KR20150048651A - Markers for predicting survival and the response to anti-cancer drug - Google Patents

Abstract

The present invention relates to a marker for predicting survival and a reactivity to an anti-cancer drug treatment of a lung cancer patient by using gene polymorphism, and to a usage thereof. More specifically, the present invention relates to a method for predicting survival of a lung cancer patient by identifying base of specific single nucleotide polymorphism (SNP) having a significant association with a prediction of survival and a reactivity of a lung cancer patient with respect to an anti-cancer drug, to a composition for predicting survival and a reactivity with respect to an anti-cancer drug of a lung cancer patient, wherein the composition comprises polynucleotide capable of identifying the SNP, polypeptide, or cDNA thereof, and to a microarray and kit including the composition.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for predicting the response of an anticancer drug to an anticancer drug,

The present invention relates to a marker for predicting the response and survival prognosis of cancer patients in lung cancer patients using gene polymorphisms and their use. More particularly, the present invention relates to a method for predicting the survival prognosis of lung cancer by identifying a single nucleotide polymorphism (SNP) base having a significant correlation with the response to anticancer drugs and prediction of survival prognosis in lung cancer patients, A composition for predicting the reactivity and survival prognosis of a lung cancer patient comprising a polynucleotide, a polypeptide or a cDNA thereof capable of confirming the SNP, and a microarray and a kit comprising the same.

Lung cancer is one of the leading causes of cancer-related deaths worldwide. In particular, non-small cell lung cancer (NSCLC) accounts for approximately 85% of lung cancers, and despite the development of NSCLC diagnosis and treatment for decades, the 5-year survival rate It is only about 16%.

Generally, in the early stage of lung cancer, a cure through extensive resection is aimed at the treatment, but in advanced cases, it is treated by chemotherapy. Although the combination of platinum-based anticancer drugs such as paclitaxel and cisplatin is most commonly used for patients with end stage non-small cell lung cancer, the effect of treatment is not so great and the prognosis is poor. In addition, among patients with similar clinical characteristics, response to chemotherapy varies widely, and even patients in the same stage have significant differences in patient survival. Therefore, numerous studies have been conducted to find molecular biomarkers that better predict the patient's clinical outcome and select patients that are effective in specific therapies.

Cancer arising from the accumulation of genetic or epidemiological changes is known to acquire the following six capabilities during development: (1) self-sufficiency in growth signals, (2) Insensitivity to anti-growth signals, (3) Evading Apoptosis, (4) Limitless Replicative Potential, (5) Sustained Angiogenesis, and (6) Tissue Invasion and Metastasis.

Therefore, polymorphism studies of candidate genes that can play an important role in cancers with these characteristics are concentrated. Several genetic association studies have reported that some single nucleotide polymorphisms can act as risk factors for tumor formation and various cancers, including lung cancer, by regulating gene function, such as gene expression or enzyme activity. Using the susceptibility genetic mutations associated with these diseases as markers of drug efficacy for cancer patients, it would be possible to customize the treatment of cancer patients by evaluating the prognosis, do. Therefore, intensive studies to identify the molecular markers that can predict the drug treatment effects of cancer patients have been carried out domestically and internationally, but no studies have been made yet.

Based on this background, the present inventors noted that the polymorphisms of the genes involved in the carcinogenesis may have an effect on the drug treatment effect of the cancer patients, suggesting that the potential functional polymorphisms of the cancer-related genes are related to the drug treatment effects of lung cancer patients As a result, a biomarker capable of predicting response to chemotherapy and survival was found, and the present invention was completed.

Korean Patent Laid-Open No. 10-2010-0136724

One object of the present invention is to identify the specific SNP bases that have a significant correlation with the anticancer drug response and survival outcome prediction for gene samples collected from patients with lung cancer to determine the reactivity and survival And to provide a method for predicting prognosis.

It is another object of the present invention to provide a composition for predicting the reactivity and survival prognosis of cancer patients in a lung cancer patient, comprising a polynucleotide, a polypeptide or a cDNA thereof capable of identifying a specific SNP marker.

It is another object of the present invention to provide a microarray for predicting the reactivity and survival prognosis of cancer patients in a lung cancer patient, comprising a polynucleotide, a polypeptide or a cDNA thereof capable of identifying a specific SNP marker.

Another object of the present invention is to provide a kit for predicting the reactivity and survival prognosis of cancer patients in a lung cancer patient, which comprises a polynucleotide, a polypeptide or a cDNA thereof capable of identifying a specific SNP marker.

In one embodiment, the present invention relates to a method for screening a gene sample obtained from a patient, comprising: (a) a polymorphism (NCBI refSNP ID: rs7990383) of the 27th base of the sequence represented by SEQ ID NO: 1 in the COL4A2 gene; (NCBI refSNP ID: rs7259651) of the 27th base of the sequence and the 27th base of the nucleotide sequence of SEQ ID NO: 3 in the SNRPB2 gene (NCBI refSNP ID: rs3761298). A method for predicting the response to an anticancer agent and the survival prognosis of a lung cancer patient.

These sequences are shown in Table 1 below. The refSNP ID of NCBI for each SNP in Table 1 indicates the sequence of the SNP and its position. Those skilled in the art can easily identify the position and sequence of the SNP using the above numbers. It will be apparent to those skilled in the art that the specific sequence corresponding to the refSNP ID of the SNPs registered in the NCBI may be varied slightly depending on the results of the study of the succeeding genes and such altered sequences are also included within the scope of the present invention.

gene NCBI refSNP ID order SEQ ID NO: COL4A2 rs7990383 CGGGGAGCCGGGGAGGAAAGGGGACA [A / G] AGGAGACCCCGGCCAACACGGCCTC One KLK10 rs7259651 ACGTCCCCAGCAAGGCTAGGGGTGGC [A / G] GGATGAGAGGCCACTGAGCAAGAGG 2 SNRPB2 rs3761298 GGGAATTTTTATTTTTTAAAAACACC [C / T] AAAGTTGCAACAACTTGAAAATAAT 3

In the present invention, the three genotypes are regarded as poor genotypes because rs7990383 AA, rs7259651 AG or GG, and the rs3761298 TT genotype are associated with poor survival outcomes for anticancer agents. Therefore, when one or more, preferably two or more, more preferably three or more of the three genotypes are detected in a patient sample, the reactivity to the anticancer agent is low and the survival prognosis is low.

In the present invention, comprehensive panel and individual effects of gene polymorphism affecting patient response and survival after paclitaxel and cisplatin chemotherapy in non-small cell lung cancer were analyzed.

First, the DNA was isolated from the patient's blood and then analyzed by polymorphism analysis of rs7990383G> A (COL4A2 gene), rs7259651A> G (KLK10 gene) and rs3761298C> T (SNRPB2 gene) We evaluated the survival rate after treatment with paclitaxel and cisplatin chemotherapy.

As a result, it was confirmed that the survival rate of paclitaxel and cisplatin after chemotherapy was significantly lowered when rs7990383G> A AA genotype, rs7259651A> G AG and GG genotypes, and rs3761298C> T TT genotype. Based on this study, two different cohorts were used to improve the reliability.

Therefore, the SNP identified in the present invention can be applied as a biomarker having histologic specificity for predicting the response and survival rate of chemotherapy. The anticancer drug response and survival prognosis prediction through the polymorphism analysis of the present invention can be easily determined by only a small amount of patient blood.

In particular, the SNP of the present invention can be used as a biomarker for anticancer chemotherapy reaction and survival in patients with non-small cell lung cancer treated first with paclitaxel-cisplatin chemotherapy. Thus, the analysis of the SNPs of the present invention will be helpful in screening small groups that are effective in paclitaxel-cisplatin chemotherapy and may also be useful in determining treatment regimens for patients with end stage non-small cell lung cancer.

In the present invention, the patient refers to a patient suffering from lung cancer. The lung cancer is preferably non-small cell lung cancer and can be adenocarcinoma or squamous cell carcinoma. A gene sample is obtained from tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine obtained from these lung cancer patients. The gene sample includes cDNA synthesized from DNA, mRNA or mRNA.

The term "prognosis" in the present invention refers to the progression and cure of a disease, such as an onset, recurrence, metastatic spread, and the likelihood of lung cancer-induced death or progression, including drug resistance, . For the purpose of the present invention, the prognosis refers to the reactivity of lung cancer to an anticancer agent and the survival prognosis thereof, and preferably means the prognosis of patients with non-small cell lung cancer treated first with paclitaxel-cisplatin chemotherapy. In general, lung cancer is treated with chemotherapy, and platinum-based chemotherapy such as paclitaxel and cisplatin is most commonly used for patients with end stage non-small cell cancer. However, similar clinical characteristics or similar Among patients with stage, the response to chemotherapy varies and there is a significant difference in survival. Using the method of the present invention, the responsiveness to chemotherapy can be easily predicted, the survival prognosis can be easily determined, and it is possible to easily determine whether or not to use additional treatment methods. This can significantly increase the survival rate after the onset of lung cancer.

The term "prediction" in the present invention means that the patient preferentially or non-preferentially responds to treatment, such as chemotherapy, to treat the patient, for example, by surgery of a particular therapeutic agent and / or primary tumor, and / Relate to the likelihood and / or likelihood of survival after treatment with chemotherapy for a particular period of time without recurrence. The predictive method of the present invention can be used clinically to make treatment decisions by selecting the most appropriate treatment regimen for patients with lung cancer. The predictive method of the present invention may also be used to confirm that a patient is preferentially responsive to treatment regimens, such as, for example, a prescribed treatment or combination, surgical intervention, chemotherapy, etc., Can be predicted as to whether or not long-term survival of the subject is possible.

The present invention also provides a composition for predicting the reactivity and survival prognosis of an anticancer agent in lung cancer patients in a patient.

(NCBI refSNP ID: rs7990383) of the nucleotide sequence of SEQ ID NO: 1 in the COL4A2 gene, the 27th nucleotide of the nucleotide sequence of SEQ ID NO: 2 in the KLK10 gene (NCBI refSNP ID: rs7259651) of the SNRPB2 gene, and a polymorphism (NCBI refSNP ID: rs3761298) of the 27th base of the sequence represented by SEQ ID NO: 3 in the SNRPB2 gene And a reagent for carrying out the present invention.

The reagents contained in the composition of the present invention are preferably one or more polynucleotides selected from the following polynucleotides:

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 1 in the COL4A2 gene or a complementary polynucleotide thereof;

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 2 in the KLK10 gene or a complementary polynucleotide thereof; And

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 3 in the SNRPB2 gene, or a complementary polynucleotide thereof.

Accordingly, the present invention provides the above polynucleotide as an embodiment.

The polynucleotide or its complementary polynucleotide according to the present invention is composed of at least 10, preferably 10 to 100, more preferably 20 to 60, even more preferably 40 to 60 contiguous bases.

The polynucleotide or its complementary polynucleotide according to the present invention is a polymorphic sequence. A polymorphic sequence refers to a sequence comprising a polymorphic site representing a single base polymorphism in a nucleotide sequence. A polymorphic site is a site in a polymorphic sequence where a single base polymorphism occurs. In the present invention, the polynucleotide may be DNA or RNA.

The reagent contained in the composition of the present invention is preferably one or more polynucleotides selected from polynucleotides that specifically hybridize with the following polynucleotides:

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 1 in the COL4A2 gene or a complementary polynucleotide thereof;

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 2 in the KLK10 gene or a complementary polynucleotide thereof; And

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 3 in the SNRPB2 gene, or a complementary polynucleotide thereof.

Accordingly, the present invention provides, as an aspect, a polynucleotide that specifically hybridizes with the polynucleotide or a complementary polynucleotide thereof.

In the present invention, a polynucleotide that specifically hybridizes with the polynucleotide or a complementary polynucleotide thereof is an allele-specific polynucleotide.

Allele-specific polynucleotides are meant to specifically hybridize to each allele. That is, hybridization refers to hybridization so that the base of the polymorphic site present in the polymorphic sequence can be specifically discriminated. Here, hybridization is usually carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher. For example, conditions of 5XSSPE (750 mM NaCl, 50 mM NaPhosphate, 5 mM EDTA, pH 7.4) and 25-30 [deg.] C may be suitable for allele-specific probe hybridization.

In the present invention, the allele-specific polynucleotide may be an allele-specific probe. That is, in the present invention, a probe means a hybridization probe, and means an oligonucleotide capable of binding sequence-specifically to a complementary strand of a nucleic acid. The allele-specific probe of the present invention has a polymorphic site among nucleic acid fragments derived from two individuals of the same species, and hybridizes to a DNA fragment derived from one individual, but not to a fragment derived from another individual. In this case, the hybridization conditions show a significant difference in the hybridization intensity between the alleles, and should be sufficiently strict so that only one of the alleles hybridizes. Preferably, the probe of the present invention aligns with the polymorphic site of the polymorphic sequence. This can lead to good hybridization differences between different allelic forms. The probe of the present invention can be used for a diagnostic kit such as a microarray for predicting the reactivity and survival prognosis of an anticancer agent in lung cancer patients by detecting alleles and the like.

In the present invention, the allele-specific polynucleotide may be an allele-specific primer. The appropriate length of the primer may vary depending on the purpose of use, but is generally comprised of 15 to 30 bases. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template. The primer hybridizes to a DNA sequence containing a polymorphic site to amplify a DNA fragment containing the polymorphic site. The primer of the present invention can be used for a diagnostic kit such as a microarray for predicting the reactivity and survival prognosis of cancer patients with lung cancer by detecting alleles and the like.

The reagent contained in the composition of the present invention is preferably a polypeptide encoded by one or more polynucleotides selected from the following polynucleotides:

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 1 in the COL4A2 gene or a complementary polynucleotide thereof;

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 2 (or a complementary polynucleotide thereof) in the KLK10 gene, and

A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 3 in the SNRPB2 gene, or a complementary polynucleotide thereof.

Accordingly, the present invention provides, as an embodiment, a polypeptide encoding the polynucleotide. Such a polypeptide may be used in a composition for predicting the reactivity and survival prognosis of an anticancer agent of a lung cancer patient, a reactivity to an anticancer agent of a lung cancer patient, and a microarray or kit for predicting the survival prognosis. Alternatively, an antibody to the polypeptide may be used in place of the polypeptide. The antibody is preferably a monoclonal antibody.

The polynucleotide contained in the composition of the present invention, the polynucleotide that specifically hybridizes with the polynucleotide, or the polynucleotide specifically encoded by the polynucleotide or cDNA thereof may also be used as a microarray for predicting the reactivity and survival prognosis of an anti-cancer agent in lung cancer patients or Is provided as an application for the manufacture of a kit. The microarray or kit may be prepared by conventional methods known to those skilled in the art.

In the present invention, the microarray may be a conventional microarray, except for including polynucleotides, polypeptides, cDNA, etc. of the present invention. The hybridization of nucleic acids on a microarray and the detection of hybridization results are well known in the art. The detection may be performed, for example, by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal including a fluorescent substance, such as Cy3 and Cy5, and then hybridizing on the microarray, The hybridization result can be detected.

In the present invention, the kit may include one or more other component compositions, solutions or devices suitable for the analysis method as well as polynucleotides, polypeptides, cDNAs, etc. of the present invention. In one embodiment, the kit of the present invention may be a kit containing the necessary elements necessary to perform PCR, and may be a test tube or other suitable container, a reaction buffer (pH and magnesium concentrations vary), deoxynucleotides (dNTPs) Enzymes such as Taq polymerase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water and sterile water. In another embodiment, the kit of the present invention may be a kit for predicting the survival prognosis of a lung cancer, which contains essential elements necessary for carrying out a DNA chip, and the DNA chip kit may include a polynucleotide, a primer or a probe specific for the SNP And the substrate may comprise a nucleic acid corresponding to a quantitation control gene or a fragment thereof.

The genotyping of the SNP of the present invention can be confirmed by sequencing analysis, sequencing analysis using an automatic sequencer, pyrosequencing, hybridization with a microarray, PCR-RELP (restriction fragment length polymorphism), PCR-SSCP single strand conformation polymorphism (PCR), SSO (specific sequence oligonucleotide), ASO (allele specific oligonucleotide) hybridization method using PCR-SSO method and dot hybridization method, TaqMan-PCR method, MALDI-TOF / MS method, RCA method rolling circle amplification, HRM (high resolution melting), primer extension, Southern blot hybridization, dot hybridization, and the like. Further, the results of the SNP polymorphism can be statistically processed using statistical analysis methods commonly used in the art, such as Student's t-test, Chi- continuous variables, categorical variables, odds ratios, and 95% confidence intervals, obtained through linear regression analysis, linear regression line analysis, and multiple logistic regression analysis, % Confidence interval, and so on.

Since the SNP identified in the present invention can be applied as a biomarker having histologic specificity for predicting the response and survival rate of the chemotherapy, a small group which is effective for paclitaxel-cisplatin chemotherapy by analyzing the SNP of the present invention And can be used to determine the therapeutic treatment of patients with non-small cell lung cancer.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1. Experimental Method

1-1. Clinical characteristics of patients

Among the patients diagnosed with lung cancer at Kyungpook National University Hospital (Daegu, Republic of Korea), 200 patients who were treated with paclitaxel-cisplatin chemotherapy more than 2 times were diagnosed with stage 3 or 4 of non-small cell lung cancer. Were included in the study. A total of 235 patients who participated in the reexamination study were also enrolled in the study, who were diagnosed with stage 3 or stage 4 non - small cell lung cancer and received paclitaxel - cisplatin chemotherapy more than once in the first treatment. Patients with lung cancer who participated in excavation and reproduction studies were excluded from chemotherapy-induced radiation therapy to avoid the effects of radiation therapy on chemotherapy response.

Chemotherapy was intravenously over a period of paclitaxel 175 mg / m ² to 3 hours, cisplatin was administered over a period of 60 minutes per day to 60 mg / m ² every three weeks. In the case of disease progression, major toxicity, or patient or physician decision, chemotherapy was discontinued. The treatment response was assessed by performing a computerized tomography following two rounds of chemotherapy. The treatment response was assessed using the Response Evaluation Criteria of solid tumors (Eisenhauer EA, Therasse P, Bogaerts J, et al.) New response evaluation criteria in solid tumors: revised RECIST guideline (version 1.1) Eur J Cancer 2009 ; 45: 228-47). The most responsive time of each patient response was recorded and independent radiologist findings were recorded. The complete response (CR) or partial response (PR) was divided into responders. Stable disease (SD) or progressive disease (PD) were classified as non-responders. To assess survival outcomes, overall survival (OS) was recorded as the time between diagnosis and death or final visit. Overall survival refers to the day of surgery, the day of death for any cause, or the last follow-up date.

This study was approved by the Clinical Examination Committee of Kyungpook National University Hospital (approval number KNUHBIO_09-1018) and received consent from all subjects. Genomic DNA samples from patients were obtained from Kyungpook National University Human Resource Bank and extracted from peripheral blood lymphocytes using QuickGene-810 system (Fujifilm, Japan). All patients were Korean and resided in Daegu Metropolitan City or nearby.

1-2. Selection of polymorphism and genotyping

Genes involved in cancer-related pathways were selected from SABiobioscience (http: // sabiobiosciences.com) and DAVID Bioinformatics Resources 6.7 (http://david.abcc.ncifcrf.gov). The candidate genes selected are 96 genes related to apoptosis, 86 genes associated with neovascularization, 74 genes involved in DNA damage signal and recovery, 38 genes involved in carcinogen metabolism, 34 genes involved in genetic stability, 65 related genes, 69 genes related to growth factors, 67 genes involved in signal transduction pathways, and 42 genes involved in invasion and metastasis. Using the database (http://www.ncbi.nlm.nih.gov/ SNP), the promoter region (~ 1.0 kb) that is thought to affect gene function, 20 bp Polymorphisms with internal and external regions, and potential functionalities existing at the 5'-untranslated region and the 3'-untranslated region were selected. Among the polymorphisms in the exon region, only polymorphisms with amino acid changes were selected. 1,969 polymorphisms of 1,151 of the 4,215 polymorphisms were analyzed using a gene chip (Affimetrix Inc., USA).

In the present study, 220 polymorphisms with an association with chemotherapy response and OS ( p <0.05) were selected and analyzed by SEQUENOM's MassARRAY iPLEX assay (SEQUENOM Inc., USA). Of the 220 polymorphisms, 206 polymorphisms were tested, except for 14 polymorphisms that could not be tested in the SEQUENOM's MassARRAY iPLEX assay. All genotypic analyzes were performed to determine the status of the patient population . In addition, about 5% of the samples were randomly selected from the reproducibility study and genotyped by another tester. The result was 100% agreement with the original analysis.

1-3. Statistical analysis

The Hardy-Weinberg Equilibrium (HWE) was tested using a degree of freedom for goodness-of-fit χ ² test. Differences in distribution of genotypes according to anticancer response to patients were compared using the Mantel-Haenszel Chi-square test for categorical variables. The association between clinical variables or genotype and chemotherapy response was tested by risk (HR) and 95% confidence intervals (CIs) and was tested using unconditional logistic regression analysis. The multivariate analysis was based on the possible variables [age, sex (male vs. female), smoking status (smoker vs. nonsmoker), tumor histology (AC and SCC vs. each rest), stage (IV. III), performance status (ECOG 2 vs. 0-1), and weight loss (yes vs. no)], and the association test was performed between the genotype and the chemotherapy response. Survival estimates based on clinical variables or genotypes were calculated using the Kaplan-Meier method. Overall survival (OS) differences for each clinical variable or genotype were compared using the log-rank test. Hazard ratios (HRs) and 95% confidence intervals (CIs) were estimated using Cox proportional hazards models. Multivariate analysis of the association between genotype and prognosis was performed by adjusting for age, gender, smoking status, tumor histology, stage, performance status, weight loss, secondary chemotherapy, and radiation therapy for primary tumors Respectively. All analyzes are in version 9 for Windows. 1 (SAS Institute, Cary, NC, USA).

Example  2. Paclitaxel - Cisplatin  Identification of polymorphisms correlated with survival rates for chemotherapy

Table 2 and Table 3 summarize the clinical, pathological characteristics, chemotherapeutic response, and OS association of selected patients in excavation and reproduction studies. The overall response rate in excavation studies was 55.5% and the median survival time (MST) was 13.7 months (95% CI = 12.5-15.2). When univariate analysis was performed, only the patient's stage was associated with the response of the chemotherapy regimen. However, age, smoking status, histology, stage, and weight loss were significantly related to OS.

The response to chemotherapy was 51.1% and the mean survival time (MST) was 12.9 months (95% CI = 11.4-16.0). It was related to the response of chemotherapy, and it appeared in two variables of histology and weight loss. Survival rates were related to variables such as histology, weight loss, 2nd line chemotherapy, and radiation therapy for primary tumors.

Univariate analysis of survival rates and responsiveness to chemotherapy according to clinical variables in excavation studies
variable patient
Number Reactivity to chemotherapy Overall survival rate Respondent
(CR + PR) Non-responders (SD + PD) OR P MST (month) 95% CI Log-Rank P HR (95% CI) P All () 200 111 (55.5) ^a 89 (44.5) 13.7 12.5 - 15.2 Age (years)  ∠65 106 63 (59.4) 43 (40.6) 1.00 14.4 12.5-17.1 1.00  ≥65 94 48 (51.1) 46 (48.9) 0.71 (0.41-1.25) 0.24 12.9 11.3-15.6 0.04 1.37 (1.02-1.84) 0.04 gender   male 180 100 (55.6) 80 (44.4) 1.00 13.5 12.1-15.1 1.00   female 20 11 (55.0) 9 (45.0) 0.98 (0.39-2.48) 0.96 17.9 10.3-32.0 0.14 0.69 (0.42-1.13) 0.14 Smoking status  Nonsmoker 18 11 (61.1) 7 (38.9) 1.00 25.9 13.1-35.4 1.00  A smoker 182 100 (54.9) 82 (45.1) 0.78 (0.29-2.09) 0.62 13.2 11.9-14.8 0.03 1.77 (1.06-2.97) 0.03 Histological type  Squamous cell carcinoma 104 64 (61.5) 40 (38.5) 1.00 13.9 12.0-15.2 1.00  Adenosine 84 41 (48.8) 43 (51.2) 0.60 (0.33-1.07) 0.08 14.3 11.6-20.2 0.77 (0.56-1.04) 0.09  Etc 12 6 (50.0) 6 (50.0) 0.63 (0.19-2.07) 0.44 10.2 5.2-19.3 0.09 1.38 (0.74-2.59) 0.31 Pathological staging  III 86 55 (63.9) 31 (36.1) 1.00 17.1 13.5-19.3 1.00  IV 114 56 (49.1) 58 (50.9) 0.54 (0.31-0.97) 0.04 12.7 9.7-14.2 0.02 1.41 (1.04-1.89) 0.03 Performance status (ECOG PS)  0-1 173 100 (57.8) 73 (42.2) 1.00 14.3 12.6-16.7 1.00  2 27 11 (40.7) 16 (59.3) 0.50 (0.22-1.15) 0.10 12.8 8.4-13.2 0.58 1.13 (0.73-1.75) 0.58 Weight loss  none 114 68 (59.6) 46 (40.4) 1.00 15.2 12.1-18.5 1.00  has exist 86 43 (50.0) 43 (50.0) 0.68 (0.39-1. 19) 0.17 13.2 11.4-14.3 0.01 1.47 (1.09-1.99) 0.01 2nd line chemotherapy  none 86 - - - 12.8 8.8-14.6 1.00  has exist 114 - - - 14.8 12.8-17.2 0.21 0.83 (0.62-1.11) 0.21 Radiation therapy for tumors  none 179 - - - 13.2 11.6-14.4 1.00  has exist 21 - - - 18.5 14.6-22.6 0.41 0.83 (0.52 - 1.31) 0.41

^a Row percentage

OR, odds ratio; MST, median survival time; CI, confidence interval; HR, hazard ratio; PS, performance status; ECOG, Eastern Cooperative Oncology Group

Univariate analysis of survival rates and responsiveness to chemotherapy according to clinical variables in recall study
variable patient
Number Reactivity to chemotherapy Overall survival rate Respondent
(CR + PR) Non-respondent
(SD + PD) OR P MST (month) 95% CI Log-Rank P HR (95% CI) P All () 235 120 (51.1) ^a 115 (48.9) 12.9 11.4-16.0 Age (years)  ∠65 123 63 (51.2) 60 (48.8) 1.00 16.1 11.4-18.5 1.00  ≥65 112 57 (50.9) 55 (49.1) 0.99 (0.59-1.65) 0.79 11.8 8.0-13.5 0.22 1.18 (0.90-1.55) 0.22 gender   male 176 93 (52.8) 83 (47.2) 1.00 11.9 10.2-15.6 1.00   female 59 27 (45.8) 32 (54.2) 0.75 (0.42 - 1.37) 0.32 16.1 11.8-21.1 0.20 0.82 (0.60-1.12) 0.21 Smoking status  Nonsmoker 54 25 (46.3) 29 (53.7) 1.00 16.0 10.6-25.9 1.00  A smoker 181 95 (52.5) 86 (47.5) 1.28 (0.70-2.36) 0.43 12.6 10.8-15.6 0.06 1.36 (0.98-1.87) 0.06 Histological type  Squamous cell carcinoma 104 61 (58.7) 43 (41.3) 1.00 12.8 10.1-17.0 1.00  Adenosine 112 50 (44.6) 62 (55.4) 0.57 (0.33-0.98) 0.04 15.7 11.3-18.1 0.28  Etc 19 9 (47.4) 10 (52.6) 0.63 (0.24-1.69) 0.36 7.7 4.7-11.9 0.05 0.07 Pathological staging  III 97 53 (54.6) 44 (45.4) 1.00 14.7 11.3-17.9 1.00  IV 138 67 (48.5) 71 (51.5) 0.78 (0.47-1.32) 0.36 12.5 10.4-16.1 0.45 1.11 (0.84-1.46) 0.45 Performance status (ECOG PS)  0-1 184 88 (47.8) 96 (52.2) 1.00 13.7 11.4-16.6 1.00  2 51 32 (62.8) 19 (37.2) 1.88 (0.97-3.47) 0.06 11.8 8.0-16.1 0.39 1.15 (0.83-1.60) 0.40 Weight loss  none 155 88 (56.8) 67 (43.2) 1.00 14.7 11.6-17.1 1.00  has exist 80 32 (40.0) 48 (60.0) 0.51 (0.29-0.88) 0.02 11.8 7.9-13.7 0.001 1.67 (1.25-2.23) 0.001 2nd line chemotherapy  none 65 - - - 7.4 5.1-10.2 1.00  has exist 170 - - - 16.2 12.7-18.1 0.01 0.63 (0.46-0.86) 0.01 Radiation therapy for tumors  none 210 - - - 12.2 10.4-15.6 1.00  has exist 25 - - - 23.7 12.6-26.3 0.04 0.63 (0.40-0.98) 0.04

^a Row percentage

OR, odds ratio; MST, median survival time; CI, confidence interval; HR, hazard ratio; PS, performance status; ECOG, Eastern Cooperative Oncology Group

Of the 1,969 polymorphisms in the excavation study, 739 polymorphisms were excluded as follows: i) 81 polymorphisms failed in genotype analysis, ii) 200 polymorphisms with less than 95% of the confirmed genotypes, iii) 362 polymorphisms <10%, iv) 96 polymorphisms in the control group with Hardy-Weinberg equilibrium P <0.05. Therefore, we analyzed the association of 1,230 polymorphisms with anticancer response and survival rate in lung cancer patients treated with clitaxel-cisplatin chemotherapy. Among 1,230 polymorphisms analyzed in the excavation study, 235 patients with paclitaxel-cisplatin chemotherapy were analyzed for the polymorphism, which showed a significant difference in genotype distribution and P <0.05 Study.

Among the 204 polymorphisms in the reproducibility study, 175 polymorphisms were analyzed except for 31 polymorphisms with less than 90% of the confirmed genotypes. The results were significantly associated with overall survival (OS) in the three polymorphisms (COL4A2 rs7990383G> A, KLK10 rs7259651A> G, SNRPB2 rs3761298C> T) (Table 4). Multivariate analysis using Cox proportional hazards models showed that the survival rate of the dominant model for KLK10 rs7259651A> G variant G allele was poor (adjusted HR [aHR] = 1.38, 95% CI = 1.02- 1.87, P = 0.04). COL4A2 rs7990383G> A and SNRPB2 rs3761298C> T showed poor OS in a recessive model for mutant allele (aHR = 3.84, 95% CI = 1.52-9.64, P = 0.004; aHR = 1.83, 95% CI = 1.09- 3.06, P = 0.022, respectively).

Paclitaxel-polymorphism for predicting survival rate for cisplatin chemotherapy Excavation research Reappearance study Gene name /
rsID genotype Number of occurrences (%) Overall survival Number of occurrences (%) Overall survival Log rank p ¶ HR (95% CI) ¶ P value Log rank p ¶ HR (95% CI) ¶ P value COL4A2
rs7990383 GG 122 (61.6) 1.00 160 (69.0) 48.8 1.00 GA 68 (29.0) 0.88 (0.63-1.22) 0.45 67 (29.0) 0.95 (0.70-1.28) 0.73 AA 8 (2.0) 0.08 1.82 (0.87-3.81) 0.11 5 (2.0) 0.004 3.78 (1.50-9.50) 0.01 dominant 0.37 0.92 (0.67-1.26) 0.59 0.32 1.10 (0.82-1.47) 0.53 recessive 0.03 1.94 (0.93-4.06) 0.07 0.001 3.84 (1.52-9.64) 0.004 KLK10
rs7259651
AA 97 (50.3) 1.00 103 (44.6) 1.00 AG 79 (40.9) 1.42 (1.03-1.97) 0.03 101 (43.7) 1.44 (1.04-2.07) 0.03 GG 17 (8.8) 0.01 1.55 (0.89-2.69) 0.12 27 (8.8) 0.05 1.23 (0.76-1.99) 0.40 dominant 0.01 1.38 (1.01-1.88) 0.04 0.02 1.38 (1.02-1.87) 0.04 recessive 0.06 1.21 (0.42-2.05) 0.47 0.98 0.92 (0.60-1.41) 0.71 SNRPB2
rs3761298 CC 112 (56.0) 1.00 117 (52.7) 1.00 CT 74 (37.0) 1.17 (0.84-1.61) 0.355 86 (38.7) 0.98 (0.72-1.33) 0.889 TT 14 (7.0) 0.022 2.49 (1.33-4.65) 0.004 19 (8.6) 0.0271 1.87 (1.09-3.20) 0.023 dominant 0.06 1.28 (0.94-1.74) 0.122 0.355 1.05 (0.78-1.41) 0.759 recessive 0.02 2.35 (1.27-4.33) 0.006 0.01 1.83 (1.09-3.06) 0.022

¶ HRs, 95% CIs, and P values for these were calculated by multivariate Cox proportional hazard models and compared with age, gender, smoking status, tumor histology, pathologic stage, ECOG performance status, weight loss, Corrected by radiotherapy for tumors

&Lt; 110 > D & P Biotech Ltd. <120> Markers for predicting survival and response to anti-cancer          drug <150> KR10-2013-0128372 <151> 2013-10-28 <160> 3 <170> Kopatentin 1.71 <210> 1 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> d is a or g <400> 1 cggggagccg gggaggaaag gggacadagg agaccccggc caacacggcc tc 52 <210> 2 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> d is a or g <400> 2 acgtccccag caaggctagg ggtggcdgga tgagaggcca ctgagcaaga gg 52 <210> 3 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is c or t <400> 3 gggaattttt attttttaaa aacaccyaaa gttgcaacaa cttgaaaata at 52

Claims (12)

For gene samples from patients,
(NCBI refSNP ID: rs7990383) of the 27th base of the sequence represented by SEQ ID NO: 1 in the COL4A2 gene,
Polymorphism (NCBI refSNP ID: rs7259651) of the 27th base of the sequence represented by SEQ ID NO: 2 in the KLK10 gene and
(NCBI refSNP ID: rs3761298) of the nucleotide sequence of SEQ ID NO: 3 in the SNRPB2 gene (NCBI refSNP ID: rs3761298).
Methods for providing information for predicting the response and survival prognosis of anticancer drugs in lung cancer patients.
The method of claim 1, wherein the anticancer agent is paclitaxel or cisplatin.
2. The method of claim 1, wherein said patient is lung cancer is non-small cell lung cancer.
4. The method of claim 3, wherein the non-small cell lung cancer is squamous cell or adenocarcinoma.
2. The method according to claim 1, wherein the genotype of the 27th base of SEQ ID NO: 1 is AA, or the genotype of the 27th base of SEQ ID NO: 2 is AG or GG, or the genotype of the 27th base of SEQ ID NO: 3 is TT And classifying the survival prognosis as being lower than that of the other genotypes.
A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 1 in the COL4A2 gene or a complementary polynucleotide thereof;
A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 2 in the KLK10 gene or a complementary polynucleotide thereof; And
And at least one polynucleotide selected from the group consisting of a polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 3 or a complementary polynucleotide thereof in the SNRPB2 gene.
A composition for predicting the response and survival prognosis of an anticancer agent in lung cancer patients.
7. The composition of claim 6, wherein the anticancer agent is paclitaxel or cisplatin.
A composition for predicting the reactivity and survival prognosis of an anticancer agent in a lung cancer patient, comprising a polynucleotide that specifically hybridizes with the polynucleotide of claim 6.
9. The composition of claim 8, wherein the specifically hybridizing polynucleotide is an allele-specific probe or an allele-specific primer.
A composition for predicting the reactivity and survival prognosis of an anticancer agent in a lung cancer patient, comprising a polypeptide encoded by the polynucleotide of claim 6.
A microarray for predicting the reactivity and survival prognosis of an anticancer agent of a lung cancer patient comprising the polynucleotide of claim 6, a polynucleotide that hybridizes therewith, or a polypeptide specifically or specifically encoded thereby.
A kit for predicting the reactivity and survival prognosis of an anticancer agent in lung cancer patients including the microarray of claim 11.