KR20140143079A - Polynucleotide encoding methyltransferase and method for producing methyl stilbene compound using thereof - Google Patents

Abstract

The present invention relates to a gene encoding methyltransferase and a method for producing a stilbene compound using the same. A methyl stilbene compound produced though the method of the present invention has anticancer, anti-inflammatory, anti-hyperlipidaemic, and antioxidant effects, so that a method for producing the methyl stilbene compound and a compound produced using the same can be usefully used in the medical industry.

Description

TECHNICAL FIELD [0001] The present invention relates to a methyltransferase-encoding polynucleotide and a method for producing methylated stilbene compound using the methyltransferase-encoding polynucleotide. [0002]

The present invention relates to a methyltransferase-encoding polynucleotide and a method for producing methylated stilbene compounds using the same.

Stilbenoid is a secondary product that is formed in woody matter and acts as phytoalexin. Especially resveratrol is one of the important stilbenoids. It has anticancer effect, strong antioxidative effect and serum It is known that it has the effect of lowering cholesterol.

Pterostilbene is one of the methylated stilbene compounds, found in grapes and blueberries, and one of the substances plants produce in response to infection. Pterostilbene has been shown to be effective in reducing the effects of anticancer drugs, hypertriglyceridemia or hypercholesterolemia, and is highly bioavailable at the time of oral ingestion and is metabolized more slowly than other antioxidant polyphenols in the body, It has a long lasting effect.

However, despite the above-mentioned excellent effects, it is difficult to supply only a limited amount because the content in the plant is low, and it is difficult to supply the product stably for the purpose of treatment. Thus, a method for producing the product with high yield and purity Is required.

KR 10-2013-0001940

The inventors of the present invention invented a method for producing a methylated stilbene compound through the expression of sorghum bicolor-derived methyltransferase gene, and found that the methyltransferase gene can be expressed in E. coli under optimal conditions And the methylated stilbene compound can be synthesized through the above-mentioned gene, thereby completing the present invention.

The present invention provides a polynucleotide for synthesizing a methylated stilbene compound, a composition for producing a methylated stilbene compound containing the polynucleotide, a recombinant vector containing the recombinant vector, Provide microorganisms.

The present invention also provides a method for producing a methylated stilbene compound by using the polynucleotide.

In order to solve the above problems, the present invention provides a polynucleotide comprising any one of the nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and combinations thereof.

Also, the present invention provides a polynucleotide comprising a polynucleotide encoding an O-methyltransferase comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and combinations thereof. Or a salt thereof.

[Chemical Formula 1]

In Formula 1, R _1, R ₂ and R ₃ are each independently hydrogen or a methyl group, and at least one of R ₁ to R ₃ is a methyl group.

Also, the present invention provides a polynucleotide comprising a polynucleotide encoding an O-methyltransferase consisting of any one of the nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and combinations thereof. Lt; / RTI > to produce a recombinant vector.

The recombinant vector is composed of a polynucleotide encoding tyrosine ammonia lyase, a polynucleotide encoding Cinnamate / 4-Coumarate (CoA ligase) and a polynucleotide encoding stilbene synthase It may further comprise a polynucleotide encoding an enzyme (Stilbene synthase).

The recombinant vector may be a polynucleotide encoding tyrosine ammonia lyase, a polynucleotide encoding Cinnamate / 4-Coumarate (CoA ligase), a polynucleotide encoding stilbene synthase A polynucleotide encoding an O-methyltransferase comprising the nucleotide sequence of SEQ ID NO: 1 and an O-methyltransferase comprising the nucleotide sequence of SEQ ID NO: 3, Or a polynucleotide encoding a polynucleotide that encodes a polynucleotide encoding a polynucleotide.

The present invention also provides a transformed microorganism for producing a compound represented by the above formula (1), which is prepared by transforming a host cell with a recombinant vector of any of the above recombinant vectors.

The present invention also provides a method for producing a recombinant vector, comprising the steps of: preparing the recombinant vector; transforming the host cell with the recombinant vector to obtain a transformed microorganism; culturing the transformed microorganism; (1), comprising the steps of:

The present invention also provides a method for producing a recombinant vector comprising the steps of: preparing a recombinant vector comprising a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; Transforming the host cell with the recombinant vector to obtain a transformed microorganism; Culturing the transformed microorganism; And obtaining a compound represented by the following formula (2) in the culture.

(2)

The present invention also provides a method for producing a recombinant vector comprising the steps of: preparing a recombinant vector comprising a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3; Transforming the host cell with the recombinant vector to obtain a transformed microorganism; Culturing the transformed microorganism; And a step of obtaining a compound represented by the following formula (3) and (4) in the cultured product.

(3)

[Chemical Formula 4]

The present invention also provides a method for producing a recombinant vector comprising the steps of: preparing a recombinant vector comprising a polynucleotide encoding TAL, CCL, and STS; and a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; Transforming the host cell with the recombinant vector to obtain a transformed microorganism; Culturing the transformed microorganism; And obtaining a compound represented by the following formula (2) in the culture.

The present invention also provides a method for producing a recombinant vector comprising the steps of: preparing a recombinant vector comprising a polynucleotide encoding TAL, CCL, and STS; and a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3; Transforming the host cell with the recombinant vector to obtain a transformed microorganism; Culturing the transformed microorganism; And obtaining a compound represented by the following formula (3) in the culture.

The present invention also provides a method for producing a recombinant vector comprising the steps of: preparing a recombinant vector comprising a polynucleotide encoding TAL, CCL, and STS; and a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 3; Transforming the host cell with the recombinant vector to obtain a transformed microorganism; Culturing the transformed microorganism; And obtaining a compound represented by the following general formulas (2), (5) and (6) in the culture.

[Chemical Formula 5]

[Chemical Formula 6]

As used herein, a culture means a culture of a specific microorganism in a culture medium or a culture solution, and the culture includes a culture containing the specific microorganism or a culture of a microorganism in which the microorganism has been inactivated Lt; / RTI > The concentrate of the culture or culture is not limited in its formulation, for example, the formulation may be liquid or solid.

In order to cultivate a specific microorganism, the medium may include a nutrient required for a cultured object, that is, a microorganism to be a cultured material, and a substance for a special purpose may be further added and mixed. The medium is also referred to as an incubator or a culture medium, and is a concept including both natural medium, synthetic medium and selective medium.

Hereinafter, the present invention will be described in detail.

The present invention provides a polynucleotide encoding an O-methyltransferase. The polynucleotide may be any one selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and combinations thereof.

The O-methyl transferase is meant to include all enzymes that catalyze the transfer of methyl in the molecule. For example, in a resveratrol, resveratrol O-methyltransferase, an enzyme that substitutes hydrogen for methyl groups, or hydrogen for two hydroxyl groups (-OH) bound to the phenyl group of trans-type resveratrol, It may be a resveratrol di-O-methyltransferase.

The polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 includes resveratrol 0-methyltransferase Sbcom1 encoding polynucleotide Sbm1 . Sbm1 the amino acid sequence of the Sorghum (Sorghum bicolor), the resveratrol O-methyl transferase Sbcom1 derived from (SEQ ID NO: 2 and Fig. 2) based on the optimal codon frequency of use of the tRNA ratio for each amino acid in E. coli (codon (SEQ ID NO: 1 and FIG. 1). The Sbm1 gene (polynucleotide) was synthesized and named as Sbm1 gene (polynucleotide).

The polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3 contains the gene Sbm3 () encoding the resveratrol O-methyltransferase Sbcom3. Based on the amino acid sequence of resveratrol 0-methyltransferase Sbcom3 (see SEQ ID NO: 4 and FIG. 11) derived from Sorghum bicolor, the optimal codon usage according to the ratio of tRNA to each amino acid in E. coli (SEQ ID NO: 3 and FIG. 10). The Sbm3 gene (polynucleotide) was synthesized and named as Sbm3 gene (polynucleotide).

In one embodiment of the present invention, a vector containing each of the Sbm1 gene and Sbm3 gene was prepared, and resveratrol was added to confirm whether the methylated stilbene compound was synthesized. As a result, the methylated stilbene compound represented by the following formula And the expression of the gene was confirmed as shown in Fig.

Each of the above genes may be provided in the form of a single cluster of genes, or may be provided in a cloned vector separated from each other.

The present invention also relates to a composition for producing a compound represented by the following general formula (1). The composition comprises a polynucleotide encoding a 0-methyltransferase comprising any one of the nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and combinations thereof.

The compound represented by the formula (1) may be a methylated stilbene compound in which at least one hydrogen in the substituent of the stilbene compound is substituted with a methyl group (-CH ₃ ).

[Chemical Formula 1]

In Formula 1, R _1, R ₂ and R ₃ are each independently hydrogen or a methyl group, and at least one of R ₁ to R ₃ is a methyl group.

The compound in which R ₁ is substituted with a methyl group in Formula 1 has a molecular formula C ₁₅ H ₁₄ O ₃ and is represented by the following Formula 2: (3,5-dihydroxy-4'-methoxy-trans stilbene (3, 5-dihydroxy-4'-methoxy- trans -stilbene).

(2)

The compound in which only one of R ₂ and R ₃ in the above formula (1) is substituted with a methyl group has a molecular formula of C ₁₅ H ₁₄ O ₃ , and is a compound represented by the following formula (3): 3,4'-dihydroxy-5-methoxy- (3,4'-dihydroxy-5-methoxy- trans -stilbene), also known as pinostilbene.

 (3)

The compound in which R ₂ and R ₃ are substituted with a methyl group in the above formula (1) has a molecular formula C ₁₆ H ₁₆ O ₃ and is 3,5-dimethoxy-4'-hydroxy-trans stilbene 3,5-dimethoxy-4'-hydroxy- trans -stilbene), also known as Pterostilbene.

[Chemical Formula 4]

In the above formula (1), the compound in which R ₁ is substituted by a methyl group and either R ₂ or R ₃ is substituted by a methyl group has the molecular formula C ₁₆ H ₁₆ O ₃ , and the compound represented by the following formula (5) -Dimethoxy-5-hydroxy- trans- stilbene. ≪ / RTI >

[Chemical Formula 5]

The compound in which all of R _1, R ₂ and R ₃ are substituted with a methyl group in the above formula (1) has a molecular formula C ₁₇ H ₁₈ O ₃ , and a trimethoxy- trans -stilbene ).

 [Chemical Formula 6]

The composition may be a composition for producing a methylated stilbene compound comprising the Sbm1 gene comprising the nucleotide sequence of SEQ ID NO:

In a specific embodiment of the present invention, a recombinant vector comprising the Sbm1 gene consisting of the nucleotide sequence of SEQ ID NO: 1 is prepared , transformed into Escherichia coli, treated with resveratrol and cultured to obtain a culture, As a result of HPLC analysis of water, it was confirmed that the methylene stilbene compound represented by Formula 2 was produced.

The composition may be a composition for producing a methylated stilbene compound comprising the Sbm3 gene comprising the nucleotide sequence of SEQ ID NO:

In a specific embodiment of the present invention, a recombinant vector comprising the Sbm3 gene consisting of the nucleotide sequence of SEQ ID NO: 3 is prepared , transformed into Escherichia coli, treated with resveratrol and cultured to obtain a culture, As a result of HPLC analysis of water, it was confirmed that the methylene stilbene compounds represented by the above formulas (3) and (4) were produced.

The composition may be a composition of O-methyl O-methyl transferase of SEQ ID NO: 1 nucleotide sequence of the gene (Sbm1) and SEQ ID NO: 3 of the sequence includes both the transferase gene (Sbm3).

The composition for the production of methylene stilbene compound includes a gene coding for tyrosine ammonia lyase (hereinafter, referred to as 'TAL'), a cinnamate / 4-coumarate coenzyme Alaease enzyme, (Hereinafter, referred to as " CCL "), a gene encoding a stilbene synthase (STS), and a combination thereof.

The TAL refers to an enzyme that converts L-Tyrosine to 4-Coumaric acid and includes all of the enzymes.

In one embodiment of the present invention, based on the amino acid sequence of tyrosine ammonia lyase identified in Saccharothrix espanaensis (KCTC9392), the optimal codon usage according to the ratio of tRNA to each amino acid in E. coli ) was determined using the nucleotide sequence (SEQ ID nO: 5), termed opTAL and not intended to be used, but by combining the opTAL gene, like.

The CCL refers to an enzyme that converts 4-Coumaric acid to 4-Coumaroyl coenzyme A and includes all of the enzymes.

Was determined the nucleotide sequence Based on the amino acid sequence of the CCL identified in Streptomyces (Streptomyces coelicolor M130) in one embodiment of the invention (SEQ ID NO: 6), named as CCL and although used to synthesize CCL gene, but not limited to, .

The STS refers to an enzyme that converts 4-Coumaroyl coenzyme A into 3-malonyl-CoA to resveratrol and includes all of the enzymes .

Based on the amino acid sequence of the peanut (Arachis hypogaea), the nucleotide sequence using the optimal codon usage according to the ratio of tRNA to each amino acid in E. coli was determined (SEQ ID NO: 7) , KSTS and synthesized KSTS gene, but the present invention is not limited thereto.

The present invention also relates to a recombinant vector for producing a compound represented by the above formula (1).

The recombinant vector can be used as long as it is used for expressing an exogenous protein in a prokaryotic or eukaryotic cell. Recombinant vectors for prokaryotic cells are preferred, and recombinant vectors for eukaryotic cells can be used for recombinant vectors for yeast insects or mammalian cells, but it is preferable to use recombinant vectors for yeast.

Commercially available vectors for prokaryotic cells include but are not limited to pET vectors (Novagen, Inc., USA), pQE vectors (Qiagen, USA) and pGEX (Pharmacia Biotech Inc., USA) PCT1 (Stratagene, USA), pSG5 (Stratagene, USA), pCMNeo (Clontech, USA), pcDNA3 (InVitrogen, USA) ), PBPV-1 (8-2) (ATCC 37110), pdBPV-MMTneo (342-12) (ATCC 37224), pRSVgpt (ATCC 37199), pRSVneo (ATCC 37198), EBO-pSV2- pSV2-dhfr (ATCC 37146), pUCTag (ATCC 37460), and lZD35 (ATCC 37565), but the present invention is not limited thereto.

The recombinant vector may be used as an expression-suppressing fragment having various functions for inhibiting, amplifying, or inducing expression, a marker for selecting a transformant, a resistance gene for antibiotics, or a signal for secretion of cells A gene coding for the gene, and the like.

Wherein the recombinant vector comprises a polynucleotide encoding an O-methyltransferase comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and combinations thereof May be a recombinant vector.

The recombinant vector may be a recombinant vector for producing a methylated stilbene compound comprising a polynucleotide encoding an O-methyl transferase comprising the nucleotide sequence of SEQ ID NO: 1.

In a specific embodiment of the present invention, a gene ( Sbm1 ) comprising the nucleotide sequence of SEQ ID NO: 1 is inserted into the NdeI / HindIII site of pET-22b (+) to produce a recombinant vector (Fig. 5). The obtained methylated stilbene compound of formula (2) was confirmed by HPLC analysis of the compound synthesized by resveratrol treatment and cultivation.

The recombinant vector may be a recombinant vector for producing a methylated stilbene compound comprising a polynucleotide encoding an O-methyl transferase comprising the nucleotide sequence of SEQ ID NO: 3.

In a specific embodiment of the present invention, a recombinant vector is prepared by inserting the gene ( Sbm3 ) comprising the nucleotide sequence of SEQ ID NO: 3 into the NdeI / HindIII site of pET-22b (+ , And Escherichia coli was treated with resveratrol and cultured. HPLC analysis of the synthesized compound showed that the methylated stilbene compounds represented by Chemical Formulas 3 and 4 were produced (see FIG. 5).

The recombinant vector may be a recombinant vector for producing a methylated stilbene compound containing both an O-methyl transferase comprising the nucleotide sequence of SEQ ID NO: 1 and a polynucleotide encoding the O-methyl transferase comprising the nucleotide sequence of SEQ ID NO: 3 have.

The recombinant vector is a gene encoding tyrosine ammonia lyase (TAL), a gene encoding Cinnamate / 4-Coumarate: CoA ligase (CCL) , A gene encoding a stilbene synthase (STS), and a combination thereof.

The recombinant vector includes a gene encoding TAL, a gene encoding CCL, a gene ( Sbm1 ) encoding an O-methyltransferase comprising a nucleotide sequence of SEQ ID NO: 1, and a gene encoding STS (See FIG. 6).

In a specific embodiment of the present invention, the recombinant vector pET-opT-L01S according to FIG. 6 was prepared (see FIG. 7), and the compound synthesized by transforming and culturing in E. coli was subjected to HPLC analysis, It was confirmed that a methylated stilbene compound was produced (see Fig. 8).

The recombinant vector comprises a gene encoding TAL, a gene encoding CCL, a gene ( Sbm3 ) encoding an O-methyltransferase comprising a nucleotide sequence of SEQ ID NO: 3, and a gene encoding STS (See FIG. 6).

In a specific embodiment of the present invention, a recombinant vector pET-opT-L03S according to the following FIG. 6 was prepared (see FIG. 7), and the compound synthesized by transforming and culturing in E. coli was subjected to HPLC analysis, (See Fig. 12).

The recombinant vector comprises a gene encoding TAL, a gene ( Sbm3 ) encoding the 0-methyltransferase comprising the nucleotide sequence of SEQ ID NO: 3, a gene encoding CCL, a 0-methyltransferase comprising the nucleotide sequence of SEQ ID NO: 1 ( Sbm1 ) that encodes the STS and a gene that encodes the STS (see FIG. 7).

In a specific example of the present invention, a recombinant vector pET-opT-L013S according to FIG. 13 was prepared (see FIG. 13), and the compound synthesized by transforming and culturing in E. coli was subjected to HPLC analysis to obtain methylated steel Benz compound and the methylated stilbene compound represented by the above Chemical Formulas 5 and 6 were produced (see Fig. 14).

Therefore, the recombinant vector of the present invention can be usefully used for the synthesis of methylated stilbene compounds.

The present invention also relates to a transformed microorganism for producing a compound represented by the above formula (1). The transformed microorganism according to an embodiment of the present invention may be a transformed host cell with the recombinant vector.

The host cell includes both prokaryotic and eukaryotic cells, preferably using prokaryotic cells, but is not limited thereto. The prokaryotic cells include both intact bacteria and germs including gram-positive bacteria and gram-negative bacteria. Examples of the gram-positive bacteria include, but are not limited to, bacteria belonging to the genus Bacillus, Staphylococcus, Streptococcus, Streptococcus, Pneumococcus, Leprosy, Diphtheria, Tetanus, Anthrax and Actinomycetes. The Gram-negative bacteria include, but are not limited to, Salmonella, Dysentery, Typhoid, Escherichia coli, Cholera, Pest, Gonococcus, Meningococcus, Spiroheta and the like.

The host cell may be any of those capable of biosynthesizing any one of L-tyrosine, 4-coumarinic acid, 4-coumaroyl coenzyme A, resveratrol, and a combination thereof, and examples thereof include those capable of producing a large amount of resveratrol Escherichia coli and L-tyrosine can be preferably used, but the present invention is not limited thereto.

The transformed microorganism may be obtained by using a recombinant vector comprising a gene coding for an O-methyltransferase consisting of any one of the nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 and combinations thereof It may be transformed.

In a specific embodiment of the present invention, Escherichia coli is transformed with a recombinant vector comprising a polynucleotide encoding the O-methyl transferase comprising the nucleotide sequence of SEQ ID NO: 1, and resveratrol is treated on the transformed E. coli culture medium And the resulting synthesized compound was subjected to HPLC analysis to confirm that each of the transformed microorganisms synthesized the methylated stilbene compound represented by the above formula (2) (see FIG. 5).

In a specific embodiment of the present invention, Escherichia coli is transformed with a recombinant vector comprising a polynucleotide encoding the O-methyl transferase comprising the nucleotide sequence of SEQ ID NO: 3, and Resveratrol is treated on the transformed Escherichia coli culture medium The synthesized compounds were analyzed by HPLC to confirm that the respective transformed microorganisms synthesized the methylated stilbene compounds represented by the following Chemical Formulas 3 and 4 (see FIG. 5).

The transforming microorganism has a gene encoding an O-methyltransferase consisting of any one of the nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and combinations thereof and a tyrosine ammonia lyase , A gene encoding Cinnamate / 4-Coumarate: CoA ligase (hereinafter referred to as CCL), a gene encoding Stilbene synthase (STS) And a recombinant vector containing any one of the genes selected from the group consisting of a combination of these genes.

The transgenic microorganism includes a gene encoding TAL, a gene encoding CCL, a gene ( Sbm1 ) encoding O-methyltransferase comprising the nucleotide sequence of SEQ ID NO: 1, and a gene encoding STS Lt; / RTI > vector.

In a specific embodiment of the present invention, a recombinant vector comprising a polynucleotide encoding the O-methyl transferase consisting of the nucleotide sequence of SEQ ID NO: 1 or a gene comprising the TAL gene, the CCL gene, the STS gene and the nucleotide sequence of SEQ ID NO: , And the resulting synthesized E. coli was cultured. The synthesized compound was subjected to HPLC analysis to confirm that each of the transforming microorganisms synthesized the methylated stilbene compound represented by the above formula (2) (See Fig. 8).

The transforming microorganism includes a gene encoding TAL, a gene encoding CCL, a gene ( Sbm1 ) encoding O-methyltransferase comprising the nucleotide sequence of SEQ ID NO: 3, and a gene encoding STS Lt; / RTI > vector.

In a specific embodiment of the present invention, a recombinant vector comprising a polynucleotide encoding the O-methyl transferase consisting of the nucleotide sequence of SEQ ID NO: 3 or a recombinant vector comprising a TAL gene, a CCL gene, an STS gene and a gene consisting of a nucleotide sequence of SEQ ID NO: , And the transformed Escherichia coli was cultured. The synthesized compound was subjected to HPLC analysis to confirm that each of the transformed microorganisms synthesized methylated stilbene compounds represented by the following formula (3): < EMI ID = (See Fig. 12).

The transgenic microorganism comprises a gene encoding TAL, a gene ( Sbm3 ) encoding a 0-methyltransferase comprising the nucleotide sequence of SEQ ID NO: 3, a gene encoding CCL, a 0-methyltransition comprising the nucleotide sequence of SEQ ID NO: A gene encoding the enzyme ( Sbm1 ) and a gene encoding the STS.

Genes (Sbm3) encoding the O- methyl transferase comprising the nucleotide sequence of the O- methyl transferase gene (Sbm1) coding for the enzyme and SEQ ID NO: 3 consisting of the base sequence of SEQ ID NO: 1 in a particular embodiment of the present invention And the transformed Escherichia coli is cultured. The compound synthesized in the above culture is subjected to HPLC analysis to produce methylated stilbene compounds represented by the above formulas (2), (5) and (6) (See Fig. 14).

The present invention also relates to a method for producing methylated stilbene compounds.

The methylated stilbene compound may be a compound represented by the following general formula (1).

A production method according to an embodiment of the present invention includes the steps of producing a recombinant vector, transforming a host cell with the recombinant vector to obtain a transformed microorganism, culturing the transformed microorganism, To obtain a compound represented by formula (I).

The production method may further include culturing the microorganism (host cell) to be transformed before the step of preparing the recombinant vector.

In one embodiment of the present invention, Escherichia coli was inoculated on LB medium to induce low temperature shock and induce protein expression, but the present invention is not limited thereto.

The step of preparing the recombinant vector comprises the step of preparing a gene ( Sbm1 ) encoding the O-methyl transferase comprising the nucleotide sequence of SEQ ID NO: 1, a gene encoding the O-methyl transferase comprising the nucleotide sequence of SEQ ID NO: 3 ( Sbm3 ), and a combination thereof. The method of the present invention can be carried out by a method comprising the steps of:

The recombinant vector may be prepared by including a gene ( Sbm1 ) encoding the O-methyl transferase comprising the nucleotide sequence shown in SEQ ID NO: 1.

The recombinant vector may be prepared by including a gene ( Sbm3 ) encoding an O-methyl transferase comprising the nucleotide sequence shown in SEQ ID NO: 3.

The recombinant vector is a gene (Sbm3) encoding the O- methyl transferase gene consisting of the nucleotide sequence shown in (Sbm1) and SEQ ID NO: 3 coding for the O- methyl transferase comprising the DNA sequence shown in SEQ ID NO: 1 , ≪ / RTI >

The step of preparing the recombinant vector comprises the step of preparing a gene ( Sbm1 ) encoding the O-methyl transferase comprising the nucleotide sequence of SEQ ID NO: 1, a gene encoding the O-methyl transferase comprising the nucleotide sequence of SEQ ID NO: 3 ( Sbm3 ), and a combination thereof, and a gene selected from the group consisting of a TAL coding gene, a CCL coding gene, an STS coding gene, and combinations thereof. .

The recombinant vector can be prepared by including, for example, a TAL coding gene, a CCL coding gene, an Sbm1 gene or an Sbm3 gene and an STS coding gene.

For example, the recombinant vector may include a TAL coding gene, a Sbm1 gene, a CCL coding gene, an Sbm3 gene, and an STS coding gene.

In a specific embodiment of the present invention, the recombinant vector may be prepared by preparing a vector containing a TAL cipher gene, a CCL cipher gene, and an STS cipher gene, then applying a restriction enzyme between the CCL cipher gene and the STS cipher gene, And the Sbm1 gene or Sbm3 gene having the same position as the enzyme was inserted.

Also, in a specific embodiment of the present invention, the recombinant vector may be prepared by preparing a vector comprising a TAL cryptoxanthin gene, a CCL cryptoxanthin gene, an Sbm1 gene and an STS crypto gene, To insert the Sbm3 gene having the same site as that of the restriction enzyme.

For example, LB, YT, 2YT, M9, and ALC M9C (modified M9 minimal medium; 25 g of CaCO3 (manufactured by Mitsubishi Kagaku Kogyo KK) are used as the medium for culturing the transformed microorganism. / l, glucose 15 g / l, 50 ug / l Kan and 1 mM IPTG subscript), and M9C medium is preferably used, but is not limited thereto.

The step of culturing the transformed microorganism may further include treating resveratrol in the transformed microorganism culture medium.

The step of obtaining the compound in the culture may be carried out by a conventional method of obtaining the compound in the culture or the extract.

The method for producing a methylated stilbene compound comprises the steps of: preparing a recombinant vector comprising a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; Transforming the host cell with the recombinant vector to obtain a transformed microorganism; Culturing the transformed microorganism; And obtaining a compound represented by the formula (2) in the culture.

The method for producing methylated stilbene compounds comprises the steps of: preparing a recombinant vector comprising a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3; Transforming the host cell with the recombinant vector to obtain a transformed microorganism; Culturing the transformed microorganism; And obtaining a compound represented by the following formula (3) and (4) in the culture.

The method for producing a methylated stilbene compound includes the steps of: preparing a recombinant vector comprising a polynucleotide encoding TAL, CCL, and STS; and a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1; Transforming the host cell with the recombinant vector to obtain a transformed microorganism; Culturing the transformed microorganism; And obtaining a compound represented by the following formula (2) in the culture.

The method for producing methylated stilbene compounds comprises the steps of: preparing a recombinant vector comprising a polynucleotide encoding TAL, CCL, and STS; and a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3; Transforming the host cell with the recombinant vector to obtain a transformed microorganism; Culturing the transformed microorganism; And obtaining a compound represented by the following formula (3) in the culture.

The method for producing methylated stilbene compounds comprises the steps of: preparing a recombinant vector comprising a polynucleotide encoding TAL, CCL, and STS; and a polynucleotide comprising a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 3; Transforming the host cell with the recombinant vector to obtain a transformed microorganism; Culturing the transformed microorganism; And obtaining a compound represented by the following formulas (2), (5), and (6) in the above culture, and a method of producing a methylated stilbene compound.

In a specific embodiment of the present invention, there is provided a method for producing a recombinant vector, comprising the steps of: preparing a recombinant vector containing the Sbm1 gene; transforming the recombinant vector into Escherichia coli; treating the transformed Escherichia coli with resveratrol and culturing, Lt; / RTI > An organic solvent was added to the obtained culture and subjected to HPLC analysis. As a result, it was confirmed that the methylated stilbene compound represented by the formula (2) was produced.

In a specific embodiment of the present invention, there is provided a method for producing a pET-opT-L01S recombinant vector, comprising the steps of: producing a pET-opT-L01S recombinant vector containing a TAL coding gene, a CCL coding gene, an Sbm1 gene and an STS coding gene; transforming the recombinant vector into E. coli; The step of culturing the transformed E. coli was performed to obtain a compound in the culture. An organic solvent was added to the culture thus obtained and analyzed by HPLC. As a result, it was confirmed that the methylated stilbene compound represented by Formula 2 was produced.

In a specific embodiment of the present invention, there is provided a method for producing a recombinant vector, comprising the steps of: preparing a recombinant vector containing the Sbm3 gene; transforming the recombinant vector into Escherichia coli; treating and culturing the transformed Escherichia coli with resveratrol, Lt; / RTI > An organic solvent was added to the obtained culture and subjected to HPLC analysis. As a result, it was confirmed that the methylated stilbene compound represented by Chemical Formula 3 and Chemical Formula 4 was produced.

In another embodiment of the present invention, there is provided a method for producing a pET-opT-L03S recombinant vector, comprising the steps of: preparing a pET-opT-L03S recombinant vector comprising a TAL cryptoxanthin gene, a CCL cognitive gene, a Sbm3 gene and an STS cryptoprotein; transforming the recombinant vector into E. coli; The step of culturing the transformed Escherichia coli was performed to obtain the compound in the culture. An organic solvent was added to the culture thus obtained and subjected to HPLC analysis. As a result, it was confirmed that the methylated stilbene compound represented by Formula 3 was produced.

In a specific embodiment of the present invention, there is provided a method for producing a recombinant vector comprising the steps of: preparing a recombinant vector comprising Sbm1 gene and Sbm3 gene; transforming the recombinant vector into Escherichia coli; treating and culturing the transformed Escherichia coli with resveratrol; The compound was extracted from water, and the methylated stilbene compound represented by the above formula (2) and (3) and the methylene stilbene compound represented by the above formula (5) and (6) were confirmed by HPLC analysis with an organic solvent.

In a specific embodiment of the present invention, there is provided a method for producing a recombinant vector, comprising the steps of: preparing a recombinant vector comprising a TAL coding gene, an Sbm1 gene, a CCL coding gene, an Sbm3 gene and an STS coding gene; transforming the recombinant vector into Escherichia coli; The step of culturing E. coli was performed to obtain a compound in the culture. The obtained culture was subjected to HPLC analysis with the addition of an organic solvent. As a result, it was confirmed that the methylated stilbene compound represented by Formula 2 and the methylated stilbene compound represented by Formula 5 and Formula 6 were produced, respectively.

Since the methylated stilbene compound produced by the production method of the present invention has an anticancer effect, an anti-inflammatory effect, an anti-hyperlipemic effect and an antioxidative effect, the method for producing the methylated stilbene compound and the compound produced using the methylated stilbene compound Can be usefully used.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a diagram showing the nucleotide sequence of a gene encoding the 0-methyltransferase Sbcom1. FIG.
2 is a diagram showing the amino acid sequence of the 0-methyl transferase Sbcom1 derived from Sorghum bicolor.
Fig. 3 is a diagram showing a resveratrol methylation enzyme-encoding gene Sbm1 cloned into the NdeI / HindIII site of the pET22 Escherichia coli expression vector.
FIG. 4 is a graph showing the expression levels of the resveratrol methylase coding genes pET22- Sbm1 and pET22- Sbm3 .
FIG. 5 is a graph showing the results of HPLC analysis of the compound obtained from the culture obtained by culturing the culture medium of pET-Sbm1 recombinant Escherichia coli and pET-Sbm3 recombinant Escherichia coli with resveratrol added thereto, LC / MS analysis ( m / z 257.13 [M + H] < ⁺ >) of the terostilbene.
FIG. 6 is a diagram illustrating a process for producing a vector comprising a polynucleotide encoding TAL, CCL, STS, and O-methyl transferase, respectively.
Figure 7 shows a vector comprising polynucleotides encoding TAL, CCL, STS and O-methyl transferase, respectively. pET-opT-LO1S represents a TAL gene, a CCL gene, an O-methyl transferase gene ( Sbm1 ) having a nucleotide sequence of SEQ ID NO: 1, and a pET- PTT-opT-LO3S represents a vector comprising the TAL gene, the CCL gene, the O-methyl transferase gene ( Sbm3 ) having the nucleotide sequence of SEQ ID NO: 3, and the STS gene, pET-opT-LO13S comprises the TAL gene, the O-methyl transferase gene ( Sbm3 ) having the nucleotide sequence of SEQ ID NO: 3, the CCL gene, the O-methyltransferase gene ( Sbm1 ) having the nucleotide sequence of SEQ ID NO: 1, ≪ / RTI >
8 is a graph showing the results of HPLC analysis of the compound synthesized in the E. coli culture transformed with the pET-opT-LO1S recombinant vector and LC / MS analysis ( m / z 243.05 [M + H] ⁺ ) to be.
9 shows the nucleotide sequence of the gene ( Sbm3 ) encoding the 0-methyltransferase Sbcom3.
10 is a diagram showing the amino acid sequence of the 0-methyl transferase Sbcom3 derived from Sorghum bicolor.
11 is a diagram showing the resveratrol methylation enzyme-encoding gene Sbm3 cloned in the NdeI / HindIII site of the pET22 Escherichia coli expression vector.
12 shows the results of HPLC analysis of the compound synthesized in the E. coli culture transformed with the pET-opT-LO3S recombinant vector and LC / MS analysis ( m / z 243.05 [M + H] ⁺ ) of the compound of formula Graph.
FIG. 13 is a diagram showing a production diagram of a pET-opT-LO13S vector. FIG.
14 shows the results of HPLC analysis of the compound synthesized in the E. coli culture transformed with the pET-opT-LO13S recombinant vector and the results of HPLC analysis of the compound of formula 5 ( m / z 257.13 [M + H] ⁺ ) and 6 ( m / z 271.14 [M + H] < ⁺ & gt ^; ).

Hereinafter, examples of the present invention will be described. The following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

[Example 1] Sbm1  Identification of resveratrol methylation activity in genes

Example 1-1. Sbcom1 enzyme encoding gene ( Sbm1  Gene)

Based on the amino acid sequence of the resveratrol O-methyltransferase Sbcom1 (SEQ ID NO: 2, see Fig. 2) of Sorghum bicolor, a base using optimal codon usage according to the ratio of tRNA to each amino acid sequence in E. coli (SEQ ID NO: 1, see Fig. 1) was determined.

Examples 1-2. Sbm1  Generation of recombinant vectors containing genes

The Sbm1 gene having the nucleotide sequence determined in Example 1-1 and having the NdeI site followed by the HindIII site was prepared in advance of the nucleotide sequence of DNA 2.0. The Sbm1 synthetic gene was inserted into the NdeI / HindIII site of pET22 , an Escherichia coli expression vector, to prepare a recombinant vector pET22- Sbm1 (Fig. 3), and the expression of the methylated enzyme gene was confirmed using the vector Respectively.

Examples 1-3. pET- Sbm1  Synthesis of methylated stilbene compounds by resveratrol addition of recombinant microorganisms

The recombinant vector pET22- Sbm1 of Example 1-2 was transformed into E. coli, and the E. coli culture medium was treated with 0.05 mM of resveratrol. The same amount of ethyl acetate as that of the culture was added thereto, followed by shaking for 2 hours, followed by centrifugation at 3000 rpm for 5 minutes. The supernatant ethyl acetate layer was concentrated under reduced pressure. The concentrated extract was dissolved in 400 쨉 l of methanol (Merck, USA), and 20 ㎕ of the solution was extracted with a mixture of ACN: H ₂ O (0.05% TFA) mobile phase was run from 20% to 100% at a rate of 1 ml / min for 25 minutes. At this time, the standards of Petrostilbene were purchased from Sigma (USA) and analyzed, and the results are shown in FIG.

As shown in Fig. 5, the extract of E. coli strain pET22- Sbm1 transformed with pET22- Sbm1 was confirmed to have a peak having the same UV spectrum at a time earlier than that of the phthalostilbene , And the methylated stilbene compound represented by the formula (1).

(2)

Examples 1-4. TAL-CCL- Sbm1 - Production of recombinant vector (pET-opT-L01S) containing STS gene

An enzyme that converts tyrosine into 4-coumaric acid is a tyrosine ammonia lyase (TAL) identified in the actinomycetes Saccharothrix espanaensis (KCTC9392) based on the amino acid sequence, and the ratio of tRNA to each amino acid in E. coli ( OpTAL ), and the enzyme that converts 4-coumaric acid to 4-coumaroyl Coenzyme A ( hereinafter , referred to as " codon usage " The nucleotide sequence ( CCL ) of cinnamate / 4-coumarate: CoA ligase was identified and synthesized from Streptomyces coelicolor M130. In addition, stilbene synthase (STS), an enzyme that condenses 3 molecules of malonyl-CoA in 4-coumaroyl coenzyme A and converts it into a stilbene compound, is transformed into E. coli based on the amino acid sequence of peanut ( Arachis hypogaea ) ( KSTS ) with optimal codon usage according to the ratio of tRNA to each amino acid.

To build a modular artificial path of resveratrol to prepare a vector of three genes opTAL, CCL and KSTS connected.

Specifically, a PCR reaction was performed using a pET-optal vector as a template DNA as a pair of opTAL-F and pET-CPac primers. PCR was performed with nPfu-special DNA polymerase for 28 cycles of annealing at 60 ° C for 30 seconds and extension at 72 ° C for 2 minutes and 30 seconds to obtain pET-opTAL TA PCR product. The PCR reaction was also performed using pET-CCL vector as a template DNA as a pair of pET-NPac and pET-CSpe primers. Thus, the pET-CCL TA PCR product was obtained, and the PCR reaction was carried out using the pET-KSTS vector as a template DNA as a pair of pET-NSpe and KS-R primers. Thus, the pET-KSTS TA PCR product was obtained.

The pET-CCTA TA PCR products were digested with restriction enzymes NdeI and PacI, and the pET-CCL TA PCR products were digested with restriction enzymes PacI and SpeI. The pET-KSTS TA PCR products were digested with restriction enzymes SpeI and XhoI. The pET-28a (+) vector was digested with restriction enzymes NdeI and XhoI, and the PCR products of the prepared three genes were ligated to a vector and transformed into E. coli. The NdeI site of the pET-opTAL TA PCR product was ligated to the NdeI site of the cleaved pET-28a (+) vector. The PacI site of the pET-opTAL TA PCR product and the PacI site of the pET-CCL TA PCR product were ligated, The SpeI site of the pET-CCL TA PCR product was ligated to the SpeI site of the pET-KSTS TA PCR product. Then, three genes synthesized by linking the XhoI site of the pET-KSTS TA PCR product to the XhoI site of the pET-28a (+) vector were inserted into one expression vector pET-28a (+).

The op TAL , CCL, and KSTS genes of pET-opT-LS thus constructed were designed to have independent T7, T7, and T7 terminators, respectively.

For constructing the modulated artificial pathway of methylated stilbene compounds, three vectors of optal , CCL, STS and Sbm1 were connected. Specifically, a PCR reaction was carried out using pET-Nspe and pET-Cspe primer pairs as pET22-Sbcom1 vector as template DNA. The PCR was performed with nPfu-special DNA polymerase for 28 cycles with annealing at 60 ° C for 30 seconds and extension at 72 ° C for 2 minutes and 30 seconds. The T-blunt-Sbcom1ss PCR product was obtained using the T-blunt cloning kit. T-blunt-Sbocm1ss PCR product was digested with restriction enzymes Spe I. The pET-opT-LS vector was digested with restriction enzyme Spe I, and the PCR product of the prepared gene was ligated with a vector and transformed into E. coli. At this time, the gene synthesized by connecting the Spe I site of the T-blunt-Sbocm1ss PCR product to the Spe I site of the pET-opT-LS vector cut out after the above production was ligated to the stilbene biosynthetic multiple enzyme expression vector pET-opT-LS To construct a pET-opT-L01S vector (see FIGS. 6 and 7). The TAL , CCL , KSTS , and Sbm1 genes of the methylated stilbene compound biosynthetic multiple enzyme expression vector thus prepared were independently designed to undergo expression control with the respective T7 promoter and T7 terminator.

primer Base sequence opTAL-F CATATGACCC AGGTGGTTGA ACGCC pET-Cpac TTAATTAATGCGCCGCTACAGGGCGCGTCC pET-Npac TTAATTAATCGCCGCGACAATTTGCGACGG pET-Cspe  ACTAGTTCCTCCTTTCAGCAAAAAACCCCTC pET-Nspe ACTAGTAGGTTGAGGCCGTTGAGCACCGCC KS-R  CTCGAGTTAAATAGCCATCGAGCGCAGGACC

Examples 1-5. Synthesis of methylated stilbene compound of pET-opT-L01S transformed microorganism

An E. coli strain pET-opT-L01S transformed with the recombinant vector pET-opT-L01S of Example 1-4 was prepared.

The E. coli was inoculated in 30 ml of LB medium (50 μg / l kanamycin) and cultured at 37 ° C. to a DO _{600 of} 0.6. Protein expression was induced by 1 mM IPTG after 10 minutes of cold shock. Then, cells were further cultured at 26 ° C for 6 hours and cells were harvested and added to 30 ml of M9C modified M9 minimal media supplemented with 25 g / l CaCO ₃ , 15 g / l glucose, 50 μg / l Kan, 1 mM IPTG ) Medium and cultured at 26 DEG C for 36 hours.

Ethyl acetate (JT Baker, USA) was added thereto in the same amount as that of the above culture solution, followed by shaking for 2 hours. The mixture was centrifuged at 3000 rpm for 5 minutes, and the supernatant ethyl acetate layer was concentrated under reduced pressure. The concentrated extract was dissolved in 400 μl of methanol (Merck, USA), and 20 μl of the solution was analyzed under the following HPLC conditions. 1 ml of a mobile phase of CH ₃ CN-H ₂ O (JTBaker, USA) (0.05% TFA; Sigma-Aldrich, USA) using a column of YMC J'sphere ODS-H80, 150 x 4.6 mm ID, / min < / RTI > for 25 minutes from 20% to 100%. Resveratrol, pinostilbene, and pterostilbene standards were purchased from Sigma (USA) and analyzed. The results are shown in FIG.

As shown in Fig. 8, peaks having the same UV spectrum at a time (Rt, 14 minutes) faster than that of the phthalostilbene in the extract of E. coli strain pET-opT-L01S transformed with pET-opT- / MS analysis confirmed that the methoxy residue was present at the carbon 4 'position by the same molecular weight ( m / z 243.05 [M + H] ⁺ ) and molecular weight fragmentation experiment as the chemical formula 2, 2, which is a methylated stilbene compound.

(2)

[Example 2] Sbm3  Identification of resveratrol methylation activity in genes

Example 2-1. Sbcom3 enzyme encoding gene ( Sbm3  Gene)

Based on the amino acid sequence of the O-methylation transferase Sbcom3 (see SEQ ID NO: 4 and FIG. 10) of Sorghum bicolor, the nucleotide sequence using optimal codon usage according to the ratio of tRNA to each amino acid sequence in E. coli (SEQ ID NO: 3, see Fig. 9).

Example 2-2. Sbm3  Generation of recombinant vectors containing genes

Prior to the nucleotide sequence, the Sbm3 gene having the NdeI site and the HindIII site was synthesized in DNA 2.0. The recombinant vector pET22- Sbm3 was prepared by inserting the Sbm3 synthetic gene into the NdeI / HindIII site of pET22 , an Escherichia coli expression vector (Fig. 11), and the expression of the methylated enzyme gene was confirmed using the vector Respectively.

Examples 2-3. pET- Sbm3  Synthesis of methylated stilbene compounds by resveratrol addition of recombinant microorganisms

The recombinant vector pET22- Sbm3 of Example 2-2 was transformed into E. coli, and the E. coli culture medium was treated with 0.05 mM of resveratrol. The same amount of ethyl acetate as that of the culture was added thereto, followed by shaking for 2 hours, followed by centrifugation at 3000 rpm for 5 minutes. The supernatant ethyl acetate layer was concentrated under reduced pressure. The concentrated extract was dissolved in 400 쨉 l of methanol (Merck, USA), and 20 ㎕ of the solution was extracted with a mixture of ACN: H ₂ O (0.05% TFA) mobile phase was run from 20% to 100% at a rate of 1 ml / min for 25 minutes. At this time, the standard of Petrostilbene was purchased from Sigma (USA) and analyzed, and the result is shown in FIG.

As shown in Fig. 5, in the extract of E. coli strain pET22- Sbm3 transformed with pET22- Sbm3 , a peak having the same UV spectrum and a weakest peak having the same UV spectrum at the same time in the same time zone as the pinostilbene And it was confirmed that the transformed strains were able to produce the methylated stilbene compounds represented by the following Chemical Formulas 3 and 4, respectively.

As shown in FIG. 5, LC / MS analysis of the compound represented by Chemical Formula 4 showed a molecular weight ( m / z 257.13 [M + H] ⁺ ) in which two methyl residues were inserted into resveratrol, Was identified as < RTI ID = 0.0 > phthalostilbene. ≪ / RTI >

 (3)

[Chemical Formula 4]

Examples 2-4. TAL-CCL- Sbm3 Production of a recombinant vector (pET-opT-L03S) containing the STS gene

An enzyme that converts tyrosine into 4-coumaric acid is a tyrosine ammonia lyase (TAL) identified in the actinomycetes Saccharothrix espanaensis (KCTC9392) based on the amino acid sequence, and the ratio of tRNA to each amino acid in E. coli ( OpTAL ), and the enzyme that converts 4-coumaric acid to 4-coumaroyl Coenzyme A ( hereinafter , referred to as " codon usage " The nucleotide sequence ( CCL ) of cinnamate / 4-coumarate: CoA ligase was identified and synthesized from Streptomyces coelicolor M130. In addition, stilbene synthase (STS), an enzyme that condenses 3 molecules of malonyl-CoA in 4-coumaroyl coenzyme A and converts it into a stilbene compound, is transformed into E. coli based on the amino acid sequence of peanut ( Arachis hypogaea ) ( KSTS ) with optimal codon usage according to the ratio of tRNA to each amino acid.

To build a modular artificial path of resveratrol to prepare a vector of three genes opTAL, CCL and KSTS connected.

Specifically, a PCR reaction was performed using a pET-optal vector as a template DNA as a pair of opTAL-F and pET-CPac primers. PCR was performed with nPfu-special DNA polymerase for 28 cycles of annealing at 60 ° C for 30 seconds and extension at 72 ° C for 2 minutes and 30 seconds to obtain pET-opTAL TA PCR product. The PCR reaction was also performed using pET-CCL vector as a template DNA as a pair of pET-NPac and pET-CSpe primers. Thus, the pET-CCL TA PCR product was obtained, and the PCR reaction was carried out using the pET-KSTS vector as a template DNA as a pair of pET-NSpe and KS-R primers. Thus, the pET-KSTS TA PCR product was obtained.

The pET-CCTA TA PCR products were digested with restriction enzymes NdeI and PacI, and the pET-CCL TA PCR products were digested with restriction enzymes PacI and SpeI. The pET-KSTS TA PCR products were digested with restriction enzymes SpeI and XhoI. The pET-28a (+) vector was digested with restriction enzymes NdeI and XhoI, and the PCR products of the prepared three genes were ligated to a vector and transformed into E. coli. The NdeI site of the pET-opTAL TA PCR product was ligated to the NdeI site of the cleaved pET-28a (+) vector. The PacI site of the pET-opTAL TA PCR product and the PacI site of the pET-CCL TA PCR product were ligated, The SpeI site of the pET-CCL TA PCR product was ligated to the SpeI site of the pET-KSTS TA PCR product. Then, three genes synthesized by linking the XhoI site of the pET-KSTS TA PCR product to the XhoI site of the pET-28a (+) vector were inserted into one expression vector pET-28a (+).

The TAL , CCL, and KSTS genes of pET-opT-LS thus constructed were constructed so that each T7 promoter and T7 terminator was independently controlled for expression.

For constructing the modulated artificial pathway of methylated stilbene compounds, vectors with three genes of optal , CCL, STS and Sbm3 were connected. Specifically, PCR reaction was performed using pET-Nspe and pET-Cspe primer pairs as pET22-Sbcom3 vector as template DNA. The PCR was performed with nPfu-special DNA polymerase for 28 cycles with annealing at 60 ° C for 30 seconds and extension at 72 ° C for 2 minutes and 30 seconds. The T-blunt-Sbcom3ss PCR product was obtained using the T-blunt cloning kit. T-blunt-Sbocm3ss PCR product was digested with restriction enzymes Spe I. The pET-opT-LS vector was digested with restriction enzyme Spe I, and the PCR product of the prepared gene was ligated with a vector and transformed into E. coli. At this time, the gene synthesized by ligating the Spe I site of the T-blunt-Sbocm3ss PCR product to the Spe I site of the pET-opT-LS vector cut out after the above production was ligated to the stilbene biosynthetic multiple enzyme expression vector pET-opT-LS To construct a pET-opT-L03S vector (see FIGS. 6 and 7). The TAL , CCL , KSTS , and Sbm3 genes of the methylated stilbene compound biosynthetic multiple enzyme expression vector thus prepared were independently designed to have independent expression control with the respective T7 promoter and T7 terminator.

Examples 2-5. Confirmation of synthesis of methylated stilbene compound of pET-opT-L03S transformed microorganism

E. coli strain pET-opT-L03S transformed with the recombinant vector pET-opT-L03S of Example 2-5 was prepared.

The E. coli was inoculated in 30 ml of LB medium (50 μg / l kanamycin) and cultured at 37 ° C. to a DO _{600 of} 0.6. Protein expression was induced by 1 mM IPTG after 10 minutes of cold shock. Then, cells were further cultured at 26 ° C for 6 hours and cells were harvested and added to 30 ml of M9C modified M9 minimal media supplemented with 25 g / l CaCO ₃ , 15 g / l glucose, 50 μg / l Kan, 1 mM IPTG ) Medium and cultured at 26? For 36 hours.

Ethyl acetate (JT Baker, USA) was added thereto in the same amount as that of the above culture solution, followed by shaking for 2 hours. The mixture was centrifuged at 3000 rpm for 5 minutes, and the supernatant ethyl acetate layer was concentrated under reduced pressure. The concentrated extract was dissolved in 400 μl of methanol (Merck, USA), and 20 μl of the solution was analyzed under the following HPLC conditions. YMC J'sphere ODS-H80, 150x4.6 ㎜ ID, by using a (YMC, Japan) column, CH ₃ CN-H ₂ O (

(Sigma-Aldrich, USA), which was transformed with pET-opT-L03S at a flow rate of 1 ml / min from 20% to 100% Lt; / RTI > for 25 minutes. At this time, the standards of the pinostilbene and the thermostabilbenz were purchased from Sigma (USA) and analyzed. The results are shown in FIG.

As a result, a peak having the same UV spectrum was observed in the same time zone (Rt, 13.5 minutes) as that of the pinostilbene of formula (3) in the preparation shown in FIG. 12 and LC / MS analysis showed the same molecular weight ( m / z 243.05 [M + H] < ⁺ >). As a result, it was confirmed that the methylated stilbene compound represented by the following formula (3) was produced in the transformed strain.

(3)

[Example 3] Sbm1 And 3 genes were confirmed by resveratrol methylation activity

Example 3-1. TAL- Sbm3 -CCL- Sbm1 Production of a recombinant vector (pET-opT-L013S) containing the STS gene

For the modular construction of the artificial route methylation stilbene compounds were prepared vector three genes opTAL, CCL, KSTS, Sbm1 and Sbm3 connected. Specifically, a PCR reaction was carried out using the pET22- Sbm3 vector prepared in Example 2-2 as a pair of pET-Npac and pET-Cpac primers as a template DNA. PCR was performed with nPfu-special DNA polymerase for 28 cycles with annealing at 60 ° C for 30 s and extention at 72 ° C for 2 min 30 sec. The T-blunt- Sbm3 pp PCR product was obtained using the T-blunt cloning kit. T-blunt- Sbm3 pp PCR product was digested with restriction enzymes Pac I. In addition, a cut in the embodiment 1-4 restriction enzyme the vector pET-opT-LO1S prepared by the Pac I and then, by connecting the PCR product of the gene and the prepared vector was transformed into E. coli. At this time, the gene synthesized by ligating the Pac I site of the T-blunt-Sbo3pp PCR product to the Pac I site of the cleaved pET-opT-LO1S vector was inserted into the methylated stilbene biosynthetic multiple enzyme expression vector pET-opT-LO1S to obtain pET -opT-L013S vector (see Figs. 7 and 13). The TAL , CCL , STS Sbm1 and Sbm3 genes of the methylated stilbene compound biosynthetic multiple enzyme expression vector thus prepared were independently designed to undergo expression control with the respective T7 promoter and T7 terminator.

Example 3-2. Synthesis of methylated stilbene compounds represented by formulas (2), (5) and (6)

E. coli strain pET-opT-L013S transformed with the recombinant vector pET-opT-L013S of Example 3-1 was prepared.

The E. coli was inoculated in 30 ml of LB medium (50 μg / l kanamycin) and cultured at 37 ° C. to a DO _{600 of} 0.6. Protein expression was induced by 1 mM IPTG after 10 minutes of cold shock. Then, culture for a further 6 hours at 26 ℃, and to give the cells 30 ml M9C (modified M9 minimal _{medium; CaCO 3 25 g / l,} glucose 15 g / l, 50 ㎍ / l Kan, 1 mM IPTG was added ) Medium and cultured at 26 DEG C for 36 hours.

Ethyl acetate (JT Baker, USA) was added thereto in the same amount as that of the above culture solution, followed by shaking for 2 hours. The mixture was centrifuged at 3000 rpm for 5 minutes, and the supernatant ethyl acetate layer was concentrated under reduced pressure. The concentrated extract was dissolved in 400 μl of methanol (Merck, USA), and 20 μl of the solution was analyzed under the following HPLC conditions. 1 ml of a mobile phase of CH ₃ CN-H ₂ O (JTBaker, USA) (0.05% TFA; Sigma-Aldrich, USA) using a column of YMC J'sphere ODS-H80, 150 x 4.6 mm ID, / min < / RTI > for 25 minutes from 20% to 100%. At this time, the standards of Petrostilbene were purchased from Sigma (USA) and analyzed.

As a result, in the extract of E. coli strain pET-opT-L013S transformed with pET-opT-L013S as shown in Fig. 14, a similar UV spectrum was observed at about the same time zone (Rt, 17.7 min) (5), respectively. As a result, it was confirmed that the methylated stilbene compound represented by the following formula (2) and the methylated stilbene compound represented by the following formula (5) were produced in the transformed strain.

Further, LC / MS analysis of the compound represented by Chemical Formula 5 shows the molecular weight in which two methyl residues are inserted into resveratrol, and LC / MS / MS molecular weight fragmentation pattern analysis and structural analysis after extraction The compound of formula 5 was identified as 3,4'-dimethoxy-5-hydroxy- trans -stilbene.

When the culture was carried out for 48 hours or longer, LC / MS analysis and extraction of a compound showing very weak peak by HPLC showed that the molecular weight of resveratrol with three methyl residues inserted therein was confirmed by structural analysis. The compound represented by the following Chemical Formula 6, which was methylated on the three-position hydroxyl group of resveratrol, was produced.

(2)

 [Chemical Formula 5]

[Chemical Formula 6]

<110> Korea Research Institute of Bioscience and Biotechnology <120> GENE ENCODING METHYLTRANSFERASE AND METHOD FOR PRODUCTIONG METHYL          STILBENE COMPOUND USING THEREOF <130> KIBB_1-12P-1 <150> KR 1020130064246 <151> 2013-06-04 <160> 13 <170> Kopatentin 2.0 <210> 1 <211> 1131 <212> DNA <213> Artificial Sequence <220> <223> Sbm1 gene sequene for encoding methyltransferase <400> 1 atggcatcgt acactagcac ttccggtcaa ttcgcagtag gtaaagtagc agcagcaaac 60 caagacgatg agacttgtat gcacgccctg aagctgttgg gtggtctggc ggtgccgttc 120 accatcaagg cggtcattga gctgggtatc atggatttgt tgctggcggc agaccgcgcg 180 atgaccgcgg aagcgctgac cgcggctctg ctgtgtccgg caccggctcc agccgcagca 240 gcggcgatgg tggatcgtat gctgcgcttc ctggcgtccc acggtgtggt ccgctgcgcg 300 accgagagcg aagagctggg ttctgacgat ggcaaaagct gtcgtcgtta cgcggcagcg 360 ggtgttggt tggatgacga gcaccacgaa tatggaaacg tggcataaca ttaaagacgg tgttctggca 480 ggcgaaaccc cgttcgacaa agcctacggt atgccggtgt tcgagtacct gggtgcgaat 540 ggcaccatga ataccctgtt caatgaggcg atggccagcc acagcatgat catcaccaaa 600 cgtctgctgg aagtttttcg tggtttcgag aactattccg ttttggtgga cgttggtggc 660 ggcaacggca ccacgatgca gatgattcgc agccagtatg agaacatcag cggcatcaac 720 tatgacttgc ctcacgttat tgcgcaagca agcccgatcg aaggtgtcga gcatgtggcg 780 ggcaacatgt ttgataacat tccgcgtggc gatgctatta tcctgaagtg gattctgcat 840 cctgaagatc aatggtaccg tcattatcct ggagtatatt ctgccggaaa cgccggaaga aaccctggcg 960 agccagttgg cctttgactt tgatctgggc atgatgttgt ttttcggtgc gagcggcaaa 1020 gaacgcacgg aaaaagagct gctggagctg gcccgtgagg cgggctttag cggtgactac 1080 acggcgacct acattttcgc taatgtgtgg gcgcacgagt ttaccaagta a 1131 <210> 2 <211> 376 <212> PRT <213> Artificial Sequence <220> <223> Sbcom1 methyltransferase <400> 2 Met Ala Ser Tyr Thr Ser Thr Ser Gly Gln Phe Ala Val Gly Lys Val   1 5 10 15 Ala Ala Ala Asn Gln Asp Asp Glu Thr Cys Met His Ala Leu Lys Leu              20 25 30 Leu Gly Gly Leu Ala Val Pro Phe Thr Ile Lys Ala Val Ile Glu Leu          35 40 45 Gly Ile Met Asp Leu Leu Leu Ala Ala Asp Arg Ala Met Thr Ala Glu      50 55 60 Ala Leu Thr Ala Ala Leu Leu Cys Pro Ala Pro Ala Pro Ala Ala Ala  65 70 75 80 Ala Ala Met Val Asp Arg Met Leu Arg Phe Leu Ala Ser His Gly Val                  85 90 95 Val Arg Cys Ala Thr Glu Ser Glu Glu Leu Gly Ser Asp Asp Gly Lys             100 105 110 Ser Cys Arg Arg Tyr Ala Ala Pro Val Cys Lys Trp Phe Ala Arg         115 120 125 Gly Gly Gly Val Glu Ser Val Val Pro Met Gly Phe Trp Met Thr Ser     130 135 140 Thr Thr Asn Met Glu Thr Trp His Asn Ile Lys Asp Gly Val Leu Ala 145 150 155 160 Gly Glu Thr Pro Phe Asp Lys Ala Tyr Gly Met Pro Val Phe Glu Tyr                 165 170 175 Leu Gly Ala Asn Gly Thr Met Asn Thr Leu Phe Asn Glu Ala Met Ala             180 185 190 Ser His Met Ile Ile Thr Lys Arg Leu Leu Glu Val Phe Arg Gly         195 200 205 Phe Glu Asn Tyr Ser Val Leu Val Asp Val Gly Gly Gly Asn Gly Thr     210 215 220 Thr Met Gln Met Ile Arg Ser Gln Tyr Glu Asn Ile Ser Gly Ile Asn 225 230 235 240 Tyr Asp Leu Pro His Val Ile Ala Gln Ala Ser Pro Ile Glu Gly Val                 245 250 255 Glu His Val Ala Gly Asn Met Phe Asp Asn Ile Pro Arg Gly Asp Ala             260 265 270 Ile Ile Leu Lys Trp Ile Leu His Asn Trp Gly Asp Lys Glu Cys Val         275 280 285 Lys Ile Leu Lys Asn Cys Tyr Thr Ala Leu Pro Val Asn Gly Thr Val     290 295 300 Ile Ile Leu Glu Tyr Ile Leu Pro Glu Thr Pro Glu Glu Thr Leu Ala 305 310 315 320 Ser Gln Leu Ala Phe Asp Phe Asp Leu Gly Met Met Leu Phe Phe Gly                 325 330 335 Ala Ser Gly Lys Glu Arg Thr Glu Lys Glu Leu Leu Glu Leu Ala Arg             340 345 350 Glu Ala Gly Phe Ser Gly Asp Tyr Thr Ala Thr Tyr Ile Phe Ala Asn         355 360 365 Val Trp Ala His Glu Phe Thr Lys     370 375 <210> 3 <211> 1125 <212> DNA <213> Artificial Sequence <220> <223> Sbm3 gene sequene for encoding methyltransferase <400> 3 atggtactga tttctgaaga ttctcgtgaa ctgttgcaag cccatgtcga actctggaat 60 cagacctact cgttcatgaa gagcgttgca ctggctgtcg ccctggatct gcatatcgca 120 gatgcgattc accgtcgtgg cggtgcagcg acgctgtccc aaatcctggg cgaaatcggt 180 gtgcgtccgt gtaagctgcc aggtctgcac cgcattatgc gcgtgctgac cgtcagcggt 240 accttcacca ttgtgcagcc gtctgcagaa acgatgagca gcgagagcga cggtcgcgag 300 ccggtgtaca aactgaccac cgcaagcagc ttgctggtca gctccgagag cagcgcgacc 360 gccagcctga gcccgatgct gaatcacgtg ctgtccccgt ttcgtgactc cccgctgagc 420 atgggtctga cggcgtggtt ccgccatgac gaggatgagc aagctccggg catgtgtccg 480 tttaccctga tgtatggtac caccttgtgg gaagtttgcc gtcgtgatga cgcgatcaac 540 gcactgttca acaatgcgat ggccgcagat agcaattttc tgatgcagat tctgttgaaa 600 gagttcagcg aggttttctt gggcatcgac agcctggttg acgttgccgg tggcgttggt 660 ggtgcgacta tggcgattgc ggctgcgttt ccgtgcctga aatgcacggt gctggacttg 720 ccgcacgttg tggcgaaagc accgtccagc agcattggca atgtccagtt cgttggtggc 780 gacatgtttg agagcattcc gccagcgaac gtggtcctgc tgaaatggat tttgcacgat 840 tggagcaacg acgagtgtat taagatcctg aagaactgca agcaggccat cccttctcgc 900 gacgcgggtg gcaaaatcat catcattgac gttgttgtcg gttcggatag cagcgatacg 960 aagtgctgg aaacgcaagt catttatgat ctgcacctga tgaagatcgg tggtgtggaa 1020 cgtgatgagc aggagtggaa aaagattttt ctggaagctg gcttcaaaga ctacaaaatc 1080 atgccgatcc tgggcctgcg tagcattatc gagctgtatc cgtaa 1125 <210> 4 <211> 374 <212> PRT <213> Artificial Sequence <220> <223> Sbcom3 methyltransferase <400> 4 Met Val Leu Ile Ser Glu Asp Ser Arg Glu Leu Leu Gln Ala His Val   1 5 10 15 Glu Leu Trp Asn Gln Thr Tyr Ser Phe Met Lys Ser Val Ala Leu Ala              20 25 30 Val Ala Leu Asp Leu His Ile Ala Asp Ala Ile His Arg Arg Gly Gly          35 40 45 Ala Ala Thr Leu Ser Gln Ile Leu Gly Glu Ile Gly Val Arg Pro Cys      50 55 60 Lys Leu Pro Gly Leu His Arg Ile Met Arg Val Leu Thr Val Ser Gly  65 70 75 80 Thr Phe Thr Ile Val Gln Pro Ser Ala Glu Thr Met Ser Ser Ser Ser                  85 90 95 Asp Gly Arg Glu Pro Val Tyr Lys Leu Thr Thr Ala Ser Ser Leu Leu             100 105 110 Val Ser Ser Glu Ser Ser Ala Thr Ala Ser Leu Ser Pro Met Leu Asn         115 120 125 His Val Leu Ser Pro Phe Arg Asp Ser Pro Leu Ser Met Gly Leu Thr     130 135 140 Ala Trp Phe Arg His Asp Glu Asp Glu Gln Ala Pro Gly Met Cys Pro 145 150 155 160 Phe Thr Leu Met Tyr Gly Thr Thr Leu Trp Glu Val Cys Arg Arg Asp                 165 170 175 Asp Ala Ile Asn Ala Leu Phe Asn Asn Ala Met Ala Ala Asp Ser Asn             180 185 190 Phe Leu Met Gln Ile Leu Leu Lys Glu Phe Ser Glu Val Phe Leu Gly         195 200 205 Ile Asp Ser Leu Val Asp Val Ala Gly Gly Val Gly Gly Ala Thr Met     210 215 220 Ala Ile Ala Ala Phe Pro Cys Leu Lys Cys Thr Val Leu Asp Leu 225 230 235 240 Pro His Val Val Ala Lys Ala Pro Ser Ser Ser Ile Gly Asn Val Gln                 245 250 255 Phe Val Gly Gly Asp Met Phe Glu Ser Ile Pro Pro Ala Asn Val Val             260 265 270 Leu Leu Lys Trp Ile Leu His Asp Trp Ser Asn Asp Glu Cys Ile Lys         275 280 285 Ile Leu Lys Asn Cys Lys Gln Ala Ile Pro Ser Arg Asp Ala Gly Gly     290 295 300 Lys Ile Ile Ile Asp Val Val Val Gly Ser Asp Ser Ser Asp Thr 305 310 315 320 Lys Leu Leu Glu Thr Gln Val Ile Tyr Asp Leu His Leu Met Lys Ile                 325 330 335 Gly Gly Val Glu Arg Asp Glu Gln Glu Trp Lys Lys Ile Phe Leu Glu             340 345 350 Ala Gly Phe Lys Asp Tyr Lys Ile Met Pro Ile Leu Gly Leu Arg Ser         355 360 365 Ile Ile Glu Leu Tyr Pro     370 <210> 5 <211> 1533 <212> DNA <213> Artificial Sequence <220> <223> optal gene sequence <400> 5 atgacccagg tggttgaacg ccaggccgat cgcctgagta gtcgtgaata cttagctcgc 60 gtcgttcgta gtgccggctg ggatgcgggc ctaacctctt gtacagatga agaaattgtt 120 cgcatgggcg cgtcagcccg caccatcgag gaatatttaa aaagtgataa accgatttat 180 ggtttaaccc aaggcttcgg cccgctggta ctgtttgatg cggatagcga attagaacag 240 ggtggtagcc tgattagcca tctgggcacc ggtcagggcg cgccgctggc gccggaagtg 300 agtcgtttaa ttctgtggct gcgtattcaa aacatgcgca aaggttatag cgccgttagc 360 ccggttttct ggcaaaaact ggcagaccta tggaataaag gctttacccc ggcaattccg 420 cgtcatggta ccgtttccgc ctcgggtgat ctgcaaccgc tggcgcatgc cgcgctggca 480 ttcaccggcg tgggtgaagc gtggacccgc gatgcagatg gccgctggag caccgttccg 540 gctgttgatg ccctggcagc gctgggtgcc gaaccgtttg attggcctgt ccgcgaagca 600 ctggcgtttg ttaatggcac cggagccagc ctggcggttg ctgttttaaa tcatcgttct 660 gccctgcgcc tggttcgcgc gtgtgcggta ctgagcgcac gcctggcgac cctgctgggc 720 gcaaatccgg aacattatga cgttggtcat ggcgttgccc gcggtcaggt tggccagctg 780 accgcggcgg aatggattcg tcagggcctg ccacgtggta tggtgcgcga tggaagccgt 840 ccgttgcagg aaccttatag ccttcgctgc gctccgcagg ttctaggcgc tgttctggat 900 cgctggacg gtgcgggtga cgtgctggcc cgcgaagttg atggttgcca ggataaccct 960 attacctacg aaggtgaatt gctgcatggc ggtaacttcc atgccatgcc ggttggtttt 1020 gcaagtgatc agattggtct ggcgatgcac atggcggcct acctggctct acgccagctg 1080 ggcctgctgg ttagcccggt aaccaatggt gatttaccac cgatgctgac cccgcgtgcc 1140 ggccgtggtg cgggtcttgc tggcgtccag atttctgcca ccagcttcgt ttctcgtatt 1200 cgccaactgg ttttcccggc gtctctgacc accctgccga ccaacggttg gaatcaagac 1260 catgtaccga tggcactgaa tggcgctaat agcgttttcg aagcactgga actgggttgg 1320 ttaaccgttg gaagcctggc ggtgggcgtt gcacagctgg cggcgatgac cggtcatgcg 1380 gctgaagggg tttgggcaga actggcaggc atttgcccgc cgttagatgc cgaccgtccg 1440 ctgggtgcgg aagttcgcgc agcccgtgat ctgctgagcg cgcacgctga tcagctgttg 1500 gtggacgaag ccgatggtaa agactttggc taa 1533 <210> 6 <211> 1569 <212> DNA <213> Artificial Sequence <220> <223> CCL gene sequence <400> 6 atgttccgca gcgagtacgc agacgtcccg cccgtcgacc tgcccatcca cgacgccgtg 60 ctcggcgggg ccgccgcctt cgggagcacc ccggcgctga tcgacggcac cgacggcacc 120 accctcacct acgagcaggt ggaccggttc caccggcgcg tcgccgccgc cctcgccgag 180 cgcctgccc cgcctcgcc ctggccttct acgccgccac ccgcgcgggc gcctccgtca ccacggtgca tccgctcgcg 300 acggcggagg agttcgccaa gcagctgaag gacagcgcgg cccgctggat cgtcaccgtc 360 tcaccgctcc tgtccaccgc ccgccgggcc gccgaactcg cgggcggcgt ccaggagatc 420 ctggtctgcg acagcgcgcc cggtcaccgc tccctcgtcg acatgctggc ctcgaccgcg 480 cccgaccgt ccgtcgccat cgacccggcc gaggacgtcg ccgccctgcc gtactcctcg 540 ggcaccaccg gcacccccaa gggcgtcatg ctcacacacc ggcagatcgc caccaacctc 600 gcccagctcg aaccgtcgat gccgtccgcg cccggcgacc gcgtcctcgc cgtgctgccg 660 ttcttccaca tctacggcct gaccgccctg atgaacgccc cgctccggct cggcgccacc 720 gtcgtggtcc tgccccgctt cgacctggag cagttcctcg ccgccatcca gaaccaccgc 780 atcaccagcc tgtacgtcgc cccgccgatc gtcctggccc tcgccaaaca ccccctggtc 840 gccgactacg acctctcctc gctgaggtac atcgtcagcg ccgccgcccc gctcgacgcg 900 cgtctcgccg ccgcctgctc gcagcggctc ggcctgccgc ccgtcggcca ggcctacggc 960 atgaccgaac tgtccccggg cacccacgtc gtccccctgg acgcgatggc cgacgcgccg 1020 cccggcaccg tcggcaggct catcgcgggc accgagatgc gcatcgtctc cctcaccgac 1080 ccgggcacgg acctccccgc cggagagtcc ggggagatcc tcatccgcgg cccccagatc 1140 atgaagggct acctgggccg ccccgacgcc accgccgcca tgatcgacga ggagggctgg 1200 ctgcacaccg gggacgtcgg acacgtcgac gccgacggct ggctgttcgt cgtcgaccgc 1260 gtcaaggaac tgatcaagta caagggcttc caggtggccc ccgccgaact ggaggcccac 1320 ctgctcaccc accccggcgt cgccgacgcg gccgtcgtcg gcgcctacga cgacgacggc 1380 aacgaggtac cgcacgcctt cgtcgtccgc cagccggccg cacccggcct cgcggagagc 1440 gagatcatga tgtacgtcgc cgaacgcgtc gccccctaca aacgcgtccg ccgggtcacc 1500 ttcgtcgacg ccgtcccccg cgccgcctcc ggcaagatcc tccgccgaca gctcagggag 1560 ccgcgatga 1569 <210> 7 <211> 1170 <212> DNA <213> Artificial Sequence <220> <223> KSTS gene sequence <400> 7 atggtttctg tgtcagagat ccgtaaagta caacgtgcgg agggtcctgc caccgtactg 60 gcaatcggta ccgcgaaccc tccgaactgc gtggaccaaa gcacttatgc ggactactat 120 tttcgtgtta caaattcaga acacatgacc gatctgaaaa agaaattcca gcgcatttgt 180 gagcgcacgc aaatcaagaa ccgccacatg catctgacag aggaaattct gaaggagaat 240 ccaaacatgt gcgcctacaa agcaccgtcc ctggatgctc gcgaagatat gatgattcgc 300 gaagtgccgc gtgtagggaa ggaagcggcc acaaaagcaa ttaaagaatg gggccagccg 360 atgtccaaaa tcacccacct gattttttgt acgaccagcg gtgtggctct gccgggggtt 420 gactacggc tgatcgtcct gctgggactg gacccttctg ttaagcgtta catgatgtac 480 caccaaggct gtttcgctgg aggtacagtt ctgcgtctgg ccaaagatct ggcagaaaat 540 aacaaagacg cccgtgttct gattgtgtgt agtgagaaca cgagcgtcac ctttcgtggg 600 ccgtccgaaa ccgatatgga ctcgctggtt ggccaagcgc tgttcgccga tggtgcagcg 660 gctatcatta tcggcagcga cccggtgcct gaagtggaga aaccgctgtt tgaaattgtc 720 tctactgatc aaaaactggt cccgaatagt cacggtgcga ttggcggcct gctgcgtgag 780 gtaggcctga cattctacct gaataagagc gtcccggata ttatttccca aaatatcaat 840 gacgcactgt cgaaggcttt cgacccgctg ggaatctcag actataactc tatcttttgg 900 attgcccatc cgggtggccg tgctatcctg gatcaggttg aggaaaaggt gaatctgaaa 960 ccagagaaaa tgaaagcgac acgcgatgtg ctgagtaact atggcaatat gtcatccgcg 1020 tgcgtactgt ttattatgga cgaaatgcgt aagaaaagcc tggaagctgg tctgaaaacg 1080 accggtgaag gactggattg gggtgttctg tttggcttcg gtccggggct gactatcgaa 1140 acagtggtcc tgcgctcgat ggctatttaa 1170 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> opTAL-F primer <400> 8 catatgaccc aggtggttga acgcc 25 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pET-CPac primer <400> 9 ttaattaatg cgccgctaca gggcgcgtcc 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pET-NPac primer <400> 10 ttaattaatc gccgcgacaa tttgcgacgg 30 <210> 11 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> pET-CSpe primer <400> 11 actagttcct cctttcagca aaaaacccct c 31 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pET-NSpe primer <400> 12 actagtaggt tgaggccgtt gagcaccgcc 30 <210> 13 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> KS-R primer <400> 13 ctcgagttaa atagccatcg agcgcaggac c 31

Claims (12)

A polynucleotide encoding an O-methyltransferase comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3. (1), comprising a polynucleotide encoding an O-methyltransferase consisting of any one of the nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and combinations thereof Composition:
[Chemical Formula 1]

In Formula 1, R _1, R ₂ and R ₃ are each independently hydrogen or a methyl group, and at least one of R ₁ to R ₃ is a methyl group. (1), comprising a polynucleotide encoding an O-methyltransferase consisting of any one of the nucleotide sequences selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and combinations thereof Recombinant vector:
[Chemical Formula 1]

In Formula 1, R _1, R ₂ and R ₃ are each independently hydrogen or a methyl group, and at least one of R ₁ to R ₃ is a methyl group. The method of claim 3,
The recombinant vector is a polynucleotide encoding tyrosine ammonia lyase (TAL), a polynucleotide encoding Cinnamate / 4-Coumarate: CoA ligase (CCL) And a polynucleotide encoding a stilbene synthase (STS). 5. The method of claim 4,
Wherein the recombinant vector comprises a polynucleotide encoding TAL, a polynucleotide encoding CCL, a polynucleotide encoding STS, a polynucleotide encoding an O-methyltransferase comprising the nucleotide sequence of SEQ ID NO: 1, Wherein the vector comprises a polynucleotide encoding a 0-methyltransferase consisting of the nucleotide sequence of SEQ ID NO: 3. A transformant microorganism for producing a compound represented by the following formula (1), which is prepared by transforming a host cell with the recombinant vector of any one of claims 3 to 5:
[Chemical Formula 1]

In Formula 1, R _1, R ₂ and R ₃ are each independently hydrogen or a methyl group, and at least one of R ₁ to R ₃ is a methyl group. Producing a recombinant vector according to any one of claims 3 to 5;
Transforming the host cell with the recombinant vector to obtain a transformed microorganism;
Culturing the transformed microorganism; And
A method for producing a methylated stilbene compound represented by the following general formula (1), comprising the steps of:
[Chemical Formula 1]

In Formula 1, R _1, R ₂ and R ₃ are each independently hydrogen or a methyl group, and at least one of R ₁ to R ₃ is a methyl group. Preparing a recombinant vector comprising a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1;
Transforming the host cell with the recombinant vector to obtain a transformed microorganism;
Culturing the transformed microorganism; And
And a step of obtaining a compound represented by the following formula (2) in said culture.
(2)

Preparing a recombinant vector comprising a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;
Transforming the host cell with the recombinant vector to obtain a transformed microorganism;
Culturing the transformed microorganism; And
And obtaining a compound represented by the following formula (3) and (4) in the cultured product.
(3)

[Chemical Formula 4]

Preparing a recombinant vector comprising a polynucleotide encoding TAL, CCL, and STS and a polynucleotide comprising a nucleotide sequence of SEQ ID NO: 1;
Transforming the host cell with the recombinant vector to obtain a transformed microorganism;
Culturing the transformed microorganism; And
And a step of obtaining a compound represented by the following formula (2) in said culture.
(2)

Preparing a recombinant vector comprising a polynucleotide encoding TAL, CCL and STS and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3;
Transforming the host cell with the recombinant vector to obtain a transformed microorganism;
Culturing the transformed microorganism; And
And a step of obtaining a compound represented by the following formula (3) in said culture.
(3)

Preparing a recombinant vector comprising a polynucleotide encoding TAL, CCL, and STS; and a polynucleotide comprising a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 3;
Transforming the host cell with the recombinant vector to obtain a transformed microorganism;
Culturing the transformed microorganism; And
And a step of obtaining a compound represented by the following formula (2), (5) and (6) in the culture.
(2)

[Chemical Formula 5]

[Chemical Formula 6]

Images