KR20150029662A - Escherichia coli for high production of d―galactonate and use thereof - Google Patents

Abstract

The present invention relates to a D-galactonate high production recombinant strain and a use of the same. More specifically, by using metabolic engineering, an expression vector including a gld gene encoding syringae-derived GalDH from an E. coli strain is transduced, so that the GalDH is expressed. The consumption of D-galactose and D-galactonate is decreased, wherein the D-galactose and D-galactonate are produced by destroying genes respectively encoding galactokinase and 2-dehydro-3-deoxy-galactonate kinase involved in a D-galactose and D-galactonate metabolism route in a host strain. Accordingly, a recombinant E. coli strain for mass-producing D-galctonate from D-galactose is produced so as to be usefully used in mass-producing D-galactonate used as raw ingredients for foods and cosmetics.

Description

D-Galactonate high-producing E. coli strain and its use {ESCHERICHIA COLI FOR HIGH PRODUCTION OF D-GALACTONATE AND USE THEREOF}

The present invention is a recombinant strain for mass-producing D-galactonate produced by metabolic engineering, a method for producing the strain, and D-galactose using the strain It relates to a method for producing a large amount of D-galactonate from.

D-galactose (D-galactose) is one of many carbohydrates found in nature, in particular, is present in 25 to 35% dry weight in giant red algae (Patent Document 1). It is used in the production of various biofuels and platform chemicals through biological and/or chemical methods. Recent reports have highlighted the chemical conversion of D-galactose into furfural, a useful precursor compound for polymer synthesis, pharmaceuticals and other petroleum-like chemicals.

D-galactose derivative, D-galactonate, is a valuable organic acid used as a polyester precursor, food additive, pharmaceutical intermediate and cosmetic raw material (Patent Document 2). D-galactonate is generally chemically produced through the oxidation of D-galactose in the atmosphere through an alumina-supported gold catalyst at 60° C. in the presence of oxygen in pH 8-10 (FIG. 1A). . This reaction is completed within 4 hours, but the pH sensitivity of the reaction often reduces the catalytic activity leading to the accumulation of lactone intermediates.

On the other hand, the biological conversion of D-galactose to D-galactonate has not yet been fully explored. Despite the fact that some microbes can convert D-galactose to D-galactonate, the lack of genetic information for these microbes and the limited genetic tools available are for D-galactonate production. Delayed further metabolic engineering. There are several routes through which D-galactose can be metabolized. Microorganisms such as Escherichia coli and Lactococcus lactis can intrinsically metabolize D-galactose through the Leloir pathway. This pathway is first associated with D-galactose phosphorylation, followed by uridylyldiphosphate-glucose (UDP-glucose)-derived uridylylmonophosphate (UMP) to galactose-1-phosphate. The conversion to is involved. Finally, secreted glucose-1-phosphate enters the central glycolysis pathway (FIG. 1B). D-galactonate is produced from the Lerwar pathway. Another D-galactose metabolism is the DeLey-Doudoroff pathway found in Azotobacter vinelandii, CauLobacter crescentus and Pseudomonas fluorescens. pathway). In this pathway, the initial reduction of D-galactose to D-galactonate is promoted by galactose dehydrogenase enzyme (GalDH), and then 2-keto-3-deoxy-galactonate (2). -keto-3-deoxy-D-galactonate) followed by dehydration of D-galactonate, then phosphorylated prior to cleavage to secrete pyruvate and glyceraldehyde phosphate ( Fig. 1B). Therefore, D-galactonate can be produced from the Dray-Dowdoloff pathway.

As such, due to the lack of suitable biological approaches for D-galactonate production, there is a need for a method capable of producing D-galactonate in large quantities.

Thus, the present inventors produced an E. coli whose metabolism was engineered to produce D-galactonate from a minimal medium (FIG. 1B).

Specifically, the present inventors found that E. coli is a host organism because of its well-established metabolic background, feasible genetic tool, fast growth rate in simple medium, and ability to metabolize a wide range of carbon sources including D-galactose. Were selected. That it was then introduced into the gld gene coding for GalDH derived from (Pseudomona ssyringae) Pseudomonas siringa into the E. coli, the E. coli is of the Lactobacillus carbonate Physicochemical path (catabolic pathway) D- galactose, and D- go Metabolic pathways were engineered by blocking both the related natural galK and dgoK genes to prevent their consumption for cell growth. As a result of confirming the D-galactonate productivity of the recombinant strain prepared according to the present invention in M9 minimal medium containing a mixed carbon source, it was confirmed that D-galactonate production from fermentation Bruce was significantly increased.

US 2010/0124774 A1 US 5650436 B

An object of the present invention is to produce a recombinant strain capable of efficiently producing D-galactonate using metabolic engineering, 1) wild-type E. coli strain is a natural that can convert D-galactose to D-galotonate Because it does not contain the enzyme of Pseudomonas syringae ( Pseudomona ssyringae ; P. syringae ) derived galactose dehydrogenase (GalDH) is transduced with an expression vector containing a gld gene encoding the gene to express the GalDH, and 2) the wild-type E. coli strain is the Lerwar pathway. Leloir pathway) and the DeLey-Doudoroff pathway allow the use of both D-galactose and D-galactonate for cell growth, so that both metabolic pathways are D through substrate competition and product consumption. -In order to prevent the reduction of galactonate, genes encoding galactokinase and 2-dehydro-3-deoxy-galactonate kinase, respectively, involved in the D-galactose and D-galactonate metabolic pathways were gene By destroying and reducing the consumption of D-galactose and D-galactonate, by developing a recombinant E. coli capable of producing a remarkably large amount of D-galactonate compared to the wild type, the recombinant strain, the strain using metabolic engineering, was developed. To provide a method of manufacturing, and a method for mass-producing D-galactonate by culturing the strain.

In order to achieve the above object, the present invention E. coli ( Escherichia coli ; E. coli ) in Pseudomona ssyringae ; P. syringae ) derived from galactose dehydrogenase (galactose dehydrogenase; GalDH), prepared by transducing an expression vector containing a gld gene encoding, D-galactonate (D-galactonate) provides a high-producing E. coli strain.

In addition, the present invention is prepared by transducing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa into Escherichia coli in which a galK gene encoding a galactokinase is knocked out, D -Provides a high galactonate E. coli strain.

In addition, the present invention relates to a galK gene encoding galactokinase and a dogK gene encoding 2-dehydro-3-deoxy-galactonate kinase in knockout E. coli. It provides a D-galactonate high-producing E. coli strain prepared by transducing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa.

In addition, the present invention

1) preparing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa; And

2) It provides a method for producing a D-galactonate high-producing E. coli strain comprising the step of transducing the expression vector of step 1) into E. coli.

In addition, the present invention

1) preparing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa;

2) knocking out the galK gene encoding galactokinase in E. coli; And

3) It provides a method for producing a D-galactonate high-producing E. coli strain comprising the step of transducing the expression vector of step 1) into E. coli of step 2).

In addition, the present invention

1) preparing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa;

2) knocking out the galK gene encoding galactokinase and the dogK gene encoding 2-dehydro-3-deoxy-galactonate kinase in E. coli; And

3) It provides a method for producing a D-galactonate high-producing E. coli strain comprising the step of transducing the expression vector of step 1) into E. coli of step 2).

In addition, the present invention

1) culturing a recombinant E. coli strain prepared by transducing the E. coli with an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa; And

2) It provides a method for mass production of D-galactonate, comprising the step of recovering D-galactonate from the culture medium cultured in step 1).

In addition, the present invention

1) culturing a recombinant E. coli strain prepared by transducing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa into E. coli in which the galK gene encoding galactokinase is knocked out; And

2) It provides a method for mass production of D-galactonate, comprising the step of recovering D-galactonate from the culture medium cultured in step 1).

In addition, the present invention

1) galK gene encoding galactokinase and dogK gene encoding 2-dehydro-3-deoxy-galactonate kinase were knocked out in Escherichia coli, including a gld gene encoding galactose dehydrogenase derived from Pseudomonas syringa. Culturing the recombinant E. coli strain prepared by transducing the expression vector; And

2) It provides a method for mass production of D-galactonate, comprising the step of recovering D-galactonate from the culture medium cultured in step 1).

In the present invention, by cloning the D-galactose dehydrogenase gene from P. syringae and expressing this gene in the E. coli strain, a D-galactonate-producing strain was prepared. In addition, in order to maximize D-galactonate production, both native D-galactose and D-galactonate metabolic pathways were blocked in the host E. coli strain. As a result of performing lab-scale batch fermentation on the recombinant strain thus prepared, ^{17.6 g L -1} of D-galactonate was produced from ^{20 g L -1 D-galactose (i.e.} , 88% yield) of the average productivity 0.24 g L ^-1 h ^- it was confirmed that with the ^first. Therefore, it is possible to industrially mass-produce D-galactonate from D-galactose using the recombinant strain of the present invention.

1 is a diagram showing the process of D-galactonate production by chemical method (A) and metabolic manipulation E. coli (B):
Here, galK is a gene encoding galactokinase;
galT is a gene encoding UDP-glucose:α-D-galactose-1-phosphate uridylyltransferase;
dgoD is a gene encoding D-galactonate dehydratase;
dgoK is a gene encoding 2-dehydro-3-deoxygalactonate kinase;
dgoA is a gene encoding 2-dehydro-3-deoxygalactonate-6-phosphate aldolase;
gld is a gene encoding D-galactose dehydrogenase;
X indicates that the gene has been disrupted;
The dotted line indicates that the gene has been introduced.
2 is a graph showing the activity of GalDH according to pH.
3 is a diagram showing the growth of a strain in which E. coli BW25113 wild type and galK and/or dgoK genes are destroyed in a solid medium containing D-galactose or D-galactonate as a carbon source.
Figure 4 is a graph showing the concentration of biomass, glucose, D-galactose and D-galactonate of EWG1, EWG2 and EWG3 during shake flask culture.
5 is a graph showing the concentration of D-galactose and D-galactonate of EWG3 during discontinuous fermentation in a 5L reactor.
6 is a graph showing the growth, glucose and acetic acid concentration of EWG3 during discontinuous fermentation in a 5L reactor.
7 is a graph showing the identification of the D-galactonate product recovered from discontinuous fermentation through NMR analysis:
(a) 13C-NMR: C1, 179.88 ppm; C2, 71.62 ppm; C3, 70.29 ppm; C4, 69.94 ppm; C5, 71.98 ppm; C6, 63.52 ppm. (b) 1H-NMR: σ 4.22 (d, 1H, J 1.5, H2), σ3.89 (m, 2H, J 1.5, J5.5, J 9.5, H3, H4), σ 3.61 (dd, 2H, J 1.5, J 5.5, H6), σ 3.57 (dd, 1H, J 1.5, J 9.5, H5).

Hereinafter, the present invention will be described in detail.

The present invention is Escherichia ( Escherichia coli ; E. coli ) in Pseudomona ssyringae ; P. syringae ) derived from galactose dehydrogenase (galactose dehydrogenase; GalDH), prepared by transducing an expression vector containing a gld gene encoding, D-galactonate (D-galactonate) provides a high-producing E. coli strain.

In addition, the present invention is prepared by transducing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa into Escherichia coli in which a galK gene encoding a galactokinase is knocked out, D -Provides a high galactonate E. coli strain.

In addition, the present invention relates to a galK gene encoding galactokinase and a dogK gene encoding 2-dehydro-3-deoxy-galactonate kinase in knockout E. coli. It provides a D-galactonate high-producing E. coli strain prepared by transducing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa.

The gld gene is composed of the nucleotide sequence of SEQ ID NO: 1, the galK gene is composed of the nucleotide sequence of SEQ ID NO: 2, the dogK gene is preferably composed of the nucleotide sequence of SEQ ID NO: 4, the gene is the base The sequence is not limited to the sequence, and a sequence in which one or a few bases are added, deleted, or substituted in the sequence may have a base sequence that exhibits the same function.

The E. coli is preferably E. coli BL21 (DE3), but is not limited to the species, and any E. coli species known in the art can be used.

The expression vector is preferably a pET28a expression vector, but the type of the vector is not limited thereto, and any expression vector generally used in the art may be used.

In the present invention, the wild-type E. coli strain does not contain a natural enzyme capable of converting D-galactose to D-galotonate, but the Leloir pathway and the DeLey-Doudoroff pathway. pathway), in consideration of the fact that both D-galactose and D-galactonate can be used for cell growth (FIG. 1B and FIG. 3), the metabolic pathway was manipulated using metabolic engineering.

First of all, the present inventors argued that the wild-type E. coli strain does not contain a natural enzyme capable of converting D-galactose to D-galotonate, so that the gld gene encoding galactose dehydrogenase (GalDH) derived from Pseudomonas syringa is used. A recombinant E. coli strain capable of expressing the GalDH was prepared by transducing the containing expression vector. After culturing the strain in a shake flask, the production amount of D-galactonate was analyzed, and EWG1 produced 0.17 g L ^-1 D-galactonate and showed an equivalent yield of 8.3%.

In addition, in order to reasonably manipulate that the present inventors favor and maximize the conversion of D-galactose to D-galactonate, the wild-type E. coli strain is D through substrate competition and product consumption through two different metabolic pathways. -Taking into account the reduction of galactonate, destroy the gene galK that encodes galactokinase, which promotes the first step of D-galactose metabolism, to prevent consumption of D-galactose through the natural D-galactose metabolic pathway, and then A recombinant E. coli strain capable of expressing the GalDH was prepared by transducing an expression vector containing a gld gene encoding galactose dehydrogenase (GalDH) derived from Pseudomonas syringa. After culturing the strain in a shake flask, as a result of analyzing the production amount of ^{D-galactonate, 0.44 g L -1} D-galactonate was produced and a yield of 22.0% was shown.

In addition, as an alternative approach to blocking the D-galactonate metabolic pathway, the present inventors have shown a gene encoding a 2-dehydro-3-deoxy-galactonate kinase that promotes the second stage of D-galactonate metabolism. After destroying dgoK, a recombinant E. coli strain capable of expressing GalDH was prepared by transducing an expression vector containing a gld gene encoding galactose dehydrogenase (GalDH) derived from Pseudomonas syringa. After culturing the strain in a shake flask, the production amount of D-galactonate was analyzed, and 1.24 g L ^-1 D-galactonate was produced, showing an equivalent yield of 62.0%.

In addition, the present invention

1) preparing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa;

2) knocking out the galK gene encoding galactokinase in E. coli; And

3) It provides a method for producing a D-galactonate high-producing E. coli strain comprising the step of transducing the expression vector of step 1) into E. coli of step 2).

In addition, the present invention

1) preparing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa;

2) knocking out the galK gene encoding galactokinase and the dogK gene encoding 2-dehydro-3-deoxy-galactonate kinase in E. coli; And

3) It provides a method for producing a D-galactonate high-producing E. coli strain comprising the step of transducing the expression vector of step 1) into E. coli of step 2).

In the above methods, E. coli is preferably E. coli BL21 (DE3), but is not limited to the species, and any E. coli species known in the art can be used.

In the above methods, the expression vector is preferably a pET28a expression vector, but the type of the vector is not limited thereto, and any expression vector generally used in the art may be used.

In the above methods, gene knockout is preferably performed by destroying a gene using a gene disruption cassette, but is not limited thereto, and any gene knockout method used in the art can be used.

In the above methods, insertion of the gene is preferably performed using electroporation, but is not limited to the above method, and any transformation method used in the art can be used.

In addition, the present invention

1) culturing a recombinant E. coli strain prepared by transducing the E. coli with an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa; And

2) It provides a method for mass production of D-galactonate, comprising the step of recovering D-galactonate from the culture medium cultured in step 1).

In addition, the present invention

1) culturing a recombinant E. coli strain prepared by transducing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringa into E. coli in which the galK gene encoding galactokinase is knocked out; And

2) It provides a method for mass production of D-galactonate, comprising the step of recovering D-galactonate from the culture medium cultured in step 1).

In addition, the present invention

1) galK gene encoding galactokinase and dogK gene encoding 2-dehydro-3-deoxy-galactonate kinase were knocked out in Escherichia coli, including a gld gene encoding galactose dehydrogenase derived from Pseudomonas syringa. Culturing the recombinant E. coli strain prepared by transducing the expression vector; And

2) It provides a method for mass production of D-galactonate, comprising the step of recovering D-galactonate from the culture medium cultured in step 1).

In the above methods, the culture is preferably a minimum medium containing a carbon source and D-galactose, but the type of the medium is not particularly limited.

In the above methods, the culture medium is preferably maintained at a pH of 7 to 8, and more preferably maintained at a pH of 7.5, but is not limited thereto.

In the above methods, the culture is preferably cultured for 36 hours or more, and more preferably cultured for 36 to 72 hours, but is not limited thereto.

In the above methods, the D-galactonate may be recovered by removing and precipitating cells, and the recovered D-galactonate may be further purified.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following Examples and Experimental Examples.

< Example 1> Preparation of recombinant E. coli expressing D-galactose dehydrogenase derived from Pseudomonas Syringa

<1-1> Preparation of strain

Pseudomona ssyringae ; P. syringae ) was purchased from the Microbial Resource Center (Korean Collection for Type CuLture; KCTC), and E. coli BL21 (DE3) was purchased from Invitrogen (USA). E. coli BW25113 wild type was obtained from the National BioResource Project (NIG) (Japan).

<1-2> of the gene Cloning And transduction

The gene gld (GeneBank registration number: YP_237399) (SEQ ID NO: 1) encoding galactose dehydrogenase (GalDH) was cloned from Pseudomonas syringae.

Then, the gld was ligated into the E. coli expression vector pET28a to prepare a pET28a-gld plasmid. Specifically, in order to position the gld under the control of the T7 promoter in the E. coli host, a 69734 λDE3 Lysogenization Kit (Novagen, EMD Millipore, USA) was used to insert the λDE3 prophage into the E. coli chromosome. . Lysogen was confirmed using a T7 tester phage according to Novagen user protocol TB031. gld was amplified using genomic DNA in Pseudomonas syringa as a template. The amplified sequence was digested with Nde I and BamH I, and then ligated into the E. coli expression vector pET28a. The final construct was named'pET28a-gld'.

Then, the pET28a-gld plasmid was transduced into E. coli BL21 (DE3) using electroporation for the expression of gld, and'E . coli. BL21 (DE3)/pET28a-gld' was prepared. Hereinafter, in the experimental example of the present invention, ' E. coli BL21 (DE3)/pET28a-gld' strain was represented as EWG1 (Table 1).

< Example 2> In E. coli Galactokinase ( galactokinase ) Production of recombinant E. coli in which the gene is destroyed and D-galactose dehydrogenase derived from Pseudomonas syringa is expressed

The strain (ΔgalK strain) in which the gene galK (SEQ ID NO: 2), which encodes galactokinase, which promotes the first step of D-galactose metabolism, was destroyed in E. coli BW25113 (National BioResource Project) ; Obtained from NIG) (Japan).

Then, pET28a-gld was transduced into the ΔgalK (E. coli BW25113 ΔgalK::kan ^r ) strain to prepare a'E. coli BW25113 ΔgalK (DE3)/pET28a-gld' strain. Or less, in the experimental example of the present invention exhibited a 'E. coli BW25113 △ galK (DE3 ) / pET28a-gld' strains as EWG2 (Table 1).

< Comparative example 1> In E. coli Galactokinase Gene and D- Galactonate Dehydratase (D-galactonate) dehydratase ) Production of recombinant E. coli in which the gene is destroyed

A strain that destroys dgoD (SEQ ID NO: 3), a gene encoding D-galactonate dehydratase, which promotes the first step of D-galactonate metabolism in the ΔgalK strain (△ galKΔdgoD) was prepared.

Specifically, gene destruction and removal experiments were performed according to the detailed protocol of OPENWETWARE (Liu H, et al., Bioresour Technol 115:244-248, 2012). At this time, the primers used for gene disruption and the primers used for the corresponding verification are shown in Table 2 below. The gene disruption cassette was amplified using pKD3 as a template and the related primers listed in Table 2. The pKD46 plasmid was used as a red recombinase expression vector, and pCP20 was used as a resistance gene removal plasmid. Hereinafter, in the experimental example of the present invention , the'E. coli BW25113 ^{ΔgalK::Kan r} , ΔdgoD::Cm ^r )'strain is represented as'ΔgalKΔdgoD' (Table 1).

< Example 4> In E. coli Galactokinase Gene and 2- Dehydro -3- Deoxy - Galactonate Kinase (2- dehydro -3- deoxy - galactonate kinase ) Production of recombinant E. coli in which the gene is destroyed and D-galactose dehydrogenase derived from Pseudomonas syringa is expressed

As an alternative approach to blocking the D-galactonate metabolic pathway, 2-dehydro-3-deoxy-galactonate kinase (2-), which promotes the second step of D-galactonate metabolism in the ΔgalK strain. Dehydro-3-deoxy-galactonate kinase) encoding gene dgoK (SEQ ID NO: 4) was destroyed to prepare a strain (ΔgalKΔdgoK).

Specifically, gene destruction and removal experiments were performed according to the detailed protocol of OPENWETWARE (Liu H, et al., Bioresour Technol 115:244-248, 2012). At this time, the primers used for gene disruption and the primers used for the corresponding verification are shown in Table 2 below. The gene disruption cassette was amplified using pKD3 as a template and the related primers listed in Table 2. The pKD46 plasmid was used as a red recombinase expression vector, and pCP20 was used as a resistance gene removal plasmid.

Then, by transducing pET28a-gld into the ΔgalKΔdgoK (E. coli BW25113 ΔgalK::Kan ^r , ΔdgoK::Cm ^r ) strain,'E. coli BW25113 ΔgalKΔdgoK (DE3)/ pET28a -gld' strain was prepared. Hereinafter, in the experimental example of the present invention, the'E. coli BW25113 ΔgalKΔdgoK (DE3) / pET28a-gld' strain is represented by EWG3 (Table 1).

Strains used in the experiment Strain Features/Genotype resource P. syringae Wild-type KCTC No. 23665 BL21(DE3) E. coli B F-dcm ompT hsdS(r _B- m _B -) gal λDE3) Invitrogen BW25113 E. coli BW25113F-, △(araD-araB)567, △ lacZ4787(::rrnB-3), λ-1, rph-1, △(rhaD-rhaB)568, hsdR514 NBRP No. ME9092 △galK E. coli BW25113 △galK::Kan ^r NBRP No. JW0740 △galK△dgoD E. coli BW25113 △galK::Kan ^r , △dgoD::Cm ^r Direct manufacture △galK△dgoK E. coli BW25113 △galK::Kan ^r , △dgoK::Cm ^r Direct manufacture BL21(DE3)-gld E. coli BL21 (DE3)/ pET28a-gld Direct manufacture EWG1 E. coli BW25113 (DE3)/ pET28a-gld Direct manufacture EWG2 E. coli BW25113 △galK (DE3)/ pET28a-gld Direct manufacture EWG3 E. coli BW25113 △galK△dgoK (DE3)/ pET28a-gld Direct manufacture

Primers used for gene disruption and PCR amplification primer Sequence (5'-3') function KdgoD-F GCCTGGTTCGCGACAAAATTAAAGCCTACAGTTGGGTTGGCATATGAATATCCTCCTTAGT (SEQ ID NO: 5) dgoD For amplification of disruption cassettes

KdgoD-R CTCTGCTACGCTGTTATCTTCATGACGCCAGAGCGGATTAGTGTAGGCTGGAGCTGCTTCG (SEQ ID NO: 6) KdgoK-F GCCTGAACGGAAAATCTCCGGCTGCGGTGTTAGCAGAAGTCATATGAATATCCTCCTTAGT (SEQ ID NO: 7) For amplification of dgoK destruction cassettes KdgoK-R GCATGAGCGATGCTCCTTATACCAGCCTGAAATGCCGTGTGTGTAGGCTGGAGCTGCTTCG (SEQ ID NO: 8) dgoD-F CGGTCTGGCAACTGATGG (SEQ ID NO: 9) For PCR confirmation of dgoD destruction
dgoD-R GGCTTACGTGGCAGGAAT (SEQ ID NO: 10) dgoK-F GCAGGCAATCAGAAGCAG (SEQ ID NO: 11) dgoK For PCR confirmation of destruction
dgoK-R CGATCAGCGGGAGTTTAGT (SEQ ID NO: 12) gld-F CGATCCATGGATGCAATCGATTCG (SEQ ID NO: 13) gld For PCR confirmation of destruction gld-R CGATGGATCCTCAATCGTAGAACGG (SEQ ID NO: 14)

< Experimental example 1> Analysis of phenotype and enzyme activity of recombinant E. coli according to the present invention

<1-1> Phenotypic analysis

For E. coli BW25113, and each of the strains of <Example 1> to <Example 3>, the phenotype was tested after checking the genotype of each strain through PCR.

Specifically, the phenotypic test was tested for each strain in M9 minimal salt medium containing ^{2 g L -1} agar and 2 g L ^{-1 of D-galactose or D-galactonate as the sole carbon source.} The cultures in which the strains were cultured overnight were diluted to 0.1 AU, 0.01 AU and 0.001 AU at OD600. After dropping an aliquot (5 μL) of the serially diluted culture onto the surface of the solid medium, the cells were incubated at 37°C, and then growth was observed.

<1-2> Enzyme activity analysis

E. coli BW25113, and for each of the strains of <Example 1> to <Example 3>, according to the method reported by Berghall et al. (Biotechnol Lett 8:541-546, 1986), crude cell extract (crude cell extract) was measured for GalDH activity.

Specifically, for the measurement of GalDH activity, the reaction mixture was 1.46 mL de-ionized water, 200 μL pH 8.5 Tris-HCl buffer (1 M), 200 μL crude enzyme, 100 μL D -Galactose stock solution (300 gL ^-1 ), 20 μL MgCl ₂ stock solution (200 mM) and 20 μL NAD ⁺ or NADP ⁺ stock solution (100 mM) were included. Protein concentration was measured using a Bio-Rad protein kit based on a method developed by Bradford (Pao SS, et al., MicrobiolMol Biol Rev 62:1-34, 1998). . One unit of enzyme activity was defined as the concentration of the enzyme capable of converting 1 μmol of D-galactose to D-galactonate per minute, and the specific activity was calculated as the enzyme activity per mg protein. Optimal pH for GalDH activity is potassium acetate (100 mM, pH 5.3-6.8), Tris-HCl (100 mM, pH 8.0-9.8) and Glycine (100 mM, pH 10.4-11.6). It was determined in the range of 5.3 to 11.6 using a buffer solution. Substrate specificity and kinetic analysis were performed in a system containing 100 mM Tris-HCl buffer (pH=8.5), 0.1 mg D-galactose dehydrogenase coenzyme, 2 mM MgCl ₂ and serially diluted concentrations of substrate.

<1-3> D- Galactonate Culture conditions for biosynthesis

Shake flask culture was performed in a 250 mL Erlenmeyer flask containing 100 mL M9 minimal salt medium containing 2 g L-1 glucose, 2 g L- ¹ D-galactose and 40 mg L- ^{1 kanamycin.} The medium was inoculated with 2 mL of overnight culture, and cultured at 37°C with 150 rpm stirring. To induce gld expression, 0.5 mM IPTG (Isopropyl ß-D-1-thiogalactopyranoside) was added when the OD600 value reached 0.3 AU, and added again after 24 hours. In order to maintain pH 7.0, 1 N NaOH was added periodically.

<1-4> D- Galactonate Production of culture medium pH effect

GalDH has the highest activity at pH 9.8, while E. coli prefers neutral and slightly alkaline environments. For this reason, the effect of extracellular pH on D-galactonate production was confirmed.

Specifically, the effect of the pH of the medium on the production of D-galactonate is maintained in the medium by adding a sterile NaOH solution (2M) and HCl solution (3M) to each of the pH 6.5, 7.0, 7.5, 8.0, shake flask Tested using the same conditions in culture.

As a result of each of the above analysis, EWG1 ( E. coli BL21 (DE3)/pET28a-gld) strain showed the presence of GalDH activity. However, the results of kinetic analysis showed that the Km of NAD+ was lower than that of NADP+, which indicates that GalDH prefers NAD+ as its cofactor (Table 3). On the other hand, the EWG1 strain did not detect any activity on glucose oxidation, indicating that GalDH is a good candidate material for selectively producing D-galactonate in the presence of a mixed carbon source.

Kinetic analysis of GalDH obtained from recombinant E. coli ^a K _m (mM) V _max
(μM/min) K _cat ^c
(min ^-1 ) Specific activity
(U/mg) NADP+ NAD+ D-galactose ^b D-glucose ^b 3.37±0.86 0.67±0.03 0.75±0.27 N.d 4.22±0.16 47.34±3.37 1.42±0.11

^{a The} data presented are the results of two independent experiments.

^b NAD ⁺ was used as a cofactor, and Nd (not detected) was not detected.

^c D-galactose calhydrogenase is presumed to be a mono-enzyme with a molecular weight of 33.3 kDa.

72 hours after the EWG1 strain was cultured in a shake flask, EWG1 produced 0.17 g L ^-1 D-galactonate and showed an equivalent yield of 8.3% (Table 4). Initially, D-glucose was consumed and D-galactose was depleted after 36 hours incubation. In addition, consumption of the produced D-galactonate was observed, demonstrating that the product enters the D-galactonate metabolic pathway under prolonged incubation time.

EWG2 ( E. coli BW25113 ΔgalK (DE3)/pET28a-gld) strain showed that the ΔgalK strain lost the growth ability for D-galactose as a result of a phenotypic test (FIG. 3 ). The strain produced 0.44 g L ^-1 D-galactonate and showed a yield of 22.0%, which was 2.6 times higher than that of EWG1 (Table 4). These results demonstrated that blocking of the natural D-galactose metabolic pathway eliminated the substrate competition that continuously increased D-galactonate production. However, the final biomass produced by EWG2 was similar to that of EWG1. In addition, the concentration of D-galactonate was shown to be consumed (FIG. 4 ).

△galK△dgoD ( E. coli BW25113 △galK::Kan ^r , △dgoD::Cm ^r ) strain showed growth against D-galactonate as a result of phenotypic test analysis, but still D-galactonate The concentration of was shown as it was consumed.

EWG3 ( E. coli BW25113 ΔgalKΔdgoK (DE3)/ pET28a-gld) strain produced 1.24 g L ^-1 D-galactonate, and showed an equivalent yield of 62.0%. That is, the productivity of EWG3 was 7.3 times higher than that of EWG1 and 2.8 times higher than that of EWG2 (Table 4).

Thus, while D-galactonate production was significantly enhanced in EWG3, its biomass production was significantly reduced compared to that of EWG1 and EWG2 (FIG. 4 ). In other words, EWG3 was shown to prevent consumption of D-galactonate for cell growth. These results suggest that elimination of product consumption was essential for the production of D- galactonate in E. coli.

D-galactose and biomass production of recombinant E. coli strain in shake flask culture Strain Galactonate
(g L ^-1 ) yield
(g D-galactone
per g D-galactose) omass
(g L ^-1 ) EWG1 0.17±0.00 0.08±0.00 0.55±0.11 EWG2 0.44±0.01 0.22±0.01 0.57±0.00 EWG3 1.24±0.11 0.62±0.06 0.28±0.02

GalDH has the highest activity at pH 9.8, while E. coli prefers neutral and slightly alkaline environments. For this reason, the effect of extracellular pH on D-galactonate production was tested with shake flask cultures of EWG3 at various pH levels (6.5-8.0). As a result, EWG3 was found to show the highest D-galactonate production at pH 7.5 (Table 5).

On the other hand, as a result of measuring the pH effect on GalDH activity, EWG 3 showed the highest enzyme activity at pH 9.8, and showed significant activity within a wide range between pH 6.8 and 11.6 (see FIG. 2).

< Experimental example 2> laboratory scale Discontinuous Confirmation of the production and yield of D-galactonate of the recombinant strain according to the present invention through fermentation

<2-1> Discontinuous Fermentation( Batch fermentation )

To evaluate the D-galactonate productivity and yield of EWG3, discontinuous fermentation was performed using a 5L scale laboratory discontinuous fermentor.

Specifically, discontinuous fermentation was performed in a 5L laboratory scale fermentor containing 2L of M9 minimal salt medium, 20 g L ^-1 of D-glucose and 20 g L ^{-1 of D-galactose.} Kanamycin (40 mg L ^-1 ) was added at the start of fermentation. The inoculum was initially grown by selecting single colonies from agar plates and transferred to 5 mL medium containing 40 mgL-1 kanamycin. The culture was grown at 37° C. with 150 rpm agitation. And after 12 hours, it was transferred to 100 mL fresh medium containing ^{40 mgL -1 kanamycin and incubated for another 12 hours.} Then, after moving the inoculum into the fermentor, discontinuous fermentation was initiated (t = 0 h). The fermentation was stirred at a speed of 650 rpm at 37° C. with a pH of 7.5 and carried out in an air flow of 0.5 vvm. When the OD600 value reached 3.0 AU, 0.5 mM IPTG was added and the temperature decreased to 34°C. The stirring speed was controlled by PID to maintain dissolved oxygen (DO) at 20% air saturation. Foaming was controlled by the addition of a foam inhibitor, and the pH was maintained using a 2N H ₂ SO ₄ acid, or a base which was either a _{30% NH 4} OH or 30% CaCO _{3 solution.}

<2-2> Cell growth and metabolite analysis

Cell growth was measured in terms of the OD600 value based on a standard curve related to the measured dry cell weight. Samples were collected in 2 mL pre-dried and pre-weighed centrifuge tubes, pelleted at 8,000 xg for 10 minutes, washed twice with diluted water, and dried at 105°C. One OD600 unit was equalized to 0.32 gdry cellL ^{- 1} .

Extracellular and intracellular metabolites such as D-glucose, acetic acid, lactic acid, D-galactose and D-galactonate were analyzed by HPLC. Intracellular samples were prepared as follows: Cells were collected by centrifugation at 4,000 xg and 4°C. The collected cells were resuspended in a lysis buffer containing Tris-HCl (25 mM, pH 8.0), NaCl (20 mM) and 10 mg mL ^{-1 of lysozyme.} The sample mixture was incubated at 37° C. for 30 minutes, followed by two freeze-thaw cycles. Finally, an intracellular sample was obtained as a supernatant after centrifugation (20,000 xg) of the cell lysate for 10 minutes at 4°C.

Metabolites were analyzed using Waters HPLC equipped with a Bio-Rad Aminex HPX-87H column (300×7.8 mm). The eluent (5 mM H ₂ SO ₄ ) was pumped at a flow rate of 0.4 mL min-1. The column temperature was maintained at 55° C., and the peak was detected using a Waters 2414 reactive index detector. Since D-galactonate partially dissolves together with D-galactose, it cannot be accurately quantified using the HPLC method. Therefore, D-galactonate concentration was measured using previously reported hydroxyamate (Puigbo P, et al., Nucleic Acids Res 35:W126-131, 2007). Samples (300 μL) were diluted in 1 mL of 0.7 M HCl and boiled at 100° C. for 15 minutes. Boiled sample (500 μL) was added to 1 mL hydroxylamine reagent (2 M NaOH with 2 M hydroxylamine HCl), followed by 650 μL of 3.2 M HCl, and finally 500 μL A solution of FeCl ₃ (0.1 M HCl containing 100 g/L) was added. The absorbance was measured immediately at 550 nm. The D-galactonate concentration was determined by comparing the absorbance against a standard curve.

After the analysis results, the fermentation for 72 hours D- galactosyl carbonate concentration of 17.6 g L ^-1 was reached (i.e., per D- galactose 0.88 g D- galacto-sulfonate), 88% of the equivalent yield and 0.24 g L ^{- It} showed the average productivity of 1 h ^-1 (Fig. 5).

Meanwhile, as a result of intracellular metabolite analysis, it was shown that there was no accumulation of D-galactonate, indicating efficient production and secretion. In addition, EWG3 produced a huge amount of acetic acid from glucose, whereby a strong inhibition of strain growth was observed (Fig. 6), which is one of the reasons for causing incomplete conversion of all D-galactose.

< Experimental example 3> D- produced by the recombinant strain according to the present invention Galactonate Recovery, purity and structure analysis

After recovering the D-galactonate produced by EWG3, the purity and structure were analyzed.

Specifically, D-galactonate was recovered from culture broth by a previously reported method (Zeng AP, et al., Curr Opin Biotechnol 22:749-757, 2011). To facilitate the recovery of D-carbonate _{, a slurry of calcium carbonate (CaCO 3} ) was added to the culture solution during fermentation, and the pH of the culture solution was also maintained. 1 mole of Ca ^{2 +} can be utilized as 2 moles of sugar acid (Kuivanen J, et al., Appl Environ Microbiol 78:8676-8683, 2012). After fermentation, centrifugation was performed to obtain a supernatant from which cells were removed. First, the cells were removed by centrifugation at 2,500 xg for 10 minutes. The supernatant was decolorized with activated carbon and concentrated in vacuo to 1 L to 200 mL, followed by addition of EtOH (3:1, v/v). After storage at 4° C. for 12 hours, the D-galactonate precipitate was collected and dried under vacuum.

The structure of D-galactonate was confirmed through 13C- and 1H-NMR analysis using a Varian Unity Inova spectrometer at 500 MHz with a 5 mm PFG indirect NMR probe. The dried D-galactonate sample was redissolved with deuterated water prior to NMR analysis.

As a result of the analysis, 82.9% of D-galactonate was recovered from the fermentation broth through the recovery procedure.

Further, as a result of performing HPLC analysis to confirm the purity of the recovered D-galactonate, it was shown that the purity was as high as 97.6%.

In addition, as a result of performing 13C-NMR and 1H-NMR analysis to confirm the structure of the purified D-galactonate, it was shown that the product was present in the active form and no lactone intermediate was detected (FIG. 7 ).

The metabolic engineering strategy developed in the present invention enables industrial production of D-galactonate, and thus can be usefully used for supplying polyester precursors, food additives, drug intermediates, and cosmetic raw materials in which D-galactonate is used. .

<110> MYONGJI UNIVERSITY INDUSTRY AND ACADEMIA COOPERATION FOUNDATION <120> ESCHERICHIA COLI FOR HIGH PRODUCTION OF D-GALACTONATE AND USE THEREOF <130> P13-0171 <160> 14 <170> KopatentIn 2.0 <210> 1 <211> 927 <212> DNA <213> Pseudomonas syringae <400> 1 atgcaatcga ttcgtctcgg tctggtgggc tacggcaaga ttgcgcagga tcaacacgtc 60 ccggcgatcc acgccaaccc cgcgtttgag ctggtggccg tggccacgca aggccagccg 120 tgcgccgggg tagagaattt caaatccctg ggcgaactgc ttgcgagcgg gctgcaggtt 180 gacgcgattg cgttctgtac gcccccgcaa ggtcgctttg ccctggtgca ggaagcgttg 240 gcggctggca aacatgtgtt ggtcgagaaa ccgccgtgcg cgaccctggg ggaggcgatg 300 gcgttggtag cccaggtgca agagcagggc gtcagcggtc tgtttgcctg gcattcgcgt 360 tacgcgcaag gtatcgaagc ggcgcgtgag tggttgtcca cccgcaccct gcacagcgtg 420 cagatcgact ggaaagaaga cgtgcgcaaa tggcaccccg gtcaggcgtg gatctggcag 480 cccggtggcc ttggcgtgtt cgatccgggc atcaatgccc tgtcgatcgt gacccacctg 540 ctgccactgt cattgttcgt cgagtctgcc gaactgcgcg tgccgagcaa ttgccagtcg 600 cctatcgctg cgtccatcaa aatgtccgac acgcgccatc tcgatatccg cgccgagttc 660 gatttcgatc atggtcacga cgagctttgg agcatcgaga ttcgctgcgc tgaggggacg 720 ttgcgcctgg acagcggcgg tgcagtgttg agtatcgatg gcgtgcgtca ggctgtttcg 780 gaagagggcg agtacgcagc ggtgtatcgc cacttccaac agttgatcgg cgataaagcc 840 agtgacttgg acctgcaacc gttgcggctg gtcgcggaca gttttttcgt gggcggtcgg 900 gcatccgttg aaccgttcta cgattga 927 <210> 2 <211> 1149 <212> DNA <213> Escherichia coli <400> 2 atgagtctga aagaaaaaac acaatctctg tttgccaacg catttggcta ccctgccact 60 cacaccattc aggcgcctgg ccgcgtgaat ttgattggtg aacacaccga ctacaacgac 120 ggtttcgttc tgccctgcgc gattgattat caaaccgtga tcagttgtgc accacgcgat 180 gaccgtaaag ttcgcgtgat ggcagccgat tatgaaaatc agctcgacga gttttccctc 240 gatgcgccca ttgtcgcaca tgaaaactat caatgggcta actacgttcg tggcgtggtg 300 aaacatctgc aactgcgtaa caacagcttc ggcggcgtgg acatggtgat cagcggcaat 360 gtgccgcagg gtgccgggtt aagttcttcc gcttcactgg aagtcgcggt cggaaccgta 420 ttgcagcagc tttatcatct gccgctggac ggcgcacaaa tcgcgcttaa cggtcaggaa 480 gcagaaaacc agtttgtagg ctgtaactgc gggatcatgg atcagctaat ttccgcgctc 540 ggcaagaaag atcatgcctt gctgatcgat tgccgctcac tggggaccaa agcagtttcc 600 atgcccaaag gtgtggctgt cgtcatcatc aacagtaact tcaaacgtac cctggttggc 660 agcgaataca acacccgtcg tgaacagtgc gaaaccggtg cgcgtttctt ccagcagcca 720 gccctgcgtg atgtcaccat tgaagagttc aacgctgttg cgcatgaact ggacccgatc 780 gtggcaaaac gcgtgcgtca tatactgact gaaaacgccc gcaccgttga agctgccagc 840 gcgctggagc aaggcgacct gaaacgtatg ggcgagttga tggcggagtc tcatgcctct 900 atgcgcgatg atttcgaaat caccgtgccg caaattgaca ctctggtaga aatcgtcaaa 960 gctgtgattg gcgacaaagg tggcgtacgc atgaccggcg gcggatttgg cggctgtatc 1020 gtcgcgctga tcccggaaga gctggtgcct gccgtacagc aagctgtcgc tgaacaatat 1080 gaagcaaaaa caggtattaa agagactttt tacgtttgta aaccatcaca aggagcagga 1140 cagtgctga 1149 <210> 3 <211> 1149 <212> DNA <213> Escherichia coli <400> 3 atgaaaatca ccaaaattac cacgtatcgt ttacctcccc gctggatgtt cctgaaaatt 60 gaaaccgatg aaggcgtggt cggttggggc gagcccgtga tcgaaggccg cgcccgtacg 120 gtggaagcgg cagttcacga gctgggtgac tatttgattg gtcaggatcc atcgcgcatc 180 aatgacttat ggcaagtgat gtatcgcgcc ggattctatc gcggcggtcc gatcctgatg 240 agcgccatcg ccgggattga ccaggcgtta tgggatatca aaggtaaagt gctgaatgcg 300 ccggtctggc aactgatggg cggcctggtt cgcgacaaaa ttaaagccta cagttgggtt 360 ggcggcgatc gtccggcgga tgttatcgac ggcattaaaa cgctacgcga aatcggcttc 420 gataccttca aactgaacgg ttgtgaagaa ctggggctaa ttgataactc ccgcgcggta 480 gatgcggcgg ttaacaccgt ggcacaaatt cgtgaagctt ttggcaatca gattgagttt 540 ggtcttgatt tccacggtcg cgtcagcgcg ccgatggcga aagtgctgat taaagaactg 600 gagccgtatc gcccgctgtt tattgaggag ccggtgctgg cggaacaagc cgaatactac 660 ccgaaactgg cggcacaaac gcatattcca ctggcggcgg gtgaacgcat gttctcacgc 720 ttcgatttta aacgcgtgct ggaggcaggt ggtatttcga ttctgcaacc ggatctctcc 780 cacgcgggcg gtattaccga atgctacaaa atcgccggaa tggcagaagc ctatgacgtg 840 acccttgcgc cgcactgtcc gctcggaccg attgcactgg cggcttgcct gcatatcgac 900 tttgtttcct ataacgccgt acttcaggaa caaagtatgg gaattcatta caacaaaggc 960 gcggagttac tcgactttgt gaaaaacaaa gaagacttca gcatggtcgg cggcttcttt 1020 aaaccgttaa cgaaaccggg cttaggcgtg gaaatcgacg aagctaaagt gattgagttc 1080 agtaaaaatg ccccggactg gcgtaatccg ctctggcgtc atgaagataa cagcgtagca 1140 gagtggtaa 1149 <210> 4 <211> 879 <212> DNA <213> Escherichia coli <400> 4 atgacagctc gctacatcgc aattgactgg ggatcgacca atctgcgcgc ctggctttat 60 cagggcgacc actgcctgga gagcaggcaa tcagaagcag gcgtcacgcg cctgaacgga 120 aaatctccgg ctgcggtgtt agcagaagtc acgaccgact ggcgtgaaga gaaaacgcca 180 gtggtaatgg caggaatggt tggcagcaac gtcggctgga aagttgcacc gtatttatct 240 gttcctgcct gtttttcgtc tattggcgaa caattaacgt cagttggcga caatatctgg 300 attattcccg gattatgtgt ctctcatgac gataaccaca atgtgatgcg cggcgaagaa 360 acacaattga tcggcgcgcg agctctggct ccttcctctc tttatgtcat gcccggaacc 420 cattgcaaat gggtgcaggc cgatagccag caaatcaacg attttcgcac cgtgatgacc 480 ggtgaattac atcatttact gttaaatcac tcattgattg gcgcaggttt gccgccgcag 540 gaaaactctg ccgatgcctt cacagctggc cttgagcgtg gtcttaatac gcccgccata 600 ttgccgcagc tttttgaagt tcgcgcctcg catgtgctgg gaacacttcc ccgcgaacag 660 gtcagcgaat ttctctctgg tttgttgatt ggcgcagagg tcgccagtat gcgcgactat 720 gtggcccatc aacacgccat cacccttgtc gccggaacat cgctgaccgc gcgctaccag 780 caagcctttc aggcgatggg ttgcgacgtg acggcggtgg cgggcgacac ggcatttcag 840 gctggtataa ggagcatcgc tcatgcagtg gcaaactaa 879 <210> 5 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for KdgoD <400> 5 gcctggttcg cgacaaaatt aaagcctaca gttgggttgg catatgaata tcctccttag 60 t 61 <210> 6 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for KdgoD <400> 6 ctctgctacg ctgttatctt catgacgcca gagcggatta gtgtaggctg gagctgcttc 60 g 61 <210> 7 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for KdgoK <400> 7 gcctgaacgg aaaatctccg gctgcggtgt tagcagaagt catatgaata tcctccttag 60 t 61 <210> 8 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for KdgoK <400> 8 gcatgagcga tgctccttat accagcctga aatgccgtgt gtgtaggctg gagctgcttc 60 g 61 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for dgoD <400> 9 cggtctggca actgatgg 18 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for dgoD <400> 10 ggcttacgtg gcaggaat 18 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for dgoK <400> 11 gcaggcaatc agaagcag 18 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for dgoK <400> 12 cgatcagcgg gagtttagt 19 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for gld <400> 13 cgatccatgg atgcaatcga ttcg 24 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for gld <400> 14 cgatggatcc tcaatcgtag aacgg 25

Claims (17)

A galactokinase gene encoding galactokinase is knocked out of Escherichia coli and an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringae is transduced into D-galactonate Producing E. coli strains.
The dogK gene encoding the galK gene encoding the galactokinase and the 2-dehydro-3-deoxy-galactonate kinase is knocked out into Escherichia coli, and galactose derived from Pseudomonas syringae Galactonate-producing E. coli strain prepared by transfecting an expression vector containing a gld gene encoding a dehydrogenase.
The D-galactonate producing Escherichia coli strain according to claim 1 or 2, wherein the gld gene comprises the nucleotide sequence of SEQ ID NO: 1.
3. The D-galactonate producing Escherichia coli strain according to claim 1 or 2, wherein the galK gene is composed of the nucleotide sequence of SEQ ID NO: 2.
3. The D-galactonate producing Escherichia coli strain according to claim 2, wherein the dogK gene comprises the nucleotide sequence of SEQ ID NO: 4.
1) preparing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringae;
2) knocking off the galK gene encoding galactokinase in E. coli; And
3) A method for producing D-galactonate-producing Escherichia coli strain, comprising the step of transfecting the Escherichia coli of step 2) with the expression vector of step 1).
1) preparing an expression vector containing a gld gene encoding a galactose dehydrogenase derived from Pseudomonas syringae;
2) knocking out a galK gene encoding galactokinase in E. coli and a dogK gene encoding 2-dehydro-3-deoxy-galactonate kinase; And
3) A method for producing D-galactonate-producing Escherichia coli strain, comprising the step of transfecting the Escherichia coli of step 2) with the expression vector of step 1).
[Claim 7] The method according to claim 6 or 7, wherein the expression vector of step 1) is a pET28a expression vector.
The method for producing D-galactonate-producing Escherichia coli strain according to claim 6 or 7, wherein the Escherichia coli in step 2) is E. coli BL21 (DE3).
[Claim 7] The method according to claim 6 or 7, wherein the knockout is performed by destroying a gene using a gene disruption cassette.
The method according to claim 6 or 7, wherein the transduction is carried out using electroporation.
1) culturing the Escherichia coli strain of claim 1; And
2) recovering D-galactonate in the culture medium cultured in the step 1).
1) culturing the Escherichia coli strain of claim 2; And
2) recovering D-galactonate in the culture medium cultured in the step 1).
14. The method for mass production of D-galactonate according to claim 12 or 13, wherein the culture in step 1) is a medium containing a carbon source and D-galactose.
14. The method of mass production of D-galactonate according to claim 12 or 13, wherein the culture of step 1) is carried out at a pH of 7 to 8.
14. The method of mass production of D-galactonate according to claim 12 or 13, wherein the step 1) is carried out for 36 to 72 hours.
14. The method for mass production of D-galactonate according to claim 12 or 13, further comprising the step of recovering and purifying in step 2).

Images