KR20140137561A - The method for analyzing gene mutations related to a age-related macular degeneration using pyrosequencing - Google Patents

Abstract

The present invention relates to a single nucleotide polymorphism marker of CFH I62V, CFH Y402H, and ARMS2 A69S genes for predicting the risk of macular degeneration and a use of the same. More specifically, the gene mutations of CFH I62V (20986A>G), CFH Y402H (37990T>C), and ARMS2 A69S (205G>T) are analyzed by a sequencing analyzing technique - for example, a pyrosequencing technique - so that the risk of macular degeneration can be predicted.

Description

[0001] The present invention relates to a method for analyzing gene mutation related to the risk of macular degeneration using pyrosequencing,

The present invention relates to the analysis of single nucleotide polymorphism variants of CFH I62V, CFH Y402H and ARMS2 A69S genes for predicting the risk of macular degeneration. More specifically, the present invention relates to a method for identifying CFH I62V (20986A> G), CFH Y402H (37990T > C), ARMS2 A69S (205G > T), and its use.

The nerve tissue located in the center of the inner retina of the eye is called the macula. Most of the photoreactive cells responding to the light stimuli are gathered here, and the phase of the object is also the center of the macula, and plays a very important role in sight. Age-related macular degeneration (AMD) is a chronic disease characterized by macular degeneration of the retinal pigment epithelium, Bruch's membrane, and choroidal capillaries. Anatomically, the sensory retina is located in the anterior part of the retinal pigment epithelium, and the treatment of nutrition, support, recirculation and waste products depends on the retinal pigment epithelium. Bruch's membrane is a five-layered structure that is interposed between the choroid and the retinal pigment epithelium. The innermost layer is the basement membrane of the retinal pigment epithelium and the outermost layer is the basement membrane of the choroidal capillary endothelial cells. In other words, it is a metamorphosis of the retinal pigment epithelium, Bruch's membrane and choroidal capillary complex.

This disease occurs mainly in the age group of 50 years or older. In the West, it is the main cause of blindness in the population over 60 years of age and it is increasing in Korea. The cause of age-related macular degeneration has not been elucidated yet. However, the most known risk factors are age (especially after 75 years of age), high-blood pressure, obesity, genetic predisposition, excessive ultraviolet Exposure, and low serum antioxidant concentrations.

There are two types of macular degeneration: dry (non-exudative) macular degeneration and habitual (exudative) macular degeneration. Dry AMD, nonexudative AMD, and nonneovascular AMD accumulate yellow deposits called drusen underneath the retina, which build up and accumulate, which interferes with blood flow to the retina, especially the macula, The failure starts to come. Dry AMD does not cause rapid visual loss, but it can progress to hatching macular degeneration. Below the retina is a choroid that contains a collection of blood vessels embedded within the fibrous tissue and a pigment epithelium that covers the choroid layer.

Wet AMD (exudative AMD, neovascular AMD) is caused by the growth of new blood vessels in the choroid below the retina. These weak neovasions are bleeding and bleeding and exudation, causing macular degeneration in the retina, resulting in visual disturbances. It is known that macular degeneration progresses very quickly, so the visual acuity rapidly deteriorates within weeks and blindness may occur between two months and three years.

Multiple polymorphisms associated with the onset or progression of AMD have been identified (see, for example, Despriet et al. (2007) Arch. Ophthalmol. 125: 1270-71; Seddon et al. (2007) JAMA 297: 1793- 99, 2585; Boon et al. (2008) Am. J. Human Genet. 82: 516-23). Previous studies have shown that certain polymorphisms at the amino acid position 402 of the complement factor H (CFH) gene are associated with responses to PDT or off-label bevacizumab with veraportin against AMD (See, Brantley et al. (2007) Ophthalmology 114: 2168-73].

There is an increasing need to utilize the identification of additional polymorphisms associated with or predicting the safety of macular degenerative diseases.

Therefore, the present inventors have found that the rapid detection of CFH I62V, CFH Y402H and ARMS2 A69S gene mutations in the macular degeneration diseases is faster than the Sanger method, which is a conventional method for sequence analysis, The present invention has been accomplished by developing a pyrosequencing method capable of detecting and quantitating a mutation of a gene sequence.

1. Despriet et al. Arch. Ophthalmol. 125: 1270-71, 2007. 2. Seddon et al. JAMA 297: 1793-99, 2585, 2007. 3. Boon et al. Am. J. Human Genet. 82: 516-23, 2008.

The present invention provides a method for detecting a mutation of a gene associated with a risk of macular degeneration using pyrosequencing.

It is another object of the present invention to provide a set of pyrosequencing primers for detecting the mutation of a gene associated with a risk of macular degeneration.

Another object of the present invention is to provide a kit for detecting a gene mutation associated with the risk of macular degeneration using pyrosequencing.

In order to solve the above problems,

(i) a primer set of SEQ ID NO: 1 and SEQ ID NO: 2;

A primer set of SEQ ID NO: 3 and SEQ ID NO: 4; And

Performing PCR using a primer set of SEQ ID NO: 5 and SEQ ID NO: 6;

(ii) pyrosequencing using the sequencing primers of SEQ ID NOS: 7 to 9 for the PCR products obtained in step (i). to provide.

Preferably, the gene associated with the risk of macular degeneration is CFH (complement factor H) or ARMS2 (Age-related maculopathy susceptibility protein 2), and the amino acid mutation by the CFH gene mutation is CFH I62V or CFH Y402H. The amino acid variation by mutation includes ARMS2 A69S.

The present invention also provides, as another embodiment, a sequencing primer set of SEQ ID NOS: 7 to 9 for detecting a mutation of a gene associated with a risk of macular degeneration.

Further, as another embodiment of the present invention,

(i) a primer set of SEQ ID NO: 1 and SEQ ID NO: 2;

A primer set of SEQ ID NO: 3 and SEQ ID NO: 4;

A PCR primer set consisting of the primer set of SEQ ID NO: 5 and SEQ ID NO: 6, and

(ii) a pyrosequencing primer set of SEQ ID NOS: 7 to 9

A diagnostic kit capable of detecting a mutation of a gene associated with a risk of macular degeneration using pyrosequencing.

Thus, the present invention encompasses both methods for quantitatively analyzing CFH I62V (20986A> G), CFH Y402H (37990T> C), and ARMS2 A69S (205G> T) mutations through pyrosequencing do. This allows an effective analysis of the risk of macular degeneration.

Since the gene mutation related to the macular degeneration disease can be detected quickly and accurately by using the pyrosequencing detection method of the present invention, it can be very usefully used for the diagnosis of the macular degeneration, the prognosis, and the estimation of the treatment progress.

Figure 1 shows a pyrogram for the CFH 62II (20986AA), CFH 402 YY (37990TT), and ARMS2 69 AS (205GT) types.
Figure 2 shows a pyrogram for the CFH 62VV (20986GG), CFH 402 YY (37990TT), and ARMS2 69 AS (205GT) types.
Figure 3 shows a pyrogram for the CFH 62IV (20986AG), CFH 402 YY (37990TT), and ARMS2 69 AA (205GG) types.
Figure 4 shows a pyrogram for the CFH 62VV (20986GG), CFH 402 YY (37990TT), and ARMS2 69 SS (205TT) types.
Figure 5 shows a pyrogram for the CFH 62II (20986AA), CFH 402 YY (37990TT), and ARMS2 69 SS (205TT) types.
Figure 6 shows a pyrogram for the CFH 62IV (20986AG), CFH 402 YY (37990TT), and ARMS2 69 AS (205GT) types.
Figure 7 shows a pyrogram for CFH 62II (20986AA), CFH 402 YY (37990TT), and ARMS2 69 AA (205GG) types.

The terms used in the present invention are defined as follows.

'Genetic polymorphism' refers to a case in which a genetic variation occurs in at least 1% of the population. The insertion, deletion, or substitution of a single nucleotide in DNA is called single nucleotide polymorphism (SNP). Nonsynonymous SNP refers to a change in the base sequence due to SNP, and silent SNP or synonymous SNP does not change the amino acid

The term " polymorphism " refers to a sequence in a sequence of genes that varies within a cluster. Polymorphisms consist of different "alleles ". The arrangement of this polymorphism can be confirmed by its position in the gene and the different amino acids or bases found therein. For example, Y402H CFH indicates that the amino acid position 402 in the CFH gene changes between tyrosine (Y) and histidine (H). These amino acid variations are the result of two possible mutant bases, C and T, which are two different alleles. Since the genotype is composed of two different distinct alleles, any of the various possible variants can be observed in any individual (e. G., CC, CT or TT in this example). The individual polymorphisms are also known to those skilled in the art and are used in, for example, the Single Nucleotide Polymorphism Database (dbSNP) of the Nucleotide Sequence Variation of the nucleotide base mutations available on the NCBI website. ("Reference SNP", "refSNP", or "rs #").

The term " genotype " refers to a specific allele of a particular gene in a cell or tissue sample. In this example, CC, CT or TT are the possible genotypes in the Y402H CFH polymorphism

A "marker" refers to a nucleotide sequence or a coding product thereof (eg, a protein) used as a reference point when identifying a locus or associated locus. The marker may be derived from a genomic nucleotide sequence or from a nucleotide sequence expressed (e.g., from RNA, nRNA, mRNA, cDNA, etc.), or from a coded polypeptide. The term includes nucleic acid sequences that are complementary to or flanked in the marker sequence, such as a probe or a pair of primers that can amplify the marker sequence.

"Nucleic acid" refers to polynucleotides or oligonucleotides such as deoxyribonucleic acid (DNA), and, if appropriate, ribonucleic acid (RNA). The term also encompasses both single (sense or antisense) and double helical polynucleotides, as applied to the described embodiments, as well as analogs of either RNA or DNA prepared from the nucleotide analogs (e.g., peptide nucleic acids) . In the present invention, the term 'nucleic acid' and the term 'nucleotide' are used in combination.

'Primer' refers to an oligonucleotide sequence that hybridizes to complementary RNA or DNA-targeted polynucleotides and serves as a starting point for the stepwise synthesis of polynucleotides from mononucleotides, for example by the action of a nucleotidyltransferase that occurs in the polymerase chain reaction .

&Quot; Diseases and conditions associated with polymorphism " refers to a susceptibility that can be expressed in a subject based on a variety of diseases or conditions, i.e., the identification of one or more alleles.

'Risk' refers to a statistically high incidence of a disease or condition in a subject having a particular polymorphic allele compared to the incidence of a disease or condition in a member of the individual that does not possess the polymorphic allele.

The 'phenotype' is the phenotypic, physiological, or biochemical characteristic of an individual determined by the genotype. Genotypes are distinct from phenotypes, which refer to individual gene constructs and, in a narrower sense, alleles on a gene.

"Target" or "patient" means any single entity requiring treatment, including human, cow, dog, guinea pig, rabbit, chicken, insect, and the like. In addition, any subject who participates in a clinical study test that does not show any disease clinical findings, or who participates in epidemiological studies or used as a control group is included. In one embodiment of the present invention, the present invention was applied to humans.

&Quot; Tissue or cell sample " refers to a collection of similar cells from a subject or tissue of a patient. The source of the tissue or cell sample may be a solid tissue from fresh, frozen and / or preserved organ or tissue sample or biopsy or aspirate; Blood or any blood components; It may be a cell at any point in the pregnancy or development of the subject. Tissue samples can also be primary or cultured cells or cell lines.

An " effective amount " is an appropriate amount that affects a beneficial or desired clinical or biochemical outcome. An effective amount may be administered one or more times. For purposes of the present invention, an effective amount of an inhibitor compound is an amount sufficient to temporarily alleviate, ameliorate, stabilize, reverse, slow down, or delay the progression of a disease state. If the recipient animal is capable of enduring the administration of the composition, or the administration of the composition to the animal is suitable, the composition will be "pharmaceutically or physiologically acceptable ". If the dose administered is physiologically significant, it can be said that the formulation is administered in a "therapeutically effective amount ". The formulation is physiologically relevant if the presence of the formulation results in a physiologically detectable change in the recipient.

The term "treating", unless otherwise indicated, refers to reversing, alleviating, inhibiting, or preventing the disease or condition to which the term applies, or one or more symptoms of the disease or disorder . As used herein, the term " treatment " refers to an act of treating when " treating " is defined as above.

All technical terms used in the present invention are used in the sense that they are generally understood by those of ordinary skill in the relevant field of the present invention unless otherwise defined. Also, preferred methods or samples are described in this specification, but similar or equivalent ones are also included in the scope of the present invention. The contents of all publications referred to herein are incorporated herein by reference.

Hereinafter, the present invention will be described in detail.

The present invention relates to a method for detecting a specific gene mutation by pyrosequencing.

Recently, the molecular biologic technique "pyrosequencing", which has been attracting attention, does not require a labeled primer and does not require a gel electrophoresis process, and only 30 to 40 base pairs (bp) It is a method that can analyze quickly and accurately by sequencing

The pyrosequencing method is a sequencing method that is performed in real time, without electrophoresis. It is performed by adding sequential nucleotides one at a time in primer-directed PCR, and the pyrophosphate released when the nucleotides are combined is ATP It is paired with sulfurylase and luciferase enzymes to emit light, which is then detected. The emitted light represents a signal peak in the order of the reaction of each nucleotide sequentially entered, and this light appears as a peak having a relative height in proportion to the number of nucleotides merged, and the sequence can be determined in real time.

Since the pattern of the peaks is different between the homo and hetero-, wild-type and mutated samples, it is possible to identify and determine the type and exact position of the mutation by comparing the nucleotide sequence of the wild type with the analyzed nucleotide sequence, , It is advantageous to process a large amount of samples in a simple and economical manner

Although the conventional direct DNA sequencing method is currently performed by an automated sequencing analyzer, a DNA sample such as a PCR product to be subjected to sequencing is obtained, followed by performing a sequencing reaction. Thereafter, the DNA generated by the sequencing reaction Is loaded into an automated DNA sequencing instrument and the sequence is read, there is a disadvantage in that the time required for sequencing is much longer. On the other hand, pyrosequencing has a sequencing primer if only the PCR product to be sequenced is prepared , Which is capable of analyzing the base sequence within about 10 minutes by a pyrosequencing instrument.

In addition, because the nucleotide dispensing order can be designed, variations in the base sequence, which are determined by single nucleotides, result in distinct pyrographs that appear in different patterns at different peaks. Moreover, the use of a particular nucleotide distribution strategy can reduce the number of pyrosequencing cycles, thereby increasing the quality of the sequence and the read length.

A process which can be used as one embodiment of the present invention will be briefly described as follows.

A gene containing a nucleotide sequence to be mutated or mutated through pyrosequencing was amplified by PCR using a pyro-PCR primer set (conjugate biotin at the 5 'end of one of the forward or reverse primers for separation and purification of one strand) The resulting amplified PCR product was reacted with avidin-conjugated beads, and only one strand of the DNA amplified by PCR using the affinity between avidin and biotin was added to the separation beads Fixed. After annealing with a pyrosequencing primer using a single stranded DNA template thus separated, the nucleotides dispensed in the order of nucleotide distribution in the pyro-sequencer reacted with the DNA template along with the substrate / Analyze the degree of variation of the base sequence using a pyrogram.

In the present invention, the gene mutation to be analyzed through pyrosequencing includes CFH I62V, CFH Y402H and ARMS2 A69S mutations that have been clinically proven to be associated with the risk of developing macular degeneration.

Recently, the main cause of blindness in advanced countries including Korea is known as macular degeneration. According to the National Statistical Office, the proportion of the elderly population is projected to rise from 11% in 2010 to 14% in 2018 and to 21% in 2025, so that many of the elderly (over 56 years old) The incidence of sex is increasing. In particular, it is known that 70% of progressive macular degeneration is determined by genetic characteristics (CFH, ARMS2, etc.). Among them, CFH I62V, CFH Y402H and ARMS2 A69S variants are known as major risk genes.

Therefore, it is possible to efficiently perform functional mutation testing by pyrosequencing analysis of functional mutant genes of CFH I62V (20986A> G), CFH Y402H (37990T> C) and ARMS2 A69S (205G> T) The risk of macular degeneration can be predicted by determining the gene mutation.

Therefore, the present invention relates to the characterization of single nucleotide polymorphisms found in genes CFH I62V (20986A> G), CFH Y402H (37990T> C) and ARMS2 A69S (205G> T) which increase the risk of macular degeneration, .

As one specific example, primers used for detecting the gene mutation, a kit for detecting a polymorphic marker or a kit for detecting macular degeneration comprising the same, are also included in the present invention.

Suitable primers for amplifying the macular degeneration polymorphic marker to be used in the present invention can be designed using appropriate methods. Using the CFH I62V, CFH Y402H and ARMS2 A69S gene sequences and polymorphic positions, one skilled in the art can construct a primer to amplify the SNPs of the present invention. The primer set used in one embodiment of the present invention is described in Example 1.

Among them, SEQ ID NOS: 1 and 2 for CFH I62V (20986A> G) amplification, SEQ ID NOS: 3 and 4 for CFH Y402H (37990T> C) amplification, SEQ ID NOS: 5 and 6 for amplification of ARMS2 A69S And a pair of at least one primer selected from the group consisting of a primer pair of a primer pair.

In another aspect, the present invention relates to a DNA typing kit or a macular degeneration diagnostic kit for detecting a polymorphic marker comprising a primer set for amplifying a polymorphic marker of CFH I62V, CFH Y402H and ARMS2 A69S genes.

The kit may comprise a set of primer pairs as described above of the present invention, DNA polymerase and dNTPs (dGTP, dCTP, dATP and dTTP) as required.

DNA typing is a technique used to identify individuals by selectively amplifying polymorphic sites in human DNA using DNA amplification techniques. The presence of nucleotide substitutions is determined by the presence of the nucleotide truncation used and the DNA extension (elongation) after cleavage. Is determined based on the presence of the reaction. Examples of methods for determining the presence or absence of a DNA elongation reaction include, but are not limited to, determination of whether elongation products produced using gel electrophoresis, capillary electrophoresis have been separated, methods for determining whether the length of the elongation product has increased using mass spectrometry .

 In the use of such a kit, the labeled oligonucleotide can be easily identified during analysis. Examples of labels that may be used include radioactive labels, enzymes, fluorescent compounds, streptavidin, avidin, biotin, magnetic moieties, metal binding moieties, antigen or antibody moieties, and the like.

The information obtained using the kit for the analysis of macular degeneration described herein is useful for determining whether the subject has or is likely to have an AMD-related disease or condition.

In addition, this information can further organize how to prevent the onset or progression of a disease or condition. For example, this information allows the physician to more effectively prescribe therapies that deal with the molecular basis of a disease or condition. Therefore, a kit for the diagnosis and treatment of macular degeneration is also an aspect of the present invention.

On the other hand, the method of the present invention can be used not only at the gene level but also at the protein (amino acid) level which is encoded by the nucleic acid sequence.

Thus, the present invention encompasses both methods for quantitatively analyzing CFH I62V (20986A> G), CFH Y402H (37990T> C), and ARMS2 A69S (205G> T) mutations through pyrosequencing do.

The present invention can be used effectively for diagnosis, prognosis, and treatment progress estimation of macular degeneration-related diseases.

<Examples>

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Unless otherwise indicated, nucleic acids are recorded in a 5 'to 3' orientation from left to right. The numerical ranges recited in the specification include numerals defining the ranges and include each integer or any non-integral fraction within a defined range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice of testing the present invention, the preferred materials and methods are described herein.

Example  One : primer  Production and PCR

After blood was collected from the subjects, DNA was isolated using Qiagen's genomic DNA isolation kit.

Analysis of the entire nucleotide sequence of the CFH gene and ARMS2 using an automated sequencer and a next generation sequencing analyzer revealed three functional mutations affecting the increased risk of macular degeneration.

Specifically, three genes were CFH I62V (20986A> G), CFH Y402H (37990T> C), and ARMS2 A69S (205G> T).

Next, mutipyrosequencing analysis, which is a high-speed mutation analysis method in which the three genes can be viewed together, was performed.

The primer pairs used in the PCR are as follows.

Primer name imer sequences 5 'to 3' Size (bp) FH_I62V_BF * TTGCAATGAACTTCCTCCA (SEQ ID NO: 1) 156 FH_I62V_R ATTCTCCCTTCCTGCATA (SEQ ID NO: 2) FH_Y402H_F GCAAACCTTTGTTAGTAAC (SEQ ID NO: 3) 386 FH_Y402H_BR * AGAAAGACATGAACATGCTAGG (SEQ ID NO: 4) RMS2_A69S_BF * AGTGAGATGGCAGCTGG (SEQ ID NO: 5) 549 RMS2_A69S_R TCTGGTTGAATAGCTGGA (SEQ ID NO: 6)

The * in the above table was prepared by binding biotin to the 5 'end.

Then, each gene was reacted under the following PCR conditions.

Example  2 : On pyro sequencing  Gene mutation analysis by

Pyrosequencing was performed using a sequencing primer using the PCR product amplified in Example 1 above. Each sequencing primer used was as follows.

Primer name (bp) The sequence (5'-3 ') CFH_I62V_seq.R CCCTTCCTGCATACCATT (SEQ ID NO: 7) CFH_Y402H_seq.F GAAAATGGATATAATCAAAAT (SEQ ID NO: 8) ARMS2_A69S_seq.R GAGCTCAGTGTGGATTTT (SEQ ID NO: 9)

The results are shown in Figs. 1 to 7. Fig.

Information on the location and frequency of genetic mutations found in Koreans, and standard guidelines for mutational genetic testing.

That is, the case where the mutation of CFH I62V (20986A> G), CFH Y402H (37990T> C), and ARMS2 A69S (205G> T) occurred in the genes in the above genes is the same as the result of sequencing based on the previously used Sanger method Lt; / RTI &gt;

This allows efficient detection of functional mutant genes of CFH I62V (20986A> G), CFH Y402H (37990T> C) and ARMS2 A69S (205G> T) by the pyrosequencing assay method of the present invention, Suggesting that the risk of macular degeneration can be effectively predicted.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Inje University <120> The method for analyzing gene mutations is related to a age-related          macular degeneration using pyrosequencing <130> PN1303-122 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CFH_I62V_BF primer <400> 1 gattgcaatg aacttcctcc a 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CFH_I62V_R primer <400> 2 ccattctccc ttcctgcata 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CFH_Y402H_F primer <400> 3 gtgcaaacct ttgttagtaa c 21 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CFH_Y402H_BR primer <400> 4 ttagaaagac atgaacatgc tagg 24 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ARMS2_A69S_BF primer <400> 5 tgagtgagat ggcagctgg 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ARMS2_A69S_R primer <400> 6 cctctggttg aatagctgga 20 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CFH_I62V_seq.R primer <400> 7 cccttcctgc ataccatt 18 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CFH_Y402H_seq.F primer <400> 8 gaaaatggat ataatcaaaa t 21 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ARMS2_A69S_seq.R primer <400> 9 gagctcagtg tggatttt 18

Claims (11)

(i) a primer set of SEQ ID NO: 1 and SEQ ID NO: 2;
A primer set of SEQ ID NO: 3 and SEQ ID NO: 4; And
Performing PCR using a primer set of SEQ ID NO: 5 and SEQ ID NO: 6;
(ii) pyrosequencing with the sequencing primers of SEQ ID NOS: 7 to 9 for the PCR products obtained in step (i)
/ RTI &gt; a method for detecting a mutation in a gene associated with a risk of macular degeneration. The method according to claim 1,
Wherein the gene associated with the risk of macular degeneration is a complement factor H (CFH) or Age-related maculopathy susceptibility protein 2 (ARMS2). 3. The method of claim 2,
Wherein the amino acid mutation by the CFH gene mutation is CFH I62V or CFH Y402H. 3. The method of claim 2,
Wherein the amino acid mutation by the ARMS2 gene mutation is ARMS2 A69S. A set of sequencing primers consisting of SEQ ID NOS: 7 to 9 capable of detecting a mutation of a gene associated with a risk of macular degeneration. 6. The method of claim 5,
Wherein the gene associated with the risk of macular degeneration is a complement factor H (CFH) or an age-related maculopathy susceptibility protein 2 (ARMS2). The method according to claim 6,
Wherein the amino acid mutation by the CFH gene mutation is CFH I62V or CFH Y402H, and the amino acid mutation by the ARMS2 gene mutation is ARMS2 A69S. (i) a primer set of SEQ ID NO: 1 and SEQ ID NO: 2;
A primer set of SEQ ID NO: 3 and SEQ ID NO: 4;
A PCR primer set consisting of the primer set of SEQ ID NO: 5 and SEQ ID NO: 6, and
(ii) a pyrosequencing primer set of SEQ ID NOS: 7 to 9
A kit for detecting a mutation in a gene associated with a risk of macular degeneration using pyrosequencing. 9. The method of claim 8,
Wherein the gene associated with the risk of macular degeneration is a complement factor H (CFH) or Age-related maculopathy susceptibility protein 2 (ARMS2). 10. The method of claim 9,
Wherein the amino acid mutation by the CFH gene mutation is CFH I62V or CFH Y402H. 10. The method of claim 9,
Wherein the amino acid mutation by the ARMS2 gene mutation is ARMS2 A69S.

Images