAGGGCCTTGTGCCTATAAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTCACTCTGGTTTTTCCAATTGTGATGTTTGGATTGTTGGGGGCTGCTGGCCTTGACAGGTCGGCTCCTCTTAAATGCATTAGCAGGACTTCTCATTGCCTCTGCGCATGATGTGATAATTATCACTCATCAATAGCACGCATGAATAGAGTCTGGCTCTCTAACCGTCCGCAAGGACAATTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCT

(2) Analysis of genetic characteristics

After genomic analysis of the two gene sequences, BLAST searches for the most similar genomic sequences and genetic analysis.

All sequences were sequenced using ClustalW2 (Multiple Sequence Alignment). Based on this, the evolutionary distance was calculated by Bayesian MCMC run using MrBayes version 3.1 program, and the molecular chemical relationship by the maximum likelihood method is shown in Fig. 3 . The boot-strapping value is 1000. Based on this, similarities and final identifications were made. As a result, Pleurotus eryngii var. Ferulae ( Pleurotus eryngii var. Ferulae ) It was identified as mushroom.

Experimental Example 5 Morphological Characteristics of New Crossbred P48-24s Fruiting Body

[Visual Features]

As shown in FIG. 4, the shade is 15-90 mm, the optimum is 20-55 mm, and the shape is semi-spherical at the beginning, but when it grows, it is flattened semi-spherically-flat and slightly centered. Fresh ends are bent inward or curled inward at the beginning of growth, and last for a considerable period. The surface is pale yellow - milky and smooth. The tissue is very thick, dense, milky white, resilient, and thin in the central part. The smell is a typical mushroom flavor, the taste is sweet, especially when chewing, the texture is very good. The wrinkles are long wrinkled wrinkles, dense, short wrinkles 1-3 in shape, initially white, but later yellow-burgundy orange, with wrinkled edges smooth.

It is 15-55 × 55-150㎜ (basal 27㎜), and it is a cylindrical type of 20-45 × 70-90mm which is thicker toward the base, thinning to the target side, thickening again and often bending. The surface is pale yellowish-milky, with indistinct vertical fibrous lines, somewhat rugged, and smooth. The car is white, dense, and resilient.

[Features of microscope]

The spores are 9.3-9.8 × 4.3-4.6 μm in size, oval-cylindrical oval, smooth on the surface, non-amyloid in the melissa solution, and foamy milky white.

As shown in Fig. 5, the two-spore type quartz is mostly used, and its size is 52-57 x 8.5-9 쨉 m long, and the four-spore type quartz has a size of 47-48 × 10 - 10.2 ㎛ with a club-like shape and a clamp at the base.

The size of the epidermidis is 25-35 × 5-8 μm, with club, fusiform, clublike fusiform shape. Generally, there are 1-3 rhyolitic projections at the top, and the cell wall is thin and colorless.

There is no sidesteadia.

The fascial layer structure is parallel mycelial - cross-linked type I hyphae, and there is a clamp on the diaphragm of mycelia.

Experimental Example 6 Morphological Characteristics of 1 to 5 Fruiting Body of the Pseudomonas aeruginosa Strain of P48-24s in the New Crossing Strain

As shown in FIG. 6, the phenotype of the fruit body, that is, the shape of the eggplant, the shape of the eggplant, the coloring of the eggplant, the rootstock, and the thickness of the egg were similar to those of the parent strain. The results were similar to the parent strain P48-24s described above.

Fruit bodies obtained by culturing the mycelium of two nuclear nucleus spores were also the same.

Experimental Example 7: Cultivation of the new cross breeders P48-24s and P48-24S of the avian oyster mushroom strains 1 to 5

1. Preparation of badge

Sources of sawdust: rice bran = 8: 2 (volume ratio, 40-50 g / 850 cc bottle standard) were used as the medium. Followed by stirring and mixing to adjust the final medium water content to 68-70%.

2. Filling

The filling amount of the medium was filled to 850 cc bottles to 480-520 g (content amount).

3. Sterilization

The high-pressure sterilization is carried out for 60 minutes (effective sterilization time) after the temperature reaches 120 ° C in the medium, and 90 minutes (850cc bottle) when the sterilization pot temperature is standard.

4. Cooling

Under a clean environment, the culture medium was cooled until the culture medium temperature became 20 DEG C or lower.

5. Inoculation

The inoculum amount of seed bacterium was inoculated as standard of about 15cc per one bottle.

6. Culture management

The temperature was maintained at 18 占 폚 for 25 days, followed by aging at 23 占 폚 for 8 to 10 days. Humidity was maintained at 60 ~ 70% for the electric culture and 70 ~ 80% for the later culture, and the carbon dioxide concentration was controlled at 3,000 ppm or less. Light intensity is controlled by dark culture, and period is 30 days.

7. Scraping bacteria

Scraping of 15 ~ 20mm was performed for the purpose of suppressing the number of germination.

8. Foot Care

The temperature was controlled at 14-15 ° C, and the humidity of the electric foot was controlled for 3-5 days at 90-95% and 70-80% for the latter 3-5 days. The carbon dioxide concentration was controlled to be less than 1,000 ppm, and the light intensity was managed only at the daytime. For 5 to 8 days. When the young mushroom was grown about 1cm from the late feet, the growth was controlled by inverting from a standing position to a standing position.

9. Growth management

In order to synchronize the size of young mushrooms formed on the surface of the culture bottle inlet, the temperature was controlled at 11-12 ° C so as not to rise above 14 ° C. The first 3 days were managed at 11 ° C. Humidity was controlled by 70-95%, and the humidity / humidity crossing was managed to a large extent. After germination confirmation, it was returned to the established state and maintained for 5-8 days. Immediately after being returned to the formulation, care should be taken in the early stage of growth to take into account the humidity conditions caused by dehumidification with low temperature control.

10. Harvest

Mushroom gods were harvested in the state of a product with a roundish hemispherical shape.

As shown in Experimental Example 7, harvesting the new avian oyster mushroom strains P48-24s and P48-24S strains of agrippedic mushroom strains 1 to 5 resulted in maintaining the lineage of DDL01 (KACC93085P) The shape and the coloring were improved so as to be able to attract the consumers' preference than the DDL01 (KACC93085P) strain shown in the photograph shown in Fig. 1, and the fresh surface of the fruit body was an unbleached white color without stain pattern. This can be seen clearly in FIG. 5, which shows the fresh surface of the fresh body of the new strain P48-24s, and in FIG. 6, which shows the fresh surface of the fruit body of the Pyrus myrtle strain of the P48-24S series have.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation, Various changes and modifications will be possible.

Korea Microorganism Conservation Center (overseas) KCCM11288P 20120625

<110> DDLEA CHE Agricultural Co., Ltd. <120> Novel Pleurotus eryngii var. ferulae Strain P48-24s and its          descendants <130> DPP-2013-0304-KR <160> 3 <170> Kopatentin 1.71 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Internal transcribed spacer 1 <400> 1 tccgtaggtg aacctgcgg 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Internal transcribed spacer 4 <400> 2 tcctccgctt attgatatgc 20 <210> 3 <211> 643 <212> DNA <213> Pleurotus eryngii <400> 3 ggaaggatca ttaatgaatt cactatggag ttgttgctgg cctctagggg catgtgcacg 60 cttcactagt ctttcaacca cctgtgaact tttgatagat ctgtgaagtc gtctctcaag 120 tcgttagact tggtttgctg ggatgtaaac gtctcggtgt gactacgcag tctatttact 180 tataacaccc caaatgtatg tctacgaatg tcatttaaag ggccttgtgc ctataaacca 240 taatacaact ttcaacaacg gatctcttgg ctctcgcatc gatgaagaac gcagcgaaat 300 gcgataagta atgtgaattg cagaattcag tgaatcatcg aatctttgaa cgcaccttgc 360 gccccttggt attccgaggg gcatgcctgt ttgagtgtca ttaaattctc aaactcactc 420 tggtttttcc aattgtgatg tttggattgt tgggggctgc tggccttgac aggtcggctc 480 ctcttaaatg cattagcagg acttctcatt gcctctgcgc atgatgtgat aattatcact 540 catcaatagc acgcatgaat agagtctggc tctctaaccg tccgcaagga caatttgaca 600 atttgacctc aaatcaggta ggactacccg ctgaacttaa gct 643

Claims (10)

The spores obtained from the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).
Inoculum containing the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).
Mushroom hypha containing the new strain Pseudomonas aeruginosa P48-24s (Accession No: KCCM11288P).
Homokaryons of the new strain Pseudomonas aeruginosa P48-24s obtained from the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).
Mushrooms produced by fruiting of the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).
It has been reported that the new strains produced by the single-spore culture or multi-sporulation culture of somatic sub-cultures of the strain Aiitri mushroom P48-24s (Accession No .: KCCM11288P) or of the strains developed therefrom or by somatic cell sorting Pseudomonas aeruginosa strain P48-24s.
Pseudomonas aeruginosa strain P48-24s strain produced by the regeneration and sorting of the strain from the mushroom tissue section of the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P) or the strain developed therefrom.
Pseudomonas aeruginosa strain P48-24s (Accession No .: KCCM11288P) or a strain of the P48-24s strain produced by the selection of mushroom-bearing basidiospores of the strain developed therefrom.
The strain P48-24s produced by crossing two strains of Pseudomonas aeruginosa P48-24s from one or two agripped mushrooms P48-24s (accession number: KCCM11288P) Mushroom strain. 9. A mushroom produced by fruiting of the Pseudomonas aeruginosa strain of the P48-24s family of any one of claims 6 to 9.

Images