KR20140086933A - Markers for predicting survival and the response to anti-cancer drug in a patient with lung cancer - Google Patents

Abstract

The present invention relates to a marker for predicting a response to an anti-cancer drug and survival prognosis of a patient with a lung cancer by using gene polymorphism, and the use of the same. More specifically, the present invention relates to a method for predicting the prognosis of lung cancer survival by checking a base of a specific single nucleotide polymorphism (SNP) having a significant correlation with a response to an anti-cancer drug and the survival prognosis of a patient with lung cancer; a composition for predicting a response to an anti-cancer drug and the survival prognosis comprising a polynucleotide, a polypeptide, or a cDNA of the same; and a microarray and a kit comprising the same.

Description

Markers for predicting survival and the response to anti-cancer drug in a patient with lung cancer

The present invention relates to markers for predicting responsiveness to anticancer agents and survival prognosis of lung cancer patients using genetic polymorphism, and their use. More specifically, the present invention is a method for predicting the survival prognosis of lung cancer by identifying the base of a specific single nucleotide polymorphism (SNP) that has a significant correlation with the prediction of reactivity and survival prognosis for an anticancer drug in a lung cancer patient, the SNP can be confirmed. It relates to a composition for predicting the reactivity and survival prognosis of a lung cancer patient comprising a polynucleotide, a polypeptide or cDNA thereof, and a microarray and a kit comprising the same.

Lung cancer is one of the leading causes of cancer death worldwide. In particular, non-small cell lung cancer (NSCLC) accounts for about 85% of lung cancer, and despite advances in diagnosis and treatment of NSCLC over the past decades, the average 5-year survival rate of patients diagnosed with lung cancer is still increasing. Less than 15%. In general, in the case of early lung cancer, the purpose of cure through extensive resection is for the purpose of treatment, but in case of advanced cancer, treatment with chemotherapy is performed. The combination therapy of platinum-based anticancer drugs such as paclitaxel and cisplatin is most often used for patients with end-stage non-small cell cancer, but the effect of treatment is not so great and the prognosis is poor. In addition, among patients with similar clinical characteristics, responses to chemotherapy vary widely, and even patients of the same stage show significant differences in patient survival. Therefore, numerous studies are being conducted to find molecular biomarkers that can better predict the clinical outcome of patients and select effective patient populations for specific treatments.

Since DNA repair systems are essential for maintaining the integrity of the genome, abnormalities in DNA repair genes can dramatically increase cancer risk factors. There have been reports that the polymorphism of DNA repair genes causes a difference in the DNA repair ability of individuals, which may be the cause of the difference in susceptibility to various cancers, including lung cancer. In addition, polymorphisms of genes related to apoptosis may affect the expression and activity of enzymes, and thus may be related to risk factors and prognosis of various cancers including lung cancer.

Therefore, in recent years, methods for predicting and diagnosing susceptibility to diseases using such gene polymorphism have been developed, and in particular, studies on the association between cancer-related gene polymorphism and cancer are being actively conducted. For example, the -652 6-nucleotide (CTTACT) deletion variant (rs3834129, -652 6N del) of the CASP8 promoter with respect to the caspase (CASP) gene known to play a critical role in the regulation and development of apoptosis is CASP8. It has been reported to decrease gene expression and is associated with multiple cancer risk (Sun T, et al. Nat Genetic 39:605-13, 2007), CASP8 D302H (rs1045485G>C) and IVS12-19G>A (rs3769818). Although the function of polymorphism is unknown, it has been reported to be associated with the risk of various types of cancer (Macpherson G, et al. J Natl Cancer Inst 96: 1866-9, 2004). In addition, chromosome 19q13.3 site is known to contain many genes related to DNA repair, apoptosis, and cell division, and rs1970764T>C (PPP1R13L IVS8-1435), rs11615G>A (ERCC1 N118N)), etc. are located here. The haplotype of has been reported to be associated with the risk of basal cell carcinoma, breast cancer, and lung cancer (Yin J, Rockenbauer E, Hedayati M, et al. Cancer Epidemiol Biomarkers Prev 11:1449-1453, 2002; Nexo BA, Vogel. U, Olsen A, et al. Carcinogenesis 24:899-904, 2003; Vogel U, Laros I, Jacobsen NR, et al. Mutat Res 546:65-74, 2004).

However, although the effect of DNA repair gene or apoptosis gene polymorphism on cancer risk and prognosis has been extensively studied, only a few studies have reported the diagnostic importance of DNA repair gene or apoptosis gene polymorphism in cancer patients. . The present inventors hypothesized that polymorphism of genes related to DNA repair and apoptosis will affect the clinical prognosis of lung cancer patients, and targeting non-small cell lung cancer patients who received paclitaxel-cisplatin combination therapy as a primary treatment As a result of analyzing the association between the polymorphism of the apoptosis gene and the response to an anticancer drug, the present invention was completed by finding a biomarker capable of predicting the response and survival to anticancer chemotherapy.

One object of the present invention is to identify the base of a specific SNP that has a significant correlation with the prediction of reactivity and survival prognosis for anticancer agents with respect to gene samples collected from lung cancer patients, thereby reactivity and survival of lung cancer patients with anticancer agents. It provides a way to predict the prognosis.

Another object of the present invention is to provide a composition for predicting the reactivity and survival prognosis of a lung cancer patient to an anticancer agent, comprising a polynucleotide, a polypeptide or a cDNA thereof capable of identifying a specific SNP marker.

Another object of the present invention is to provide a microarray for predicting the reactivity and survival prognosis of a lung cancer patient to an anticancer agent, comprising a polynucleotide, a polypeptide or a cDNA thereof capable of identifying a specific SNP marker.

Another object of the present invention is to provide a kit for predicting the reactivity and survival prognosis of an anticancer agent in a lung cancer patient, comprising a polynucleotide, a polypeptide or a cDNA thereof capable of identifying a specific SNP marker.

The present invention relates to a gene sample obtained from a patient, SNP (NCBI refSNP ID: rs1052555) located at the 27th base of the sequence represented by SEQ ID NO: 1 in the XPD gene, and 27 of the sequence represented by SEQ ID NO: 2 in the BRCA1 gene. SNP located at the first base (NCBI refSNP ID: rs799917), SNP located at the 27th base of the sequence represented by SEQ ID NO: 3 in the TNFRSF1B gene (NCBI refSNP ID: rs1061624), represented by SEQ ID NO: 4 in the BCL2 gene SNP (NCBI refSNP ID: rs2279115) located at the 27th base of the sequence, SNP located at the 27th base of the sequence represented by SEQ ID NO: 5 in the BIRC5 gene (NCBI refSNP ID: rs9904341), and in the CASP8 gene Reactivity to an anticancer agent of a lung cancer patient comprising the step of identifying the bases of two or more SNPs selected from the group consisting of SNPs (NCBI refSNP ID: rs3769818) located at the 27th base of the sequence represented by SEQ ID NO: 6, and Provides a method for predicting survival prognosis.

These sequences are shown in Table 1 below. In Table 1, the NCBI refSNP ID for each SNP indicates the sequence and position of the SNP. Those skilled in the art can easily identify the position and sequence of the SNP by using the above number. It will be apparent to those skilled in the art that the specific sequence corresponding to the refSNP ID of the SNP registered in NCBI may be slightly changed according to the results of research on the continued gene, and such a changed sequence is also included within the scope of the present invention.

gene NCBI refSNP ID order Sequence number XPD/ERCC2 rs1052555 gatgccaacctcaacctgaccgtgga [c/t] gagggtgtccaggtggccaagtact One BRCA1 rs799917 ggtttcaaagcgccagtcatttgctc [c/t] gttttcaaatccaggaaatgcagaa 2 TNFRSF1B rs1061624 cctgcaggccaagagcagaggcagcg [a/g] gttgtggaaagcctctgctgccatg 3 BCL2 rs2279115 tccgtccccggctccttcatcgtccc [a/c] tctcccctgtctctctcctggggag 4 BIRC5 rs9904341 gccattaaccgccagatttgaatcgc [c/g] ggacccgttggcagaggtggcggcg 5 CASP8 rs3769818 catcgcctctgaaatacatcacataa [c/t] attgtgactgtctgtgggggaaagc 6

In the present invention, since the rs1052555 CC, rs799917 CC, rs1061624 AA, rs2279115 AA, rs9904341 CG+GG and rs3769818 GG genotypes are associated with poor survival results for anticancer agents, the six genotypes are considered to be poor genotypes. Therefore, when any two or more, preferably three or more, more preferably four or more, more preferably six or more, and most preferably six or more of the six genotypes are detected in the patient's sample. , It is predicted that the reactivity to anticancer drugs is low and the survival prognosis is low.

The present inventors investigated whether polymorphisms of various DNA repair genes and apoptosis-related genes have a correlation with the responsiveness to anticancer drugs and survival prognosis in lung cancer patients in order to predict the reactivity and survival prognosis of cancer patients. To this end, we first analyzed the genotype for 74 selected SNPs from DNA extracted from blood lymphocytes of 382 non-small cell lung cancer patients who received paclitaxel-cisplatin combination therapy as a primary treatment, and the relationship between drug response and overall survival (OS). Was analyzed. The overall survival (OS) refers to from the date of surgery to the day of death due to any cause or from the date of the last follow-up investigation. As a result, two SNPs (XRCC1 rs25487, BRCA1 rs799917) appear to have special significance for anticancer chemotherapy response, and six SNPs (XPD/ERCC2 rs1052555C>T, BRCA1 rs799917C>T, TNFRSF1B rs1061624G>A, BCL2 rs2279115C> A, BIRC5 rs9904341C>G, CASP8 rs3769818G>A) were significantly associated with the survival analysis results.

In addition, by arbitrarily combining any one or more of the six SNPs specified by the present invention, it was possible to predict the reactivity and survival prognosis of a lung cancer patient to an anticancer agent with higher precision. As described in Examples to be described later, it was found that the correlation between the combination of SNPs and lung cancer survival results was high. That is, it was found that as the number of SNPs identified by the present invention from lung cancer patients increases, the overall survival (OS) of lung cancer patients decreases.

Specifically, in the case of XRCC1 rs25487G>A (Arg399Gln, R399Q), the AA genotype was less sensitive to chemotherapy than the GG or GA genotype, and XPD/ERCC2 rs1052555 C>T (Asp711Asp, D711D) was a mutant T allele. It was found to be associated with a good survival rate in the genetic dominant model. BRCA1 rs799917 C>T (Pro871Leu, P871L) was shown to be good in both anticancer drug response and survival in the dominant model of the mutant T allele.In TNFRSF1B rs1061624 G>A, AA genotype was associated with poor survival compared to GG or GA genotypes. It turns out that there are. In the case of BCL2 rs2279115C>A (-938C>A), the AA genotype was associated with poor survival, and in the case of BIRC5 rs9904341 (-31C>G), the CG or GG genotype showed a poor survival rate compared to the CC genotype. CASP8 rs3769818 (IVS12-19G>A) showed good prognosis in the dominant model of the variant A allele.

Furthermore, as a result of examining the effect of the combination of SNPs on the overall survival rate, among the six specific SNPs, lung cancer patients with a large number of rs1052555 CC, rs799917 CC, rs1061624 AA, rs2279115 AA, rs9904341 CG+GG and rs3769818 GG genotypes survive. We found that the results were even worse (P _trend =2x10 ^-6 ). The overall survival rate (OS) was significantly worse in the group of patients with 3 poor genotypes and 4 to 6 genotypes compared to the case with 0 to 2 poor genotypes. (Respectively, HR=1.54, 95% confidence interval = 1.14-2.08, P = 0.005, HR for overall survival rate (OS) = 2.10, 95% confidence interval = 1.55-2.85, P=2x10 ^-6 ). Interestingly, when the effects of 6 SNPs were divided by histological type, 3 SNPs (rs1052555, rs799917, rs9904341) were related to the survival of patients with adenocarcinoma (P for heterogeneity [PH] = 0.01, 0.05, and 0.04, respectively). 2SNPs (rs1061624, rs2279115) were associated with squamous cell carcinoma (PH = 0.23 and 0.04, respectively).

These results show that the SNP identified in the present invention can be applied as a biomarker with histological specificity that can predict the response and survival rate of anticancer chemotherapy. In particular, the SNP of the present invention can be used as a biomarker for predicting the anticancer chemotherapy response and survival for non-small cell lung cancer patients who have been primarily treated with paclitaxel-cisplatin chemotherapy. Therefore, the analysis of the SNP of the present invention will be helpful in the selection of a small group effective in paclitaxel-cisplatin chemotherapy, and may also be helpful in determining the treatment regimen for patients with terminal non-small cell lung cancer.

In the present invention, the patient refers to a patient who has developed lung cancer. The lung cancer is preferably non-small cell lung cancer, and may be adenocarcinoma or squamous cell cancer. Gene samples are obtained from tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine obtained from these lung cancer patients, and the gene samples include DNA, mRNA, or cDNA synthesized from mRNA.

In the present invention, the term "prognosis" refers to the course of and cure the disease such as the onset, recurrence, metastatic spread, and the possibility of lung cancer-caused death or progression, including drug resistance, of a neoplastic disease such as lung cancer. . For the purposes of the present invention, the prognosis refers to the responsiveness of lung cancer to an anticancer agent and the corresponding survival prognosis, and preferably refers to the prognosis of a patient with non-small cell lung cancer treated with paclitaxel-cisplatin chemotherapy first. In general, when lung cancer is advanced, treatment with chemotherapy is performed, and in particular, combination therapy with platinum-based anticancer drugs such as paclitaxel and cisplatin is most often used for patients with end-stage non-small cell cancer. Among patients with stage, responses to chemotherapy were varied and there was a significant difference in survival. By using the method of the present invention, it is possible to easily predict the responsiveness to anticancer chemotherapy, and accordingly, the survival prognosis can be easily determined, so that it is possible to easily determine whether to use an additional required treatment method. This can significantly increase the survival rate after the onset of lung cancer.

In the present invention, the term "prediction" means that the patient responds favorably or unfavorably to the treatment, such as chemotherapy, and the treatment of the patient, for example, a specific therapeutic agent, and/or surgical removal of the primary tumor, and/or cancer It is related to whether and/or the likelihood of survival after treatment with chemotherapy for a certain period of time without relapse. The predictive method of the present invention can be used clinically to make treatment decisions by selecting the most appropriate treatment regimen for patients with lung cancer. In addition, the prediction method of the present invention is to determine whether a patient preferentially responds to a treatment regimen, such as a prescribed treatment regimen, including administration of a prescribed therapeutic agent or combination, surgical intervention, chemotherapy, etc., or the patient after the treatment regimen It is possible to predict whether long-term survival is possible.

The present invention also provides a composition for predicting the responsiveness and survival prognosis to an anticancer agent in a patient with lung cancer in a patient.

The composition comprises a SNP (NCBI refSNP ID: rs1052555) located at the 27th base of the sequence represented by SEQ ID NO: 1 in the XPD gene with respect to the gene sample isolated from the patient, and the sequence represented by SEQ ID NO: 2 in the BRCA1 gene. SNP located at the 27th base (NCBI refSNP ID: rs799917), SNP located at the 27th base of the sequence represented by SEQ ID NO: 3 in the TNFRSF1B gene (NCBI refSNP ID: rs1061624), to SEQ ID NO: 4 in the BCL2 gene SNP (NCBI refSNP ID: rs2279115) located at the 27th base of the displayed sequence, SNP (NCBI refSNP ID: rs9904341) located at the 27th base of the sequence represented by SEQ ID NO: 5 in the BIRC5 gene, and CASP8 gene It is characterized by containing a reagent for confirming the bases of two or more SNPs selected from the group consisting of SNPs (NCBI refSNP ID: rs3769818) located at the 27th base of the sequence represented by SEQ ID NO: 6.

The reagents contained in the composition of the present invention are preferably two or more polynucleotides selected from the following polynucleotides:

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 1 in the XPD gene or a complementary polynucleotide thereof;

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 2 in the BRCA1 gene or a complementary polynucleotide thereof;

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 3 in the TNFRSF1B gene, or a complementary polynucleotide thereof;

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 4 in the BCL2 gene or a complementary polynucleotide thereof;

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 5 in the BIRC5 gene, or a complementary polynucleotide thereof; And

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 6 in the CASP8 gene, or a complementary polynucleotide thereof.

Accordingly, the present invention provides the polynucleotide as an aspect.

The polynucleotide or its complementary polynucleotide according to the present invention is composed of 10 or more, preferably 10 to 100, more preferably 20 to 60, even more preferably 40 to 60 contiguous bases.

The polynucleotide or its complementary polynucleotide according to the present invention is a polymorphic sequence. A polymorphic sequence refers to a sequence including a polymorphic site representing a monobasic polymorphism in a nucleotide sequence. Polymorphic site refers to a site in which a single base polymorphism occurs in a polymorphic sequence. In the present invention, the polynucleotide may be DNA or RNA.

The reagents contained in the composition of the present invention are preferably two or more polynucleotides selected from polynucleotides that specifically hybridize with the following polynucleotides:

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 1 in the XPD gene or a complementary polynucleotide thereof;

A polynucleotide consisting of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 2 in the BRCA1 gene, or a complementary polynucleotide thereof;

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 3 in the TNFRSF1B gene, or a complementary polynucleotide thereof;

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 4 in the BCL2 gene or a complementary polynucleotide thereof;

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 5 in the BIRC5 gene, or a complementary polynucleotide thereof; And

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 6 in the CASP8 gene, or a complementary polynucleotide thereof.

Accordingly, the present invention provides a polynucleotide that specifically hybridizes with the polynucleotide or its complementary polynucleotide as an aspect.

In the present invention, the polynucleotide or a polynucleotide that specifically hybridizes with a complementary polynucleotide thereof is an allele-specific polynucleotide.

Allele-specific polynucleotide refers to hybridizing specifically to each allele. In other words, it refers to hybridization so that the base of the polymorphic site present in the polymorphic sequence can be specifically distinguished. Here, hybridization is usually carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25° C. or more. For example, 5XSSPE (750mM NaCl, 50mM Na Phosphate, 5mM EDTA, pH 7.4) and conditions of 25 to 30°C may be suitable for allele-specific probe hybridization.

In the present invention, the allele-specific polynucleotide may be an allele-specific probe. That is, in the present invention, a probe means a hybridization probe, and means an oligonucleotide capable of sequence-specific binding to a complementary strand of a nucleic acid. The allele-specific probe of the present invention has a polymorphic site among nucleic acid fragments derived from two individuals of the same species, and hybridizes to a DNA fragment derived from one individual, but does not hybridize to a fragment derived from another individual. In this case, the hybridization conditions should be sufficiently stringent so that only one of the alleles is hybridized, showing a significant difference in hybridization strength between alleles. It is preferable that the central region of the probe of the present invention is aligned with the polymorphic region of the polymorphic sequence. This can lead to a good hybridization difference between different allelic forms. The probe of the present invention may be used in a diagnostic kit such as a microarray or a prediction method for predicting the responsiveness and survival prognosis of a lung cancer patient to an anticancer agent by detecting alleles.

In addition, in the present invention, the allele-specific polynucleotide may be an allele-specific primer. The appropriate length of the primer may vary depending on the intended use, but is generally composed of 15 to 30 bases. The primer sequence need not be completely complementary to the template, but must be sufficiently complementary to hybridize to the template. The primer hybridizes to a DNA sequence containing a polymorphic site to amplify a DNA fragment containing a polymorphic site. The primers of the present invention may be used in diagnostic kits such as microarrays or predictive methods for predicting the reactivity and survival prognosis of lung cancer patients with anticancer drugs by detecting alleles.

The reagent contained in the composition of the present invention is a polypeptide encoded by two or more polynucleotides, preferably selected from the following polynucleotides:

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 1 in the XPD gene or a complementary polynucleotide thereof;

A polynucleotide consisting of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 2 in the BRCA1 gene, or a complementary polynucleotide thereof;

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 3 in the TNFRSF1B gene, or a complementary polynucleotide thereof;

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 4 in the BCL2 gene or a complementary polynucleotide thereof;

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 5 in the BIRC5 gene, or a complementary polynucleotide thereof; And

A polynucleotide composed of 10 or more consecutive bases including the 27th base of the sequence represented by SEQ ID NO: 6 in the CASP8 gene, or a complementary polynucleotide thereof.

Accordingly, the present invention provides a polypeptide encoding the polynucleotide as an aspect. Such a polypeptide may be used in a composition for predicting the reactivity to an anticancer agent and a survival prognosis of a lung cancer patient, a microarray or a kit for predicting the reactivity to an anticancer agent and a survival prognosis of a lung cancer patient. Alternatively, an antibody against the polypeptide can be used in place of the polypeptide. The antibody is preferably a monoclonal antibody.

The polynucleotide contained in the composition of the present invention, a polynucleotide specifically hybridizing thereto, or a polypeptide specifically encoded by the polypeptide or cDNA thereof is also a microarray for predicting the reactivity and survival prognosis of an anticancer agent in a lung cancer patient or It is provided for use in the manufacture of kits. The microarray or kit may be manufactured by a conventional method known to those skilled in the art.

In the present invention, the microarray may be formed of a conventional microarray, except for including the polynucleotide, polypeptide, cDNA, and the like of the present invention. Hybridization of nucleic acids on microarrays and detection of hybridization results are well known in the art. For the detection, for example, a nucleic acid sample is labeled with a labeling substance capable of generating a detectable signal including a fluorescent substance, for example, a substance such as Cy3 and Cy5, and then hybridized on a microarray and the labeling substance By detecting the signal generated from the hybridization result can be detected.

In the present invention, the kit may include a composition, solution, or device suitable for not only the polynucleotide, polypeptide, cDNA, etc. of the present invention, but also one or more other constituent components suitable for the analysis method. In one aspect, the kit of the present invention may be a kit containing essential elements necessary for performing PCR, and a test tube or other suitable container, a reaction buffer (various in pH and magnesium concentration), deoxynucleotides (dNTPs), Enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water and sterile water may further be included. As another aspect, the kit of the present invention may be a kit for predicting lung cancer survival prognosis including essential elements necessary for performing a DNA chip, and the DNA chip kit is attached to a specific polynucleotide, primer, or probe for the SNP. And the substrate may include a nucleic acid corresponding to a quantitative control gene or a fragment thereof.

Confirmation of the genotype of the SNP of the present invention includes sequencing analysis, sequencing analysis using an automatic base sequence analyzer, pyrosequencing, hybridization by microarray, PCR-RELP method (restriction fragment length polymorphism), PCR-SSCP method ( single strand conformation polymorphism), PCR-SSO method (specific sequence oligonucleotide), ASO (allele specific oligonucleotide) hybridization method combining PCR-SSO method and dot hybridization method, TaqMan-PCR method, MALDI-TOF/MS method, RCA method ( rolling circle amplification), HRM (high resolution melting) method, primer stretching method, Southern blot hybridization method, dot hybridization method, and the like. Furthermore, the results of the SNP polymorphism can be statistically processed using statistical analysis methods generally used in the art, for example, Student's t-test, Chi-square test (Chi- square test), linear regression line analysis, multiple logistic regression analysis, etc. It can be analyzed using variables such as% confidence interval.

Since the SNP identified in the present invention can be applied as a biomarker with histological specificity to predict the response and survival rate of anticancer chemotherapy, by analyzing the SNP of the present invention, a small group effective in anticancer chemotherapy of paclitaxel-cisplatin It can be useful for screening or determining the treatment regimen for patients with late stage non-small cell lung cancer.

1 is XPD / ERCC2 analyzed using the Kaplan-Meier method. It shows the overall survival curve according to the genotype of rs1052555. (A) is the overall result, (B) is the result of squamous cell carcinoma, and (C) is the result of adenocarcinoma. P value is based on log-rank test.
Figure 2 shows the overall survival curve according to the genotype of BRCA1 rs799917 analyzed using the Kafran-Meier method. (A) is the overall result, (B) is the result of squamous cell carcinoma, and (C) is the result of adenocarcinoma. P value is based on log-rank test.
3 shows the overall survival curve according to the genotype of TNFRSF1B rs1061624 analyzed using the Kafran-Meier method. (A) is the overall result, (B) is the result of squamous cell carcinoma, and (C) is the result of adenocarcinoma. P value is based on log-rank test.
Figure 4 shows the overall survival curve according to the genotype of BCL2 rs2279115 analyzed using the Kafran-Meier method. (A) is the overall result, (B) is the result of squamous cell carcinoma, and (C) is the result of adenocarcinoma. P value is based on log-rank test.
5 shows the overall survival curve according to the genotype of BIRC5 rs9904341 analyzed using the Kafran-Meier method. (A) is the overall result, (B) is the result of squamous cell carcinoma, and (C) is the result of adenocarcinoma. P value is based on log-rank test.
6 shows the overall survival curve according to the genotype of CASP8 rs3769818 analyzed using the Kafran-Meier method. (A) is the overall result, (B) is the result of squamous cell carcinoma, and (C) is the result of adenocarcinoma. P value is based on log-rank test.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the present invention is not limited by the following examples.

Example 1. Patient

DNA extracted from blood lymphocytes of 382 patients who were diagnosed with stage 3 or stage 4 of non-small cell lung cancer at Kyungpook National University Hospital between August 2005 and December 2008 and who were treated with paclitaxel-cisplatin chemotherapy more than two times as the first line treatment. Included in the study. In order to avoid the effect of radiation therapy on the response to chemotherapy, patients with anticancer radiation therapy were excluded.

For chemotherapy, paclitaxel 175 mg/m ² was administered intravenously over 3 hours, and cisplatin 60 mg/m ² was administered every 3 weeks over 60 minutes per day. Anticancer drug administration was discontinued in case of disease progression, major toxicity, or at the decision of the patient or doctor. The treatment response was evaluated by chemotherapy twice and then computed tomography. The degree of treatment response was evaluated using the Response Evaluation Criteria of solid tumors (Eisenhauer EA, Therasse P, Bogaerts J , et al . New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer 2009;45:228-47). Among the reactions of each patient, the largest response was recorded, and the radiologist's independent findings were recorded. Complete response (CR) or partial response (PR) were classified as responders, and stable disease (SD) or progressive disease (PD) were classified as non-responders. To evaluate the survival outcome, overall survival (OS) was recorded as the time between diagnosis and death or the last day of treatment.

The histological classification of lung cancer is as follows: 185 cases of squamous cell carcinoma (SCC); Adenocarcinoma (AC) 174 cases; 3 cases of large cell carcinoma; 20 cases not designated as non-small cell lung cancer. The pathological stages of tumors classified according to the modified lung cancer staging system are as follows: stage IIIA in 59 cases; 101 cases in stage IIIB and 222 cases in stage IV. Written consent was obtained from all patients, and the study was approved by the institutional review committee of Kyungpook National University Hospital.

Example 2. Genotyping and genotyping analysis

In order to select polymorphisms of genes related to DNA repair and apoptosis pathways, 74 SNPs were selected from 48 genes by searching public databases and literature (42 SNPs of 27 DNA repair pathway genes and 21 Apoptotic pathway genes. 32 SNP). With a frequency of at least 5%, those present in the promoter or in the UTR (untranslated region) or the coding region of the gene were selected mainly, and those reported to be related to cancer or functionally important SNPs were selected. Selected SNPs were genotyped using Sequenome mass spectrometry-based genotyping assay. SNP (MSH2 rs17217877) which is monomorphic from the set of selected 74 SNPs, 7 SNPs with a call rate of less than 90.0% (XRCC1 rs3213245, XPA rs1800975, XPD/ERCC2 rs13181, RFC4 rs187868, ATR rs2227930, TNFRSF1B/TNFR2 rs1159376622), CASP7 rs1061676622 SNPs that failed the analysis (CHEK1, rs521102), and 3 SNPs (XPCrs2228001, TNFRSF10A rs2230229, XIAP rs5956583) deviating from Hardy-Weinbergequilibrium (HWE; P<0.05) were excluded from subsequent studies.

62 SNPs of 44 genes (34 SNPs of 25 DNA repair pathway genes and 28 SNPs of 19 apoptosis pathway genes) were evaluated for association analysis. To control the quality of the experiment, genotype was analyzed without providing information on the patient, and 10% of the analyzed samples were randomly selected and verified by PCR-RFLP or DNA sequencing.

Example 3. Statistical Analysis

HWE was tested using the degree of freedom for goodness-of-fit χ ² test. Depending on clinicopathological factors for patients in the genotype distribution differences were compared using χ ² tests for the category variable. The association between clinical variables or genotypes and chemotherapy responses was tested by risk (OR) and 95% confidence (CIs), and was tested using unconditional logistic regression analysis. Multivariate analysis was performed on possible variables (age (over 65 vs. under 65), gender (male vs. female), smoking status (smoker vs. nonsmoker), tumor histology (AC and, SCC vs. Each remaining), stage (IV vs. III), performance status (ECOG 2 vs. 0-1), and nominal variables such as weight loss (yes vs. none)] between genotype and chemotherapy The association test was performed at. Survival estimation according to clinical variable or genotype was calculated using the Kaplan-Meier method. The difference in overall survival rate (OS) according to each clinical variable or genotype was compared using the log-rank test. Hazard ratios (HRs) and 95% reliability (CIs) were estimated using Cox proportional hazards models. Multivariate analysis of the association between genotype and prognosis was performed by correcting for age, sex, smoking, tumor histological findings, stage, performance status, weight loss, administration of secondary anticancer drugs, and radiotherapy for primary tumors. I did. All analyzes are for Windows version 9. 1 (SAS Institute, Cary, NC, USA) was performed using a statistical analysis system.

Experiment result

1. Patient characteristics and clinical predictors

Table 2 shows the relationship between the patient's clinical and pathological characteristics, anticancer drug response, and OS. The overall response rate was 47. 6% and the median survival time (MST) was 13. 4 months (95% CI = 12.3-14.5). When univariate analysis was performed, only histology was related to the response of chemotherapy. However, age, sex, smoking status, histology, weight loss, and 2nd line chemotherapy were significantly related to OS.

2. Effect of gene polymorphism on the prognosis of chemotherapy

As a result of multivariate analysis of anticancer chemotherapy and survival rate according to 62 SNPs, two SNPs (XRCC1 rs25487G>A and BRCA1 rs799917C>T) were highly related to chemotherapy after correction (Table 3). The XRCC1 rs25487 AA genotype had a significantly worse chemotherapy response compared to the GG+GA genotype (adjusted odds ratio [aOR] = 0.26, 95% CI = 0.09-0.75, P = 0.01). BRCA1 rs799917 showed a much better association in the dominant model for the mutant T allele.

When multivariate analysis was performed using Cox proportional hazards models, 6 SNPs (XPD/ERCC2 rs1052555C>T, BRCA1 rs799917C>T, TNFRSF1B rs1061624G>A, BCL2 rs2279115C>A, BIRC5 rs9904341C>G, and >A) was significantly related to the overall survival rate (OS) (Table 4 and FIGS. 1-6). XPD/ERCC2 rs1052555C>T, BRCA1 rs799917C>T and CASP8 rs3769818G>A showed better results in the dominant model for the variant A allele. (adjusted HR [aHR] = 0.67, 95% CI = 0.45-1.00, P = 0.05; aHR = 0.78, 95% CI = 0.63-0.97, P = 0.03; and aHR = 0.79, 95% CI = 0.63-0.99, P = 0.04, respectively). TNFRSF1B rs1061624G>A and BCL2 rs2279115C>A showed poor OS in the recessive model for the variant (aHR = 1.42, 95% CI = 1.10-1.84, P = 0.007; and aHR = 1.83 , 95% CI = 1.31-2.56, P= 0.0004, respectively). Patients with BIRC5 rs9904341 CG+GG genotype showed significantly poor overall survival (OS) compared to patients with CC genotype (aHR = 1.35, 95% CI = 1. 04-1.75, P = 0.03).

Next, after the clinical results after cytotoxic chemotherapy were stratified according to tumor histology, the influence of 6 SNPs on the survival results was further analyzed. 3 SNP (XPD/ERCC2 rs1052555C>T, BRCA1 rs799917C>T, and BIRC5 rs9904341C>G) was significantly associated with overall survival (OS) only in adenocarcinoma (AC) (aHR = 0.33, 95% CI = 0.17-0.64, P = 0.001,P for heterogeneity (PH) = 0.01; aHR = 0.62, 95% CI = 0.44-0.86, P = 0.004, PH = 0.05; and aHR = 1.66, 95% CI = 1.14-2. 44, P = 0.009, PH = 0.04), 2 SNPs (TNFRSF1B rs1061624G>A, and BCL2 rs2279115C>A) were significantly associated with overall survival (OS) only in squamous cell carcinoma (SCC) (aHR = 1.70, 95% CI = 1.17-2.46, P = 0.005, PH = 0.23; and aHR = 2.78, 95% CI = 1.62-4.80, P = 0.0002, PH = 0.04; Table 5 and 1-6). However, CASP8 rs3769818G>A was not significantly related to the overall survival rate of squamous cell carcinoma or adenocarcinoma. None of these polymorphisms were associated with patient or tumor-related factors such as age, sex, smoking status, histologic type, pathological stage or adjuvant therapy.

3. Of SNP Effect of combination on overall survival rate

Since the rs1052555 CC, rs799917 CC, rs1061624 AA, rs2279115 AA, rs9904341 CG+GG and rs3769818 GG genotypes are associated with poor survival outcomes, we consider 6 genotypes to be poor genotypes and treat patients according to the number of poor genes. Grouped to evaluate the effect.

As shown in Table 6, as the number of unfavorable genes increased, MST decreased (MST = 18. 0 months, 95% CI = 13. 8-22. 1; MST = 13. 7 months, 95% CI = 9. 9-17. 5; MST = 12. 1 months, 95% CI = 10.3-13. 8, respectively; Log-Rank P=1x10 ^-6 ). Based on multivariate analysis, patients with 3 and 4-6 bad genes had significantly worse OS compared to patients with 0-2 bad genes.

Next, the combined effect of SNP on the survival result according to tumor histology was analyzed (Table 7). 2 SNPs (TNFRSF1B rs1061624 AA, BCL2 rs2279115 AA), which are only related to the overall survival rate of squamous cell carcinoma, and 3 SNPs (XPD/ERCC2 rs1052555CC, BRCA1 rs799917CC, andBIRC5 rs9904341CG+GG), which are only related to the overall survival rate of adenocarcinoma. Each was considered a poor genotype and analyzed. When analyzed using the rs1061624 AA and rs2279115 AA genotypes as bad genotypes, 0 bad genotypes (MST = 15. 8 months, 95% CI = 12. 8-18. 8, Log-Rank P=7x10) ^{Compared to -5} ), the MST of 1-2 cases of poor genotype (MST = 11. 8 months, 95% CI = 9. 8-13. 9) was much shorter. When multivariate analysis was performed, the OS was significantly worse in cases where the poor genotype was 1-2 compared to 0 (aHR = 2. 03, 95% CI = 1.42-2.89, P=9x10 ^-5 ) . When the rs1052555 CC, rs799917 CC, and rs9904341 CG+GG genotypes were considered as bad genotypes and analyzed, the MST of AC patients decreased as the number of bad genotypes increased (MST = 23. 9 months, 95% CI = 11.1-36. 7; MST = 17. 8 months, 95% CI = 13.3-22. 3; and MST = 11. 0 months, 95% CI = 9. 0-13. 0, respectively; Log -Rank P=3x10 ^-6 ). When multivariate analysis was performed, patients with 2-3 poor genotypes had significantly worse OS than those with 0-1 poor genotypes (aHR = 1.79, 95% CI = 1. 13-2 83, P = 0.01; and aHR= 3. 32, 95% CI = 2. 02-5. 46, P=2x10 ^-6 , respectively; Ptrend=1x10 ^-6 ).

<110> D&P Biotech, Ltd. <120> Markers for predicting survival and the response to anti-cancer drug in a patient with lung cancer <160> 6 <170> KopatentIn 1.71 <210> 1 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is c or t <400> 1 gatgccaacc tcaacctgac cgtggaygag ggtgtccagg tggccaagta ct 52 <210> 2 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is c or t <400> 2 ggtttcaaag cgccagtcat ttgctcygtt ttcaaatcca ggaaatgcag aa 52 <210> 3 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is a or g <400> 3 cctgcaggcc aagagcagag gcagcgygtt gtggaaagcc tctgctgcca tg 52 <210> 4 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is a or c <400> 4 tccgtccccg gctccttcat cgtcccytct cccctgtctc tctcctgggg ag 52 <210> 5 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is c or g <400> 5 gccattaacc gccagatttg aatcgcygga cccgttggca gaggtggcgg cg 52 <210> 6 <211> 52 <212> DNA <213> Homo sapiens <220> <221> variation <222> (27) <223> y is c or t <400> 6 catcgcctct gaaatacatc acataayatt gtgactgtct gtgggggaaa gc 52

Claims (11)

For gene samples from patients,
A SNP (NCBI refSNP ID: rs1061624) located in the 27th base of the sequence represented by SEQ ID NO: 3 in the TNFRSF1B gene and a SNP located in the 27th base of the sequence represented by SEQ ID NO: 4 in the BCL2 gene ID: rs2279115). &Lt; RTI ID = 0.0 &gt;
Methods for providing information for predicting the response and survival prognosis of anticancer drugs in lung cancer patients. 2. The method of claim 1, wherein the anticancer agent is paclitaxel and cisplatin. 2. The method of claim 1, wherein said patient is lung cancer is non-small cell lung cancer. 4. The method of claim 3, wherein the non-small cell lung cancer is squamous cell cancer. A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 3 (NCBI refSNP ID: rs1061624) in the TNFRSF1B gene, or a complementary polynucleotide thereof; And
A polynucleotide consisting of 10 or more consecutive bases comprising the 27th base of the sequence represented by SEQ ID NO: 4 (NCBI refSNP ID: rs2279115) in the BCL2 gene, or a complementary polynucleotide thereof.
A composition for predicting the response and survival prognosis of an anticancer agent in lung cancer patients. A composition for predicting the reactivity and survival prognosis of an anticancer agent in a lung cancer patient comprising a polynucleotide that specifically hybridizes with the polynucleotide of claim 5. 7. The composition of claim 6, wherein the specifically hybridizing polynucleotide is an allele-specific probe or an allele-specific primer. A composition for predicting the reactivity and survival prognosis of an anticancer agent in a lung cancer patient comprising a polypeptide encoded by the polynucleotide of claim 5. 6. The composition of claim 5, wherein the anticancer agent is paclitaxel and cisplatin. A microarray for predicting the reactivity and survival prognosis of an anticancer agent in a lung cancer patient comprising the polynucleotide of claim 5, a polynucleotide that hybridizes therewith, or a polypeptide specifically or specifically encoded thereby. A kit for predicting the response and survival prognosis of an anticancer agent in lung cancer patients including the microarray of claim 10.

Images