KR20150069248A - Novel Pleurotus eryngii var. ferulae Strain P48-24s and its descendants - Google Patents
Novel Pleurotus eryngii var. ferulae Strain P48-24s and its descendants Download PDFInfo
- Publication number
- KR20150069248A KR20150069248A KR1020130155462A KR20130155462A KR20150069248A KR 20150069248 A KR20150069248 A KR 20150069248A KR 1020130155462 A KR1020130155462 A KR 1020130155462A KR 20130155462 A KR20130155462 A KR 20130155462A KR 20150069248 A KR20150069248 A KR 20150069248A
- Authority
- KR
- South Korea
- Prior art keywords
- strain
- mushroom
- strains
- pseudomonas aeruginosa
- kccm11288p
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Mycology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Description
본 발명은 아위느타리버섯에 대한 것으로, 보다 구체적으로는 종래 알려진 아위느타리버섯 균주들을 선발한 후 선발된 균주와 아위느타리버섯 균주 DDL01(기탁번호 : KACC93085P)를 교배 육종하여 얻어진 DDL01(KACC93085P)의 계통을 이은 아위느타리버섯 신균주 P48-24s 및 그 균주로부터 발육된 균주를 상기 종의 제2 균주와 혼성화시킴으로써 생산된 P48-24s의 자손인 P48-24s 계열의 아위느타리버섯 균주에 관한 것이다.
(KACC93085P) obtained by cross-breeding a selected strain of aviforme mushroom strain and a strain selected from the previously known strains and a strain of avirulent mushroom DDL01 (accession number: KACC93085P) And a strain P48-24s, which is a progeny of P48-24s, produced by hybridizing a strain developed from the strain with a second strain of the strain.
아위느타리버섯은 큰느타리버섯의 변종(Pleurotus eryngii var. ferulae) 또는 담자균류의 느타리버섯과(pleurototaceae) 느타리버섯속(pleurotus)의 독립된 종(Pleurotus ferulae)으로 분류 체계상 논란이 되고 있는 종으로서, 건조지대인 중국 신강지방의 아위나무에서 야생되기 때문에 아위느타리라고 불리게 되었다. It is classified as Pleurotus eryngii var. Ferulae (Pleurotus eryngii var. Ferulae) or Pleurotus ferulae (Pleurotus ferulae) of pleurototaceae. Because it is wild in the arid tree of Xinjiang province of China, which is a dry area, it is called "
아위느타리버섯은 1958년부터 인도, 프랑스, 독일 등에서 인공재배에 대한 연구가 시작되었고, 1958년 Kalmer가 처음으로 인공재배에 성공하였으며, 1983년 중국에서 톱밥, 면실피, 밀기울을 섞어 인공재배에 성공하였으며 1990년에는 단포자 교잡으로 우수한 균주를 확보하여 복건성, 신강성, 등지에서 광범위하게 사용되고 있으며(이동희, 2005), 세계적으로 년간 1,000톤 정도로 소량 생산되고 있는 버섯이다(홍기형, 2004). Research on artificial cultivation began in 1958 in India, France and Germany. In 1958, Kalmer was the first to succeed in artificial cultivation. In 1983, artificially cultivated artificial cultivation of sawdust, cottonseed, and bran in China. (1990), which has been widely used in Fujian Province and Sinjangseong Province (Dong-hee, 2005) and secures excellent strains by crossing monocotyledonous mushroom (Hong Gi-hyung, 2004).
아위느타리버섯 자실체의 형태적 특성을 살펴보면, 갓은 크기가 15-100㎜, 최적은 20-50㎜이며 초기에는 반구형이고, 갓 끝은 안쪽으로 굽어 있으며, 성장하면 반반구형, 중고편평형 또는 편평하게 펴진다. 최적은 반구형이다. 표면은 평활하다. 어린 시기에는 갈회색(5D2, brownish grey, Methuen Handbook of Color)을 띠고, 성장하면 회황색(5B3, greyish orange)을 띤다. 습할 때 흡습성이나 건조하면 건변색현상이 일어난다. 조직은 부드럽고 탄력성이 있는 육질형이며, 유백색이다. 맛은 달며, 사탕수수의 향과 유사한 향이 있다. 특히 씹을 때 아삭거리는 감촉이 매우 좋다. 주름살은 대에 내린주름살이고, 15-35× 1-3㎜이며, 4-가지형이고, 다소 빽빽하다. 초기에는 유백색이나 성장하면 황백색(4A2, yellowish white)을 띤다. 주름살날은 평활하다. 대는 크기가 50-150 × 15-35㎜로 최적은 15-40 × 70-90㎜의 원통형이고, 기부쪽이 다소 굵거나 팽대해있다. 표면은 유백색을 띠며, 표면은 평활하다. 대 속은 차 있다. 대의 종방향으로는 매우 견고하고, 횡방향으로는 얇게 찢어진다. 포자의 색은 흰색이다. 포자는 크기가 5~6 X 7~9㎛로 원통형이다. 담자기는 크기가 24-39× 5-7㎛로 긴 곤봉형이며, 대부분 4-포자형이며, 기부에 클램프가 있다. 날시스티디아 크기가 25-35× 5-8㎛로 곤봉형, 방추형, 곤봉상방추형이며, 일반적으로 정단부에 1-3개의 뾰죽한 돌기가 있고, 세포벽은 얇으며, 무색이다. 측시스티디아는 없다. 자실층조직은 평행균사형-혼선형으로 제1균사조직형이며 균사의 격막에 클램프가 있다As for the morphological characteristics of the fruiting body of the eggplant mushroom, it is 15-100 mm in size and 20-50 mm in the optimum. It is hemispherical at the beginning, the end of the egg is curved inward, and when it grows, it becomes semi-spherical, used flat or flat It spreads. The optimum is hemispherical. The surface is smooth. In the younger period, it is gray (5D2, brownish gray, Methuen Handbook of Color) and grows to grayish orange (5B3, greyish orange). When it is wet, it becomes hygroscopic. The tissue is soft and resilient, meaty and milky. Taste is sweet and has an aroma similar to that of sugarcane. Especially when you chew chewy texture is very good. The wrinkles are wrinkles on the stool, 15-35 × 1-3 mm, 4-shape, and somewhat dense. It is milky white at the beginning and 4A2 (yellowish white) when it grows. The wrinkle blade is smooth. The size of the pedestal is 50-150 × 15-35㎜, the optimum is a cylindrical form of 15-40 × 70-90㎜, and the base side is somewhat thick or swollen. The surface is milky white and the surface is smooth. There is a car inside. It is very strong in the longitudinal direction and thinly torn in the lateral direction. The color of the spores is white. The spores are cylindrical with a size of 5 ~ 6 × 7 ~ 9㎛. The volcano is 24-39 × 5-7 μm long and has a long club style, mostly 4-spore type, with a clamp on the base. The size of the epidermidis is 25-35 × 5-8 μm, with club, fusiform, clublike fusiform shape. Generally, there are 1-3 rhyolitic projections at the top, and the cell wall is thin and colorless. There is no sidesteadia. The fascial layer structure is parallel mycelial-crossover type and is the first mycelial tissue type and there is a clamp on the diaphragm of mycelia
이러한 형태적 특성을 가진 아위느타리버섯은 다른 버섯에 비하여 형태가 우수하고 향미가 풍부하여 식용가치가 높으면서, 항종양, 혈당강하 작용을 하는 것으로 알려져 있다(홍 등 2004). 또한 위와 신장 장애 및 기침을 멎게 하고 염증을 제거하여 산부인과 종류의 병을 방제하는 의약적 효능이 알려져 있으며(김대식, 2002), 이외에도 식이섬유, 아미노산 및 기타 비타민 등을 다량함유하고 있어 건강식품 및 기능성 약용버섯으로서의 가치가 높다. 최근에 일본에서는 식용버섯으로 인기가 높아 생산이 급속히 증가되고 있으며, 우리나라에서는 2001년부터 꾸준히 연구되어 왔으나 상업화되지 못하다가 본 출원인에 의해 2009년 말에 개발된 아위느타리버섯 DDL01(기탁번호 : KACC93085P)이 현재 상업화 되어 판매되고 있는 상황이다. It is known that Ai outerium mushrooms having such morphological characteristics are superior in morphology and rich in flavor compared with other mushrooms, and have high anti-tumor and hypoglycemic effect while having high edible value (Hong et al., 2004). In addition, it has been known that the medicinal efficacy of controlling gynecologic diseases by stopping stomach and kidney disorders and coughs and eliminating inflammation is known (Kim Dae-sik, 2002), and also contains a large amount of dietary fiber, amino acid and other vitamins, Its value as medicinal mushroom is high. Recently, it has been studied in Korea since 2001 due to its high popularity as an edible mushroom in Korea. However, it has not been commercialized since 2001, and it has been confirmed by the Applicant that DDU01 (Accession No. KACC93085P) Is currently being commercialized and sold.
아위느타리버섯 DDL01(기탁번호 : KACC93085P)은 재배기간이 짧고, 맛과 형태가 우수하여 상품성이 높으며 병재배가 가능하여 상품화된 후 국내뿐만 아니라 일본, 미국 등에 수출하고 있는 상황이다.The mushroom DDU01 (accession number: KACC93085P) is short in cultivation period, has good taste and shape, and has high commerciality.
그런데, 미국의 경우 미국수요자들이 자실체의 갓 표면 색깔이 백색에 가까울수록 호감을 보이고 있지만, 도 1에 도시된 바와 같이 아위느타리버섯 DDL01은 갓의 색택이 갈색의 호피무늬형상을 갖고 있으므로 세계 최대의 소비지인 미국에서 아위느타리버섯 DDL01 보다 더 높은 부가가치를 창출하기 위해서는 갓의 색택이나 다른 형태적 특징 등에서 새롭게 개량된 균주가 개발될 필요가 있었다. However, in the United States, US consumers are more likely to have a fresh white color near the surface of fruiting bodies, but as shown in FIG. 1, the reddish mushroom DDL01 has a brown leaf pattern, In order to create a higher value added in the US, which is a consuming place, than the aviator mushroom DDL01, it was necessary to develop a newly improved strain in terms of coloring and other morphological characteristics of gut.
본 발명자들은 이러한 문제점을 해결하기 위하여 연구 노력한 결과 상업화된 DDL01(KACC93085P) 균주보다 상업성이 더 우수하면서도 DDL01(KACC93085P) 균주의 계통을 이은 아위느타리버섯 균주의 육종에 성공함으로써 본 발명을 완성하였다.As a result of efforts to solve these problems, the present inventors have succeeded in breeding the A. myrtle mushroom strain, which is more commercial than the commercialized DDL01 (KACC93085P) strain and has a strain of DDL01 (KACC93085P) strain, and completed the present invention.
따라서, 본 발명의 목적은 상업화된 DDL01(KACC93085P) 균주보다 갓 표면의 색깔이 백색에 근접하여 수요자들의 호감을 이끌어낼 수 있는 형태적 특성을 가진 DDL01(KACC93085P) 균주의 계통을 이은 아위느타리버섯 신균주 P48-24s(기탁번호 : KCCM11288P) 및 그 균주로부터 발육된 균주를 상기 종의 제2 균주와 혼성화시킴으로써 생산된 P48-24s의 자손인 P48-24s 계열의 아위느타리버섯 균주를 제공하는 것이다.Accordingly, an object of the present invention is to provide a method of producing a strain of DDU01 (KACC93085P) having a morphological characteristic capable of bringing a favorable feeling of consumers closer to white than the commercialized DDL01 (KACC93085P) The strain P48-24s (accession number: KCCM11288P) and the strain developed from the strain are hybridized with the second strain of the above-mentioned species to produce P48-24s strain Pseudomonas aeruginosa strain, which is a progeny of P48-24s.
본 발명의 다른 목적은 갓 표면의 색깔이 미백색이면서 동시에 호피형태의 얼룩무늬가 없어 소비자가 호감을 갖는 색택을 가져 품질 및 상품성이 우수한 DDL01(KACC93085P) 균주의 계통을 이은 신균주 P48-24s 및 그 균주로부터 발육된 균주를 상기 종의 제2 균주와 혼성화시킴으로써 생산된 P48-24s의 자손인 P48-24s 계열의 아위느타리버섯 균주를 제공하는 것이다.It is another object of the present invention to provide a novel strain P48-24s which has a color of freshly white surface but which has no habit-like mottled pattern and which has a favorable color tone and which is superior in quality and commerciality to a strain of DDL01 (KACC93085P) Which is a progeny of P48-24s produced by hybridizing a strain developed from a strain with a second strain of the above-mentioned species.
본 발명의 목적들은 이상에서 언급한 목적들로 제한되지 않으며, 언급되지 않은 또 다른 목적들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.The objects of the present invention are not limited to the above-mentioned objects, and other objects not mentioned can be clearly understood by those skilled in the art from the following description.
상술된 본 발명의 목적을 달성하기 위해, 먼저, 본 발명은 2012년 6월 25일자로 한국미생물보존센터에 기탁된 신균주 아위느타리버섯 P48-24s(기탁번호 : KCCM11288P)로부터 수득된 포자를 제공한다.In order to achieve the above object of the present invention, first, the present invention provides a spore obtained from a new strain Pseudomonas aeruginosa P48-24s (accession number: KCCM11288P) deposited on June 25, 2012 at the Korean Microorganism Conservation Center do.
또한, 본 발명은 신균주 아위느타리버섯 P48-24s(기탁번호 : KCCM11288P)를 포함하는 접종원(inoculum)을 제공한다. In addition, the present invention provides an inoculum comprising the novel strain Aiuteridium mushroom P48-24s (Accession No .: KCCM11288P).
또한, 본 발명은 신균주 아위느타리버섯 P48-24s(기탁번호 : KCCM11288P)를 포함하는 버섯 균사(spawn)를 제공한다.In addition, the present invention provides a mushroom spawn comprising the new strain Pseudomonas aeruginosa P48-24s (Accession No. KCCM11288P).
또한, 본 발명은 신균주 아위느타리버섯 P48-24s(기탁번호 : KCCM11288P)로부터 수득된 신균주 아위느타리버섯 P48-24s의 동종핵체(homokaryons)를 제공한다.In addition, the present invention provides homokaryons of the new strain Pseudomonas aeruginosa P48-24s obtained from the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).
또한, 본 발명은 신균주 아위느타리버섯 P48-24s(기탁번호 : KCCM11288P)의 자실체 형성(fruiting)에 의해 생산된 버섯을 제공한다.In addition, the present invention provides a mushroom produced by fruiting of the novel strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).
또한, 본 발명은 신균주 아위느타리버섯 P48-24s(기탁번호 : KCCM11288P) 또는 이로부터 발육된 균주의 체세포(somatic)계대배양물의 단일-포자 배양법 또는 다중-포자배양법에 의한 증식(propagation) 또는 체세포 선별에 의해 생산된 P48-24s 계열의 아위느타리버섯 균주를 제공한다.In addition, the present invention relates to a method of propagating somatic cells or a method of propagation of somatic cells or cultured cells by a single-spore culture method or a multi-spore culture method of a new bacterial strain Aiuterium mushroom P48-24s (accession number: KCCM11288P) Lt; RTI ID = 0.0 > P48-24s < / RTI > strain produced by screening.
또한, 본 발명은 신균주 아위느타리버섯 P48-24s(기탁번호 : KCCM11288P) 또는 이로부터 발육된 균주의 버섯 조직 절편으로부터, 균주의 재생(regeneration) 및 선별에 의해 생산된 P48-24s 계열의 아위느타리버섯 균주를 제공한다.
The present invention also relates to a method for producing a strain of P48-24s strain of the strain P48-24s produced by regeneration and screening of a strain from a mushroom tissue section of a strain of the novel strain Pichia mushroom P48-24s (accession number: KCCM11288P) Mushroom strain.
또한, 본 발명은 신균주 아위느타리버섯 P48-24s(기탁번호 : KCCM11288P) 또는 이로부터 발육된 균주의 버섯 담자홀씨(basidiospores) 선별에 의해 생산된 P48-24s 계열의 아위느타리버섯 균주를 제공한다.In addition, the present invention provides a Pseudomonas aeruginosa strain of the P48-24s series produced by the selection of mushroom-bearing basidiospores of the new strain Pseudomonas aeruginosa P48-24s (accession number: KCCM11288P) or a strain developed therefrom.
또한, 본 발명은 신균주 아위느타리버섯 P48-24s(기탁번호 : KCCM11288P) 또는 이로부터 발육된 하나 또는 두 가지의 아위느타리버섯 P48-24s로부터 아위느타리버섯 P48-24s의 두 균주를 교잡하여 생산된 P48-24s 계열의 아위느타리버섯 균주를 제공한다.In addition, the present invention relates to a method for producing a microorganism which is produced by hybridizing two strains of avian oyster mushroom P48-24s from one or two avium oyster mushrooms P48-24s (accession number: KCCM11288P) Pseudomonas aeruginosa strain P48-24s.
또한, 본 발명은 상술된 어느 하나의 P48-24s 계열의 아위느타리버섯 균주의 자실체 형성(fruiting)에 의해 생산된 버섯을 제공한다.The present invention also provides a mushroom produced by the fruiting of any of the above-mentioned P48-24s strains of A. aeruginosa.
본 발명은 다음과 같은 우수한 효과를 갖는다.The present invention has the following excellent effects.
즉, 본 발명에 의하면 상업화된 DDL01(KACC93085P) 균주보다 갓 표면의 색깔이 백색에 근접하여 수요자들의 호감을 이끌어낼 수 있는 형태적 특성을 가진 DDL01(KACC93085P) 균주의 계통을 이은 아위느타리버섯 신균주 P48-24s(기탁번호 : KCCM11288P) 및 그 균주로부터 발육된 균주를 상기 종의 제2 균주와 혼성화시킴으로써 생산된 P48-24s의 자손인 P48-24s 계열의 아위느타리버섯 균주를 제공할 수 있다. That is, according to the present invention, a strain of the genus Agilentum mushroom (KACC93085P), which has a morphological characteristic that can bring out the favorable feeling of the consumers by approaching the white color of the fresh surface of the commercial DDL01 (KACC93085P) strain, P48-24s (Accession No .: KCCM11288P) and a strain developed from the strain can be provided with a strain of P48-24s strain Pseudomonas aeruginosa, which is a progeny of P48-24s produced by hybridization with the second strain of the above species.
또한, 본 발명의 아위느타리버섯 신균주 P48-24s 및 그 균주로부터 발육된 균주를 상기 종의 제2 균주와 혼성화시킴으로써 생산된 P48-24s의 자손인 P48-24s 계열의 아위느타리버섯 균주의 자실체 형성(fruiting)에 의해 생산된 버섯은 갓 표면의 색깔이 미백색이면서 동시에 호피형태의 얼룩무늬가 없어 소비자가 호감을 갖는 색택을 가져 품질 및 상품성이 우수하다.
In addition, the fungus body of the pseudomonas mushroom strain P48-24s of the present invention and the strain developed from the strain of the present invention are hybridized with the second strain of the above-mentioned species, The mushrooms produced by fruiting are fresh white color with no whiteness and no habit-like mottled pattern.
도 1은 상업화된 아위느타리버섯(Pleurotus eryngii var. ferulae) DDL01(KACC93085P) 균주가 재배된 자실체 사진이다.
도 2는 본 발명의 아위느타리버섯 신균주 P48-24s(수탁번호 : KCCM11288P) 및 P48-24S 계열의 아위느타리버섯 균주1 내지 5의 포자의 핵을 관찰한 형광현미경 사진이다.
도 3은 본 발명에 따른 아위느타리버섯 신균주 P48-24s(수탁번호 : KCCM11288P)의 계통관계를 UPGMA 방법으로 나타낸 것이다.
도 4는 본 발명에 따른 아위느타리버섯 신균주 P48-24s(수탁번호 : KCCM11288P)가 재배된 자실체가 담자기에서 2포자형임을 보여주는 사진이다.
도 5는 본 발명의 일 실시예에 따른 아위느타리버섯 신균주 P48-24s(수탁번호 : KCCM11288P)가 재배되어 자실체가 형성된 버섯사진이다.
도 6는 본 발명의 다른 실시예에 따른 아위느타리버섯 신균주 P48-24s 계열의 균주(자균1)이 재배되어 자실체가 형성된 버섯사진이다. Fig. 1 is a photograph of a fruit body cultivated with a commercialized strain of Pleurotus eryngii var. Ferulae DDL01 (KACC93085P).
FIG. 2 is a fluorescence microscope photograph showing the nuclei of spores of the avian oyster mushroom new strain P48-24s (accession number: KCCM11288P) and P48-24S family avirulent mushroom strains 1 to 5 of the present invention.
Fig. 3 shows the systematic relationship of a new strain of Pseudomonas aeruginosa strain P48-24s (accession number: KCCM11288P) according to the present invention by the UPGMA method.
Fig. 4 is a photograph showing that a fruiting body grown with a new strain P4-24s (accession number: KCCM11288P) according to the present invention is in the form of a two-spore type in a vertebrate.
FIG. 5 is a photograph of a mushroom having a fruit body formed by cultivating a new strain of avifolium mushroom P48-24s (accession number: KCCM11288P) according to an embodiment of the present invention.
FIG. 6 is a photograph of a mushroom of which a strain (Pseudomonas aeruginosa 1) of the genus Pseudomonas aeruginosa strain P48-24s according to another embodiment of the present invention is cultivated and a fruit body is formed.
본 발명에서 사용되는 용어는 가능한 현재 널리 사용되는 일반적인 용어를 선택하였으나, 특정한 경우는 출원인이 임의로 선정한 용어도 있는데 이 경우에는 단순한 용어의 명칭이 아닌 발명의 상세한 설명 부분에 기재되거나 사용된 의미를 고려하여 그 의미가 파악되어야 할 것이다.Although the terms used in the present invention have been selected as general terms that are widely used at present, there are some terms selected arbitrarily by the applicant in a specific case. In this case, the meaning described or used in the detailed description part of the invention The meaning must be grasped.
이하, 첨부한 도면 및 바람직한 실시예들을 참조하여 본 발명의 기술적 구성을 상세하게 설명한다.Hereinafter, the technical structure of the present invention will be described in detail with reference to the accompanying drawings and preferred embodiments.
그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화 될 수도 있다. However, the present invention is not limited to the embodiments described herein but may be embodied in other forms.
본 발명은, 광범위하게는 새롭게 개발된 아위느타리버섯 신균주 P48-24s 및 이로부터 발육되거나(developed) 계통을 이은(descended) 균주를 포함하는, 아위느타리버섯 균주 군에 관한 것이다. 구체적으로는 본 발명은 아위느타리버섯 신균주 P48-24s, 상기 P48-24s로부터 직접 발육된 균주, 및 P48-24s 균주 자체 또는 P48-24s균주로부터 발육된 균주를 상기 종의 제2 균주와 혼성화시킴으로써 생산된 P48-24s의 자손인 P48-24s 계통의 아위느타리버섯 균주에 관한 것이다. The present invention relates broadly to a group of P. aeruginosa strains, including a newly developed avian oyster mushroom new strain P48-24s and a strain developed or descended therein. Specifically, the present invention relates to a method for producing a microorganism by hybridizing a second strain of the above species with a strain of Pseudomonas aeruginosa strain P48-24s, a strain directly grown from the P48-24s, and a strain derived from the P48-24s strain itself or the P48-24s strain Which is a progeny of the produced P48-24s strain P48-24s.
여기서, 용어 "계통을 이은(descended)"은 전형적으로 최소 수백 세대 및 수천년을 포함하는 유전적 분기(divergence)의 자연적 발생 과정을 의미하는 진화적으로 계통을 이은 것보다는 균주로부터 계통적으로(genealogically) 내려온 것으로 특히 간주된다. 용어 "-로부터 발육된(developed from)"은 출발 물질의 임의의 요소(이 경우 아위느타리버섯 균주)의 임의의 선별 또는 조작 수단(means)을 포함하는 것을 의미할 수 있다. 용어 "혼성화"는 2개의 상이한 균주를 매우 근접하게, 바람직하게는 멸균된 배지 상에서, 융합(anastomosis, 즉 균사 또는 세포 융합)이 유발될 때까지 함께 성장하게 함으로써 달성되는 것을 의미할 수 있다. 2개의 양립 가능한(compatible) 핵 (즉, 2개의 핵은 교배 타입을 결정하는 Mat 유전자좌에서 상이한 대립형질을 가진다)이 융합세포에 존재하면, 함께 증식하고, 성장하는 이종핵체(heterokaryotic) 균주를 확립한다. 통상적으로 이러한 과정은 교배(crossing)로 알려져 있다. 생성된 이종핵체 균주에 있는 2개의 핵 각각이 융합 과정에 관여하는 상이한 부모 균주에 의해 제공되는(contributed) 경우, 새로운 이종핵체는 두 부모의 제1세대 이계 교배된 (outcrossed) 하이브리드 자손이다. 예를 들어, P48-24s균주가 부모 균주 중의 하나이고, 이것이 아위느타리버섯의 다른 부모 균주와 교배하게 되는 경우, 이에 의해 생성된 하이브리드(hybrid)는 본 발명의 일 실시예인 제1 세대 이계교배 하이브리드 균주일 수 있다.The term " descended "as used herein refers to a genealogically from a strain rather than to an evolutionarily systematic line, which means a natural developmental process of genetic divergence, typically involving at least several hundred generations and thousands of years. It is especially considered to have come down. The term " developed from "may mean that it includes any sorting or manipulating means of any element of the starting material (in this case a strain of Asteraceae). The term "hybridization" may mean that two different strains are achieved in close proximity, preferably on a sterile medium, by causing them to grow together until anastomosis (i. E., Mycelia or cell fusion) is induced. When two compatible nuclei (i.e., two nuclei have different alleles at the Mat locus determining the mating type) are present in the fusion cell, they proliferate together and establish a growing heterokaryotic strain do. This process is commonly known as crossing. When each of the two nuclei in the resulting heterologous strain is contributed by different parental strains involved in the fusion process, the new heterologous nucleotide is a first-generation outcrossed hybrid offspring of the two parents. For example, if the P48-24s strain is one of the parent strains and it crosses with other parent strains of the avian oyster mushroom, the resulting hybrid is a first generation crossbreeding hybrid, Lt; / RTI >
따라서, 본 발명은 신균주 아위느타리버섯 P48-24s 및 모든 수단에 의해 이로부터 발육된 모든 균주들을 포함하고, 반드시 이에 한정되는 것은 아니지만 상기 수단은 단일-포자 배양법, 다중-포자 배양법 및 체세포 선별법을 포함하며, 제1세대 하이브리드 균주 및 P48-24s의 자손에 의해 생산된 임의의 하이브리드 균주를 포함하는 P48-24s로부터 계통을 이은 모든 하이브리드 균주도 포함한다. Thus, the present invention encompasses all strains developed from this strain by the novel strain aviforme mushroom P48-24s and by all means, including but not limited to single-spore culture, multi-spore culture and somatic cell sorting And includes all hybrid strains from the P48-24s lineage, including first generation hybrid strains and any hybrid strains produced by the offspring of P48-24s.
본 발명의 더욱 바람직한 실시예(embodiment)에서, 신균주 P48-24s 또는 이로부터 계통을 이은 균주는, 독특한 신규 하이브리드 균주를 추가로 형성하기 위해 DDL01(KACC93085P) 계통 그룹의 균주 또는 상기 그룹으로부터 계통을 이은 균주와 혼성화 즉 교배될 수 있다. In a more preferred embodiment of the present invention, the strain strains P48-24s or strains from this strain are strains of the DDL01 (KACC93085P) strain group or strains from said strain to further form a unique new hybrid strain This can be hybridized or crossed with the strain.
바람직한 혼성화 방법은, 비-반수체(즉, 이종핵체) 부모 균주 각각으로부터 얻어진 2개의 반수체(haploid) 균주(즉, 동종핵체)를 이용한다. 단일형 핵을 포함하는 반수체 균주는, 더 높은 성공 빈도로 혼성화하며, 이종핵체를 포함하는 융합과는 대조적으로, 오직 1개의, 예측가능한, 핵 유전자형을 가진 자손을 생산한다. 동종핵체는 원형질체의 생성, 균사 팁(tips)의 분리를 포함하는 여러가지 방법에 의해 부모 균주로부터 발육되거나, 또는 발아된 포자로부터 발육될 수 있다. 후자의 방법이 포자형성(sporogenesis) 동안 감수분열 재조합의 결과로서, 다양한 유전형을 가진 동종핵체를 제공한다. 또한, 전술한 모든 방법은, 버섯 작물을 생산하고 본 발명의 다양한 태양(aspect)을 달성할 수 있는, P48-24s의 이종핵체 선별 배양물을 발육시키기 위해 이용될 수 있다.A preferred hybridization method utilizes two haploid strains (i. E., Homologs) obtained from each of the non-haploid (i.e., heterologous) parental strains. Haploid strains containing a single nucleus hybridize with a higher success rate and, in contrast to fusion involving a heterologous nucleus, produce only one, predictable, offspring with a nucleotide genotype. Homologues can be developed from parental strains or from germinated spores by a variety of methods including the production of protoplasts, isolation of mycelium tips. The latter method provides a homologue with various genotypes as a result of meiosis recombination during sporogenesis. In addition, all of the above-described methods can be used to develop a P48-24s heterologous selection culture, which can produce mushroom crops and achieve various aspects of the present invention.
아위느타리버섯 신균주 P48-24s 또는 이로부터 계통을 이은 P48-24s 계열의 아위느타리버섯 균주와 관련해 현존하는 선행기술에 대한 본 발명의 이점은, 하기의 기재로부터 명확해질 것이며, 하기에 기재되고 청구된 발명에 의해 달성된다.The advantages of the present invention over the existing prior art with respect to the P. aeruginosa strain P48-24s or the strain P48-24s family of P. aeruginosa strains from which the strain is derived will be clear from the description below, Is achieved by the present invention.
본 발명은 균주 P48-24s로 표시되는 아위느타리버섯 균주의 하이브리드 진균 배양에 의해 달성될 수 있으며, 상기 진균 균주의 대표적인 균주는 2012년 6월 25일자로 한국미생물보존센터에 기탁번호 KCCM11288P로 기탁되었다.The present invention can be accomplished by hybrid fungal culturing of the avian oyster mushroom strain represented by the strain P48-24s, and a representative strain of the fungal strain is deposited with the Korean Society for Microbiological Biology as a deposit number KCCM11288P on June 25, 2012 .
본 발명은, 아위느타리버섯 제1 균주를 아위느타리버섯 제2균주와 교배시켜 생산되는 아위느타리버섯의 하이브리드 진균 균주에 의해 달성될 수 있으며, 상기 아위느타리버섯의 제1 및 제2 균주의 최소 1개는 P48-24s로 표시되는 진균 균주 또는 상기 균주 P48-24s로부터 계통을 잇거나 발육된 진균 균주이다.The present invention can be achieved by a hybrid fungal strain of aviforme mushroom produced by crossing a first strain of aviforme mushroom with a second strain of aviforme mushroom, wherein at least 1 of the first and second strains of the aviforme mushroom Is a fungal strain represented by P48-24s or a fungal strain derived or developed from the above strain P48-24s.
본 발명은, 균주 P48-24s로 표시되는 아위느타리버섯균주의 하이브리드 진균 균주 또는 균주 P48-24s로부터 계통을 잇거나 발육된 균주의 배양으로부터, 체세포 계대배양물(원형질체 재생물을 포함), 담자성 조직 절편, 단일 담자홀씨, 또는 다중 담자홀씨를 선별함으로써 생산한 아위느타리버섯균주의 배양물에 의해 달성될 수 있다. The present invention relates to a method for the production of a somatic cell subculture (including a protoplast regeneration product), a fermentation product of fermentation broth (fermentation broth) from a hybrid fungal strain of the genus Pseudomonas aeruginosa strain represented by strain P48-24s or a strain cultured or developed from strain P48-24s, Tissue sections, single-chambered horticulture, or multi-chambered horticultural strains.
이와 같이 본 발명의 기술적 특징은 상업화된 DDL01(KACC93085P) 균주보다 수요자들의 호감을 이끌어낼 수 있도록 형태적 특성이 개선되도록 교배 육종된 DDL01 (KACC93085P) 균주의 계통을 이은 아위느타리버섯 신균주 P48-24s(기탁번호 : KCCM11288P) 및 그 균주로부터 발육된 균주를 상기 종의 제2 균주와 혼성화시킴으로써 생산된 P48-24s의 자손인 P48-24s 계열의 아위느타리버섯 균주에 있다.As described above, the technical feature of the present invention is that the strains of DDL01 (KACC93085P) strains crossed to improve the morphological characteristics so as to attract consumers' preference than the commercialized strain DDL01 (KACC93085P) (Accession No .: KCCM11288P) and a strain developed from the strain, which is a progeny of P48-24s produced by hybridization with the second strain of the above-mentioned species.
즉, 본 발명의 신균주 아위느타리버섯 P48-24s 및 P48-24s 계열의 아위느타리버섯 균주의 자실체 형성(fruiting)에 의해 생산된 버섯은 갓 표면의 색깔이 미백색 및/또는 호피 형태의 얼룩무늬가 없어 백색에 근접하게 되기 때문이다.
That is, the mushrooms produced by the fruiting of the pseudomonas aeruginosa strains P48-24s and P48-24s of the new strain of the present invention have a whitish and / or hoof-shaped mottling pattern Because it is close to white.
한편, 아위느타리버섯의 균주는 적절한 조건 하에서만 버섯을 생산할 수 있는 것으로 이해될 것이다. 이러한 배양물로부터 버섯을 생산하기에 필요한 이러한 조건들은 당업자들에게 잘 공지되어 있으며, 과도한 실험(undue experimentation)을 수행하지 않고도 결정될 수 있다. 본 발명에서 아위느타리버섯은, 비록 균주를 자실체형성(fruiting) 시키기 위해 당업계에 공지된 어떠한 방법이든지 사용될 수 있다. 특히, 다음의 과정에 따라 통상적으로 생산될 수 있다. 단일의(single) 버섯 균주를 포함하는 순수(pure) 배양물이 멸균된 배지 상에서 클론적으로(clonally) 증식된다. 이 배양물은, 세포 구성물로 이루어진 균사로 불리는, 아주 미세하고 실같은(threadlike) 성분을 많이 포함하는 균사체(mycelium)이다. 상업적인 목적을 위해, 순수 배양물의 일부는 더 부피가 큰 적당한 배지에 전달되며, 이들이 충분히 자라면, 균사(spawn) 및 케이싱 접종물(casinginoculant)과 같은 상업적 제품을 생산하기 위한 접종원(inoculum)으로서 사용될 수 있다(원칙적으로 순수 배양물의 모든 형태는 넓은 뜻에서 접종원이다). 일반적으로 버섯 균사는 쵸크(chalk)와 같은 다른 물질로 보정될 수 있는, 호밀(rye), 밀(wheat) 또는 기장(millet)과 같은 멸균되고 조리된 곡식으로부터 제조된다. 케이싱 접종물은 전형적으로 피트 모스(peat moss), 버미큘라이트(vermiculite) 및/또는 영양제로 혼합되고 물로 적셔진 배양토와 같은 특정 물질로 이루어져 있다. 적은 부피의 접종원이 부피가 더 큰 멸균된 곡물(균사용) 또는 다른 기질(케이싱 접종물용)과 혼합된다. 순수 배양물 균사체가 전체적으로 자라고, 멸균된 기질의 대부분을 완전히 군락화시키게 될 때, 기질과 균사체가 합쳐진 덩어리(mass)는 전형적인 상업적 제품(균사 또는 케이싱 접종물)이 된다.
On the other hand, it will be understood that strains of A. manganese can only produce mushrooms under appropriate conditions. These conditions necessary to produce mushrooms from such cultures are well known to those skilled in the art and can be determined without undue experimentation. In the present invention, avaine mushroom may be used in any method known in the art for fruiting strains. In particular, it can be produced usually according to the following procedure. Pure cultures containing a single mushroom strain are clonally grown on sterile medium. This culture is a mycelium containing very fine, threadlike components called mycelia composed of cellular constituents. For commercial purposes, a portion of the pure culture is transferred to a more bulky, suitable medium and, if sufficiently grown, to be used as an inoculum for the production of commercial products such as a spawn and casinginoculant (In principle, all forms of pure culture are broadly inoculated). Mushroom hyphae are generally produced from sterilized and cooked grains such as rye, wheat or millet, which can be corrected with other materials such as chalk. The casing inoculum typically consists of certain materials such as peat moss, vermiculite, and / or culture soil mixed with a nutrient and wetted with water. A small volume of inoculum is mixed with larger volumes of sterilized cereal (bacterial) or other substrates (for casing inoculum). When the pure culture mycelium grows and most of the sterilized substrate is completely clustered, the mass of substrate and mycelium combined becomes a typical commercial product (hyphae or casing inoculum).
본 발명에 따른 아위느타리버섯 신균주 P48-24s는 종래 알려진 아위느타리버섯 균주들 중에서도 농업회사법인주식회사 뜰아채 부설연구소의 보존균주 중 DDL01 (KACC93085P)과 시험재배를 통해 DAC7322, DAC7421를 선발하였고, 이하의 실험에서 교배육종의 모본 균주로 사용하였다.Among the known strains of avium oyster mushroom strain P48-24s according to the present invention, selected strains DDC01 (KACC93085P) and DAC7322 and DAC7421 were selected among the preserved strains of the agar plant, , Which was used as a transgenic strain of breeding seedlings.
실시예 1. 아위느타리버섯 신균주 P48-24s의 육종EXAMPLES Example 1 Breeding of a new strain of avium oyster mushroom P48-24s
본 발명을 위해 농업회사법인주식회사 뜰아채 부설연구소의 보존균주 중 DDL01(KACC93085P), DAC7322 및 DAC7421를 모균주로 사용했다. For the present invention, DDL01 (KACC93085P), DAC7322 and DAC7421 were used as the parent strains among the preserved strains of the Institute of Agricultural Research,
(1) 단포자의 분리(1) Isolation of monospore
낙하법에 의해 아위느타리버섯 균주 DDL01, DAC7322 및 DAC7421의 자루 부위가 제거된 갓 부위를 버섯의 주름살이 밑으로 향하게 하여 페트리접시에 올려놓고 24시간 경과된 후에 갓을 제거하고 페트리접시 위에 떨어진 버섯의 포자들을 멸균수를 통해 적당한 농도로 희석하여 감자 한천배지에 도말하여 25℃에서 배양하였다. 배양 7일 이후부터 발아하는 1차 균사를 이쑤시개를 통해 순수분리하고 각각의 1차 균사는 다시 감자 한천배지에 접종하였다. 접종된 감자 한천배지는 25℃에서 14일간 배양한 뒤 각각의 균사를 일부 떼어내어 현미경을 통해 클램프의 유무를 확인하고 클램프가 보이지 않는 균사만을 10% 글리세롤 용액에 넣고 냉장보관하며 시험에 사용하였다.
After dropping the bag of DDU01, DAC7322 and DAC7421 on the petri dish with the wrinkles of the mushroom facing downward, after 24 hours, remove the freshly harvested mushrooms The spores were diluted to an appropriate concentration through sterilized water, and then plated on a potato agar medium and cultured at 25 ° C. The first germination germinated from 7 days after cultivation was separated by toothpick, and each primary mycelium was inoculated again on potato agar medium. The inoculated potato agar broth was incubated at 25 ℃ for 14 days. The mycelium was partially removed, and the presence or absence of the clamp was confirmed by a microscope. Only the mycelium with no clamp was put in a 10% glycerol solution and used for the test.
(2) 교배(2) Crossing
순수 분리되어 냉장보관중인 서로 다른 각각의 아위느타리버섯 균주의 단포자(일핵)균사와 단포자(일핵)균사의 교배와 단포자(일핵)균사와 모균의 균사(이핵)의 교배방법을 수행하였다. 각각 감자한천배지에 접종하고 25℃에서 14일간 배양한 뒤 생육이 좋고 균사체량이 많은 것만을 선발하여 교배 육종에 사용하였다. 감자한천 배지에 자란 균사체를 1cm 원형의 크기로 잘라 떼어낸 균사체 블럭을 각각 1개씩 새로운 감자한천배지 페트리접시에 3cm 간격을 두고 대치하여 교배 육종를 수행하였다. 접종된 감자한천배지 페트리접시를 25℃ 항온기에서 21~28일간 배양한 뒤 균사를 떼어내어 현미경으로 관찰해 단핵의 균사체 블럭쪽에서 클램프가 형성된 균주만을 선발하였다.
Mating of monocotyledonous (monocotyledonous) mycelia and monocotyledonous (mycorrhizal) hyphae of hybrids of each of the different Aeweuteri mushroom strains isolated from each other and hyphae of monocotyledonous hyphae and hyphal mycelium . Each of them was inoculated on a potato agar medium and cultured at 25 ° C for 14 days. Only those with good growth and high mycelium were selected for crossing breeding. Mycelium grown on a potato agar medium was cut into 1 cm round size, and each mycelium block was replaced with a new potato agar medium petri dish at intervals of 3 cm to perform crossing breeding. The inoculated potato agar medium petri dish was incubated at 25 ℃ for 21 ~ 28 days. Mycelia were removed and examined with a microscope to isolate strains which were clamped on the mycelial block side of mononuclear cells.
(3) 교배주의 재배시험(3) Crossbreeding Cultivation Test
톱밥 : 미강을 8:2의 비율로 혼합해 수분을 64%로 조정하여 850cc 버섯재배용 병에 580g씩 입병한 후 2cm의 봉으로 가운데 위에 밑부분까지 타공하여 121℃에서 60분간 멸균하였다. 멸균한 후 20℃ 까지 냉각한 후 상기 선발된 균주를 접종하고 24℃에서 30일간 암흑상태에서 배양하였다. 배양 완료 후 균긁기 작업을 행한 후 14~18℃, 습도 80~95%, 조도 100~200룩스에서 발이 및 생육 등의 재배시험을 실시하였다.
Sawdust: Mixed rice bran at a ratio of 8: 2 to adjust the water content to 64%. 580g of rice was put into a 850cc mushroom cultivation bottle and then pestle with a 2cm rod to the bottom at the center and sterilized at 121 ° C for 60 minutes. After cooling to 20 캜 after sterilization, the selected strain was inoculated and cultured in the dark state at 24 캜 for 30 days. After completion of the cultivation, bacterial scratching was carried out, and cultivation tests such as foot and growth were carried out at 14 to 18 ° C, 80 to 95% in humidity and 100 to 200 lux at the illuminance.
(4) 신규 교배주인 아위느타리버섯 신균주 P48-24s의 선발(4) Selection of new strain Pseudomonas aeruginosa mushroom strain P48-24s
단포자 교배를 통해 얻어진 교배주들을 시험재배하고, 스크리닝하여 자실체 갓의 색택을 미백색으로 유도하는 특징을 지닌 DDL01(KACC93085P)의 단포자 P7329W, P7330W와 P7332W를 선발하여 그중 P7332W를 DAC7322(이핵)와 1차 교배를 통해 DAC7348의 교배주를 선발하였으며, 다시 DAC7348의 균주와 DAC7421균주의 단포자를 교배하여 최종적으로 갓의 색택이 미백색인 교배주들을 선발하고, 자실체의 갓 표면에 호피형태의 얼룩무늬가 없는 미백색이며 반반구형상인 교배주를 선발하여 P48-24s로 명명하여, 2012년 6월 25일자로 한국미생물보존센터에 기탁하였다.(수탁번호 : KCCM11288P).
Mongrel strains obtained through single-spore mating were tested and screened to select the spore strains P7329W, P7330W and P7332W of DDL01 (KACC93085P), which induces the color of the fruit body gum to be light white. Among them, P7332W was selected as DAC7322 The mating strain of DAC7348 was selected through the first mating. Again, the strain of DAC7348 was crossed with the monoclonal of DAC7421. Finally, the mature hybrid of the color of the gut was selected, and the hatching pattern , And named it as P48-24s, and deposited it on June 25, 2012 at the Korean Center for Microbial Conservation (Accession No .: KCCM11288P).
실시예 2. P48-24S 계열의 아위느타리버섯 균주1 내지 5의 육종Example 2 Breeding of Pseudomonas aeruginosa strains 1 to 5 of the P48-24S series
실시예 1에서 선발된 신균주 P48-24s를 모균주로 한 것을 제외하면 실시예1과 동일한 방법으로 (1)단포자의 분리, (2)교배, (3)교배주의 재배시험을 수행하여 신균주 P48-24s의 자간 단포자 교배를 통해 얻어진 P48-24S 계열의 아위느타리버섯 균주1 내지 5 즉 P48-24S를 모균으로 하는 자균1 내지 5를 얻었다.
(1) separation of monocotyledonous spores, (2) mating, and (3) crossing cultivation test were carried out in the same manner as in Example 1, except that the new strain P48-24s selected in Example 1 was used as a parent strain, Pigeon strains 1 to 5 of the P48-24S strain obtained through crosses of the strain P48-24s were obtained.
실험예 1. 신규 교배주 P48-24s 및 P48-24S 계열의 아위느타리버섯 균주1 내지 5의 균학적 특성 EXPERIMENTAL EXAMPLE 1. Mycological characteristics of fresh mating strain P48-24s and P48-24S strains of aviforme mushroom strains 1 to 5
실시예1에서 얻어진 신규 교배 균주 P48-24s 및 실시예2에서 얻어진 P48-24S 계열의 아위느타리버섯 균주1 내지 5의 균학적 특성을 다음과 같이 조사하였다.The mycological characteristics of the novel crossbreeding strain P48-24s obtained in Example 1 and the P48-24S strain Aventus mushroom strains 1 to 5 obtained in Example 2 were investigated as follows.
1) 포테이토 덱스트로스 한천(PDA)배지에서의 생육 상태 (25℃): 7일째의 콜로니 직경은 40.7mm. 균사는 흰색으로 빽빽하며, 기중 균사의 양은 보통, 직선적으로 자란다.1) Growth condition (25 占 폚) on potato dextrose agar (PDA) medium: Colony diameter on day 7 was 40.7 mm. Mycelium is dense with white, and the amount of air hypha grows normally and linearly.
2) 머쉬룸 컴플레트 한천(MCM)배지에서의 생육 상태 (25℃): 7일째의 콜로니 직경은 36.1mm. 균사는 흰색으로 빽빽하며, 기중 균사의 양은 보통, 직선적으로 자란다.2) Growth condition (25 占 폚) on mushroom complex agar (MCM) medium: Colony diameter on the 7th day is 36.1 mm. Mycelium is dense with white, and the amount of air hypha grows normally and linearly.
3) 마이코로지컬한천(MA)배지에서의 생육 상태 (25℃): 7일째의 콜로니 직경은 40.3mm. 균사는 흰색으로 빽빽하며, 기중 균사의 양은 보통, 직선적으로 자란다.3) Growth condition (25 占 폚) on the Maiko Cultural Agar (MA) medium: The colony diameter on the 7th day is 40.3 mm. Mycelium is dense with white, and the amount of air hypha grows normally and linearly.
4) 콘밀한천(CMA)배지에서의 생육 상태 (25℃): 7일째의 콜로니 직경은 39.3mm. 균사는 흰색으로 매우 희박하고, 기중 균사의 양은 매우 적음, 직선적으로 자란다.4) Growth condition (25 ° C) on a medium of agar (CMA) on the agar: the colony diameter on the 7th day is 39.3 mm. Mycelium is very thin in white, the amount of air hypha is very small, grows linearly.
5) 사브로우드 덱스트로스 한천(SDA)배지에서의 생육 상태 (25℃): 7일째의 콜로니 직경은 38.5mm. 균사는 흰색으로 빽빽하며, 후기에 균사체의 색택이 부분적으로 붉은노랑을 띄며, 기중 균사의 양은 보통, 직선적으로 자란다.5) Growth condition (25 占 폚) on a medium of SDA broth: The diameter of colonies on the 7th day is 38.5 mm. Mycelium is dense with white, and the color of mycelium is partially reddish yellow in the latter period. The amount of mycelium in the air is usually linear.
6) 균사생육최적온도: PDA 배지상에 직경 5mm의 종균을 접종해, 각 온도대에서 각각 배양 짓고, 7일 뒤에 각 콜로니 경을 측정했더니, 균사신장의 최적온도는 26℃ 부근이었다.6) Optimum temperature of mycelial growth: 5 mm diameter seedlings were inoculated on the PDA medium, cultured at each temperature zone, and 7 days later, the optimum temperature for mycelial growth was around 26 ° C.
7) 균사생육최적 pH:글루코스-펩톤-이스트 익스트렉트 액체 배지 25ml씩을 멸균 후, 각 pH에 조정해, 종균을 접종 후, 25℃으로12일간(에) 정치배양 한 뒤, 건조균체중량을 측정했더니, 균사생육최적 pH은 5.5 부근이었다.
7) Optimum pH of mycelial growth: 25 ml of glucose-peptone-yeast extract liquid medium was sterilized, adjusted to each pH, inoculated with seed bacterium, allowed to stand at 25 ° C for 12 days, The optimum pH for mycelial growth was around 5.5.
실험예 2. 신규 교배주 P48-24s 및 P48-24S 계열의 아위느타리버섯 균주1 내지 5의 단포자 특성Experimental Example 2. Monoclonal characteristics of fresh mating strain P48-24s and P48-24S strains of aviforme mushroom strains 1 to 5
실시예들에서 얻어진 균주의 단포자 특성을 조사하였다. 특징적으로 단포자의 수율이 매우 낮았다. 또한 대부분 단일 콜로니이면서 클램프를 갖는 1차 균사의 경우, 형광현미경으로 포자 내의 핵을 관찰한 결과 도 2에 도시된 바와 같이 두 개의 핵을 지닌 이핵체 및 1개의 핵을 지닌 일핵체가 혼재하여 존재하였다.
The spore characteristics of the strains obtained in the examples were examined. Characteristically, the yield of monospore was very low. In the case of the primary mycelium which is mostly single-colony and clamped, the nuclei in the spores were observed by fluorescence microscopy, and as shown in FIG. 2, there existed a mixture of a nucleus having two nuclei and a nucleus having one nucleus .
실험예 3. 신규 교배주 P48-24s 및 P48-24S 계열의 아위느타리버섯 균주1 내지 5의 유전적 특성Experimental Example 3: Genetic characteristics of fresh mating strain P48-24s and P48-24S strains of A. myrtaceae strains 1 to 5
실시예들에서 얻어진 균주의 유전적 특성을 조사하기 위해 양 균사가 갖고 있는 성인자가 다르면, 그 균사는 서로 다른 균사다라고 하는 균류 분류학적 사실에 입각해, 양친주 및 근연품종과의 한천배지상에서의 대치배양에 의해 성인자의 동이판정을 수행하였다. 포테이토 덱스트로스 한천배지상에 3센치의 간격을 두고 서로 대치하여 각각 균주를 접종해 25℃로 14~21일간 배양한 뒤 양 콜로니 경계부에 대선이 생길지 아닐지를 판정했고(대선형성은 +, 형성하지 않는 것은 ― 로 표시), 그 결과를 표 1에 나타내었다. 여기서, P48-24S를 모균으로 하는 자균은 실시예2에서 얻어진 P48-24S 계열의 아위느타리버섯 균주1 내지 5로서, 신균주 P48-24S의 단포자끼리 배양하여 얻어진 교배주를 의미한다.In order to investigate the genetic characteristics of the strains obtained in the examples, the mycelia are different from each other if they are different from each other. Based on the mycological findings of mycelium, And the adult was determined by confluent culture. The seeds were inoculated with each other at intervals of 3 centimeters on a potato dextrose agar medium and incubated at 25 ° C for 14 to 21 days, and it was judged whether or not an election would occur at the boundary between the two colonies (-), and the results are shown in Table 1. Herein, the strain of P48-24S as a host strain means a strain obtained by culturing single spores of the new strain P48-24S as the P48-24S strain of aviforme mushroom strain 1 to 5 obtained in Example 2.
실험예 4. 신규 교배주인 P48-24s 의 분자생물학적 동정EXPERIMENTAL EXAMPLE 4. Molecular Biological Identification of New Crossbred P48-24s
(1) ITS지역(region)의 염기서열 결정 (1) Determination of the nucleotide sequence of the ITS region
배양체로부터 비드 비팅(bead beating) 방법을 이용하여 DNA를 추출하였고 내부 전사되는 ITS(Internal transcribed spacer)를 PCR(polymerase chain reaction)증폭하기 위하여 ITS1 (TCCGTAGGTGAACCTGCGG; 서열번호 1) / ITS4 (TCCTCCGCTTATTGATATGC; 서열번호 2)의 프라이머 세트를 각각 이용하여 증폭한 후 정제를 통해 (주)Macrogen에 시퀀싱을 의뢰하여 염기서열을 결정하였다(서열번호 3).ITS1 (TCCGTAGGTGAACCTGCGG; SEQ ID NO: 1) / ITS4 (TCCTCCGCTTATTGATATGC; SEQ ID NO: 1) was used to amplify an internal transcribed ITS (Internal Transcribed Spacer) by PCR using a bead beating method from a culture medium. 2) were amplified using the primer sets, respectively, and then subjected to sequencing by the Macrogen Co. (SEQ ID NO: 3) through purification.
> P48-24s> P48-24s
GGAAGGATCATTAATGAATTCACTATGGAGTTGTTGCTGGCCTCTAGGGGCATGTGCACGCTTCACTAGTCTTTCAACCACCTGTGAACTTTTGATAGATCTGTGAAGTCGTCTCTCAAGTCGTTAGACTTGGTTTGCTGGGATGTAAACGTCTCGGTGTGACTACGCAGTCTATTTACTTATAACACCCCAAATGTATGTCTACGAATGTCATTTAAAGGGCCTTGTGCCTATAAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTCACTCTGGTTTTTCCAATTGTGATGTTTGGATTGTTGGGGGCTGCTGGCCTTGACAGGTCGGCTCCTCTTAAATGCATTAGCAGGACTTCTCATTGCCTCTGCGCATGATGTGATAATTATCACTCATCAATAGCACGCATGAATAGAGTCTGGCTCTCTAACCGTCCGCAAGGACAATTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCT
GGAAGGATCATTAATGAATTCACTATGGAGTTGTTGCTGGCCTCTAGGGGCATGTGCACGCTTCACTAGTCTTTCAACCACCTGTGAACTTTTGATAGATCTGTGAAGTCGTCTCTCAAGTCGTTAGACTTGGTTTGCTGGGATGTAAACGTCTCGGTGTGACTACGCAGTCTATTTACTTATAACACCCCAAATGTATGTCTACGAATGTCATTTAAAGGGCCTTGTGCCTATAAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTCACTCTGGTTTTTCCAATTGTGATGTTTGGATTGTTGGGGGCTGCTGGCCTTGACAGGTCGGCTCCTCTTAAATGCATTAGCAGGACTTCTCATTGCCTCTGCGCATGATGTGATAATTATCACTCATCAATAGCACGCATGAATAGAGTCTGGCTCTCTAACCGTCCGCAAGGACAATTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCT
(2) 유전적 특성 분석(2) Analysis of genetic characteristics
염기서열이 결정된 두 유전자 부분을 수정을 거쳐 유전자은행의 BLAST 서치를 통해 가장 유사한 균주의 염기서열들을 얻은 후, 좀 더 정확한 유전적 분석을 시도하였다. After genomic analysis of the two gene sequences, BLAST searches for the most similar genomic sequences and genetic analysis.
ClustalW2(Multiple Sequence Alignment)를 이용하여 모든 염기서열을 정렬하였고, 이를 토대로 MrBayes version 3.1 program을 이용하여 Bayesian MCMC run으로 진화학적 거리를 계산하고, maximum likelihood 방법으로 분자진화학적 관계를 도 3에 나타내었다. 이때 boot-strapping 값은 1000으로 사용하였다. 이를 토대로 이들의 유사성 및 최종 동정을 하였다. 그 결과 느타리버섯속의 프레오로투스 에링기 버라이어티 페룰라에(Pleurotus eryngii var. ferulae) 버섯으로 동정되었다.
All sequences were sequenced using ClustalW2 (Multiple Sequence Alignment). Based on this, the evolutionary distance was calculated by Bayesian MCMC run using MrBayes version 3.1 program, and the molecular chemical relationship by the maximum likelihood method is shown in Fig. 3 . The boot-strapping value is 1000. Based on this, similarities and final identifications were made. As a result, Pleurotus eryngii var. Ferulae ( Pleurotus eryngii var. Ferulae ) It was identified as mushroom.
실험예 5. 신규 교배주인 P48-24s 자실체의 형태적 특성 Experimental Example 5 Morphological Characteristics of New Crossbred P48-24s Fruiting Body
[육안적 특징] [Visual Features]
도 4에 도시된 바와 같이 갓은 15-90mm, 최적은 20-55mm, 모양은 초기에 반반구형이나, 성장하면 편평상 반반구형-편평하게 펴지며, 약간 중앙부위가 함몰되어 있다. 갓 끝은 성장초기에 안쪽으로 굽어있거나 말려있으며, 상당기간동안 지속된다. 표면은 담황백색-유백색을 띠며, 평활하다. 조직은 중앙부위는 매우 두껍고, 치밀하며, 유백색을 띠고, 탄력성이 있는 육질형이며, 갓끝쪽으로 얇아진다. 냄새는 전형적인 버섯향이며, 맛은 단맛이 있고, 특히 씹을 때 감촉이 매우 좋다. 주름살대에 긴 내린 주름살이고, 빽빽하며, 짧은 주름살은 1- 3가지형이고, 초기에는 백색이나 후에 담회황색-담회오렌지색을 띠며, 주름살 날은 평활하다. As shown in FIG. 4, the shade is 15-90 mm, the optimum is 20-55 mm, and the shape is semi-spherical at the beginning, but when it grows, it is flattened semi-spherically-flat and slightly centered. Fresh ends are bent inward or curled inward at the beginning of growth, and last for a considerable period. The surface is pale yellow - milky and smooth. The tissue is very thick, dense, milky white, resilient, and thin in the central part. The smell is a typical mushroom flavor, the taste is sweet, especially when chewing, the texture is very good. The wrinkles are long wrinkled wrinkles, dense, short wrinkles 1-3 in shape, initially white, but later yellow-burgundy orange, with wrinkled edges smooth.
대 15-55 × 55-150㎜(기부 27㎜)로 최적은20-45× 70-90mm의 원통형이며, 기부쪽으로 굵어지며, 대상부 쪽으로 가늘어지다가 다시 굵어지고, 종종 굽어있다. 표면은 담황백색-유백색을 띠며, 불명료한 세로로 섬유질선이 있고, 다소 울퉁불퉁하며, 평활하다. 대의 속은 차있으며, 백색이고 치밀하며, 탄력성이 있는 육질형이다. It is 15-55 × 55-150㎜ (basal 27㎜), and it is a cylindrical type of 20-45 × 70-90mm which is thicker toward the base, thinning to the target side, thickening again and often bending. The surface is pale yellowish-milky, with indistinct vertical fibrous lines, somewhat rugged, and smooth. The car is white, dense, and resilient.
[현미경 특징] [Features of microscope]
포자는 크기가 9.3-9.8×4.3-4.6㎛로 타원형-원통상타원형이고, 표면은 평활하며, 멜저용액에서 비아밀로이드이다, 포자문 유백색이다. The spores are 9.3-9.8 × 4.3-4.6 μm in size, oval-cylindrical oval, smooth on the surface, non-amyloid in the melissa solution, and foamy milky white.
담자기는 2가지형이며, 도 5에 도시된 바와 같이 2포자형의 담자기가 대부분이고 크기가 52-57×8.5-9㎛로 긴 곤봉형이며, 4-포자형의 담자기는 크기가 47-48×10-10.2 ㎛로 곤봉형이며 기부에 클램프(협구)가 있다.As shown in Fig. 5, the two-spore type quartz is mostly used, and its size is 52-57 x 8.5-9 쨉 m long, and the four-spore type quartz has a size of 47-48 × 10 - 10.2 ㎛ with a club-like shape and a clamp at the base.
날시스티디아 크기가 25-35× 5-8㎛로 곤봉형, 방추형, 곤봉상방추형이며, 일반적으로 정단부에 1-3개의 뾰죽한 돌기가 있고, 세포벽은 얇으며, 무색이다. The size of the epidermidis is 25-35 × 5-8 μm, with club, fusiform, clublike fusiform shape. Generally, there are 1-3 rhyolitic projections at the top, and the cell wall is thin and colorless.
측시스티디아는 없다. There is no sidesteadia.
자실층조직은 평행균사형-혼선형으로 제1균사조직형이며 균사의 격막에 클램프가 있다.
The fascial layer structure is parallel mycelial - cross-linked type I hyphae, and there is a clamp on the diaphragm of mycelia.
실험예 6. 신규 교배주인 P48-24s 계열의 아위느타리버섯 균주1 내지 5 자실체의 형태적 특성 Experimental Example 6 Morphological Characteristics of 1 to 5 Fruiting Body of the Pseudomonas aeruginosa Strain of P48-24s in the New Crossing Strain
도 6에 도시된 바와 같이 자실체의 표현형 즉 전체형태, 갓의 형태, 갓의 색택, 대길이, 대굵기 등이 모균의 표현형과 유사하게 나타났고, 현미경에 의한 자실체 주름살 부위의 자실층과 담자기를 관찰한 결과 상술된 모균주인 P48-24s와 유사하게 나타났다. As shown in FIG. 6, the phenotype of the fruit body, that is, the shape of the eggplant, the shape of the eggplant, the coloring of the eggplant, the rootstock, and the thickness of the egg were similar to those of the parent strain. The results were similar to the parent strain P48-24s described above.
또한, 두 개의 핵을 지닌 이핵체 단포자의 균사체를 배양한 후 재배하여 얻어진 자실체도 같은 결과로 나타났다.
Fruit bodies obtained by culturing the mycelium of two nuclear nucleus spores were also the same.
실험예 7. 신규 교배주인 P48-24s 및 P48-24S 계열의 아위느타리버섯 균주1 내지 5의 재배 Experimental Example 7: Cultivation of the new cross breeders P48-24s and P48-24S of the avian oyster mushroom strains 1 to 5
1. 배지조제1. Preparation of badge
배지재료는, 톱밥 : 미강 = 8 : 2(용적비, 40-50g/850cc 병이 표준)으로 혼합해 사용하였다. 교반 혼합하여 최종 배지 함수율이 68~70%가 되도록 조정하였다.Sources of sawdust: rice bran = 8: 2 (volume ratio, 40-50 g / 850 cc bottle standard) were used as the medium. Followed by stirring and mixing to adjust the final medium water content to 68-70%.
2. 충진2. Filling
배지의 충진양은 850cc 빈병에 480-520g(내용양)이 되도록 충진하였다.The filling amount of the medium was filled to 850 cc bottles to 480-520 g (content amount).
3. 살균3. Sterilization
고압살균은 배지내 온도가 120℃에 달하고 나서 60분간(유효살균시간) 실시하며, 살균솥 온도를 표준으로 할 경우에는, 90분간 (850cc 병) 실시한다.The high-pressure sterilization is carried out for 60 minutes (effective sterilization time) after the temperature reaches 120 ° C in the medium, and 90 minutes (850cc bottle) when the sterilization pot temperature is standard.
4. 방냉4. Cooling
청결한 환경 하에서 배지온도가 20℃ 이하가 될 때까지 냉각하였다.Under a clean environment, the culture medium was cooled until the culture medium temperature became 20 DEG C or lower.
5. 접종5. Inoculation
종균의 접종양은 1병당 15cc 정도를 표준으로 접종하였다.The inoculum amount of seed bacterium was inoculated as standard of about 15cc per one bottle.
6. 배양관리6. Culture management
온도는 18℃으로 25일간 관리하고, 이에 계속하여 23℃으로 8~10일간의 배양숙성 관리하였다. 습도는 전기배양은 60~70%, 후기배양은 70~80%으로 관리하였으며, 이산화탄소 농도는 3,000ppm 이하로 관리하였다. 조도는 암흑배양으로 관리하고, 기간은 30일간 배양한다.The temperature was maintained at 18 占 폚 for 25 days, followed by aging at 23 占 폚 for 8 to 10 days. Humidity was maintained at 60 ~ 70% for the electric culture and 70 ~ 80% for the later culture, and the carbon dioxide concentration was controlled at 3,000 ppm or less. Light intensity is controlled by dark culture, and period is 30 days.
7. 균긁기7. Scraping bacteria
발아 수를 억제하는 목적으로 15~20mm 균긁기를 실시하였다.Scraping of 15 ~ 20mm was performed for the purpose of suppressing the number of germination.
8. 발이관리8. Foot Care
온도는 14-15℃으로 관리하고, 전기발이의 습도는 90-95%으로 3-5일간, 후기발이는 70~80%으로 3-5일간 관리하였다. 이산화탄소 농도는 1,000ppm 이하로 관리하며, 조도는 낮에만 전등관리로 하였다. 5-8일 간, 물구나무서기상태로 관리하였다. 후기발이에서 1cm 정도의 어린버섯의 원기가 형성되면 바로 물구나무서기상태에서 정립상태로 뒤집어 생육관리를 하였다.The temperature was controlled at 14-15 ° C, and the humidity of the electric foot was controlled for 3-5 days at 90-95% and 70-80% for the latter 3-5 days. The carbon dioxide concentration was controlled to be less than 1,000 ppm, and the light intensity was managed only at the daytime. For 5 to 8 days. When the young mushroom was grown about 1cm from the late feet, the growth was controlled by inverting from a standing position to a standing position.
9. 생육관리9. Growth management
재배병 입구 표면에 형성된 어린버섯들의 크기를 동조화하기 위해서 온도는 11-12℃으로 관리해 14℃ 이상으로는 올라가지 않도록 하였다. 최초의 3일간을 11℃으로 관리하였다. 습도는 70-95%으로 관리해 건 /습의 습도교차를 크게 벌여 관리하였다. 발아 확인 후에 정립상태로 되돌려 5-8일간 관리하였다. 정립에 되돌린 직후는 생육 초기에 저온관리로 제습에 의한 습도조건에 주의하여 관리한다.In order to synchronize the size of young mushrooms formed on the surface of the culture bottle inlet, the temperature was controlled at 11-12 ° C so as not to rise above 14 ° C. The first 3 days were managed at 11 ° C. Humidity was controlled by 70-95%, and the humidity / humidity crossing was managed to a large extent. After germination confirmation, it was returned to the established state and maintained for 5-8 days. Immediately after being returned to the formulation, care should be taken in the early stage of growth to take into account the humidity conditions caused by dehumidification with low temperature control.
10. 수확10. Harvest
버섯 갓이 둥그스름한 반구형의 모양이 남아있는 상품의 상태에서 수확하였다.
Mushroom gods were harvested in the state of a product with a roundish hemispherical shape.
실험예 7과 같이 실시예들에서 얻어진 아위느타리버섯 신균주 P48-24s 및 P48-24S 계열의 아위느타리버섯 균주1 내지 5를 재배하여 수확한 결과, DDL01(KACC93085P)의 계통을 유지하지만 자실체 갓의 형상이나 색택이 도 1에 도시된 사진의 DDL01(KACC93085P) 균주보다 수요자들의 호감을 이끌어낼 수 있도록 개선되어 자실체의 갓 표면이 호피형태의 얼룩무늬가 없는 미백색이었다. 이점은, 신균주 P48-24s의 자실체의 갓 표면을 확인할 수 있는 도 5 및 P48-24S 계열의 아위느타리버섯 균주의 자실체의 갓 표면을 확인할 수 있는 도 6에 도시된 사진을 통해 보다 분명히 알 수 있다.
As shown in Experimental Example 7, harvesting the new avian oyster mushroom strains P48-24s and P48-24S strains of agrippedic mushroom strains 1 to 5 resulted in maintaining the lineage of DDL01 (KACC93085P) The shape and the coloring were improved so as to be able to attract the consumers' preference than the DDL01 (KACC93085P) strain shown in the photograph shown in Fig. 1, and the fresh surface of the fruit body was an unbleached white color without stain pattern. This can be seen clearly in FIG. 5, which shows the fresh surface of the fresh body of the new strain P48-24s, and in FIG. 6, which shows the fresh surface of the fruit body of the Pyrus myrtle strain of the P48-24S series have.
본 발명은 이상에서 살펴본 바와 같이 바람직한 실시 예를 들어 도시하고 설명하였으나, 상기한 실시 예에 한정되지 아니하며 본 발명의 정신을 벗어나지 않는 범위 내에서 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자에 의해 다양한 변경과 수정이 가능할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation, Various changes and modifications will be possible.
<110> DDLE A CHE Agricultural Co., Ltd. <120> Novel Pleurotus eryngii var. ferulae Strain P48-24s and its descendants <130> DPP-2013-0304-KR <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Internal transcribed spacer 1 <400> 1 tccgtaggtg aacctgcgg 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Internal transcribed spacer 4 <400> 2 tcctccgctt attgatatgc 20 <210> 3 <211> 643 <212> DNA <213> Pleurotus eryngii <400> 3 ggaaggatca ttaatgaatt cactatggag ttgttgctgg cctctagggg catgtgcacg 60 cttcactagt ctttcaacca cctgtgaact tttgatagat ctgtgaagtc gtctctcaag 120 tcgttagact tggtttgctg ggatgtaaac gtctcggtgt gactacgcag tctatttact 180 tataacaccc caaatgtatg tctacgaatg tcatttaaag ggccttgtgc ctataaacca 240 taatacaact ttcaacaacg gatctcttgg ctctcgcatc gatgaagaac gcagcgaaat 300 gcgataagta atgtgaattg cagaattcag tgaatcatcg aatctttgaa cgcaccttgc 360 gccccttggt attccgaggg gcatgcctgt ttgagtgtca ttaaattctc aaactcactc 420 tggtttttcc aattgtgatg tttggattgt tgggggctgc tggccttgac aggtcggctc 480 ctcttaaatg cattagcagg acttctcatt gcctctgcgc atgatgtgat aattatcact 540 catcaatagc acgcatgaat agagtctggc tctctaaccg tccgcaagga caatttgaca 600 atttgacctc aaatcaggta ggactacccg ctgaacttaa gct 643 <110> DDLEA CHE Agricultural Co., Ltd. <120> Novel Pleurotus eryngii var. ferulae Strain P48-24s and its descendants <130> DPP-2013-0304-KR <160> 3 <170> Kopatentin 1.71 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Internal transcribed spacer 1 <400> 1 tccgtaggtg aacctgcgg 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Internal transcribed spacer 4 <400> 2 tcctccgctt attgatatgc 20 <210> 3 <211> 643 <212> DNA <213> Pleurotus eryngii <400> 3 ggaaggatca ttaatgaatt cactatggag ttgttgctgg cctctagggg catgtgcacg 60 cttcactagt ctttcaacca cctgtgaact tttgatagat ctgtgaagtc gtctctcaag 120 tcgttagact tggtttgctg ggatgtaaac gtctcggtgt gactacgcag tctatttact 180 tataacaccc caaatgtatg tctacgaatg tcatttaaag ggccttgtgc ctataaacca 240 taatacaact ttcaacaacg gatctcttgg ctctcgcatc gatgaagaac gcagcgaaat 300 gcgataagta atgtgaattg cagaattcag tgaatcatcg aatctttgaa cgcaccttgc 360 gccccttggt attccgaggg gcatgcctgt ttgagtgtca ttaaattctc aaactcactc 420 tggtttttcc aattgtgatg tttggattgt tgggggctgc tggccttgac aggtcggctc 480 ctcttaaatg cattagcagg acttctcatt gcctctgcgc atgatgtgat aattatcact 540 catcaatagc acgcatgaat agagtctggc tctctaaccg tccgcaagga caatttgaca 600 atttgacctc aaatcaggta ggactacccg ctgaacttaa gct 643
Claims (10)
The spores obtained from the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).
Inoculum containing the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).
Mushroom hypha containing the new strain Pseudomonas aeruginosa P48-24s (Accession No: KCCM11288P).
Homokaryons of the new strain Pseudomonas aeruginosa P48-24s obtained from the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).
Mushrooms produced by fruiting of the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P).
It has been reported that the new strains produced by the single-spore culture or multi-sporulation culture of somatic sub-cultures of the strain Aiitri mushroom P48-24s (Accession No .: KCCM11288P) or of the strains developed therefrom or by somatic cell sorting Pseudomonas aeruginosa strain P48-24s.
Pseudomonas aeruginosa strain P48-24s strain produced by the regeneration and sorting of the strain from the mushroom tissue section of the new strain Pseudomonas aeruginosa P48-24s (Accession No .: KCCM11288P) or the strain developed therefrom.
Pseudomonas aeruginosa strain P48-24s (Accession No .: KCCM11288P) or a strain of the P48-24s strain produced by the selection of mushroom-bearing basidiospores of the strain developed therefrom.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020130155462A KR101544927B1 (en) | 2013-12-13 | 2013-12-13 | Novel Pleurotus eryngii var. ferulae Strain P48-24s and its descendants |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020130155462A KR101544927B1 (en) | 2013-12-13 | 2013-12-13 | Novel Pleurotus eryngii var. ferulae Strain P48-24s and its descendants |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20150069248A true KR20150069248A (en) | 2015-06-23 |
KR101544927B1 KR101544927B1 (en) | 2015-08-17 |
Family
ID=53516419
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020130155462A KR101544927B1 (en) | 2013-12-13 | 2013-12-13 | Novel Pleurotus eryngii var. ferulae Strain P48-24s and its descendants |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101544927B1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20180057342A (en) * | 2016-11-22 | 2018-05-30 | 권철우 | Novel Pleurotus eryngii var. ferulae Strains D4 and fruit body of the same |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102074058B1 (en) * | 2018-02-21 | 2020-03-02 | 경상북도 | A novel hybridized mushroomstrain GBN2WP0970 and fruit body of the same with high inhibition rate of neutral fat absorption |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100954964B1 (en) | 2009-11-24 | 2010-04-23 | 농업회사법인주식회사 뜰아채 | A novel pleurotus eryngii var. ferulae strain ddl01 and method of producing it |
-
2013
- 2013-12-13 KR KR1020130155462A patent/KR101544927B1/en active IP Right Grant
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20180057342A (en) * | 2016-11-22 | 2018-05-30 | 권철우 | Novel Pleurotus eryngii var. ferulae Strains D4 and fruit body of the same |
Also Published As
Publication number | Publication date |
---|---|
KR101544927B1 (en) | 2015-08-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101035898B1 (en) | Novel lentinula edodes (berk.) pegler gna01 | |
KR101433040B1 (en) | Novel Pleurotus eryngii var. ferulae Strain | |
JP2007053928A (en) | New fungal strain and method for culturing new fruit body | |
KR101485491B1 (en) | A novel Pleurotus eryngii var. ferulae strain DDL01 and method of producing it | |
JP5124670B2 (en) | Mushroom artificial cultivation method | |
EA035884B1 (en) | New hybrid agaricus bisporus mushroom strains | |
KR101544927B1 (en) | Novel Pleurotus eryngii var. ferulae Strain P48-24s and its descendants | |
CN1194089A (en) | High temperature resistant mushroom and its breeding and cultivating method | |
CN109661972B (en) | Breeding method of high-temperature-resistant shiitake mushrooms | |
KR101485485B1 (en) | Novel Pleurotus eryngii var. ferulae Strains and fruit body of the same | |
KR20090081226A (en) | Method for making of nutrient broth for cultivating Oyster mushrooms and nutrient broth for cultivating Oyster mushrooms made thereby | |
KR101455702B1 (en) | Novel Pleurotus eryngii var. ferulae Strain P49AB64 | |
CN114250151A (en) | Cross breeding method of tricholoma lobayense heim | |
KR100403411B1 (en) | The novel pleurotus ferulae-k9 and the culture method for thereof | |
KR20220069342A (en) | Lentinula edodes BL48(KACC93342P) strain with short cultivation period adapted to bottle cultivation | |
KR101485487B1 (en) | Novel Pleurotus eryngii var. ferulae MMW7622 and fruit body of the same | |
JPH0466033A (en) | Method for cultivating new white mushroom | |
KR102323518B1 (en) | Novel Pleurotus eryngii var. ferulae Strains 151 and fruit body of the same | |
CN114365658B (en) | Lentinus edodes fruiting body model cultivation method | |
KR101439973B1 (en) | Novel Pleurotus eryngii var. ferulae Strains and fruit body having white pileus of the same | |
KR101517678B1 (en) | 3215KCCM11435P Novel Pleurotus eyrngii 3215KCCM11435P strain adapted to high temperature | |
JP4063707B2 (en) | Mushroom artificial cultivation method | |
KR920009501B1 (en) | New mushroom pleurotus sp. | |
KR20240109915A (en) | Novel strain pleurotus sp. P21287 obtained by interspecies hybridization and its cultivation method | |
KR0169292B1 (en) | Strain of pleurotus s.p p1542 cultured by protoplast fusion and a method of production of mushroom using such a strain |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20180809 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20190812 Year of fee payment: 5 |