KR20150044534A - Recombinant vector for screening of anticancer agent comprising human Noxin promoter fragment and screening method of anticancer agent by using it - Google Patents

Abstract

The present invention relates to a recombinant vector for screening anticancer agents including a human Noxin promoter fragment and a screening method of anticancer agents using the same wherein a vector is made having a human Noxin promoter combination and luciferase which is a reporter, and is transformed in a cancer cell line and treated with a novel drug, thereby enabling the vector including a transcription factor having a binding part to have a decreased NFAT2 function due to the drug in expressed transgenic cancer cell lines and decreasing the transcription activity and the expression of human Noxin and inhibiting cell growth, which enables the recombinant vector for screening the anticancer agent including the human Noxin promoter fragment to be used for screening anticancer materials.

Description

Technical Field [0001] The present invention relates to a recombinant vector for screening an anticancer agent comprising a human Noxin promoter fragment and an anticancer agent screening method using the anticancer agent,

The present invention relates to a recombinant vector for screening an anticancer agent comprising a fluorescent protein gene linked to a human Noxin (human Noxin) promoter fragment, and a method for screening an anticancer agent using the recombinant vector.

Human Genome Project Research shows that there is a new era of bio-biotechnology that aims to understand human diseases at the molecular level, to discover new disease-related targets, and to develop new drugs using them. As a result, the era of personalized medicine that diagnoses, treats, and predicts various diseases according to individual patients with different genetic environments is coming to the reality. Customized medicine includes biomarkers for genome diagnosis, targeting treatment technology, discovery of disease-specific drug action points, new drugs for target treatment, accurate clinical information, genome information of patients, genome dynamics results, Matrix and others should be complemented by the development of drug genome technology. In particular, in order to be competitive in customized medicine, it is important to develop a drug prediction system for diseases and individuals, to discover diagnostic biomarkers, to develop new target genes and proteins, and to develop therapeutic agents using them.

In recent years, there has been a fierce competition for exploring therapeutic targets and studying the functions of genes involved in the generation and treatment of cancer, which is a worldwide incurable disease, in order to use them for diagnosis and therapeutic drug development. With the activation of the genome research, studies on human gene DNA chip or proteome analysis have been actively conducted, and a large number of genes related to cancer have been discovered. Therefore, a list of many genes and related databases have been established, but most of these genes Biological function and cancer relevance have not yet been studied or are uncertain, and there are considerable difficulties in actual cancer-related or diagnostic and target genes.

Human Noxin (human Noxin) is an anti-apoptotic factor for the FLJ25416 gene (GenBank accession number: FLJ25416, FLJ13936, UniProtKB / TrEMBL entry Q8IXT1). For example, in the absence of human Noxin protein under normal conditions of stress and stress, cell death increases. In addition, Noxin protein has been reported to induce cell cycle arrest in G1 or early S phase in a p53 / TP53-independent manner, but its function is not well known until now.

Accordingly, the present inventors prepared a vector containing a combination of a human Noxin promoter and a reporter (luciferase) in order to find a method of screening anticancer substances for cancer treatment using a target gene, As a result of the transformation and treatment of the new drug, the NFAT2 action was inhibited by the drug in the transformed cancer cell line containing the NFAT2 transcription factor binding site in the human Noxin promoter combination, thereby reducing the transcription activity and expression of human Noxin , Confirming that the cell growth is inhibited, the recombinant vector for screening an anticancer agent comprising the human Noxin promoter fragment can be used for screening of anticancer substances, thereby completing the present invention.

An object of the present invention is to provide a recombinant vector comprising at least one human Noxin (human Noxin) promoter fragment selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 and a fluorescent protein gene linked to the promoter fragment And to provide a recombinant expression vector for anticancer drug screening.

In order to accomplish the object of the present invention, the present invention provides a recombinant vector comprising at least one human Noxin (human Noxin) promoter fragment selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, A recombinant expression vector for screening an anticancer agent containing a fluorescent protein gene linked thereto.

The present invention also provides a transformed cell line for screening an anticancer agent transformed with the recombinant expression vector.

In addition,

1) culturing the recombinant expression vector transformed cell line;

2) treating the cell line of step 1) with the test substance; And

3) treating the test substance of step 2), and then measuring the fluorescence of the fluorescent protein.

The present invention relates to a recombinant vector for screening an anticancer agent comprising a human Noxin (human Noxin) promoter fragment and a method for screening an anticancer agent using the recombinant vector, which comprises a combination of a human Noxin promoter and a reporter luciferase As a result, NFAT2 activity by the drug was inhibited in the transformant cancer cell line expressing the vector containing the NFAT2 transcription factor binding site in the human Noxin promoter combination, By confirming that the transcriptional activity and expression of Noxin is decreased and the cell growth is inhibited, the recombinant vector comprising the human Noxin promoter fragment can be usefully used for screening of anticancer substances.

1A shows growth inhibition of a lung cancer cell line by knockdown of human Noxin (hNoxin).
FIG. 1B shows cell viability of a lung cancer cell line caused by depression of human Noxin. FIG.
FIG. 2A is a schematic diagram of a luciferase vector containing a combination of human Noxin promoter prepared according to a transcription factor binding site. FIG.
FIG. 2B is a graph showing the transcriptional activity of human Noxin in the human Noxin promoter combination luciferase transfected cells according to the transcription factor binding site.
FIG. 3A is a schematic diagram of a human Noxin promoter-combining luciferase vector according to an exon region. FIG.
FIG. 3B is a graph showing the transcriptional activity of human Noxin in the human Noxin promoter combination luciferase transfected cells according to the exon region.
4A is a schematic diagram showing a point mutant luciferase vector of the NFAT2 binding site in the human Noxin promoter.
4b shows the transcriptional activity of human Noxin in point mutant luciferase vector transfected cells of the NFAT2 binding site in the human Noxin promoter.
Figure 5A is a schematic representation of the binding site of the NFAT2 transcription factor in the human Noxin promoter.
FIG. 5B shows the binding sites of NFAT transcription factors in the human Noxin promoter.
6A is a graph showing the degree of human Noxin mRNA expression by overexpression of NFAT1 and NFAT2.
FIG. 6B is a graph showing the degree of human Noxin mRNA expression due to the fall of NFAT1 and NFAT2.
FIG. 7A is a graph showing the effect of NFAT2 on growth inhibition of lung cancer cells.
7B is a graph showing the inhibitory effect of human cancer cell Noxin mRNA on NFAT2 knockdown.
8A is a graph showing human Noxin transcription activity by phorbol myristate acetate (PMA) / A23187 (PA) and cyclin A (cyclase A), which is a calcineurin inhibitor, activating the NFAT signaling system (CsA).
8B is a graph showing the degree of human Noxin expression by PMA / A23187 and cyclosporin A. FIG.
Figure 9 is a schematic diagram of cloning a human Noxin promoter, enhancer and repressor into a pGL4.17 luciferase vector in which a neomycin selection marker is present.
FIG. 10 is a graph showing the transcriptional activity of human Noxin in the cell line by preparing a transformed cell line expressing the human Noxin promoter.
11A is a diagram showing a novel drug showing a growth inhibitory effect in a transformed cell line expressing a human Noxin promoter.
FIG. 11B is a graph showing the transcriptional activity of human Noxin in a transformed cell line expressing a human Noxin promoter treated with new drugs showing growth inhibitory effect.
FIG. 11C shows the expression level of human Noxin mRNA in cells treated with new drugs showing growth inhibitory effects.

Hereinafter, the present invention will be described in detail.

The present invention provides a recombinant vector comprising at least one human Noxin (hNOxin) promoter fragment selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 and a fluorescent protein gene linked to the promoter fragment A recombinant expression vector for screening anticancer agent is provided.

The fluorescent protein is preferably but not limited to luciferase, enhanced green fluorescent protein (EGFP), or cyan fluorescent protein (CFP).

The promoter fragment preferably binds to a transcription factor that controls the expression of the hNoxin gene, but is not limited thereto.

The transcription factor is preferably selected from the group consisting of p300, NF-1, C / EBP, SP1, and NFAT, but is not limited thereto.

The anticancer agent preferably inhibits the action of NFAT2, but is not limited thereto.

In a specific example of the present invention, the inventors of the present invention conducted experiments to observe cell growth of normal and human Noxin knockdown cancer cells in order to confirm the inhibitory effect of inhibiting the expression of human Noxin (human Noxin, hNoxin) As a result of SRB analysis (sulforhodamine B assay), it was confirmed that human Noxin knockdown lung cancer cell line inhibited cell growth and decreased cell viability compared to normal cell line, Inhibition and cell death (see Figures 1A and 1B).

In order to confirm the function of the transcription factors that regulate the expression of the human Noxin gene, the present inventors used the human Noxin promoter region to which the transcription factors p300, NF-1, C / EBP, (1.3, SEQ ID NO: 1) at -1206 bp position, +125 (0.8, SEQ ID NO: 2) at -717 bp position and +125 0.4, SEQ ID NO: 3) was selected and cloned into a pGL2-luciferase vector as a receptor vector to prepare a pGL2-hNoxin promoter-luciferase vector, and the respective pGL2- -hNOXin promoter-luciferase vector, the transcription activity was measured. As a result, it was confirmed that the luciferase activity of each hNoxin promoter produced in transformed HEK293 cells and HeLa cells was similar, Of the three hNoxin promoters Yi sa activity was confirmed that similar (see Figures 2a and 2b).

In order to confirm the function of the transcription factors that regulate the expression of the human Noxin gene, the inventors of the present invention constructed a human Noxin promoter region, a fragment between the exon 1 and the exon 2, and a region between the exon 3 and the exon 4, As shown in the schematic diagram and in Table 3, it was recognized that a region above -1206 nucleotides from the hNOxin transcription initiation base was recognized as a promoter, P1 (the same as -1206 bp to +125 region, SEQ ID NO: 1), P1 to +315 nucleotide sequence 520 bp between exon 1 and exon 2 was named P2 (SEQ ID NO: 5), 665 bp between exon 3 and exon 4 was named P4 (SEQ ID NO: 6) pGL2-luciferase vector (P1) containing P2, pGL2-luciferase vector (P2) containing P2, pGL2-luciferase vector (P4) containing P4, pGL2- Luciferase vector (P2P4), pGL2-luciferase vector (P1P2) containing P1 and P2, P1 and P4 A pGL2-luciferase vector (P1P4) containing P1, P2 and P4, a pGL2-luciferase vector (P1 +) containing P1 and +315, P1, +315 and P2 (P1 + P4), including pGL2-luciferase vector (P1 + P2) containing P1, +315 and P4 and pGL2-luciferase vector (P1 + P2P4), the transcriptional activity was measured using the cells transformed with each of the pGL2-hNoxin promoter-luciferase vectors. As a result, transfected HEK293 cells and HeLa cells were found to express the human Noxin promoter And that the P1 promoter promotes the transcriptional activity by confirming that the P1 promoter having the P1 and promoter P1 sequences including the P1 and +315 nucleotide sequences exhibit luciferase activity (see FIGS. 3A and 3B).

In order to confirm that human Noxin transcription activity is inhibited through mutation of the NFAT binding site in the human Noxin promoter, the inventors of the present invention found that four kinds of NFAT binding site mutations MT1 (SEQ ID NO: 22) in the human Noxin -350 to +125 bp region, , MT2 (SEQ ID NO: 23), MT3 (SEQ ID NO: 24) and MT4 (SEQ ID NO: 25) were transfected with pGL-luciferase vectors. As a result, the MT4 point mutant promoter was transformed By confirming the decrease of luciferase activity in one cell, it was confirmed that the MT4 position in the NFAT binding site of the human Noxin promoter regulates human Noxin expression (see FIGS. 4A and 4B).

In order to confirm the direct human Noxin promoter binding and binding positions of NFAT transcription factors, the inventors of the present invention performed chromatin-immunoprecipitation for NFAT binding sites A, B, C and D as shown in the schematic diagram of FIG. As a result, when NFAT2 was immunoprecipitated with NFAT2 antibody and amplified with NFAT binding site C and D primer, NFAT2 was directly bound to NFAT binding site C and D site of human Noxin promoter by confirming that PCR product was detected, (Fig. 5A and Fig. 5B).

In order to confirm the expression of human Noxin by NFAT2 as a transcription factor of human Noxin, the present inventors performed RT-PCR and Western blotting using NFAT1 and NFAT2-overexpressing HEK293 cells and NFAT1 and NFAT2 knockdown HEK293 cells Western blotting revealed that human Noxin mRNA was expressed in NFAT2-overexpressed cells and Nox2 mRNA expression was promoted by NFAT2 by confirming that human Noxin mRNA expression was decreased in NFAT2 knockdown cells (See Figs. 6A and 6B).

In order to examine the effect of NFAT2-induced human Noxin expression on NFAT2-induced cancer cell growth, SRB analysis and RT-PCR using NFAT2 decayed cancer cells showed that NFAT2 decreased lung cancer cells Viability and the expression of human Noxin gene were decreased, it was confirmed that NFAT2 induces the expression of human Noxin gene as a transcription factor of human Noxin to promote cell growth (FIGS. 7A and 7B).

In order to confirm the expression of human Noxin and the regulation of transcriptional activity by the NFAT signal system, the inventors of the present invention found that PF (Phorbol myristate acetate), which is an NFAT signal system activating substance, and A23187, which is calcium ionophore, The transcriptional activity of human Noxin was measured using pGL-hNoxin luciferase vector (-350 to +125) transformed HEK293 cells treated with cyclosporin A, which is a calcineurin inhibitor, and RT-PCR was performed As a result, the luciferase activity and the amount of human Noixn mRNA of the human Noxin promoter of the cells treated with PMA / A23187 were increased, whereas in the case of cells treated with cyclophorin A, the luciferase activity of the human Noxin promoter And confirming that the amount of human Noxin mRNA was decreased, it was confirmed that the transcriptional activity and expression of human Noxin were regulated by the NFAT signal system (see FIGS. 8A and 8B).

In order to screen for a drug that regulates human gene expression, the present inventors have transfected a pGL2 vector containing the P1 or P1, P2, and P4 regions (P1P2P4) into HeLa cells to obtain a stable human Noxin promoter-expressing transformant cell line And the transcriptional activity was measured. As a result, it was confirmed that luciferase activity was high in the fourth clone among the transformed cell lines expressing the human Noxin P1 promoter region, and the transformed cell line was used for drug screening Reference).

Further, in order to identify a drug that inhibits the transcriptional activity of human Noxin, the present inventors treated 1000 new kinds of drugs with # 4 transfected cell line and analyzed SRB, transcriptional activity and RT-PCR. As a result, Cell viability and luciferase activity of the human Noxin promoter decreased in # 1, # 6, # 7, # 10, # 14 and # 25 treated cells of 1000 kinds of new drugs, # 6, and # 7 significantly reduced the amount of human Noxin mRNA in the transformed cell line treated with the cells # 1, # 6, and # 7, inhibited human Noxin transcriptional activity and expression of HeLa cells, , And thus it was confirmed that the human Noxin promoter transfected cell line can be used for screening anticancer substances (see FIGS. 11A to 11C).

Therefore, in the cancer cell line transformed with the expression vector of the human Noxin promoter fragment containing the NFAT2 binding site of the present invention, the action of NFAT2 is inhibited by the drug to decrease the transcription activity and expression of human Noxin, The recombinant expression vector containing the promoter fragment and the fluorescent protein gene linked to the promoter fragment can be usefully used for screening anticancer substances.

The present invention also provides a recombinant expression vector comprising a recombinant expression vector comprising at least one human Noxin promoter fragment selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 and a fluorescent protein gene linked to the promoter fragment Thereby providing a transformed cell line for anticancer drug screening.

In the cancer cell line transformed with the expression vector of the human Noxin promoter fragment containing the NFAT2 binding site of the present invention, the action of NFAT2 is inhibited by the drug to decrease the transcription activity and expression of human Noxin, Therefore, a cell line transformed with a recombinant expression vector containing a promoter fragment and a fluorescent protein gene linked to the promoter fragment can be usefully used for screening anticancer substances.

In addition,

1) culturing a recombinant expression vector transformed cell line comprising at least one human Noxin promoter fragment selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 and a fluorescent protein gene linked to the promoter fragment ;

2) treating the cell line of step 1) with the test substance; And

3) treating the test substance of step 2), and then measuring the fluorescence of the fluorescent protein.

Wherein the cancer is selected from the group consisting of lung cancer, colon cancer, rectal cancer, colon cancer, breast cancer, cervical cancer, endometrial cancer, fallopian tube carcinoma, ovarian cancer, vaginal carcinoma, vulvar carcinoma, liver cancer, gastric cancer, small bowel cancer, pancreatic cancer, Cancer of the ovary, cancer of the urethra, cancer of the urethra, prostate cancer, testicular cancer, thyroid cancer, pituitary cancer, adenocarcinoma, soft tissue sarcoma, non-small cell lung cancer, bone cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, Chronic or acute leukemia, lymphoma lymphoma, central nervous system tumor, spinal cord tumor, brainstem glioma, and pituitary adenoma. However, the present invention is not limited thereto.

In the cancer cell line transformed with the expression vector of the human Noxin promoter fragment containing the NFAT2 binding site of the present invention, the action of NFAT2 is inhibited by the drug and the transcriptional activity and expression of human Noxin are decreased, and the cell growth is inhibited Therefore, a cell line transformed with a recombinant expression vector containing a promoter fragment and a fluorescent protein gene linked to the promoter fragment can be usefully used for screening anticancer substances.

Hereinafter, the present invention will be described in detail with reference to examples.

It should be noted, however, that the following examples are illustrative of the present invention and are not intended to limit the scope of the present invention.

< Example  1> Human Noxin ( human Noxin , hNoxin ) On knockdown  Confirmation of inhibition of cancer cell growth by

In order to confirm the inhibitory effect of human Noxin (hNoxin; SEQ ID NO: 7) on the growth of cancer cells, siRNAs were used to produce hNOxin knockdown cancer cells and then subjected to SRB analysis (sulforhodamine B assay).

Specifically, the human pulmonary normal cells CCD34Lu (CRL-1491), CCD39Lu (CRL-1498) and lung cancer cell A549 (CRL-185) purchased from the Biotechnology Research Center Bio Evaluation Center cell line bank, NCI- H1703 was cultured in a DMEM or RPMI medium supplemented with 10% FBS at a rate of 6000 for normal cells and 10000 for cancer cells on a 48-well plate for 24 hours. Then, 0.5 μl of Lipofectamine 2000 ) (Invitrogen) and 10 nM of hNOxin specific siRNA (ST Pharm. Korea) or control group scramble siRNA (ST Pharm. Korea) for 20 minutes and transfected. After 72 hours, the degree of cell growth was observed under a microscope (Fig. 1a) and SRB (Sulforhodamine B) analysis was performed (Fig. 1b). For SRB analysis, the cells growing on the plate were fixed with 4% formalin and allowed to stand at room temperature for 60 minutes, followed by washing with tap water for 4 to 5 times. The washed plate was dried, and then 100 μl / well of 0.4% SRB (a solution in which 0.1% acetic acid was dissolved; protein staining reagent) was added. Then, the plate was allowed to stand for 30 minutes and washed with 0.1% acetic acid to remove unbound dyeing reagent and dry the plate. Then, 100 쨉 l / well of 10 mM Tris base (pH 10.5) was added to dissolve the staining reagent, absorbance was measured at 540 nm, and cell growth was calculated as a percentage.

As a result, as shown in FIG. 1A and FIG. 1B, cell growth of the normal cell line was not inhibited, but cell growth of the two types of lung cancer cell lines inhibiting hNOxin expression using siRNA was inhibited and cell viability was confirmed Thus, it was confirmed that by controlling the expression of hNOxin, specific cancer cell growth can be suppressed and cell death can be controlled (FIGS. 1A and 1B).

< Example  2> Various hNoxin  Promoter promoter ) Combination Cloning ( cloning ) And transcriptional activation confirmation

<2-1> Depending on transcription factor binding site hNoxin  Promoter combination Cloning  And transcriptional activation confirmation

In order to confirm the function of the transcription factors that regulate the expression of hNoxin gene, various combinations of DNA fragments including hNoxin promoter regions to which transcription factors p300, NF-1, C / EBP, ) Vector, pGL2 luciferase vector, and the transcriptional activity was measured using the cloned promoter combination.

Specifically, HEK293 cells (ATCC) were recovered and total RNA was isolated using Trizol (Invitrogen). The separated RNA was used as a template using RT-PCR kit (Invitrogen) according to the manufacturer's procedure Genomic DNA was synthesized. Using the above-mentioned genomic DNA as a template for PCR, polymerase chain reaction (PCR) was performed using the primer shown in Table 2 below. (0.8, SEQ ID NO: 2) at position -717 bp and +125 (0.4, SEQ ID NO: 3) at position -350 bp at position -1206 bp from the hNOxin mRNA start site Were selected to produce hNoxin promoter fragments. Each of the DNA fragments was cloned into pGEM-T easy vector (Promega) and the nucleotide sequence was analyzed. Then, the fplmid and pGL2 luciferase vectors containing the respective promoter fragments were digested with SacI and XhoI restriction enzymes, and the gene fragments were subcloned into pGL2-luciferase vector. (Fig. 2A).

snippet order -1206 to +125 positions
(1.3) ATTTTACGGACTGTACTACTGATCCACCTGTCGGGGAGAAAGACTCTACCCGCAGTTTGACGAAAATGGTCGTTTCCAGATGCTTGTAGGATTTCCTCGCTAAGCTCCACCCTCTGCGGCGCCTTCTTCTGATTGGCTCTGAGTAATCAGAGCCAAAGCGTTACTTCCGGCGGAAAAGGACGCGGGAGATTCGATTGGAAGGCTGCCGGCGTGCTACTGAGTTCGGCCGGTCCGAGTCACTGTGCGTCGCCTGGGCCCGTTCCTGGTCTTCTCCCCCAGGTGAGCTGGGTAAAGGGGTTCTCGGGAAG (SEQ ID NO: 1) -717 to +125 locations
(0.8) CTACAGATGTGGAAACTGAGGCTCAGAGAGGTGCGGGAACTTGCACTAGATCACTCAGCAGTGAGCGGAGCACGTCGTCGCAGACCGCTGGGTCCAGGTCCAAAGACTGTGCTCCTTGCACCCACCTCCATCTGGAGCCTAACCACTCCCTATGATACTCCGTTCTTGGGTCACCCCAAAACTGTGTTGCTCGCACAACCCATCCATTACACAGGTCGCCCCGGGTCCACATCGCCCCTAAATCCCGCCAGGTCCCGGTCCCTTCTTTCAAATAACGCCCCCTTTCTTCTCCGGCACCCGAAAACCCACTCCGCGCTCCACCCCCCTCCTGCCTCCTGCCACCGCCCCCTTCCTCCCTCCGCCCGTGGGTAGT GCTAG CCCCTAGGACAGCGCCGGGTCTGGCTTCCAAAGCTCCCTCAACCCTCTTCATCCAGCTTCCATTCCCTCTTTCAGTCACCCCGCCAGACCCCAGGGCGCTGCGGCTCACTCCACACTTTCCCGGGAACCCTACGCCCAGGAGGCTCAGCGAAGCTCCAAAACCAATTTTACGGACTGTACTACTGATCCACCTGTCGGGGAGAAAGACTCTACCCGCAGTTTGACGAAAATGGTCGTTTCCAGATGCTTGTAGGATTTCCTCGCTAAGCTCCACCCTCTGCGGCGCCTTCTTCTGATTGGCTCTGAGTAATCAGAGCCAAAGCGTTACTTCCGGCGGAAAAGGACGCGGGAGATTCGATTGGAAGGCTGCCGGCGTGCTACTGAGTTCGGCCGGTCCGAGTCACTGTGCGTCGCCTGGGCCCGTTCCTGGTCTTCTCCCCCAGGTGAGCTGGGTAAAGGGGTTCTCGGGAAG (SEQ ID NO: 2) -350 to +125 position
(0.4) GCTAGCCCCTAGGACAGCGCCGGGTCTGGCTTCCAAAGCTCCCTCAACCCTCTTCATCCAGCTTCCATTCCCTCTTTCAGTCACCCCGCCAGACCCCAGGGCGCTGCGGCTCACTCCACACTTTCCCGGGAACCCTACGCCCAGGAGGCTCAGCGAAGCTCCAAAACCAATTTTACGGACTGTACTACTGATCCACCTGTCGGGGAGAAAGACTCTACCCGCAGTTTGACGAAAATGGTCGTTTCCAGATGCTTGTAGGATTTCCTCGCTAAGCTCCACCCTCTGCGGCGCCTTCTTCTGATTGGCTCTGAGTAATCAGAGCCAAAGCGTTACTTCCGGCGGAAAAGGACGCGGGAGATTCGATTGGAAGGCTGCCGGCGTGCTACTGAGTTCGGCCGGTCCGAGTCACTGTGCGTCGCCTGGGCCCGTTCCTGGTCTTCTCCCCCAGGTGAGCTGGGTAAAGGGGTTCTCGGGAAG (SEQ ID NO: 3)

primer order -1206 to +125 position (1.3)
Forward 5'-ATGAGCTCGGGAAACCCAAAGCCA-3 '(SEQ ID NO: 8) Reverse 5'-TGCTCGAGCTTCCCGAGAACCCCTTTACC-3 '(SEQ ID NO: 9) -717 to +125 position (0.8)
Forward 5'-TCAGAGCTCCTACAGATGTGGAAACTGAGGC-3 '(SEQ ID NO: 10) Reverse 5'-TGCTCGAGCTTCCCGAGAACCCCTTTACC-3 '(SEQ ID NO: 11) -350 to +125 position (0.4)
Forward 5'-TCAGAGCTCGCTAGCCCCTAGGACAGCGCC-3 '(SEQ ID NO: 12) Reverse 5'-TGCTCGAGCTTCCCGAGAACCCCTTTACC-3 '(SEQ ID NO: 13)

HEK293 cells were further divided into 48 wells and cultured for one day. Then, 10 ng of each of the pGL2-hNoxin promoter-luciferase vector or pGL2-luciferase vector and 5 ng of the Renilla control vector were added And transformed with Polyfect reagent (QIAGEN INC., USA) according to the manufacturer's procedure. After incubation for 36 hours, the medium was removed and the lysate was obtained using 1 × passive lysis buffer using a dual-luciferase assay system (Promega) The activity of luciferase was measured according to the manufacturer's procedure (Fig. 2b).

As a result, as shown in Fig. 2B, the luciferase activity of the three hNoxin promoters appeared in HEK293 cells at similar levels, all contained the NFAT binding site, and confirmed the same luciferase activity also in HeLa cells, It was confirmed that the transcription activities of the respective hNoxin promoters produced were similar (FIG. 2B).

<2-2> Exon exon ) Depending on site hNoxin  Promoter combination Cloning  And transcriptional activation confirmation

In order to confirm the function of the transcription factors controlling the expression of the hNoxin gene, fragments between the promoter region, exon 1 and exon 2 of the hNoxin, and fragments between the exon 3 and the exon 4 were combined into pGL2 Cloning was carried out in a luciferase vector, and the transcriptional activity was measured using the cloned promoter combination.

Specifically, the genomic DNA was extracted from HEK293 cells as in Example <2-1>, and the genomic DNA was subjected to PCR using primers of the following Table 4 as primers for PCR to obtain P1, P2, P4, And + fragments were prepared. As shown in the schematic diagram of FIG. 3A and in Table 3 below, -1206 nucleotides upstream from the hNOxin transcription initiation base were recognized as promoters and P1 (identical to the promoter fragment from -1206 bp to +125 from the hNOxin mRNA start site, 1.3, (SEQ ID NO: 5) between exon 1 and exon 2, 665 bp between exon 3 and exon 4 (SEQ ID NO: 5) Was named P4 (SEQ ID NO: 6). Each of the DNA fragments was cloned into pGEM-T easy vector (Promega) and the nucleotide sequence was analyzed. Then, the plasmid combination containing each promoter fragment and the pGL2 luciferase vector were digested with restriction enzymes, and the respective promoter combinations were subcloned into the pGL2-luciferase vector to obtain 11 hNoxin promoter vectors, P1 , PGL2-luciferase vector (P1) containing P2, pGL2-luciferase vector (P2) containing P2, pGL2-luciferase vector (P4) containing P4, pGL2-luciferase vector containing P2 and P4 (P1P2) containing P1 and P2, PGL2-luciferase vectors (P1P2) containing P1 and P2, pGL2-luciferase vectors (P1P4) containing P1 and P4, pGL2-luciferase vectors PGL2-luciferase vector (P1 +) containing P1 and +315, pGL2-luciferase vector (P1 + P2) containing P1, +315 and P2, pGL2-luciferase vector containing P1, (P1 + P4), and P1, +315, P2 and P4 were obtained (Fig. 3a).

snippet order P1 + ATTTTACGGACTGTACTACTGATCCACCTGTCGGGGAGAAAGACTCTACCCGCAGTTTGACGAAAATGGTCGTTTCCAGATGCTTGTAGGATTTCCTCGCTAAGCTCCACCCTCTGCGGCGCCTTCTTCTGATTGGCTCTGAGTAATCAGAGCCAAAGCGTTACTTCCGGCGGAAAAGGACGCGGGAGATTCGATTGGAAGGCTGCCGGCGTGCTACTGAGTTCGGCCGGTCCGAGTCACTGTGCGTCGCCTGGGCCCGTTCCTGGTCTTCTCCCCCAGGTGAGCTGGGTAAAGGGGTTCTCGGGAAGCCGAAGAGCCGGAGACTCCTAAGGAGGCTCTTAACTTCATTATGAATGAGACCCACCCAGAGCCCGGCGCTTGTTTTTTCACAAGTGGTTCTCTGTAAACGGGCAGCCATGAGGGTAACAGAATATAAACGTCAGTTATTTTATTTTAGACTCAGTGCTTTTGCAATCACCTAACGAACGTTTATTGAACACTTACAGTGCCATCGAGCTAGACTCGGAGTGAGCTTTTAGAATCGGAAATAGAGAGGAAAAGGCGCGACTCTTGCTTCTGTAATGTGCAAATACGTATTCAGTGGGCCACTGTGCAGAGTAGTA (SEQ ID NO: 4) P2 TCATTCAATTATTCATCAGACATGCATCCACTATACTGCAAGTCAAGCAGTAGAGAGAGACAGAGAAATAAAACAAAGTATAAAAACACCCCCAGAGCCTAGGTAAATAAATAAATAAATACAAAAATAAACTAGGTGGCAAGTATGAAGGAAATATTATGAAAACACCAAAGGAAATTAATTAACAGTAACTGTCTGAAACGATCTTATTCTATTATTGTCCAACAGACAATAAATGGGAAGCCTTTTTGCCATTTTCTGGGGTTCACCAGGTGAAATACAAATAGTAAAAATACTAATGATCCCTTTCATTACAGTTCTCAAATTTGCTGTTTTTATAGATTTTTAGACTTACTTATTTGATCCACTAGAGGGCAGTAAACCCTTAAATAAAGACAATGTAACCAACCTTCCTTTAAAAGTATAGTAATAAGTGCTGGCACAATTAATTTAGAAATGAACCCAAAATTTCCTGCTTATTTAAGTTTTTCATTTATTAGTGAGTTGTCTGCCCAATTAG (SEQ ID NO: 5) P4 CTTTGTCATCTCAGATAAAAATTCAAACTAATTTCCCCATTTGTAAATTTTACCTATAAAAATGAAATAATGTATGTTGAAAACATTTGTAAACTGAATGCTAATGCATATTAGTCTAAGTTTTGCTAGGAATTTTACATTAAACCTGTATGCATTATTGCATAGCCTTTAAAGAAATTCCAATATATATTTTAAACAGTTCATTTCCCTAGAGTTTGGTACTAATGGAGTTTTATCCCCTAGTGAGTCAATTACCTTTAATTCATTCTATGGCTAACCTACAGCACAAACTCTAGCAGATTTGTATAGGATTATATGAATGGGTTGGTATAGATCTATCCTCAGTATGGCAGAAGAATAACAGCACAGATCTAATAAAGGTGAGTCACTTTCAGAGCTACAGATTTTAGACTCCCCCTAGTGGCCATCTGGCAACAATCAAATTTATACAACCATCTTTCACCTTGCTTTCTGTTTGCCTTTTGCCACTCTTTTTTAAGATCTTTAGCAATCTGAAGAAAAAACAAAATTCTAGTATTAGCCATTACCATAAAATGTTTTTAGGTGCTTGTTGTATTTCAAAAAAATTTTTTAAACTATTCTGTCTGTTAAATAAAGTTAACCTAACTGAGGGGTGGACATTAAGAACCTGAAAGATAGAAATC (SEQ ID NO: 6)

primer order P1
Forward 5'-ATGAGCTCGGGAAACCCAAAGCCA-3 '(SEQ ID NO: 14) Reverse 5'-TGCTCGAGCTTCCCGAGAACCCCTTTACC-3 '(SEQ ID NO: 15) P2
Forward 5'-GCTCTCGAGTCATTCAATTATTCATCA-3 '(SEQ ID NO: 16) Reverse 5'-GTTAAGCTTCTAATTGGGCAGACAACT-3 '(SEQ ID NO: 17) P4
Forward 5'-GTTAAGCTTCTTTGTCATCTCAGATAA-3 '(SEQ ID NO: 18) Reverse 5'-GAGAAGCTTGATTTCTATCTTTCAGGT-3 '(SEQ ID NO: 19) P1 +
Forward 5'-ATGAGCTCGGGAAACCCAAAGCCA-3 '(SEQ ID NO: 20) Reverse 5'-GCCTCGAGCGTACTACTCTGCACAGT-3 '(SEQ ID NO: 21)

HEK293 cells were seeded on a 48-well plate as in Example <2-1> and cultured for one day. Then, 100 ng of each pGL2-hNoxin promoter-luciferase vector or pGL2-luciferase vector, 5 ng of the Renilla control vector was transformed with the polypeptide reagent according to the manufacturer's procedure and cell lysates were obtained to determine the activity of luciferase (Fig. 3b).

As a result, as shown in FIG. 3B, P1 + which is the hNOXin promoter in the HEK293 cell and P1 + added with the +315 nucleotide sequence in P1 exhibited luciferase activity while P1P2, P1P4 and P1P2P4 containing P2 and / or P4 Confirmed the inhibition of the luciferase activity of P1. In addition, confirming that the above results were the same in P1 + combination and HeLa cells, it was confirmed that the P1 promoter promoted transcriptional activity and P2 and P4 inhibited the transcriptional activity of P1 (FIG. 3b). Therefore, it was confirmed through the results of Example 2 that the hNOxin promoter produced in various combinations can be used for verifying the function of transcription factors controlling hNOxin expression including NFAT.

< Example  3> hNoxin  Promoter NFAT  Mutation at the binding site Cloning  And its inhibitory effect on transcriptional activity

To determine whether hNOXin transcriptional activity was inhibited by mutation of the NFAT binding site in the hNOxin promoter, four kinds of NFAT binding site mutations at the -350 to +125 bp region of hNoxin were prepared and the transcription activity of hNoxin was measured.

Specifically, pGL2-hNoxin (-350 to +125, 0.4, SEQ ID NO: 3) was designated as WT, and this was used as a template of PCR using a point mutation kit (Enzynomics) After cloning MT1 (SEQ ID NO: 22), MT2 (SEQ ID NO: 23), MT3 (SEQ ID NO: 24) and MT4 (SEQ ID NO: 25), the nucleotide sequences were analyzed as shown in Table 5 (FIG.

Normal DNA sequence Mutant nucleotide sequence MT1 CGGCTCACTCCACAC TTTCC CGGGAACCCTACG CGGCTCACTCCACACTTT AA CGGGAACCCTACG (SEQ ID NO: 22) MT2 GCAGTTTGACGAAAATGGTCG TTTCC AGATGCTTGTAGGATTTCC GCAGTTTGACGAAAATGGTCG TTT AA AGATGCTTGTAGGATTTCC (SEQ ID NO: 23) MT3 TTTCCAGATGCTTGTAGGA TTTCC TCGCTAAGCTCCACCCTC TTTCCAGATGCTTGTAGGA TTT AA TCGCTAAGCTCCACCCTC (SEQ ID NO: 24) MT4 GCCAAAGCGTTACTTCCGGC GGAAA AGGACGCGGGAGATTCGATTG GCCAAAGCGTTACTTCCGGC TT AAA AGGACGCGGGAGATTCGATTG (SEQ ID NO: 25)

Further, 10 ng of each pGL2-hNoxin WT, MT1, MT2, MT3 or MT4 vector, pGL2-luciferase and 5 ng of a Renilla control vector were added to the polyplex reagent , And cell lysates were obtained to measure the activity of luciferase (Fig. 4B).

As a result, as shown in Fig. 4B, compared to the wild-type hNoxin promoter,

It was confirmed that the luciferase activity of the MT4 point mutant promoter was decreased, and in particular, MT4 decreased about 6-fold or more of the luciferase activity. Thus, the site of MT4 in the NFAT binding site of the hNoxin promoter showed hNoxin expression (Fig. 4B).

< Example  4> NFAT  Transcription factor hNoxin  Promoter Whether or not it  Confirm

Chromatin-immunoprecipitation was performed to confirm the direct hNOxin promoter binding and binding site of the NFAT transcription factor.

Specifically, 1% formaldehyde was added to HEK293 cells on a 100 mm plate and allowed to react at room temperature for 15 minutes to fix the protein and chromatin binding. Subsequently, the cells were sectioned at about 500 bp using ultrasound, and immunoprecipitation was performed using anti-NFAT1 (Santa curz Biotechnology) or anti-NFAT2 antibody (Santa curz Biotechnology). Proteinase K was then treated to break down the bound protein and extract the DNA. Then, as shown in the schematic diagram of FIG. 5A, the NFAT binding sites of the hNoxin promoter were divided into A to D and the primers of the following Table 6 were prepared, and the separated DNA was used as a template as in Example <2-1> PCR was performed (Fig. 5B).

primer order NFAT binding site A
Forward 5'-AAAAGGAGGCCAGCAGAAGCGC-3 '(SEQ ID NO: 26) Reverse 5'-GAGAGGAAAGTGGAGTGGAGG-3 '(SEQ ID NO: 27) NFAT binding site B
Forward 5'-GCACACGCATCATCTCCTCTA-3 '(SEQ ID NO: 28) Reverse 5'-TGGGTGCAAGGAGCACAGTCT-3 '(SEQ ID NO: 29) NFAT binding site C
Forward 5'-TGCTAGCCCCTAGGACAGCGC-3 '(SEQ ID NO: 30) Reverse 5'-TCCCCGACAGGTGGATCAGTA-3 '(SEQ ID NO: 31) NFAT binding site D
Forward 5'-TACGCCCAGGAGGCTCAGCGAA-3 '(SEQ ID NO: 32) Reverse 5'-GTCCTTTTCCGCCGGAAGTA-3 '(SEQ ID NO: 33)

As a result, as shown in FIG. 5B, it was confirmed that the PCR product of the hNOXin promoter C and the D portion was amplified only when immunoprecipitated with the NFAT2 antibody, and no PCR product was detected in the case of immunoprecipitation with the NFAT1 antibody, Among the NFAT transcription factors, NFAT2 directly binds to the C and D regions of the NFAT binding site of the hNoxin promoter and controls the expression of hNoxin. The C and D regions of the hNoxin promoter coincide with the mutation positions of MT1 and MT4 (Fig. 5B).

< Example  5> NFAT2  By transcription factor hNoxin  Expression and inhibition of cancer cell growth

<5-1> NFAT2  Over-expression hNoxin  Confirmation of expression promotion

RT-PCR and Western blotting were performed using NFAT1 and NFAT2 overexpressing HEK293 cells to confirm the expression of hNoxin by the transcription factor NFAT2 of hNoxin identified in Example 4 above.

Specifically, HEK293 cells were plated on a 12-well plate at 1 × 10 ⁵ cells / ml and cultured for one day. Then, 1 μg of HA (hemagglutinin) labeled NFAT1 or NFAT2 vector was mixed with 5 μl of polyprotein reagent to prepare 15 Min, and cultured for 48 hours. Next, the NFAT1 or NFAT2-overexpressed HEK293 cells were subjected to RT-PCR as described in Example <2-1> to synthesize cDNA, and electrophoresed with agarose gel to measure the amount of mRNA. The primers described in Table 7 below were used as primers. At this time, GAPDH was used as an internal control gene.

primer order hNoxin
Forward 5'-CTTGTCCAGGTTGGTTTTCAA-3 '(SEQ ID NO: 34) Reverse 5'-AGGTGCCTGAGAGTCACACT-3 '(SEQ ID NO: 35) GAPDH
Forward 5'-TCATGACCACAGTCCATGCC-3 '(SEQ ID NO: 36) Reverse 5'-TCCACCACCCTGTTGCTGTA-3 '(SEQ ID NO: 37)

The overexpressed HEK293 cells were cultured for 48 hours, and then cell extracts were obtained using RIPA buffer solution. Approximately 10 μg of the protein per each of the obtained samples was separated by SDS-PAGE and transferred to a polyvinylidene fluoride membrane using the SDS sample buffer solution. Then, an HRP-conjugated secondary antibody was added to the primary antibody attached to the membrane, followed by treatment with ECL (Peirce chemical co, USA). Actin was used as a control protein.

As a result, as shown in Fig. 6A, both NFAT1 and NFAT2 were overexpressed in HEK293 cells, and it was confirmed that hNOXin mRNA expression was promoted in cells overexpressing NFAT2, thereby promoting the expression of hNOXin mRNA by NFAT2 ).

<5-2> NFAT2 Down  by hNoxin  Confirmation of expression inhibition

To confirm the expression of hNoxin by the transcription factor NFAT2 of hNoxin identified in Example 4, NFAT1 and NFAT2 knockdown HEK293 cells were prepared using siRNA and RT-PCR was performed using the siRNA.

Specifically, HEK293 cells were plated on a 12-well plate at 5 × 10 ⁴ cells / ml, cultured for one day, and incubated with 40 nM of 2 kinds of NFAT1 siRNA or NFAT2 siRNA prepared from bionea, and Lipofectamine 2000 (Lipofectamine 2000, Invitrogen ) Were mixed and incubated for 20 minutes. Cells were treated for 48 hours. Then, the NFAT1 or NFAT2 knockdown HEK293 cells were subjected to RT-PCR as described in Example <2-1> to synthesize cDNA and electrophoresed on agarose gel to determine the amount of mRNA. As primers, Table 7 and NFAT1 (P159803, Bioneer) and NFAT2 (P138556, Bioneer) primers were used.

As a result, as shown in FIG. 6B, the expression of both NFAT1 and NFAT2 in HEK293 cells was inhibited by the two different siRNAs for NFAT1 and NFAT2, and the decrease in the amount of hNoxin mRNA in NFAT2 decadent cells was confirmed , And expression of hNoxin was promoted by NFAT2 (FIG. 6B).

<5-3> NFAT2 Down  Of Cancer Cells

In order to confirm the effect of NFAT2-induced hNoxin expression on cancer cell growth, SRB analysis and RT-PCR were performed using NFAT2 decayed cancer cells.

Specifically, A549 and NCI-H1703 were dispensed into 10,000 wells on a 48-well plate and cultured for one day. Then, 10 nM of scramble siRNA and NFAT2 siRNA obtained by the method described in Example <5-2>, and lipofectamine 2000 0.5 Were mixed and incubated for 20 minutes to treat the cells. SRB analysis was performed over time as in Example 1 (FIG. 7A).

A549 and NCI-H1703 were mixed in a 6-well plate at 1 × 10 ⁵ cells / ml and cultured for one day. Then, 100 nM of scramble siRNA and NFAT2 siRNA obtained by the method described in Example <5-2> 5 μl of Lipofectamine 2000 was mixed, reacted for 20 minutes, treated with cells, and cultured for 72 hours. Then, the NFAT knockdown cells were subjected to RT-PCR as described in Example <2-1> to synthesize cDNA and electrophoresed on agarose gel to measure the amount of mRNA. [Table 7] and NFAT1 (P159803, bioneer) and NFAT2 (P138556, bioneer) primers were used as primers (Fig. 7B).

As a result, as shown in FIGS. 7A and 7B, it was confirmed that the NFAT2 depressed A549 and H1703 cells showed a decrease in cell viability over time, so that the growth of lung cancer cells was inhibited by NFAT2 depression (Fig. 7A). It was confirmed that the expression of hNoxin gene was decreased in both A549 and H1703 cells that were downsized in NFAT2 (Fig. 7B), and the growth of cancer cells was inhibited by inhibiting the expression of hNoxin gene by NFAT2 depression. Therefore, it was confirmed that NFAT2 is a transcription factor that regulates the expression of hNoxin gene through the results of Example 5, and the growth of cancer cells is regulated by controlling hNoxin expression by NFAT2.

< Example  6> NFAT  Through signal conditioning hNoxin  Identification of expression and transcriptional activity

To confirm the expression of hNoxin and the regulation of transcriptional activity by the NFAT signaling system, PMA (Phorbol myristate acetate), calcium ionophore A23187, and calcineurin inhibitor to activate the NFAT signaling system The transcriptional activity of hNoxin and RT-PCR were measured using HEK293 cells treated with cyclosporin A (cyclosporin A).

Specifically, HEK293 cells were seeded in a 48-well plate and cultured for one day. Then, 100 ng of pGL2-hNoxin-luciferase (-350 to +125, 0.4) Transformed with 5 ng of control vector and incubated for 30 hours. Then, 10 μM cyclosporin A (CsA) was pretreated for 1 hour and treated with 100 nM PMA / 1 μM A23187 (PA) at the same time. After 9 hours, the medium was removed and cell lysates were obtained using 1 x passive lysis buffer and the activity of luciferase was measured (Fig. 8A).

Also, after using the 12-well plate dividing the HEK293 cells with 2 × 10 ⁵ cells / ㎖ cultured for one day, cyclosporine A (CsA) and PMA / A2318710 (PA), and processing the embodiment as shown in the above <2-1 >, CDNA was synthesized by performing RT-PCR, and the amount of mRNA was measured by electrophoresis on agarose gel. The primers described in Table 7 were used as primers (Fig. 8B).

As a result, as shown in FIGS. 8A and 8B, when the NFAT signaling system was activated using PMA and A23187, the amount of luciferase activity and hNoxin mRNA of the hNoxin promoter was increased, while the activity of NFAT activity was inhibited by using cyclophorin A , The activation of the NFAT signaling system promotes the transcriptional activation and expression of hNoxin, whereas the inhibition of NFAT signaling promotes the transcriptional activation and expression of hNoxin (Figs. 8A and 8B).

< Example  7> hNoxin  Construction of a transformed cell line expressing a promoter and construction of a drug screening system using the same

&Lt; 7-1 > enhancer ) And The repressor  inclusive hNoxin  Production of transformed cell line expressing promoter

In order to screen for drugs that regulate hNoxin gene expression, transfected cell lines expressing sites including P1, P2 and P4 were constructed and transcriptional activity was measured.

Specifically, a pGL vector containing a promoter (P1) region of the hNoxin gene or a pGL vector containing P1, P2 and P4 regions (P1P2P4) obtained by the method described in Example <2-2> The pGL4.17 luciferase vector in which the neomycin selection marker was present was recloned using XhoI or XhoI and HindIII restriction enzymes and the pGL4.17-P1 luciferase vector containing the P1 site and P1P2P4 Lt; RTI ID = 0.0 &gt; pGL4.17-P1P2P4 &lt; / RTI &gt; luciferase vector (Figure 9). Then, the pGL4.17-P1 luciferase vector, pGL4.17-P1P2P4 luciferase vector, and pGL4.17 luciferase vector were added to HeLa cells as a human cervical cancer cell line as described in Example <2-1> Transformed and cultured for 48 hours. Then, each of the transfected cells was transferred to a 100 mm plate, and 500 μg / ml of G418 was treated with the medium containing 500 μg / ml of G418 every other day for 2 weeks. After 2 weeks, the clones formed were transferred one by one to a 12-well plate and cultured in a medium containing G418 to construct a stable transformed cell line. Each transformed cell line was subjected to luciferase activity as described in Example <2-1> above.

As a result, as shown in Fig. 10, five clones showing luciferase activity among the transformed cell lines expressing the hNoxin promoter were obtained, and it was confirmed that luciferase activity was high in clones 2 and 4, The transformed cell line in which the No. 4 clone was cultured was used for drug screening.

<7-2> hNoxin  Drug Screening Using Transformed Cell Lines Expressing Promoter

In order to identify a drug that inhibits the transcriptional activity of hNoxin, 1000 kinds of new drugs were treated with hNoxin P1-luciferase transformed cell line obtained by the method described in Example <7-2> Activity measurements were performed.

Specifically, the pGL4.17-hNoxin P1 luciferase # 4 transformed Hela cell line obtained by the method described in Example <7-2> was dispensed into a 96-well plate for one day, and 1000 kinds of new drugs 5 μM was treated for 48 hours, and SRB analysis was performed as in <Example 1> to select a drug that inhibited cell growth (FIG. 11A). Then, 5 μM of the new drug selected as in Example <2-1> was treated for 12 hours and the activity of luciferase was measured (FIG. 11B). After 10 μM of Drug # 1, # 6, # 10, # 14 and # 25 and 5 μM of Drug # 7 were treated for 12 hours, RT-PCR was performed as in Example <2-1> And cDNA was synthesized and electrophoresed on agarose gel to measure the amount of mRNA. The primers described in Table 7 below were used as primers. At this time, GAPDH was used as an internal control gene.

As a result, the viability of hNoxin P1 Luciferase # 4 transformed HeLa cell line treated with # 1, # 6, # 7, # 10, # 14 and # 25 among 1000 kinds of new drugs (# 11, # 6, # 7, # 10, # 14 and # 25) were selected as drugs inhibiting the growth of Hela cells (Fig. 11A).

Further, as shown in Fig. 11B, the luciferase activity of the hNoxin P1 luciferase # 4 transformed HeLa cell line treated with the new drugs # 1, # 6, # 7, # 10, # 14 and # 25 decreased , In particular, confirming that the luciferase activity of the cell line treated with the # 7 drug was markedly reduced, confirming that the drugs inhibited the transcriptional activity of hNoxin (FIG. 11B).

Further, as shown in Fig. 11C, it was confirmed that the amount of hNoxin mRNA in the hNoxin P1 Luciferase # 4 transformed HeLa cell line treated with the new drugs # 1, # 6 and # 7 markedly decreased, 1, # 6, and # 7 inhibited hNOxin transcriptional activity and expression of HeLa cells and inhibited cell growth (FIG. 11C). Therefore, it was confirmed that the hNOxin promoter transformed cell line can be used for the screening of anticancer substances through the results of Example 7 above.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Recombinant vector for screening of anticancer agent          human Noxin promoter fragment and screening method of anticancer          agent by using it <130> 13p-09-51 <160> 37 <170> Kopatentin 2.0 <210> 1 <211> 1333 <212> DNA <213> Homo sapiens <400> 1 gggaaaccca aagccagcca gctcctcaga gacgccgccc aagccaggtc accacagcca 60 ctccgccccc atccccgagg acaccgcctc cactccactt tcctctcgtg ccatctgctc 120 cttagcactc accttcattg cggtcacacc ccaagtctgc ccttatcatg ctagggcctc 180 ttcctaactc atcgctgtag cccatgcttt atctatagcg cccccgaagc ccacctgtcc 240 ttcaggtcac ccaatatccc taccattatc atcaccacca aaccctgccc tggccaccgc 300 aattccattg cgacacctcc tgccttccgc aaatcctacg taacggcaat aacagctacc 360 atgacaattt attgaaggtt cactacaggc cagtgtatca cgaggcaggg aggcacacgc 420 atcatctcct ctaactaaat cgtcacagca atcttgtgcg tcgtatatga ttgttattcc 480 catctacaga tgtggaaact gaggctcaga gaggtgcggg aacttgcact agatcactca 540 gcagtgagcg gagcacgtcg tcgcagaccg ctgggtccag gtccaaagac tgtgctcctt 600 gcacccacct ccatctggag cctaaccact ccctatgata ctccgttctt gggtcacccc 660 aaaactgtgt tgctcgcaca acccatccat tacacaggtc gccccgggtc cacatcgccc 720 ctaaatcccg ccaggtcccg gtcccttctt tcaaataacg ccccctttct tctccggcac 780 ccgaaaaccc actccgcgct ccacccccct cctgcctcct gccaccgccc ccttcctccc 840 tccgcccgtg ggtagtgcta gcccctagga cagcgccggg tctggcttcc aaagctccct 900 caaccctctt catccagctt ccattccctc tttcagtcac cccgccagac cccagggcgc 960 tgcggctcac tccacacttt cccgggaacc ctacgcccag gaggctcagc gaagctccaa 1020 aaccaatttt acggactgta ctactgatcc acctgtcggg gagaaagact ctacccgcag 1080 tttgacgaaa atggtcgttt ccagatgctt gtaggatttc ctcgctaagc tccaccctct 1140 gcggcgcctt cttctgattg gctctgagta atcagagcca aagcgttact tccggcggaa 1200 aaggacgcgg gagattcgat tggaaggctg ccggcgtgct actgagttcg gccggtccga 1260 gtcactgtgc gtcgcctggg cccgttcctg gtcttctccc ccaggtgagc tgggtaaagg 1320 ggttctcggg aag 1333 <210> 2 <211> 850 <212> DNA <213> Homo sapiens <400> 2 ctacagatgt ggaaactgag gctcagagag gtgcgggaac ttgcactaga tcactcagca 60 gtgagcggag cacgtcgtcg cagaccgctg ggtccaggtc caaagactgt gctccttgca 120 cccacctcca tctggagcct aaccactccc tatgatactc cgttcttggg tcaccccaaa 180 actgtgttgc tcgcacaacc catccattac acaggtcgcc ccgggtccac atcgccccta 240 aatcccgcca ggtcccggtc ccttctttca aataacgccc cctttcttct ccggcacccg 300 aaaacccact ccgcgctcca cccccctcct gcctcctgcc accgccccct tcctccctcc 360 gcccgtgggt agtgctagcc cctaggacag cgccgggtct ggcttccaaa gctccctcaa 420 ccctcttcat ccagcttcca ttccctcttt cagtcacccc gccagacccc agggcgctgc 480 ggctcactcc acactttccc gggaacccta cgcccaggag gctcagcgaa gctccaaaac 540 caattttacg gactgtacta ctgatccacc tgtcggggag aaagactcta cccgcagttt 600 gacgaaaatg gtcgtttcca gatgcttgta ggatttcctc gctaagctcc accctctgcg 660 gcgccttctt ctgattggct ctgagtaatc agagccaaag cgttacttcc ggcggaaaag 720 gacgcgggag attcgattgg aaggctgccg gcgtgctact gagttcggcc ggtccgagtc 780 actgtgcgtc gcctgggccc gttcctggtc ttctccccca ggtgagctgg gtaaaggggt 840 tctcgggaag 850 <210> 3 <211> 477 <212> DNA <213> Homo sapiens <400> 3 gctagcccct aggacagcgc cgggtctggc ttccaaagct ccctcaaccc tcttcatcca 60 gcttccattc cctctttcag tcaccccgcc agaccccagg gcgctgcggc tcactccaca 120 ctttcccggg aaccctacgc ccaggaggct cagcgaagct ccaaaaccaa ttttacggac 180 tgtactactg atccacctgt cggggagaaa gactctaccc gcagtttgac gaaaatggtc 240 gtttccagat gcttgtagga tttcctcgct aagctccacc ctctgcggcg ccttcttctg 300 attggctctg agtaatcaga gccaaagcgt tacttccggc ggaaaaggac gcgggagatt 360 cgattggaag gctgccggcg tgctactgag ttcggccggt ccgagtcact gtgcgtcgcc 420 tgggcccgtt cctggtcttc tcccccaggt gagctgggta aaggggttct cgggaag 477 <210> 4 <211> 1648 <212> DNA <213> Homo sapiens <400> 4 gggaaaccca aagccagcca gctcctcaga gacgccgccc aagccaggtc accacagcca 60 ctccgccccc atccccgagg acaccgcctc cactccactt tcctctcgtg ccatctgctc 120 cttagcactc accttcattg cggtcacacc ccaagtctgc ccttatcatg ctagggcctc 180 ttcctaactc atcgctgtag cccatgcttt atctatagcg cccccgaagc ccacctgtcc 240 ttcaggtcac ccaatatccc taccattatc atcaccacca aaccctgccc tggccaccgc 300 aattccattg cgacacctcc tgccttccgc aaatcctacg taacggcaat aacagctacc 360 atgacaattt attgaaggtt cactacaggc cagtgtatca cgaggcaggg aggcacacgc 420 atcatctcct ctaactaaat cgtcacagca atcttgtgcg tcgtatatga ttgttattcc 480 catctacaga tgtggaaact gaggctcaga gaggtgcggg aacttgcact agatcactca 540 gcagtgagcg gagcacgtcg tcgcagaccg ctgggtccag gtccaaagac tgtgctcctt 600 gcacccacct ccatctggag cctaaccact ccctatgata ctccgttctt gggtcacccc 660 aaaactgtgt tgctcgcaca acccatccat tacacaggtc gccccgggtc cacatcgccc 720 ctaaatcccg ccaggtcccg gtcccttctt tcaaataacg ccccctttct tctccggcac 780 ccgaaaaccc actccgcgct ccacccccct cctgcctcct gccaccgccc ccttcctccc 840 tccgcccgtg ggtagtgcta gcccctagga cagcgccggg tctggcttcc aaagctccct 900 caaccctctt catccagctt ccattccctc tttcagtcac cccgccagac cccagggcgc 960 tgcggctcac tccacacttt cccgggaacc ctacgcccag gaggctcagc gaagctccaa 1020 aaccaatttt acggactgta ctactgatcc acctgtcggg gagaaagact ctacccgcag 1080 tttgacgaaa atggtcgttt ccagatgctt gtaggatttc ctcgctaagc tccaccctct 1140 gcggcgcctt cttctgattg gctctgagta atcagagcca aagcgttact tccggcggaa 1200 aaggacgcgg gagattcgat tggaaggctg ccggcgtgct actgagttcg gccggtccga 1260 gtcactgtgc gtcgcctggg cccgttcctg gtcttctccc ccaggtgagc tgggtaaagg 1320 ggttctcggg aagccgaaga gccggagact cctaaggagg ctcttaactt cattatgaat 1380 gagacccacc cagagcccgg cgcttgtttt ttcacaagtg gttctctgta aacgggcagc 1440 catgagggta acagaatata aacgtcagtt attttatttt agactcagtg cttttgcaat 1500 cacctaacga acgtttattg aacacttaca gtgccatcga gctagactcg gagtgagctt 1560 ttagaatcgg aaatagagag gaaaaggcgc gactcttgct tctgtaatgt gcaaatacgt 1620 attcagtggg ccactgtgca gagtagta 1648 <210> 5 <211> 520 <212> DNA <213> Homo sapiens <400> 5 tcattcaatt attcatcaga catgcatcca ctatactgca agtcaagcag tagagagaga 60 cagagaaata aaacaaagta taaaaacacc cccagagcct aggtaaataa ataaataaat 120 acaaaaataa actaggtggc aagtatgaag gaaatattat gaaaacacca aaggaaatta 180 attaacagta actgtctgaa acgatcttat tctattattg tccaacagac aataaatggg 240 aagccttttt gccattttct ggggttccc aggtgaaata caaatagtaa aaatactaat 300 gatccctttc attacagttc tcaaatttgc tgtttttata gatttttaga cttacttatt 360 tgatccacta gagggcagta aacccttaaa taaagacaat gtaaccaacc ttcctttaaa 420 agtatagtaa taagtgctgg cacaattaat ttagaaatga acccaaaatt tcctgcttat 480 ttaagttttt catttattag tgagttgtct gcccaattag 520 <210> 6 <211> 665 <212> DNA <213> Homo sapiens <400> 6 ctttgtcatc tcagataaaa attcaaacta atttccccat ttgtaaattt tacctataaa 60 aatgaaataa tgtatgttga aaacatttgt aaactgaatg ctaatgcata ttagtctaag 120 ttttgctagg aattttacat taaacctgta tgcattattg catagccttt aaagaaattc 180 caatatatat tttaaacagt tcatttccct agagtttggt actaatggag ttttatcccc 240 tagtgagtca attaccttta attcattcta tggctaacct acagcacaaa ctctagcaga 300 tttgtatagg attatatgaa tgggttggta tagatctatc ctcagtatgg cagaagaata 360 acagcacaga tctaataaag gtgagtcact ttcagagcta cagattttag actcccccta 420 gtggccatct ggcaacaatc aaatttatac aaccatcttt caccttgctt tctgtttgcc 480 ttttgccact cttttttaag atctttagca atctgaagaa aaaacaaaat tctagtatta 540 gccattacca taaaatgttt ttaggtgctt gttgtatttc aaaaaaattt tttaaactat 600 tctgtctgtt aaataaagtt aacctaactg aggggtggac attaagaacc tgaaagatag 660 aaatc 665 <210> 7 <211> 3545 <212> DNA <213> Homo sapiens <400> 7 gggagattcg attggaaggc tgccggcgtg ctactgagtt cggccggtcc gagtcactgt 60 gcgtcgcctg ggcgcgttcc tggtcttctc ccccagggtc ttgctctgtc acccaggctg 120 gagtgccatg gcatcatcat agctcactat ggccttgatc ctcctgcctt agcctcccaa 180 gcagctggta ttacagacca cggtgtgaac acatgaacag aagacgaaaa tttcttctag 240 cctcagtact tgctctccag aattcaagtt ttatatatcc atcatgtcag aagtgcttct 300 ctaggataat cctggtctcc aaaaggtcta attgtccaaa atgtggctct actggtgaat 360 ctggaaatgc caattacaga tacaaacttt ccttaaaagt tgcagaatca aacaaattgt 420 ttgttattac tgtatttgga agttgcttag atacattttt tggtcttact gccactggtt 480 tgcacaggta cattcaggat cctaataaaa ttccagaaac actggacaat gatacaactc 540 agaatctatt aactaaagca gttgaaactt gctttgttgg acaaagcttt atttttggag 600 tgacgaattt tgaaaaccaa cctggacaag gttcagatgc cagtaacttc ttacagcaat 660 gctctgacca caaaagaaaa gccaaagcac tagtggcttg ccagattgtt ctaccagacc 720 caggtattgc aggctttact gtcattgact acttccatca acttttgcag acttttaatt 780 tcaggaaact tcagtgtgac tctcaggcac ctaacaatca cttacttgct ttagatcact 840 caaatagtga tctcagcagc acatatactt ctgacagcac ttctgatttt ttcaagtcct 900 gcagcaagga tactttttca aaattctggc agccatcact tgaattcact tgcattgttt 960 cacaactaac agataatgat gatttttcag cttcagaaca aagtaaggcc tttggtactc 1020 ttcagcagaa cagaaagtcc atctccattg cagaggccac tggttccagt agctgccatg 1080 atcccattca ggattcatgg agccttgttt catatatgga taaaaagagt acagcagaaa 1140 agttgggtaa agaacttggc ttacaagcta aggagctgag tgcagttcac agcagtcatc 1200 atgaaattgg agttaatgac tctaatttat tctctttgga aatgcgagag ccccttgagt 1260 caagtaatac aaaatccttc cacagtgcag tggaaattaa aaataggtcc cagcatgagc 1320 taccatgttt tcagcatcat ggtatagata ccccaactag ccttcagaag agatctgcat 1380 gttgtccacc ttcgttactc agacttgaag agacagccag cagttcccag gatggtgacc 1440 ctcaaatttg ggatgatctg ccattctctg aaagcctgaa caagtttctg gcagttcttg 1500 aaagtgagat tgctgtaacc caggcagatg tcagtagtag gaaacatcat gtagataatg 1560 acattgataa atttcatgca gaccacagca gtttatctgt gactccccag agaactactg 1620 gagccctgca tacaccacct atagctttaa gatcatcaca agtaatagtc aaagcaaact 1680 gtagcaaaga tgacttcctt ttcaactgta aaggaaatct aagtcctagt gttgaaaagg 1740 agtcacaacc agataacaaa gtagaggctg tctctgtaaa tcataatgga agagatatgt 1800 cagaatattt tttaccgaat ccttacctgt cagctctgtc ttcatcttca aaagatttag 1860 aaacaatagt tactcttaag aagactatca gaatctcacc acacagggag agtgaccatt 1920 ctagtctaaa taacaaatat ttgaatggat gtggagaaat atcagtttca gaaatgaatg 1980 aaaagttgac aactctgtgt tataggaagt ataatgatgt ctctgatctt tgcaaattag 2040 aaaataaaca atattgtagg tggtccaaga accaagatga cagttttaca atttgcagga 2100 aacttacata tcctttagaa actctttgca atagtccaaa tagaagtaca aatacattga 2160 aagaaatgcc ttggggacat atcaataaca acgtaacaca gagctattct attggttatg 2220 aaggtagcta tgatgcctct gctgatctct ttgatgatat tgctaaagaa atggacattg 2280 caactgagat taccaaaaaa tcacaggata ttttgttaaa atggggaaca tctttggcag 2340 aaagtcaccc ttcagagtct gatttttcac tgagatcact ttctgaagac ttcatccagc 2400 cttcacaaaa attatccttg caaagcctat ctgactctag gcattcaaga acatgctctc 2460 caacacctca ttttcaatca gattcagaat ataattttga aaatagtcaa gactttgttc 2520 catgttcaca gtcaactcca atttcagggt tccaccaaac aagaattcat gggataaaca 2580 gagctttcaa aaaacctgta ttttattcag atcttgatgg taactatgaa aaaataagga 2640 ttttccctga aaatgacaaa cagcaagcca gcccaagctg tccaaaaaat ataaaaacac 2700 ctagccagaa aatcagaagc cctattgtat ctggtatttc acaaccagac gttttcaatc 2760 actacccttt tgctgagtgc catgaaactg atagtgatga atgggtccct cctaccacac 2820 aaaaaatatt tccttcagat atgcttggat tccaaggcat aggtctaggg aaatgccttg 2880 ctgcctatca tttccctgat caacaagagt taccaagaaa gaaactgaaa catattagac 2940 aaggaaccaa taaaggttta attaagaaga aattaaagaa tatgcttgca gcagttgtta 3000 cgaaaaagaa aactcataaa tataactgta aaagttcagg ctggatttcc aaatgtccag 3060 acattcaagt cttagcagca cctcagctgc accctattct tggacctgat tcttgttcag 3120 aagtcaaatg ttgccttcca ttttcagaaa aaggcccacc ttcagtgtgt gaaactcgaa 3180 gtgcttggtc acctgaattg ttttcataaa aagtcacctg aacccaattc ctgaactttt 3240 aaatctgttt ggaaatgttt gccttcaggg gtacggaaag cattctttac attttgaaca 3300 cttggagaga agcaaattga aaacaggact ctgctgggag ctactgtgcc ttttaaaata 3360 taaagccatt gttttcccca gggttttatc tagaatacta tgattaggta gttgagcact 3420 ttatcttata ctgtttattg tactttaata atattgttaa gattgttttt gaaagtatta 3480 atgtttgtta aaatcacata tacatccaga aataaagact ttgcaaacca aaaaaaaaaa 3540 aaaaa 3545 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 1.3 forward primer <400> 8 atgagctcgg gaaacccaaa gcca 24 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> 1.3 reverse primer <400> 9 tgctcgagct tcccgagaac ccctttacc 29 <210> 10 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 0.8 forward primer <400> 10 tcagagctcc tacagatgtg gaaactgagg c 31 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> 0.8 reverse primer <400> 11 tgctcgagct tcccgagaac ccctttacc 29 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 0.4 forward primer <400> 12 tcagagctcg ctagccccta ggacagcgcc 30 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <220> <222> 0.4 reverse primer <400> 13 tgctcgagct tcccgagaac ccctttacc 29 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P1 forward primer <400> 14 atgagctcgg gaaacccaaa gcca 24 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> P1 reverse primer <400> 15 tgctcgagct tcccgagaac ccctttacc 29 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P2 forward primer <400> 16 gctctcgagt cattcaatta ttcatca 27 <210> 17 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P2 reverse primer <400> 17 gttaagcttc taattgggca gacaact 27 <210> 18 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P4 forward primer <400> 18 gttaagcttc tttgtcatct cagataa 27 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P4 reverse primer <400> 19 gagaagcttg atttctatct ttcaggt 27 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P1 + forward primer <400> 20 atgagctcgg gaaacccaaa gcca 24 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P1 + reverse primer <400> 21 gcctcgagcg tactactctg cacagt 26 <210> 22 <211> 33 <212> DNA <213> Homo sapiens <400> 22 cggctcactc cacactttaa cgggaaccct acg 33 <210> 23 <211> 45 <212> DNA <213> Homo sapiens <400> 23 gcagtttgac gaaaatggtc gtttaaagat gcttgtagga tttcc 45 <210> 24 <211> 42 <212> DNA <213> Homo sapiens <400> 24 tttccagatg cttgtaggat ttaatcgcta agctccaccc tc 42 <210> 25 <211> 46 <212> DNA <213> Homo sapiens <400> 25 gccaaagcgt tacttccggc ttaaaaggac gcgggagatt cgattg 46 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NFAT binding A forward primer <400> 26 aaaaggaggc cagcagaagc gc 22 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NFAT binding A reverse primer <400> 27 gagaggaaag tggagtggag g 21 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NFAT binding B forward primer <400> 28 gcacacgcat catctcctct a 21 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NFAT binding B reverse primer <400> 29 tgggtgcaag gagcacagtc t 21 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NFAT binding C forward primer <400> 30 tgctagcccc taggacagcg c 21 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NFAT binding C reverse primer <400> 31 tccccgacag gtggatcagt a 21 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NFAT binding D forward primer <400> 32 tacgcccagg aggctcagcg aa 22 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NFAT binding D reverse primer <400> 33 gtccttttcc gccggaagta 20 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> hNoxin forward primer <400> 34 cttgtccagg ttggttttca a 21 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hNoxin reverse primer <400> 35 aggtgcctga gagtcacact 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 36 tcatgaccac agtccatgcc 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 37 tccaccaccc tgttgctgta 20

Claims (8)

A recombinant expression vector for screening an anticancer agent comprising at least one human Noxin (human Noxin) promoter fragment selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, and a fluorescent protein gene linked to the promoter fragment vector.
The recombinant expression vector according to claim 1, wherein the fluorescent protein is luciferase, enhanced green fluorescent protein (EGFP), or cyan fluorescent protein (CFP). vector.
2. The recombinant expression vector for screening an anticancer agent according to claim 1, wherein the promoter fragment binds to a transcription factor that controls the expression of a human Noxin gene.
4. The recombinant expression vector for screening anticancer drug according to claim 3, wherein the transcription factor is any one selected from the group consisting of p300, NF-1, C / EBP, SP1 and NFAT.
The recombinant expression vector for screening an anticancer agent according to claim 1, wherein the anticancer agent inhibits the action of NFAT2.
A transformed cell line for screening an anticancer agent transformed with the recombinant expression vector of claim 1.
1) culturing the transformed cell line of claim 6;
2) treating the cell line of step 1) with the test substance; And
3) measuring the fluorescence of the fluorescent protein after treating the test substance of step 2).
8. The method of claim 7, wherein the cancer is selected from the group consisting of lung cancer, colorectal cancer, rectal cancer, colon cancer, breast cancer, cervical cancer, endometrial cancer, fallopian tube carcinoma, ovarian cancer, vaginal carcinoma, vulvar carcinoma, liver cancer, gastric cancer, Cancer of the gallbladder, cancer of the gallbladder, kidney cancer, bladder cancer, urethral cancer, penile cancer, prostate cancer, testicular cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, non-small cell lung cancer, Wherein the cancer is at least one selected from the group consisting of chronic obstructive pulmonary disease, endocrine cancer, chronic or acute leukemia, lymphocytic lymphoma, central nervous system tumor, spinal cord tumor, brainstem glioma and pituitary adenoma.

Images