KR20150055945A - Genetic marker for prediction of meat quality grade in Hanwoo - Google Patents

Abstract

The present invention relates to a genetic marker, a kit, and a microarray for predicting meat quality grade of Korean beef, and to a method for predicting meat quality grade of Korean beef using the same, and more specifically, to a method for predicting meat quality grade of Korean beef by measuring an expression amount of intramuscular fat specific fibronectin 1 (FN1) gene, integrin, alpha 7 (ITGA7) gene, integrin, alpha 5 (ITGA5) gene, and Lysyl oxidase (LOX) gene correlated to meat quality grade of Korean beef. According to the present invention, meat quality grade of Korean beef can be predicted and distinguished in advance, and can control fat content of Korean beef entities produced through the genetic marker to detect an expression amount of intramuscular fat specific gene of Korean beef by using the genetic marker, the kit, and the microarray for predicting meat quality grade of Korean beef, and the method for predicting meat quality grade of Korean beef using the same.

Description

Genetic marker for prediction of meat quality grade in Hanwoo {Hanwoo}

The present invention relates to a genetic marker, a kit, a microarray for predicting meat quality of a Korean beef cattle, and a method for predicting a meat quality grade of Hanwoo using the same. More particularly, the present invention relates to a method for predicting a meat quality grade of Korean beef cattle, ) Gene, Integrin, alpha 7 (ITGA7) gene, Integrin, alpha 5 (ITGA5) gene and Lysyl oxidase (LOX) gene.

In general, conventional quantitative genetic methods for improving breeding of livestock are based on the phenotypic record of livestock. In other words, the candidates were selected for their records such as bloodline records and body development, and the next black cattle produced by mating with the birds were reared and slaughtered to record growth and carcass traits. In order to estimate the genetic breeding value of livestock, the most suitable statistical model formula is selected and the vertical axis is selected. Since it takes a long time to measure these phenotypic observations, the selection of the vertical axis is delayed, Since many of the candidates are raised, economic costs such as feed costs, facility investment and maintenance costs, labor costs, and labor costs are more than necessary.

On the other hand, dominance of livestock phenotypes is also governed by the environment, but in any population raised in the same environment there are individual differences between phenotypic traits. This is due to the difference in genetic level of the individual, and the rapid development of genetic engineering, molecular biology, and related science and technology to understand genetic information related to the economic traits of livestock expressive traits and to shorten generation intervals by early selection , Selection intensity, accuracy of selection, and so on, to develop genetic markers capable of increasing the amount of genetic modification per year.

A number of patent documents are referenced and cited throughout the present invention. The disclosures of the cited patent documents are hereby incorporated by reference into the present invention in its entirety to better illustrate the state of the art to which the present invention pertains and the content of the present invention.

Korean Patent Publication No. 2009-0087216

It is an object of the present invention to provide a genetic marker, a kit, a microarray for predicting the meat quality grade of Korean beef cattle, and a method for predicting the meat quality grade of Korean beef cattle using the same.

In order to solve the above technical problem,

According to an aspect of the present invention, there is provided a primer set comprising: a forward and reverse primer set represented by SEQ ID NOS: 1 and 2; A forward and reverse primer set represented by SEQ ID NOS: 3 and 4; A forward and reverse primer set represented by SEQ ID NOS: 5 and 6; And a set of forward and reverse primers represented by SEQ ID NOS: 7 and 8, can be provided.

In one embodiment, the forward and reverse primer sets set forth in SEQ ID NOS: 1 and 2 are specifically hybridized to the Fibronectin 1 (FN1) gene, and the forward and reverse primer sets set forth in SEQ ID NOS: 3 and 4, Integrin and alpha 7 (ITGA7) genes, and the forward and reverse primer sets represented by SEQ ID NOS: 5 and 6 specifically hybridize to Integrin, alpha 5 (ITGA5) gene, The forward and reverse primer sets, designated 7 and 8, can specifically hybridize to the Lysyl oxidase (LOX) gene.

According to another aspect of the present invention, a kit for predicting a meat quality grade of a Hanwoo containing the genetic marker can be provided.

According to another aspect of the present invention, there can be provided a microarray for predicting a meat quality grade of Hanwoo including the genetic marker.

According to another aspect of the present invention, there is provided a method for preparing a recombinant vector comprising the steps of: extracting total RNA from adipose tissue of cow's milk and synthesizing cDNA using reverse transcriptase; Performing amplification by Realtime-PCR using the cDNA as a template and using the gene marker according to claim 1 or 2; And measuring the expression level of Fibronectin 1 (FN1) gene, Integrin, alpha 7 (ITGA7) gene, Integrin, alpha 5 (ITGA5) gene and Lysyl oxidase (LOX) gene through the amplification reaction. A method of predicting a meat quality grade of Hanwoo including a meat quality grade predicting method can be provided.

It is possible to early predict and discriminate the meat quality of Korean beef cattle using genetic markers, kits, microarrays for predicting meat quality grade of Korean beef cattle according to the present invention and meat quality grade prediction method using the same, It is possible to control the fat content of Hanwoo, which is produced through a genetic marker for detecting the expression level of the gene specific to the Hanwoo.

Certain terms are hereby defined for convenience in order to facilitate a better understanding of the present invention. Unless otherwise defined herein, scientific and technical terms used in the present invention shall have the meanings commonly understood by one of ordinary skill in the art. Also, unless the context clearly indicates otherwise, the singular form of the term also includes plural forms thereof, and plural forms of the term should be understood as including its singular form.

According to an aspect of the present invention, there is provided a primer set comprising: a forward and reverse primer set represented by SEQ ID NOS: 1 and 2; A forward and reverse primer set represented by SEQ ID NOS: 3 and 4; A forward and reverse primer set represented by SEQ ID NOS: 5 and 6; And a set of forward and reverse primers represented by SEQ ID NOS: 7 and 8, can be provided.

As used herein, the term "primer " refers to a single stranded oligonucleotide sequence complementary to a carboxy nucleic acid strand and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

In one embodiment, the oligonucleotides used as primers may also comprise a nucleotide analogue, such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid Or an intercalating agent.

In one embodiment, the forward and reverse primer sets set forth in SEQ ID NOS: 1 and 2 are specifically hybridized to the Fibronectin 1 (FN1) gene, and the forward and reverse primer sets set forth in SEQ ID NOS: 3 and 4, Integrin and alpha 7 (ITGA7) genes, and the forward and reverse primer sets represented by SEQ ID NOS: 5 and 6 specifically hybridize to Integrin, alpha 5 (ITGA5) gene, The forward and reverse primer sets, designated 7 and 8, can specifically hybridize to the Lysyl oxidase (LOX) gene.

According to another aspect of the present invention, a kit for predicting a meat quality grade of a Hanwoo containing the genetic marker can be provided.

In one embodiment, the genetic marker comprises the forward and reverse primer sets set forth in SEQ ID NOS: 1 and 2; A forward and reverse primer set represented by SEQ ID NOS: 3 and 4; A forward and reverse primer set represented by SEQ ID NOS: 5 and 6; And a set of forward and reverse primers represented by SEQ ID NOS: 7 and 8, and the kit may include a reagent for performing an amplification reaction.

In one embodiment, the reagent for performing the amplification reaction may include a DNA polymerase, dNTPs, and a buffer, and may further include a user's manual describing optimal reaction conditions.

According to another aspect of the present invention, there can be provided a microarray for predicting a meat quality grade of Hanwoo including the genetic marker.

The term "microarray" used in the present invention means a group of polynucleotides immobilized on a substrate at a high density, and the polynucleotide group means a microarray immobilized in a constant region. Such microarrays are well known in the art to which the present invention pertains. The microarrays are described, for example, in U.S. Patent Nos. 5,445,934 and 5,744,305, the contents of which are incorporated herein by reference.

The term "substrate" as used herein refers to any substrate to which a gene probe can be attached under conditions such that it retains hybridization properties and the background level of hybridization remains low. Typically, the substrate can be a microtiter plate, a film (e.g., nylon or nitrocellulose) or a microsphere (bead) or chip. Before application or fixation to the membrane, the nucleic acid probe may be modified to promote immobilization or improve hybridization efficiency. Such modifications may include homopolymer tailings, coupling with aliphatic groups, different reactive functional groups such as NH2, SH and carboxyl groups, or coupling with biotin, haptens or proteins.

According to another aspect of the present invention, there is provided a method for preparing a recombinant vector comprising the steps of: extracting total RNA from adipose tissue of cow's milk and synthesizing cDNA using reverse transcriptase; Performing amplification by Realtime-PCR using the cDNA as a template and using the gene marker according to claim 1 or 2; And measuring the expression level of Fibronectin 1 (FN1) gene, Integrin, alpha 7 (ITGA7) gene, Integrin, alpha 5 (ITGA5) gene and Lysyl oxidase (LOX) gene through the amplification reaction. A method of predicting a meat quality grade of Hanwoo including a meat quality grade predicting method can be provided.

In one embodiment, the method for extracting total RNA from the adipose tissue in the cow's tummy may be performed by a method known in the art, for example, a CTAB method, (Promega) may be used. The cDNA can be synthesized from the extracted total RNA, and the target sequence can be amplified by performing amplification reaction using the cDNA as a template and using one or more oligonucleotide primer sets according to one embodiment of the present invention. Methods for amplifying a target sequence include polymerase chain reaction (PCR) (including real time PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription- based amplification system, a strand displacement amplification or amplification through a Q [beta] replicase, or any other suitable method for amplifying a nucleic acid molecule known in the art to which this invention belongs. The PCR is a method of amplifying a gene including a target sequence from a pair of primers that specifically bind to a target sequence using a polymerase. Such a PCR method is well known in the art to which the present invention belongs, and a commercially available kit may be used.

In one embodiment, the amplified target sequence may be labeled with a detectable labeling substance. For example, the labeling substance may be a fluorescent, phosphorescent or radioactive substance, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. The set of one or more oligonucleotide primers used to amplify the target sequence is as described above.

In one embodiment, the present invention may further comprise detecting the amplification product. The detection of the amplification product can be performed by DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

Example

Disclosure material

26 Hanwoo (steers, hydrogen and cows)

(1) classified into groups with high intramuscular fatness (7.00 ± 0.94), middle group (4.00 ± 0.58) and low group (1.00 ± 0.00);

(2) classified as a group with high meat quality (40.00 ± 0.00), a middle group (28.57 ± 3.78) and a low group (10.00 ± 0.00);

(3) classified into groups with high meat quality (300 ± 0.00), intermediate (200 ± 0.00) and low (100 ± 0.00) groups;

Hanwoo lentil samples can be referenced from the slaughter age and trait characteristics of the samples used in the analysis of Tables 1, 2 and 3 below. In the following Tables 1, 2 and 3, the higher the values of the intramuscular fatness, the meat quality grade and the meat fatness, the better the meat quality.

Group ¹ individual age
(month) Intramuscular fat map Group ¹ individual age
(month) Intramuscular fat map Group ¹ individual age
(month) Intramuscular fat map
Muscle fat is high


29249 30 9 Midline lipid middle 28257 32 5 Low intramuscular fat 28291 31 One 29241 30 8 28043 32 4 28298 31 One 28049 32 7 29020 30 4 28300 31 One 28258 32 7 28046 32 4 27258 32 One 28261 32 7 29024 30 4 29242 30 One 28271 32 7 29019 30 4 29240 30 One 29234 30 7 29232 31 3 29236 30 One 28256 32 6 28259 33 One 28260 32 6 29247 30 One 28057 32 6

¹ Intramuscular level: High (high quality meat) = 6 ~ 9; Middle (intermediate grade) = 3 to 5; Low (low grade) = 1 to 2.

Group ¹ individual age
(month) Meat grade Group ¹ individual age
(month) Meat grade Group ¹ individual age
(month) Meat grade
Flesh grade high


29249 30 40 Meat quality grade medium 28257 32 30 Flesh grade low 28291 31 10 29241 30 40 28043 32 30 28298 31 10 28049 32 40 29020 30 30 28300 31 10 28258 32 40 28046 32 30 27258 32 10 28261 32 40 29024 30 30 29242 30 10 28271 32 40 29019 30 30 29240 30 10 29234 30 40 29232 31 20 29236 30 10 28256 32 40 28259 33 10 28260 32 40 29247 30 10 28057 32 40

¹ meat grade: 1 ++ or 1+ = 40; 1 = 30; 2 = 20; 3 = 10.

Group ¹ individual age
(month) Weight rating Group ¹ individual age
(month) Weight rating Group ¹ individual age
(month) Weight rating
High meat grade


28291 31 300 Medium grade 28049 32 200 Low grade 29249 30 100 28298 31 300 28258 32 200 29241 30 100 28300 31 300 28261 32 200 29234 30 100 27258 32 300 28271 32 200 28057 32 100 29242 30 300 28256 32 200 28257 32 100 29240 30 300 28260 32 200 28046 32 100 29236 30 300 28043 32 200 29024 30 100 29020 30 200 29019 30 100 28259 33 200 29232 31 100 29247 30 200

¹ Heavy grade: A = 300; B = 200; C = 100.

Analysis of gene expression network

(1) Animal QTL database ( http://www.genome.iastate.edu/cgi-bin/QTLdb/BT/index) was used to search candidate genes related to intramuscular level, meat quality grade, and meat grade, Genes that are likely to be associated with traits were extracted. We downloaded the microarray information of the bovine using NCBI's GEO (Gene Expression Omnibus) database. All arrays were standardized for the expression values using the RMA (Robust Multiarray Average) technique provided in statistical package 'R'. The expression values of the extracted genes were converted to log 2 for further analysis.

(2) The expression values of the selected genes are determined by the Pearson's correlation coefficient ( r ) for each gene to construct a co-expression network, and the soft thresholding And the power adjacency function were used to calculate the intensity of the link between genes. In addition, since the gene network follows the P (k) ~ k ^-r distribution, which is a power-law function, the exponent value is selected so that the expression value of the gene meets the power law. In a gene network, each of the genes is called a node, and the degree of connectivity between the nodes is known through the edges.

(3) A pairwise correlation was calculated for the gene and a centrality analysis was performed to examine the network topology for each gene. The node degree is a value that can measure how much each node is located in the network by calculating the degree of connection between one node constituting the network and other nodes directly connected thereto. Also, the betweeness centrality (BC) value was calculated. BC measures the centrality to a specific node mediation connecting one node and the other node constituting the network. The betweenness centrality of a particular node is calculated by the ratio of the number of shortest paths of all the pairs of all nodes except the specific node to the number of nodes having the shortest actual distance.

Analysis method of gene expression using Realtime PCR method

Total RNA (2 ug) in tissues is extracted using Trizol Reagent (Molecular Research Center). Quantitate at 260 nm absorbance and electrophoresis using 1% agarose gel. The 28S and 18S bands are stained with ethidium bromide (EtBr). The extracted total RNA is synthesized using iScript cDNA synthesis kit (Bio-Rad, Hercules, Calif.). Real time PCR is performed using QuantiTect SYBR green RT-PCR Master mix (Qiagen, Valencia, CA) and Opticon sequence detection system (MJ research, USA). A brief experimental method is presented below. 10 μl of cDNA (300 ng) was mixed with 10 μl of SYBR Green RT-PCR Master Mix and 10 μl 1.25 μl of each primer is added and mixed. Repeat for 15 seconds at 94C, 30 seconds at 62C, and 30 seconds at 72C to run a total of 40 cycles. All primer designs use sequences registered in the National Center for Biotechnology Information (NCBI). The relative expression levels were compared using the Ct method and noramlization was performed using ribosomal protein S9 (RPS9) as a housekeeping gene.

Table 4 below shows the Fibronectin 1 (FN1) gene, Integrin, alpha 7 (ITGA7) gene, Integrin, alpha 5 (ITGA5) gene and Lysyl oxidase (LOX) gene that exhibit specific or significant expression differences in adipose tissue ) Nucleotide sequences of primers designed to analyze the expression levels of genes.

gene direction order FN1 tablet tccattgaactgaccaacctc station acgctgactaaatactcggtg ITGA7 tablet gcagaaggagagtaaggagaac station gtgcacaggtaacaatcttgc ITGA5 tablet ataaactctccccgattcacatc station gatctgagccttgtcctctatg LOX tablet ctgaacatcgtccctatgcag station agctatttggtgcctgagtc

The results of Realtime-PCR using the primer set were statistically processed by the GLM method of SAS program, and the correlation between the gene expression and the meat quality grade of Hanwoo was processed through the CORR method.

(FN1) gene, Integrin, alpha 7 (ITGA7) gene, Integrin, alpha 5 (ITGA5) gene and Lysyl oxidase (LOX) gene obtained through the above statistical method and the degree of meat quality of Korean beef The correlation is shown in Table 5 below.

gene Hanwoo meat quality grade FN1 0.64 *** ITGA7 -0.70 *** ITGA5 -0.62 *** LOX 0.66 ***

Correlation coefficient (P) *, P &lt;0.05; **, P &lt;0.01; ***, P < 0.001, N = 26

The level of gene expression related to the extracellular matrix (ECM) was analyzed and compared in the intramuscular adipose tissue of Hanwoo steer, hydrogen and cow. MRNA expression level and flesh quality of ECM - related genes were investigated in adipose tissue of 26 Hanwoo radish. We also analyzed the correlation between meat quality grade and mRNA expression. The increase in the number and quantity of cells in adipose tissue is indicated by a balance between fat deposition and elimination. Expression of 30 genes involved in ECM showed a correlation with mRNA. Especially, fibronectin 1 (FN1; r = 0.64, P <0.001) and lysyl oxidase (LOX; r = 0.66; P <0.001) were highly correlated. Conversely, the genes for integrin, alpha 7 (ITGA7; r = -0.70, P <0.001) and 5 (ITGA5; r = -0.62, P <0.001) showed strong negative correlation.

Therefore, according to the above results, the genetic markers according to the present invention can be obtained from the expression amounts of Fibronectin 1 (FN1) gene, Integrin, alpha 7 (ITGA7) gene, Integrin, alpha 5 (ITGA5) gene and Lysyl oxidase (LOX) Can be used as a genetic marker capable of predicting the meat quality of an individual.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit of the invention as set forth in the appended claims. The present invention can be variously modified and changed by those skilled in the art, and it is also within the scope of the present invention.

                         SEQUENCE LISTING <110> RURAL DEVELOPMENT ADMINISTRATION   <120> Genetic marker for prediction of meat quality grade in Hanwoo <130> NPF-24989 <160> 8 <170> PatentIn version 3.2 <210> 1 <211> 21 <212> DNA <213> Artificial <220> <223> forward primer for Fibronectin 1 <400> 1 tccattgaac tgaccaacct c 21 <210> 2 <211> 21 <212> DNA <213> Artificial <220> <223> reverse primer for Fibronectin 1 <400> 2 acgctgacta aatactcggt g 21 <210> 3 <211> 22 <212> DNA <213> Artificial <220> <223> forward primer for Integrin, alpha 7 <400> 3 gcagaaggag agtaaggaga ac 22 <210> 4 <211> 21 <212> DNA <213> Artificial <220> <223> reverse primer for Integrin, alpha 7 <400> 4 gtgcacaggt aacaatcttg c 21 <210> 5 <211> 23 <212> DNA <213> Artificial <220> <223> forward primer for Integrin, alpha 5 <400> 5 ataaactctc cccgattcac atc 23 <210> 6 <211> 22 <212> DNA <213> Artificial <220> <223> reverse primer for Integrin, alpha 5 <400> 6 gatctgagcc ttgtcctcta tg 22 <210> 7 <211> 21 <212> DNA <213> Artificial <220> <223> forward primer for Lysyl oxidase <400> 7 ctgaacatcg tccctatgca g 21 <210> 8 <211> 20 <212> DNA <213> Artificial <220> <223> Reverse primer for Lysyl oxidase <400> 8 agctatttgg tgcctgagtc 20

Claims (5)

A forward and reverse primer set represented by SEQ ID NOS: 1 and 2;
A forward and reverse primer set represented by SEQ ID NOS: 3 and 4;
A forward and reverse primer set represented by SEQ ID NOS: 5 and 6; And
A genetic marker for predicting the meat quality grade of Hanwoo including the forward and reverse primer sets represented by SEQ ID NOS: 7 and 8;
The method according to claim 1,
The forward and reverse primer sets represented by SEQ ID NOS: 1 and 2 specifically hybridize to the Fibronectin 1 (FN1) gene,
The forward and reverse primer sets shown in SEQ ID NOS: 3 and 4 specifically hybridize to Integrin, alpha 7 (ITGA7) gene,
The forward and reverse primer sets shown in SEQ ID NOS: 5 and 6 specifically hybridize to Integrin, alpha 5 (ITGA5) gene,
Wherein the forward and reverse primer sets represented by SEQ ID NOS: 7 and 8 are specifically hybridized to the Lysyl oxidase (LOX) gene.
A kit for predicting a meat quality grade of Korean beef cattle, comprising a genetic marker according to claim 1 or 2.
A microarray for predicting meat quality grade of Korean beef cattle comprising a genetic marker according to claim 1 or 2.
Extracting total RNA from adipose tissue of Hanwoo radish and synthesizing cDNA using reverse transcriptase;
Performing amplification by Realtime-PCR using the cDNA as a template and using the gene marker according to claim 1 or 2; And
Measuring the expression level of Fibronectin 1 (FN1) gene, Integrin, alpha 7 (ITGA7) gene, Integrin, alpha 5 (ITGA5) gene and Lysyl oxidase (LOX) gene through the amplification reaction, How to grade.