KR20140134635A - Recombinant microorganism with kauronic acid production ability and method for preparing kauronic acid using the same - Google Patents

Abstract

The present invention relates to a recombinant microorganism with kaureonic acid production ability, which is a precursor of stevioside, and a method for manufacturing of kaureonic acid using the same. According to the present invention, a mess of kaureonic acid which is the precursor of stevioside of natural sweetener can be provided by only a simple process, by manipulating a metabolism pathway by recombinant gene induced to microorganism, not by directly separating from a stevia extract.

Description

Recombinant microorganism with kauronic acid production ability and method for preparing kauronic acid using the same

The present invention relates to a recombinant microorganism having the ability to produce kauric acid, which is a precursor of stevioside, and a method for producing kauric acid using the same.

Stevia ( Stevia rebaudiana Bertoni ) is a perennial plant in the family Asteraceae. Its origin is an alpine region adjacent to the border of Brazil and Paraguay in South America. Stevia grows wild in rivers or around wetlands, and contains sweetening substances in its leaves. The sweetening ingredients of stevia include stevioside, rebaudioside-A, etc., which use steviol as a glycoside.

Stevioside is a natural sweetener that has about 200 times the sweetness of sugar, and Rebaudioside-A is about 250 times that of sugar. Stevioside has a slightly bitter aftertaste, but Rebaudioside-A has little bitterness, so it is excellent as a sweetening ingredient. Accordingly, efforts to produce rebaudioside-A by glucosylating stevioside have been continued, and it has been found that transglycosylation is performed using steviol glycoside as a donor.

Until now, studies related to the production of stevioside have been mainly on extracting directly from the leaves of Stevia rebaudiana Bertoni, and suppressing stevioside from the extract of Stevia itself, and reducing the production yield of rebaudioside A with excellent sweetness. Enzyme treatment methods have been studied to increase. In the prior patent literature, a ß-1,4-galactosyl transferase was applied to stevioside in an aqueous solution containing a stevia extract and a ß-1,4-galactosyl saccharide compound as a main component of stevioside, thereby forming a galactosyl group on stevioside. Method of manufacturing (Japanese Patent Laid-Open No. 58-94367), a method of improving the quality of stevioside by converting stevioside to sugar transfer stevioside by enzymatic reaction in a reaction system in which water and a hydrophobic organic solvent are mixed (registered in Korea Patent No. 1994-528), a method of separating each of stevioside and rebaudioside A into a crystalline form using the difference in solubility in alcohol and water (Japanese Patent Laid-Open No. 56-121453), gamma on stevia plants A method of inducing genetic modification into a plant that contains a large amount of rebaudioside A by irradiating light rays (Japanese Patent Laid-Open No. 2002-34502) and the like are disclosed.

Accordingly, the present inventors have tried to develop a new method for producing stevioside using microorganisms, as a result of developing a recombinant vector capable of synthesizing the precursor of stevioside, kauric acid, and the recombinant microorganism transformed with the vector The present invention was completed by confirming that it has excellent kauric acid producing ability.

An object of the present invention is to provide a recombinant vector for the production of stevioside precursor kauric acid.

Another object of the present invention is to provide a recombinant microorganism having the ability to produce kauric acid, which is a precursor of stevioside.

Another object of the present invention is to provide a method for producing a stevioside precursor kauric acid using the recombinant microorganism.

In order to achieve the object of the present invention, the present invention is a gene encoding GGDPS; A gene encoding CDPS; A gene encoding KS; And it provides a recombinant vector for producing a stevioside precursor kauric acid containing a gene encoding KO (kaurene oxidase).

In addition, the present invention provides a recombinant microorganism having the ability to produce kauric acid, which is a precursor of stevioside transformed with the recombinant vector.

In addition, the present invention, (a) culturing the recombinant microorganism; And (b) recovering kauric acid from the microbial culture medium obtained in step (a).

According to the present invention, by manipulating the metabolic pathway by a recombinant gene introduced into a microorganism, rather than directly separating from the extract of stevia, it is possible to provide a large amount of kauric acid, a precursor of stevioside, a natural sweetener with only a simple process.

1 is a diagram showing the biosynthetic metabolic circuit of kaurin, kauric acid and steviol.
2 is a diagram showing a vector used for cloning in the present invention ((A) pGEM-T Easy vector, (B) pUC_mod vector, (C) an expression vector modified from pET23 vector, (D) pSTV29 vector).
3 is a diagram illustrating CDPS isolated and purified from recombinant E. coli.
4 is a diagram showing copalol produced through an in vitro assay through GC/MS analysis.
5 is a diagram illustrating KS isolated and purified from recombinant E. coli.
6 is a diagram showing copalol and kaurin produced through an in vitro assay through GC/MS analysis.
7 is a diagram showing the cowrin produced through an in vitro assay through GC/MS analysis.
8 is a diagram showing CDPS and KS proteins isolated and purified from recombinant E. coli through SDS-PAGE.
9 is a diagram showing the cowrin produced using GGDPS derived from stevia and various strains through GC/MS.
10 is a diagram showing a comparison of the amount of cowin produced using GGDPS derived from stevia and various strains.
11 is a diagram showing a recombinant vector containing a gene encoding GGDPS (crtE) derived from Rhodobacter sphaeroides and CDPS and KS derived from Stevia rebaudiana Bertoni.
12 is a diagram showing the change in the amount of cowrin production according to the culture method.
13 is a diagram showing a comparison of the amount of kauric acid produced using a normal KO gene derived from stevia and a KO* gene having three mutations (L28Q, N284H, F446V).
14 is a diagram showing kauric acid produced using a KO* gene having three mutations (L28Q, N284H, F446V) through GC/MS.
Figure 15 is a GGDPS (crtE) derived from Rhodobacter sphaeroides and CDPS derived from Stevia rebaudiana Bertoni , KS and encoding KO* gene with three mutations (L28Q, N284H, F446V). It is a diagram showing a recombinant vector containing a gene.
16 is a diagram showing the amount of steviol produced using the gene group producing kauric acid and the KAH gene.

Hereinafter, the present invention will be described in detail.

The present invention relates to a gene encoding GGDPS (geranylgeranyl diphosphate synthase); A gene encoding CDPS (copalyl diphosphate synthase); And it provides a recombinant vector for producing a stevioside precursor kaurine containing a gene encoding KS (kaurene synthase).

In addition, the present invention is a gene encoding GGDPS; A gene encoding CDPS; A gene encoding KS; And it provides a recombinant vector for producing a stevioside precursor kauric acid containing a gene encoding KO (kaurene oxidase).

In addition, the present invention (1) a gene encoding GGDPS; A gene encoding CDPS; A gene encoding KS; And a recombinant vector comprising a gene encoding KO; And (2) a recombinant vector comprising a gene encoding KAH (kaurenoic acid hydroxylase); it provides a recombinant vector for producing steviol, a precursor of stevioside, including all.

The gene is characterized by being derived from Stevia rebaudiana Bertonii , but is not limited thereto as long as it is expressed in host cells into which it is introduced and exhibits the same enzyme activity even if it is derived from another organism.

The gene encoding the GGDPS (geranylgeranyl diphosphate synthase) is preferably a nucleotide represented by SEQ ID NO: 1 derived from Rhodobacter sphaeroides , and in this case, it is significantly superior to when using GGDPS derived from Stevia rebaudiana. Stevioside precursors can be produced with efficiency.

The gene encoding the CDPS (copalyl diphosphate synthase) is preferably a nucleotide represented by SEQ ID NO: 2 derived from Stevia rebaudiana.

The gene encoding the KS (kaurene synthase) is preferably a nucleotide represented by SEQ ID NO: 3 derived from Stevia rebaudiana.

The gene encoding the KO (kaurene oxidase) is preferably a nucleotide represented by SEQ ID NO: 4 derived from Stevia rebaudiana or a nucleotide represented by SEQ ID NO: 5. The nucleotide represented by SEQ ID NO: 5 encodes a KO gene having three mutations (L28Q, N284H, F446V), and is a precursor of stevioside with remarkably superior efficiency compared to when using a normal KO gene (SEQ ID NO: 4). Can be created.

The gene encoding the KAH (kaurenoic acid hydroxylase) is preferably a nucleotide represented by SEQ ID NO: 6 derived from Stevia rebaudiana.

In the present invention, the term "vector" refers to a gene construct containing a nucleotide sequence of a gene operably linked to a suitable control sequence so that the target gene can be expressed in a suitable host, and the control sequence is used to initiate transcription. Capable promoters, any operator sequence to regulate such transcription, and sequences that control termination of transcription and translation.

In the present invention, "operably linked" refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA can be operably linked to affect the expression of the coding sequence. The operative linkage with the recombinant vector can be prepared using gene recombination techniques well known in the art, and site-specific DNA cleavage and linkage use enzymes generally known in the art.

In the present invention, "expression of a target gene" may mean expressing the target gene to produce a protein encoded by the target gene In the present invention, the method of expressing the target gene is characterized by a vector containing the target gene. This is a method of culturing the transformed transformant (host cell, microorganism, etc.) to express the protein encoded by the target gene, and through this, the final product of the biosynthetic pathway involving the protein can be prepared.

The vector of the present invention is not particularly limited as long as it can replicate in cells, and any vector known in the art may be used, such as a plasmid, cosmid, phage particle, or viral vector.

In the present invention, as a preferred embodiment, a vector map of a vector for producing cowin according to the present invention is shown in FIG. 11, and a vector map of a vector for producing kauric acid is shown in FIG. 15.

In addition, the present invention provides a recombinant microorganism having the ability to produce cowin, kauric acid or steviol transformed with the recombinant vector.

The microorganism may be selected from the group consisting of E. coli, bacteria, yeast, and fungi, and is not limited thereto, preferably, as long as it has E. coli, or cowin, kauric acid, or steviol-producing ability.

A method of introducing a recombinant vector into a cell may use a method known in the art, and is preferably a transformation method. The "transformation" means that DNA is introduced into a host so that the DNA becomes replicable as an extrachromosomal factor or by chromosomal integration completion. Transformation includes any method of introducing a nucleic acid molecule into an organism, cell, tissue or organ, and as known in the art, can be performed by selecting a suitable standard technique according to the host cell. These methods include electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE (diethylaminoethyl)-dextran method, cationic liposome method. , And lithium acetate-DMSO method may be included, but are not limited thereto.

In addition, the present invention, (a) culturing the recombinant microorganism; And (b) recovering cowin, kauric acid or steviol from the microbial culture solution obtained in step (a).

In the present invention, the cultivation of the recombinant microorganism can be performed using a commonly known culture method.

In the present invention, the separation and recovery of cowin, kauric acid or steviol from the recombinant microorganism and its culture medium can be performed using a known method suitable according to the physical and chemical properties of the material, for example, distillation, electrodialysis. , Pervaporation, chromatography, solvent extraction, reaction extraction, HPLC, and the like, may be used, and may be used in combination, but are not limited thereto.

Hereinafter, it will be described in detail through preferred embodiments to aid the understanding of the present invention. However, the following examples are for illustrative purposes only and are not intended to limit the content of the present invention.

Example 1. Securing of Vector and Preparation of Cloning Primer

The biosynthetic metabolic circuit of cowin, kauric acid and steviol is shown in FIG.

As shown in FIG. 1, the enzymes related to kaurin biosynthesis include GGDPS (geranylgeranyl diphosphate synthase, crtE), CDPS (copalyl diphosphate synthase), KS (kaurene synthase), and the like, and the enzyme related to kaurin acid biosynthesis is KO (kaurene oxidase). Is further included, and the enzyme related to steviol biosynthesis further includes kaurenoic acid hydroxylase (KAH).

In order to prepare a recombinant microorganism having the ability to generate a stevioside precursor, cloning was performed to secure an enzyme related to biosynthesis. First, moisture from the leaves of Stevia rebaudiana Bertoni was removed under liquid nitrogen, and the dried product was finely ground in a mortar. Total RNA of stevia leaves was obtained using a method known in the art, and cDNA was synthesized therefrom.

A vector map used to confirm biosynthetic gene cloning, assembly, and protein expression in the present invention is shown in FIG. 2.

As shown in FIG. 2, as the T-vector (A), pGEM®-T Easy Vector provided by Promega's pGEM®-T Easy Vector System I was used, and the pUC_mod vector (B) was used in a general cloning process. In addition, an expression vector modified from invitrogen's pET23 vector (C) was used in experiments for protein isolation and purification, and Takara's pSTV29 vector (D) was used for assembly of genes.

In addition, primers for cloning each gene are shown in Tables 1 to 3 below (the portions indicated by the underline indicate portions complementary to each gene).

Primer sequence for cloning into pUC_mod vector gene Primer sequence Restriction enzyme site GGDPS 5'-F GCTCTAGAAGGAGGATTACAAA ATGGCTCTTGTAAATCCCAC -3' XbaI 5'-R GGAATTC TCAGTTTTGCCTATAAG -3' EcoRI CDPS 5'-F GCTCTAGAAGGAGGATTACAAA ATGAAGACCGGCTTCATC -3' XbaI 5'-R TTCCCTTGCGGCCGC TCATATTACAATCTCGAAC -3' NotI KS 5'-F GCTCTAGAAGGAGGATTACAAA ATGAATCTTTCACTATGCATC -3' XbaI 5'-R TTCCCTTGCGGCCGC TTACCTTTGTTCTTCATTTTC -3' NotI EN
(Or KO*) 5'-F GCTCTAGAAGGAGGATTACAAA ATGGATGCCGTCACCGGTTTG -3' XbaI 5'-R GGAATTC TCATATCCTGGGCTTTATTATG -3' EcoRI KAH 5'-F GCTCTAGAAGGAGGATTACAAA ATGATTCAGGTGCTGACCC -3' XbaI 5'-R GGAATTC TTAGACTTGGTGTGGGTGC -3' EcoRI

Primer sequence for cloning into T vector gene Primer sequence CDPS 5’-F ATGAAGACCGGCTTCATC-3’ 5’-R TCATATTACAATCTCG-3’ KS 5’-F ATGAATCTTTCACTATG-3’ 5’-R TTACCTTTGTTCTTCAT-3’

Primer sequence for cloning into pET vector gene Primer sequence Restriction enzyme site GGDPS 5'-F TCCCCCCGGG GCTCTTGTAAATCCCAC -3' XmaI 5'-R GGAATTC TCAGTTTTGCCTATAAG -3' EcoRI CDPS 5'-F TCCCCCCGGG AAGACCGGCTTCATC -3' XmaI 5'-R TTCCCTTGCGGCCGC TCATATTACAATCTCGAAC -3' NotI KS 5'-F TCCCCCCGGG AATCTTTCACTATGCATC -3' XmaI 5'-R TTCCCTTGCGGCCGC TTACCTTTGTTCTTCATTTTC -3' NotI

Table 4 shows information on specific recombinant vectors that cloned each gene into each of the vectors.

Plasmid characteristic pUCM A vector that has ampicillin resistance modified from pUC19 and can be continuously expressed pUCM_GGDPS GGDPS expression vector derived from Stevia rebaudiana pUCM_CDPS CDPS expression vector from Stevia rebaudiana pUCM_KS KS expression vector derived from Stevia rebaudiana pUCM_KO KO expression vector derived from Stevia rebaudiana pUCM_KO* KO* expression vector with three mutations (L28Q, N284H, F446V) derived from Stevia rebaudiana pUCM_KAH KAH expression vector synthesized from protein sequence information of Stevia rebaudiana pGEM®-T Easy T vector for cloning pGEM_CDPS CDPS-inserted vector derived from Stevia rebaudiana pGEM_KS KS-inserted vector derived from Stevia Rebaudiana pET21 Vector for protein expression with 6 His tags in C-terminal pET21_GGDPS GGDPS protein expression vector derived from Stevia rebaudiana pET21_CDPS CDPS protein expression vector derived from Stevia rebaudiana pET21_KS KS protein expression vector derived from Stevia rebaudiana pET23M Vector for protein expression with His tag in N-terminal pET23M_GGDPS GGDPS protein expression vector derived from Stevia rebaudiana pET23M_CDPS CDPS protein expression vector derived from Stevia rebaudiana pET23M_KS KS protein expression vector derived from Stevia rebaudiana pSTV29 Chloramphenicol-resistant vector for assembly of kauric acid-producing gene pSTV29_CDPS CDPS-inserted vector derived from Stevia rebaudiana pSTV29_CDPS_KS CDPS and KS derived vector from Stevia rebaudiana pSTV29_crtE_CDPS_KS A cowin production vector in which CDPS and KS derived from Stevia rebaudiana and KS with crtE derived from Rhodobacter spheroid are assembled pSTV29_crtE_CDPS_KS_KO Kauric acid production vector in which CDPS derived from Stevia rebaudiana, crtE derived from KS and Rhodobacter spheroid, and normal KO gene derived from Stevia rebaudiana are assembled pSTV29_crtE_CDPS_KS_KO* Kauric acid production vector in which CDPS derived from Stevia rebaudiana, crtE derived from KS and Rhodobacter spheroid, and KO* with three mutations (L28Q, N284H, F446V) derived from Stevia rebaudiana are assembled

The nucleotide sequence and amino acid sequence were compared with the NCBI database for the finally obtained clone.

Example 2. In vitro functional assay

2-1. Confirmation of CDPS (Copalyl diphosphate synthase) activity

Using the pET23M_CDPS recombinant vector into which the CDPS gene was inserted, transformed recombinant E. coli was prepared according to a known electroporation method. This was incubated in 50ml LB medium at 37°C at OD600nm until it reached 0.6, followed by induction of expression with 0.1 mM IPTG, followed by further incubation at 30°C for 3 hours. Recombinant E. coli in the culture medium was collected through centrifugation, and GGDP assay buffer (50mM potassium phosphate pH 8, 10% glycerol, 2mM DTT, 5mM MgCl ₂ ) and lysozyme (100 mg/ml) were mixed with the collected cell pellet. . This was incubated at 37° C. for 15 minutes and then sonicated 3 times for 20 seconds on ice. After centrifuging this at 12000g, the supernatant was removed. The CDPS protein obtained through the above process was confirmed through His-tag purification. This is shown in FIG. 3.

As shown in FIG. 3, after induction of expression with IPTG, a band was confirmed at about 90 kDa corresponding to the molecular weight of CDPS for each time period, and it was confirmed on SDS-PAGE that CDPS expressed in recombinant E. coli was isolated and purified with high purity. .

Next, the following experiment was performed to confirm whether the CDPS obtained through the above process was normally expressed and the conversion from GGDP to CDP was normally performed. First, 500 µg of protein extract of recombinant E. coli expressing the CDPS gene obtained through the above process and 10 µg of GGDP (Sigma, St Louis, Missouri, USA) dissolved in 250 µl of GGDP assay buffer were mixed at 30° C. for 2 hours. Cultured. Then, the produced protein was confirmed using gas chromatography-mass spectrometry (GC/MS). At this time, when the conversion from GGDP to CDP occurs, a phosphate group is attached to the terminal to form a copalyl diphosphate structure.Since the material cannot be analyzed through GC/MS, the phosphate group is treated through CIP (Calf-intestinal alkaline phosphatase) treatment. Removed and analyzed. As a control, a protein extract of recombinant E. coli into which an empty vector that did not express a gene was inserted was used. The results are shown in FIG. 4.

As shown in FIG. 4, one separated peak was confirmed at a mass value of 290 m/z, and as a result of comparing the fragmented mass pattern result with the GC/MS library, it was confirmed that the material has a copalol structure. Through the above results, it was confirmed that CDPS was normally expressed and active in recombinant E. coli.

2-2. Confirmation of KS (Kaurene synthase) activity

The experiment was performed in the same manner as in Example 2-1, except that the pET23M_KS recombinant vector into which the KS gene was inserted was used instead of the pET23M_CDPS recombinant vector into which the CDPS gene was inserted in Example 2-1. The KS protein obtained through the above process was confirmed through His-tag purification. This is shown in FIG. 5.

As shown in FIG. 5, after induction of expression with IPTG, a band was identified around 89 kDa corresponding to the molecular weight of KS for each time period, and it was confirmed on SDS-PAGE that KS expressed in recombinant E. coli was separated and purified with high purity. .

Next, the following experiment was performed to confirm whether the conversion from CDP to cowin was normally performed by normal expression obtained through the above process. First, 250 μg of the protein extract of recombinant E. coli expressing the KS gene obtained through the above process, 250 μg of the protein extract of the recombinant E. coli expressing the CDPS gene obtained in Example 2-1, and 10 μg of GGDP were mixed at 30° C. Incubated for 2 hours at. After that, the produced protein was confirmed through gas chromatography-mass spectrometry (GC/MS). As a control, a protein extract of recombinant E. coli into which an empty vector that did not express a gene was inserted was used. The results are shown in FIGS. 6 and 7.

As shown in Fig. 6, copalol as an intermediate product and cowin as a final product were identified and identified through GC/MS. In addition, as shown in FIG. 7, one separated peak was confirmed at a mass value of 272 m/z, and as a result of comparing the fragmented mass pattern result with the GC/MS library, it was confirmed once again that the material was cowin. .

Finally, it was confirmed that the final protein extract was properly extracted and purified through SDS-PAGE. The results are shown in FIG. 8.

As shown in Fig. 8, it was confirmed that the CDPS and KS proteins were properly extracted and purified. Subsequent experiments were performed using the CDPS and KS protein extracts identified through the above process.

Through the above experimental results, it was confirmed that in an in vitro assay, CDPS made copalyl diphosphate (CDP) using GGDP as a substrate, and KS produced cowlin using this as a substrate. Therefore, the subsequent experiment was not a method of producing kaurin by adding a substrate, but to create a system that directly generates kaurin by expressing GGDPS and KS in E. coli.

Example 3. GGDPS (crt E) screening

In order to prepare a recombinant microorganism having excellent cowrin-producing ability, GGDPS (crtE) screening was performed. GGDPS (crtE) of Stevia rebaudiana Bertoni was used as a control, and a gene having the same function as GGDPS (crt E) derived from another strain was obtained. Final cowrin production was compared using genes that function like GGDPS (crtE) from a total of six strains including Rhodopirellula Baltica SH1, Pantoea agglomerans, Corynebacterium glutamicum Rhodobacter sphaeroides, Rhodobacter capsulatus, and Brevibacterium linens. In the case of cowin, since there is no standard, it is difficult to perform an accurate quantitative analysis, so a total of three experiments were performed for a relative quantitative comparison experiment, and the amount of cowin produced per unit cell was compared with a relative quantitative value.

More specifically, transformed cells were obtained by expressing six types of pUCM_crtE in pSTV29_CDPS_KS subjected to gene assembly. In order to separate the final produced cowin from transformed cells, the following three methods were used.

a) The entire cultured cells (0.2 g-wet cell weight, g-wcw) were extracted with a chloroform:MeOH = 2:1 solution, and then finally eluted with the same solution.

b) The entire cultured cells (0.2 g-wcw) were extracted with a hexane solution, and then finally eluted with the same solution.

c) After drying all the cultured cells (0.2 g-wcw) with chloroform:MeOH = 2:1 solution and the group extracted with hexane solution, 40 µl of methoxyaminhydrochloride was added and at 37°C. It was incubated with shaking for 2 hours. Thereafter, MSTFA was added and incubated with shaking at 37° C. for 30 minutes to obtain a final sample.

The material obtained through the methods a) and b) had very high abundance of peaks and had many other peaks, and the material obtained through the method c) showed a relatively stable pattern. Therefore, the material obtained through the method of c) was analyzed through GC/MS. The results are shown in FIGS. 9 and 10.

As shown in Figs. 9 and 10, in the case of using GGDPS derived from stevia, it was not possible to qualitatively confirm cowrin. In addition, as a result of quantitatively comparing the amount of kaurin produced according to the type of GGDPS, it was confirmed that the most kaurine was produced per unit cell when using GGDPS (crtE) derived from Rhodobacter sphaeroides. Therefore, in subsequent experiments, GGDPS (crtE) derived from Rhodobacter sphaeroides was assembled and used.

Example 4. Construction of a recombinant vector for cowrin production containing CDPS, KS and GGDPS (crtE)

Based on the results of Example 3, in order to generate a large amount of cowin in recombinant E. coli, CDPS, KS, and GGDPS (crtE) were assembled to be expressed in one plasmid, thereby constructing a recombinant vector. The vector map of the recombinant vector is shown in FIG. 11.

It was confirmed that the production of kaurin in the recombinant strain transformed with the recombinant vector was confirmed, through which GGDPS derived from Rhodobacter sphaeroides rather than the existing Stevia-derived GGDPS gene was used in the recombinant microorganism. We have established a system that can effectively produce a large amount of cowin.

Example 5. Verification of increasing productivity of recombinant strains producing cowrin through fermentation tank culture

In order to increase the productivity of cowin in the recombinant microorganism (E. coli) transformed with the recombinant vector prepared in Example 4, a fermentor was cultured. More specifically, 1L of LGN (yast extract 5g, tryptone 10g, NaCl 5g, sodium nitrate 10g, glycerol 5g) containing glycerol as a carbon source was used, and anaerobic culture was performed by continuously supplying nitrogen gas. It was carried out to see if it could produce cowrin. For a comparative experiment under flask conditions, 1L of LGN (yast extract 5g, tryptone 10g, NaCl 5g, sodium nitrate 10g, glycerol 5g) containing 100ml of glycerol was added to a 120ml bottle and sealed so that no oxygen was supplied for anaerobic culture. Was carried out. Finally, the amount of cowrin produced per unit cell was compared. The results are shown in FIG. 12.

As shown in FIG. 12, as a result of extracting and analyzing the cowlin produced by the same amount of recombinant strain under the same anaerobic culture conditions, it was found that when the fermentation tank culture was performed than the flask culture, a larger amount of cowrin could be produced. Confirmed.

Example 6. KO (normal KO or mutant KO*) screening for the production of kauric acid

Recombinant vector for cowrin production by assembling GGDPS (crtE) derived from Rhodobacter sphaeroides , CDPS and KS genes derived from stevia in a conventional pSTV29 vector, which was confirmed to have excellent cowrin-producing ability in Example 4 ( pSTV29_crtE_CDPS_KS) was prepared (see FIG. 11). Using a recombinant expression vector (pUCM-KO or pUCM-KO*) comprising a normal KO gene derived from stevia and a KO* gene having three mutations (L28Q, N284H, F446V) together with the recombinant vector (pSTV29_crtE_CDPS_KS) The transformed recombinant E. coli was prepared according to a known electroporation method. The amount of kauric acid finally produced by the recombinant E. coli was confirmed. In the case of kauric acid, since there is no standard, it is difficult to perform an accurate quantitative analysis, so a total of three experiments were performed for a relative quantitative comparison experiment, and the amount of kauric acid produced per unit cell was compared with a relative quantitative value. The results are shown in FIG. 13.

As shown in Figure 13, in the control group transformed with a vector that does not contain the KO gene, kauric acid was not produced at all, but among the KO genes, the KO* gene having three mutations (L28Q, N284H, F446V) other than the normal gene In the group transformed with a recombinant vector including, it was confirmed that the ability to produce kauric acid was remarkably increased.

In order to reconfirm the production of kauric acid through GC/MS, 5 ml of a chloroform:MeOH=2:1 solution and 2 ml of water were added to the recombinant E. coli, thoroughly mixed, and then n-hexadecane ( hexadecane) was added in an absolute amount. After heat was applied to the solution, it was extracted by ultrasonic treatment, and after drying, TMSD (Trimethylsilydiazomethane, methylation) was added and reacted at 70° C. for 1 hour. The results are shown in FIG. 14.

As shown in Fig. 14, production of kauric acid was confirmed.

Example 7. Construction of a recombinant vector for producing kauric acid containing CDPS, KS, GGDPS (crt E) and mutant KO*

Based on the experimental results of Example 6, in order to generate a large amount of kauric acid in recombinant E. coli, CDPS, KS, GGDPS (crtE) and three mutations (L28Q, N284H, F446V) derived from Rhodobacter spheroids were used. Eggplants were assembled so that KO* could be expressed in one plasmid, thereby constructing a recombinant vector. The vector map of the recombinant vector is shown in FIG. 15.

It was confirmed that the production of kauric acid in the recombinant strain transformed with the recombinant vector was confirmed, through which the KO* gene having three mutations (L28Q, N284H, F446V) other than the conventional stevia-derived normal KO gene Using this, a system capable of effectively producing a large amount of kauric acid in recombinant microorganisms was constructed.

Example 8. Preparation of a recombinant microorganism having steviol-producing ability

Using the recombinant vector containing the kauric acid production module prepared in Example 7 (see Fig. 15) and the recombinant expression vector (pUCM_KAH) expressing KAH derived from stevia together, recombination in the same manner as in Example 6 E. coli was prepared. The recombinant E. coli was cultured at 30° C. for 16 to 24 hours using 100 ml of LB (yast extract 5g, tryptone 10g, NaCl 5g) medium to obtain a culture solution. For the separation and qualitative analysis of the steviol generated from the recombinant E. coli, the culture medium of the recombinant E. coli was extracted with a solution of chloroform: MeOH = 2: 1, dried, and then TMSD (Trimethylsilydiazomethane, methylation) 50 [mu]l was added and 1 at 70[deg.]C. It was allowed to react for hours. The results are shown in FIG. 16.

As shown in FIG. 16, steviol was not produced at all in the control group transformed with the recombinant vector not containing the KAH gene, but the group transformed with the recombinant vector containing the normal KO gene (blue color) contained a trace amount of steviol. It was confirmed that it was generated as, and it was confirmed that a remarkably large amount of steviol was produced in the group (red) transformed with a recombinant vector containing a KO* gene having three mutations (L28Q, N284H, F446V).

<110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Recombinant microorganism with kaurene, kauronic acid, or steviol production ability and method for preparing kaurene, kauronic acid, or steviol using the same <130> 15 <150> KR 10-2012-0040906 <151> 2012-04-19 <160> 6 <170> KopatentIn 2.0 <210> 1 <211> 867 <212> DNA <213> Rhodobacter sphaeroides <400> 1 atggcgtttg aacagcggat tgaagcggca atggcagcgg cgatcgcgcg gggccagggc 60 tccgaggcgc cctcgaagct ggcgacggcg ctcgactatg cggtgacgcc cggcggcgcg 120 cgcatccggc ccacgcttct gctcagcgtg gccacggcct gcggcgacga ccgcccggct 180 ctgtcggacg cggcggcggt ggcgcttgag ctgatccatt gcgcgagcct cgtgcatgac 240 gatctgccct gcttcgacga tgccgagatc cggcgcggca agcccacggt gcatcgcgcc 300 tattccgagc cgctggcgat cctcaccggc gacagcctga tcgtgatggg cttcgaggtg 360 ctggcccgcg ccgcggccga ccagccgcag cgggcgctgc agctggtgac ggcgctggcg 420 gtgcggacgg ggatgccgat gggcatctgc gcggggcagg gctgggagag cgagagccag 480 atcaatctct cggcctatca tcgggccaag accggcgcgc tcttcatcgc cgcgacccag 540 atgggcgcca ttgccgcggg ctacgaggcc gagccctggg aagagctggg agcccgcatc 600 ggcgaggcct tccaggtggc cgacgacctg cgcgacgcgc tctgcgatgc cgagacgctg 660 ggcaagcccg cggggcagga cgagatccac gcccgcccga acgcggtgcg cgaatatggc 720 gtcgagggcg cggcgaagcg gctgaaggac atcctcggcg gcgccatcgc ctcgatcccc 780 tcctgcccgg gcgaggcgat gctggccgag atggtccgcc gctatgccga gaagatcgtg 840 ccggcgcagg tcgcggcccg cgtctga 867 <210> 2 <211> 2361 <212> DNA <213> Stevia rebaudiana <400> 2 atgaagaccg gcttcatctc tcccgccacc gtcttccacc accgtatttc tccggcaacc 60 accttccgcc accacctttc tccggcgacc accaactcca ctggaattgt agctcttaga 120 gacatcaact tccggtgtaa agcggtatcc aaagagtact ctgatttact acaaaaagat 180 gaggcttcat ttaccaagtg ggacgatgac aaagtgaagg accatttgga cacaaataag 240 aatttgtatc caaacgatga gatcaaggag tttgttgaga gcgtgaaagc aatgtttggt 300 tctatgaatg acggagaaat aaatgtgtca gcgtatgata cggcttgggt tgcactcgtg 360 caagatgttg atggaagtgg ttcccctcaa tttccatcaa gtttggagtg gatcgcgaac 420 aatcaactct cagatgggtc ttggggcgat catttgttat tttcggctca tgataggatc 480 attaacacgt tggcatgtgt tatagcgcta acttcttgga acgtccatcc aagtaaatgt 540 gaaaaaggac tgaattttct tagagaaaac atatgtaaac tcgaagacga gaacgcggaa 600 catatgccaa ttggttttga agtcacgttc ccgtcgctaa tagatatcgc aaagaagcta 660 aatattgaag ttcctgagga tactcctgcc ttaaaagaaa tttatgcaag aagagacata 720 aaactcacaa agataccaat ggaagtattg cacaaagtgc ccacaacttt acttcatagt 780 ttggaaggaa tgccagattt ggaatgggaa aaacttctga aattgcaatg caaagatgga 840 tcatttctgt tttctccatc atctactgct tttgcactca tgcaaacaaa agatgaaaag 900 tgtcttcagt atttgacaaa tattgttacc aaattcaatg gtggagttcc gaatgtgtac 960 ccggtggatc tattcgaaca tatttgggta gttgatcgac ttcaacgact tgggatttct 1020 cgttatttca aatcagagat caaagattgc gttgaatata ttaacaagta ttggacaaag 1080 aatgggattt gttgggcaag aaacacgcac gtacaagata ttgatgatac cgcaatggga 1140 tttagggttt taagagcaca tggttatgat gttactccag atgtatttcg acaatttgag 1200 aaggatggta aattcgtatg tttcgctgga cagtcaacac aagccgtcac cggaatgttc 1260 aatgtgtata gagcgtcaca aatgctcttt cccggagaaa gaattcttga agatgcaaag 1320 aaattttcat ataattattt gaaagaaaaa caatcgacaa atgagcttct tgataaatgg 1380 atcatcgcca aagacttacc tggagaggtt ggatatgcgc tagacatacc atggtatgca 1440 agcttaccgc gactcgagac aagatattac ttagagcaat acgggggcga ggatgatgtt 1500 tggattggaa aaactctata caggatggga tatgtgagca ataatacgta ccttgaaatg 1560 gccaaattgg actacaataa ctatgtggcc gtgcttcaac tcgaatggta cactatccag 1620 caatggtatg ttgatatcgg tatcgaaaag tttgaaagtg acaatatcaa aagcgtatta 1680 gtgtcgtatt acttggctgc agccagcata ttcgagccgg aaaggtccaa ggaacgaatc 1740 gcgtgggcta aaaccaccat attagttgac aagatcacct caatttttga ttcatcacaa 1800 tcctcaaaag aggacataac agcctttata gacaaattta ggaacaaatc gtcttctaag 1860 aagcattcaa taaatggaga accatggcac gaggtgatgg ttgcactgaa aaagacccta 1920 cacggcttcg ctttggatgc actcatgact catagtcaag acatccaccc gcaactccat 1980 caagcttggg agatgtggtt gacgaaattg caagatggag tagatgtgac agcggaatta 2040 atggtacaaa tgataaatat gacagctggt cgttgggtat ccaaagaact tttaactcat 2100 cctcaatacc aacgcctctc aaccgtcaca aatagtgtgt gtcacgatat aactaagctc 2160 cataacttca aggagaattc cacgacggta gactcgaaag ttcaagaact agtgcaactt 2220 gtgtttagcg acacgcccga tgatcttgat caggatatga aacagacgtt tctaaccgtc 2280 atgaaaacct tctactacaa ggcgtggtgt gatccgaaca cgataaatga ccatatctcc 2340 aaggtgttcg agattgtaat a 2361 <210> 3 <211> 2352 <212> DNA <213> Stevia rebaudiana <400> 3 atgaatcttt cactatgcat cgcgtcccct ttgttaacca aatcaaatcg acccgcggct 60 ctgtcagcta ttcatacagc atcaacttca catggtggac aaactaatcc cactaatctg 120 atcattgata caaccaaaga acggatccaa aaacagttta aaaatgtaga aatttctgtt 180 tcttcatatg acacagcatg ggtagccatg gtcccttctc caaactcacc caaatcgcct 240 tgtttccctg agtgtctcaa ttggttaatt aataatcagc ttaatgatgg ttcatggggt 300 cttgttaatc acactcataa tcataatcac ccgttgctta aagattctct atcttcaaca 360 ttagcatgta ttgttgcatt aaaaagatgg aatgttgggg aagatcaaat aaataaaggt 420 ctaagtttta ttgagtcaaa tcttgcttca gctactgaaa aaagtcaacc atctcccatt 480 ggttttgaca tcatatttcc tggtttgctt gagtatgcga aaaacttgga cataaacctc 540 ctttcaaaac aaacagattt tagtttgatg ctacataaga gggaattgga gcaaaaaaga 600 tgccattcaa atgagatgga tggatacttg gcgtatatct ctgaaggact cggtaattta 660 tatgattgga atatggtgaa gaaatatcag atgaaaaatg gttctgtttt caactcacca 720 tcagcaacag ctgctgcttt cattaatcat caaaatcctg gttgtcttaa ttatttaaat 780 tcacttttgg acaagtttgg taatgcagtc ccaacagttt atcctcatga tttatttatc 840 cgactttcta tggttgacac aattgaaaga ttaggaattt cacaccattt cagagtggaa 900 attaaaaatg ttttagatga aacatacaga tgttgggtgg aacgagatga gcaaatattc 960 atggatgttg taacatgtgc tttagccttt cggttattaa ggatcaatgg gtatgaagtt 1020 tccccagatc cattggctga aattactaat gaattagctt tgaaagacga atatgcagct 1080 cttgaaacat atcatgcgtc acatatatta taccaagagg atttatcttc tggaaaacaa 1140 atcttgaagt cagctgattt cctcaaagag ataatatcca ctgattcaaa caggctttct 1200 aaattaattc acaaagaggt ggaaaatgct cttaagttcc ctatcaatac cggtttagaa 1260 cgcataaaca ctagacgaaa tatacagctt tacaatgtag acaatacaag aattctgaaa 1320 actacatatc actcatcaaa tattagtaac actgattacc taaggttggc tgttgaagat 1380 ttctacacct gccaatctat ttatcgtgaa gaattaaaag gtcttgaaag gtgggtggta 1440 gagaataagt tggaccagct caagtttgct aggcaaaaga ccgcctactg ttatttctct 1500 gttgctgcaa cactttcgtc tcccgaatta tcagatgcgc gtatttcatg ggccaaaaat 1560 ggcatattaa ctacagtagt tgatgacttt tttgatatcg gtggtacaat cgatgaattg 1620 accaacctga ttcaatgtgt tgaaaaatgg aatgtagatg tcgacaagga ttgttgttca 1680 gagcatgttc ggattttatt tttagcatta aaagatgcaa tctgttggat tggagatgaa 1740 gcttttaaat ggcaagcgcg cgatgtaact agccatgtta ttcaaacttg gttggaacta 1800 atgaatagta tgttgagaga agctatatgg acaagagatg cttatgtgcc aacattaaat 1860 gaatatatgg aaaacgctta cgtgtcattt gcattaggcc cgattgtcaa gccggctatt 1920 tactttgtgg ggcccaaatt atcagaggag attgttgaaa gctctgaata tcataatcta 1980 tttaagctaa tgagcacgca gggtcgactt ctaaacgata tccatagctt caagagggaa 2040 tttaaggaag gcaaattaaa cgcggtagca ttgcatttga gtaacggaga aagtgggaaa 2100 gtggaagaag aggttgtgga ggagatgatg atgatgatta aaaacaagag gaaagaatta 2160 atgaaattaa tttttgaaga aaatggtagc attgttccta gagcttgtaa agatgcattt 2220 tggaacatgt gtcacgtgtt gaattttttt tacgcaaacg atgacgggtt tactggaaac 2280 acgattcttg atactgtgaa ggacatcatt tacaacccgt tggtgcttgt gaatgaaaat 2340 gaagaacaaa gg 2352 <210> 4 <211> 1542 <212> DNA <213> Stevia rebaudiana <400> 4 atggatgcgg ttactggtct gctgactgtt cctgcgactg cgattaccat tggtggcacc 60 gcagtggccc tggcggtcgc tctgatcttc tggtacctga aaagctacac gtccgctcgt 120 cgttctcagt ctaaccacct gccgcgtgta ccggaagtac cgggcgttcc actgctgggt 180 aacctgctgc aactgaagga gaaaaaaccg tacatgacct tcacccgctg ggctgcgacc 240 tacggtccga tctatagcat caaaacgggc gcaacgagca tggtcgtggt atcttctaac 300 gaaatcgcta aagaagcact ggtcacccgc ttccagagca tcagcacccg taacctgtcc 360 aaagccctga aagtgctgac tgctgataag accatggttg caatgtctga ctatgacgac 420 taccacaaga ccgtgaaacg tcacatcctg accgcggtgc tgggcccgaa cgctcagaaa 480 aaacatcgta tccatcgtga tatcatgatg gataacatct ccactcagct gcatgaattt 540 gtgaaaaaca acccggagca ggaggaagtg gacctgcgta aaattttcca gtctgaactg 600 tttggtctgg cgatgcgtca ggctctgggc aaagatgtgg aatccctgta tgtcgaagac 660 ctgaaaatta ccatgaatcg tgacgaaatc ttccaggttc tggttgtaga cccgatgatg 720 ggtgccatcg acgttgattg gcgcgacttc ttcccgtatc tgaaatgggt tccgaacaag 780 aaattcgaaa ataccattca gcagatgtat attcgtcgtg aagccgttat gaaatccctg 840 atcaaagagc acaaaaagcg tattgcatct ggcgagaaac tgaatagcta tattgattac 900 ctgctgagcg aagcgcagac tctgaccgat caacagctgc tgatgtccct gtgggaaccg 960 attatcgagt cttccgatac caccatggta accaccgaat gggcaatgta cgaactggct 1020 aaaaacccga aactgcagga ccgtctgtac cgcgacatca aatccgtttg tggtagcgaa 1080 aaaatcaccg aagagcacct gtcccaactg ccgtacatca ctgcaatctt ccacgagact 1140 ctgcgtcgtc attctccggt tccgatcatc ccactgcgtc acgtgcacga agacactgtt 1200 ctgggcggtt accacgtgcc agccggcacc gaactggcgg ttaacattta cggctgcaac 1260 atggacaaaa acgtctggga aaacccggaa gagtggaacc ctgaacgctt catgaaagaa 1320 aacgaaacta ttgatttcca aaagactatg gcgtttggcg gtggtaaacg cgtatgcgct 1380 ggttctctgc aggcactgct gacggcgtct atcggcatcg gtcgcatggt tcaggaattt 1440 gaatggaagc tgaaagatat gacccaggaa gaagtaaaca cgatcggtct gaccactcag 1500 atgctgcgcc ctctgcgcgc tatcattaag ccgcgtatct aa 1542 <210> 5 <211> 1542 <212> DNA <213> Stevia rebaudiana <400> 5 atggatgccg tcaccggttt gctaacagtt ccggcaaccg caataaccat cggcggtacg 60 gccgtcgcac tcgccgtcgc tcagatattc tggtacctca aaagctacac atctgcacgc 120 aggagccaat caaaccatct ccctcgggtt cccgaggtac ctggtgtgcc attattgggg 180 aatttattgc agttgaagga gaagaaacct tacatgactt ttacgagatg ggcggcaact 240 tatggtccga tttattcgat taaaaccgga gcaacttcta tggtggtcgt cagttcaaat 300 gaaattgcaa aggaggcatt ggttaccaga tttcaatcta tctcaaccag aaacctatca 360 aaggcattaa aggttctcac agcagataaa accatggtgg cgatgagtga ttatgatgat 420 tatcataaga ctgtcaaacg ccatatactg accgctgttt tgggaccaaa tgctcagaag 480 aaacaccgca tccataggga catcatgatg gataatatat caacccaact tcatgaattt 540 gttaaaaata atcctgaaca agaggaagtg gatctaagga aaatattcca atccgaactt 600 tttggattag ctatgagaca agcattggga aaggatgtgg agagcttata tgttgaggat 660 cttaaaatca ccatgaaccg agacgagata tttcaggtat tggttgttga cccgatgatg 720 ggtgcaattg acgtcgactg gagagatttc ttcccgtatc taaagtgggt cccgaataaa 780 aagtttgaaa acacgatcca acaaatgtat atccggagag aagctgtgat gaagtctctt 840 attaaagaac ataaaaaacg tattgcatcc ggagagaaat taaacagcta cattgattac 900 ttgctatcgg aagcacaaac gttaaccgat caacaactac ttatgtctct atgggaacct 960 attattgaat catcagacac cactatggtt acaactgaat gggctatgta tgaacttgca 1020 aaaaacccca aacttcagga tcgtttgtat cgggatatca aaagtgtttg cgggtcagag 1080 aagattacag aagaacactt gtctcaactg ccatacataa ctgccatttt tcatgaaacc 1140 ttgagaaggc atagtccagt tcctataatt ccattaagac acgtgcatga agacacagtg 1200 ttaggagggt accatgtgcc agctggaacc gagctagcgg taaacattta tggatgtaac 1260 atggataaga atgtgtggga gaatcctgaa gaatggaatc cagagagatt catgaaggaa 1320 aatgaaacga tagatgtcca gaaaacaatg gcgtttggag gtggaaagcg cgtatgtgct 1380 ggttcgcttc aagcattgtt gactgcttcc attggaattg gaagaatggt gcaagagttt 1440 gagtggaaac tgaaagatat gacccaagaa gaagttaata cgattgggct tacgacccag 1500 atgcttcgtc cactgcgggc cataataaag cccaggatat ga 1542 <210> 6 <211> 1431 <212> DNA <213> Stevia rebaudiana <400> 6 atgattcagg tgctgacccc gatcctgctg ttcctgatct tctttgtttt ctggaaagta 60 tacaagcacc agaaaactaa aattaacctg ccgccgggca gcttcggttg gccgtttctg 120 ggcgaaactc tggctctgct gcgtgctggc tgggattctg aaccggaacg cttcgtccgt 180 gaacgcatta aaaaacatgg ctccccactg gttttcaaaa cgagcctgtt tggcgatcgt 240 tttgccgtgc tgtgcggtcc ggccggtaac aaatttctgt tttgcaacga gaacaaactg 300 gtggcatctt ggtggcctgt cccggtacgt aaactgttcg gcaaaagcct gctgactatc 360 cgcggcgatg aagccaaatg gatgcgtaaa atgctgctgt cctatctggg cccggatgcg 420 tttgcgaccc attacgcagt aacgatggac gtagtgaccc gccgtcacat tgacgttcac 480 tggcgtggca aagaagaagt caacgtgttc cagaccgtta agctgtatgc cttcgagctg 540 gcatgtcgtc tgttcatgaa tctggatgac ccgaaccaca tcgcgaaact gggctccctg 600 ttcaacatct tcctgaaggg catcattgaa ctgccgatcg acgttcctgg cacccgtttc 660 tactcttcta aaaaggcggc tgcggctatc cgtatcgaac tgaagaaact gattaaagcc 720 cgcaaactgg aactgaagga gggtaaagca tctagctccc aagacctgct gagccatctg 780 ctgacctctc ctgacgaaaa cggtatgttc ctgaccgaag aagagatcgt tgataacatc 840 ctgctgctgc tgttcgcagg tcacgacacg tccgcgctgt ctatcaccct gctgatgaaa 900 accctgggtg aacactccga cgtgtatgat aaagttctga aagaacagct ggaaatttct 960 aaaaccaaag aagcgtggga aagcctgaaa tgggaggata tccagaagat gaaatactcc 1020 tggtctgtta tctgcgaggt gatgcgtctg aatccgccgg ttatcggtac ttaccgtgaa 1080 gcactggtag atatcgacta cgcgggttac actattccga aaggttggaa actgcattgg 1140 agcgcggtgt ccacccagcg tgatgaagca aacttcgaag acgttactcg tttcgacccg 1200 tctcgctttg agggtgcggg tccgaccccg ttcaccttcg ttccgttcgg cggtggtcca 1260 cgcatgtgtc tgggtaagga atttgctcgc ctggaagttc tggctttcct gcacaacatt 1320 gtaacgaact tcaaatggga tctgctgatc ccggacgaga aaatcgaata tgacccgatg 1380 gctactccag ctaaaggtct gccgatccgt ctgcacccac accaagtcta a 1431

Claims (10)

A gene encoding geranylgeranyl diphosphate synthase (GGDPS); A gene coding for CDPS (copalyl diphosphate synthase); A gene encoding KS (kaurene synthase); And a gene encoding KO (kaurene oxidase), which is a precursor of stevioside.
The recombinant vector according to claim 1, wherein the gene encoding GGDPS is a nucleotide sequence of SEQ ID NO: 1 derived from Rhodobacter sphaeroides .
2. The recombinant vector according to claim 1, wherein the gene encoding CDPS is a nucleotide sequence of SEQ ID NO: 2 derived from Stevia rebaudiana .
The recombinant vector according to claim 1, wherein the gene encoding KS is a nucleotide sequence of SEQ ID NO: 3 derived from Stevia rebaudiana .
The recombinant vector for producing kauric acid according to claim 1, wherein the gene encoding KO is a nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5 derived from Stevia rebaudiana .
6. The recombinant vector for producing kauric acid according to claim 5, wherein the nucleotide represented by SEQ ID NO: 5 encodes a KO gene having three mutations L28Q, N284H and F446V.
The recombinant vector according to claim 1, wherein the recombinant vector is expressed as follows.

8. A recombinant microorganism having the ability to produce kauric acid, which is a precursor of stevioside, transformed with the recombinant vector of any one of claims 1 to 7.
The recombinant microorganism according to claim 8, wherein the microorganism is at least one member selected from the group consisting of E. coli, bacteria, yeast and fungi.
(a) culturing a recombinant microorganism transformed with a recombinant vector for producing kauric acid according to any one of claims 1 to 7; And
(b) recovering kauric acid from the microbial culture obtained in the step (a), wherein the kauric acid is a precursor of stevioside.

Images