KR20140129821A - Serodiagnosis kit for canine influenza virus H3N2 comprising HA1 protein of canine influenza virus H3N2 as antigen - Google Patents

Abstract

The present invention relates to a serodiagnosis kit specific to canine influenza virus H3N2 including HA1 (hemagglutinin 1) protein of canine influenza virus H3N2 as an antigen, and a diagnosis method. According to the present invention, the serodiagnosis kit has higher sensitivity and singularity than an existing diagnosis kit, can diagnose serotype specific to canine influenza virus H3N2 through a simple process from a lot of samples, and can check a neutralizing antibody especially specific to canine influenza virus H3N2, thereby being variously applied to vaccine research, investigation of dynamics, etc.

Description

[0001] The present invention relates to a serological diagnostic kit specific for influenza virus H3N2 comprising an HA1 protein of influenza virus H3N2 as an antigen, and a serological diagnostic kit comprising a serine protease for canine influenza virus H3N2 as antigen,

The present invention relates to a serum diagnostic kit and a diagnostic method specific to an influenza virus H3N2 comprising HA1 protein of canine influenza virus (CIV) H3N2 as an antigen.

Influenza (Influenza) is a disease caused by influenza virus type A of Orthomyxoviridae, and is an important disease in people, pigs, horses, birds and the like.

The serotype of the influenza virus is classified according to the types of two proteins, hemagglutinin and neuraminidase, and there are H serotype and N serotype. The avian influenza virus has 16 types of H serotype and 9 types of N serotype, and there are 144 serotypes of avian influenza virus that can arise arithmetically.

As influenza is a common infectious disease, influenza viruses are highly variable and have the potential to spread from one species to another, thus addressing the global spread of highly pathogenic influenza is becoming a big challenge.

Recently, the influenza virus has been newly isolated and identified. It is known that the influenza virus causes acute respiratory disease and has clinical symptoms such as severe cough, fever and nasal discharge.

Previously, hemagglutination inhibition (HI) tests were used for serologic diagnosis of canine influenza virus H3N2. However, while this test is relatively inexpensive, it is time consuming and difficult to implement in large quantities (Skibbe et al., 2004). In addition, a competitive ELISA system that detects avian influenza A virus-specific antibodies using NP protein has been used, but it is unclear whether this is caused by influenza virus H3N2 or other avian influenza viruses. Until now, kits for serum diagnosis specific to influenza virus H3N2 have not been developed.

As a result of efforts to develop a serum diagnostic method specific to influenza virus H3N2, the present inventors have developed an indirect ELISA system using the HA1 protein of H3N2 as an antigen, and found that when using this system, high sensitivity and specificity And confirming that a serotype specific to the influenza virus H3N2 can be diagnosed through a simple process from a large amount of samples, thus completing the present invention.

It is an object of the present invention to provide a serum diagnostic kit specific for the influenza virus H3N2 comprising the HA1 protein of canine influenza virus (CIV) H3N2 as an antigen.

It is yet another object of the present invention to provide a method for serological diagnosis specific to the influenza virus H3N2 using HA1 protein antigen of canine influenza virus (CIV) H3N2.

Another object of the present invention is to provide a screening method of neutralizing antibodies specific to the influenza virus H3N2 using the HA1 protein antigen of canine influenza virus (CIV) H3N2.

In order to solve the above problems, the present invention provides a serum diagnostic kit specific for the influenza virus H3N2 comprising the HA1 protein of canine influenza virus (CIV) H3N2 as an antigen.

(A) contacting an HA1 protein antigen of an influenza virus (CIV) H3N2 with a serum sample of an animal; And (b) detecting the presence of an antibody bound to the HA1 protein antigen of the influenza virus H3N2 in the serum sample of the step (a). .

(A) contacting an HA1 protein antigen of an influenza virus (CIV) H3N2 with a serum sample of an animal; And (b) detecting the presence of an antibody bound to the HA1 protein antigen of the influenza virus H3N2 in the serum sample of the step (a), and screening the neutralizing antibody specific for the influenza virus H3N2 to provide.

The diagnostic kit according to the present invention has a higher sensitivity and specificity than conventional diagnostic kits and can diagnose the serotype specific to the influenza virus H3N2 through a simple process from a large amount of samples and in particular to the influenza virus H3N2 Specific antibodies can be identified. Therefore, the present invention can be applied to vaccine research and epidemiological studies.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a graph showing the results of ROS curve analysis of indirect ELISA and HI test of the present invention. FIG.
FIG. 2 is a graph comparing the results of the indirect ELISA and the HI test of the present invention in a diluted serum according to the HI titer.

Hereinafter, the present invention will be described in more detail.

The present invention provides a serum diagnostic kit specific for the influenza virus H3N2 comprising the HA1 protein of canine influenza virus (CIV) H3N2 as an antigen.

The HA1 protein of the influenza virus H3N2 may be composed of the amino acid sequence of SEQ ID NO: 1 and includes functional equivalents of the protein. Is at least 70% or more, preferably 80% or more, more preferably 90% or more, still more preferably 90% or more, more preferably 90% or more, more preferably 90% or more, Refers to a protein having substantially the same physiological activity as a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 and having a sequence homology of 95% or more.

The HA1 protein of the influenza virus H3N2 may be a recombinant protein and may be a protein produced in insect cells using baculovirus including a gene encoding the HA1 protein of the influenza virus H3N2.

The kit of the present invention comprises one or more other component compositions, solutions or devices suitable for diagnostic and analytical methods.

Preferably, the kit of the present invention may be a kit comprising essential elements necessary for performing enzyme immunoassay (ELISA). The ELISA kit comprises an antibody specific for an antigen protein, and comprises an agent for measuring the protein level. The ELISA kit may comprise a reagent capable of detecting an antibody forming an "antigen-antibody complex", such as a labeled secondary antibody, chromopores, an enzyme (eg, conjugated to an antibody) have. In addition, antibodies specific for the quantitative control protein may be included.

In the present invention, "ELISA (Enzyme Linked Immunosorbent Assay)" refers to a method of confirming an antigen-antibody reaction by binding an enzyme to an antibody. ELISAs include direct ELISA for detecting the antigen and indirect ELISA for detecting the antibody, direct sandwich ELISA using another labeled antibody recognizing the antigen in the complex of the antibody and the antigen attached to the solid support, antibodies and antigens attached to the solid support , Indirect indirect sandwich ELISA using a labeled secondary antibody recognizing the antibody after reacting with another antibody recognizing the antigen in the complex of the present invention, but the present invention is not limited thereto, and an indirect ELISA is used in one embodiment of the present invention .

The diagnostic kit according to the present invention has a higher sensitivity and specificity than conventional diagnostic kits and can diagnose the serotype specific to the influenza virus H3N2 through a simple process from a large amount of samples and in particular to the influenza virus H3N2 Specific antibodies can be identified. Therefore, the present invention can be applied to vaccine research and epidemiological studies.

In addition,

(a) contacting HA1 protein antigen of canine influenza virus (CIV) H3N2 with a serum sample of an animal; And

(b) detecting the presence of an antibody bound to the HA1 protein antigen of the influenza virus H3N2 in the serum sample of the step (a), and providing a serum diagnostic method specific to the influenza virus H3N2.

The HA1 protein of the influenza virus H3N2 of step (a) may be composed of the amino acid sequence of SEQ ID NO: 1 and includes the functional equivalent of the protein.

The step of detecting the antibody in step (b) includes, but is not limited to, a method of detecting an antibody that directly binds to HA1 protein antigen of influenza virus H3N2, a method of detecting a secondary antibody binding to the antibody, and the like .

In addition,

(a) contacting HA1 protein antigen of canine influenza virus (CIV) H3N2 with a serum sample of an animal; And

(b) detecting the presence of an antibody bound to the HA1 protein antigen of the influenza virus H3N2 in the serum sample of the step (a), and screening for a neutralizing antibody specific to the influenza virus H3N2 do.

Since the HA1 protein of the influenza virus H3N2 according to the present invention is related to the virus neutralizing activity, it is possible to monitor the serum conversion to the influenza virus H3N2 and measure the effect of the vaccine by measuring the neutralizing antibody binding to the protein .

Hereinafter, the present invention will be described more specifically based on examples. It will be apparent to those skilled in the art that the embodiments are only for describing the present invention in more detail and that the scope of the invention is not limited by these embodiments in accordance with the gist of the present invention.

Example 1. Cloning of pAcGP67A-cH3N2 HA1-6Xhis

Oligonucleotides were synthesized from Bioneer (South Korea). The 5 'oligonucleotide (5'-CAGGATCCCAATCTTCCAGGAAATGAAAATAA, SEQ ID NO: 2) contains a nucleotide sequence encoding the BamHI site and the N-terminal amino acid residue of the HA1 protein of the influenza virus H3N2, and a 3' oligonucleotide (5'- CAGCGGCCGCTCAATGGTGATGGTGTGATGGGTTTGCCTCTCAGGGAC , SEQ ID NO: 3) contains the NotI site, the termination codon, the C-terminal 6XHis tag, and the nucleotide sequence encoding the C-terminal amino acid residue of the HA1 protein of the influenza virus H3N2.

PCR was carried out using the oligonucleotide according to a conventionally known method to amplify a nucleotide sequence region coding for HA1 protein of influenza virus H3N2. The PCR product was purified using QIAquick PCR purification kit (Qiagen), digested with BamHI and NotI restriction enzymes, and repaired with the same kit. The purified PCR product was then cloned into the pAcGP67A vector digested with BamHI-NotI. The final sequence was confirmed by Macrogen (Seoul, South Korea).

Example 2. Isolation of Recombinant Baculovirus

sf9 S. frugiperda cells were maintained in Sf-900 II SFM medium containing 10% fetal bovine serum. PAcGP67A-cH3N2 HA1 DNA (2 ug) prepared in Example 1 was co-transformed into 2 x 10 ⁶ Hi5 insect cells together with 0.5 ug of BaculoGold AcNPV DNA according to a conventionally known method. On the fifth day after the transformation, the medium was centrifuged and the supernatant was subjected to limiting dilution assay together with Sf9 cells. 2 x 10 ⁶ Sf9 cells were cultured in 6-well plates with a 10-fold dilution of the supernatant. On the eighth day after transformation, the supernatant was centrifuged, and the supernatant was subjected to limiting dilution assay together with Sf9 cells. 2 x 10 ⁶ Sf9 cells were cultured in T-75 flasks with a 10-fold dilution of the supernatant. The recombinant virus in the supernatant was amplified by infected Sf9 cells.

Example 3. Isolation of open H3N2 HA1 protein in Sf9 cells

2 x 10 ⁶ Hi5 cells in Sf-900 II SFM medium were infected with 0.01-10 moi of recombinant baculovirus in a stirring flask. The supernatant was cultured for 3 days, and centrifuged at 3000 g for 10 minutes to remove cell debris. The supernatant was loaded on a Ni-NTA resin and equilibrated with 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl and 5 mM imidazole. After washing 5 mM imidazole resin, 250 mM imidazole protein was isolated. The isolated protein, H3N2 HA1, was dialyzed against 20 mM Tris-HCl (pH 8.0) and 10% glycerol.

Example 4. Indirect ELISA (Enzyme-linked immunosorbent assay) preparation for identifying antigen-specific antibodies

Indirect ELISA was performed to identify antibodies specific to H3N2 HA1 protein prepared in Example 3 as an antigen. First, ELISA plates (Greiner bio-one, Germany) were coated with HA1 protein (50 ng / well) derived from open H3N2 in carbonate carbonate buffer and incubated overnight at 4 ° C. Antigen-free carbonate buffer without antigens was coated for endpoint assays. The cells were blocked with a solution of 0.2% skim milk in PBS (phosphate buffered saline, T-PBS) containing 0.05% Tween 20 at 37 ° C for 1 hour. After washing the plate, a 100-fold diluted serum sample (10 ug / ml of hi5 culture soup including serum diluent: 0.2% skim milk in T-PBS) was treated twice with antigen-coated wells And incubated at 37 ° C for 90 minutes. Then, each well was treated with both anti-dog IgG (sheep anti-dog IgG, 1: 1,000) and then cultured under the same conditions. After washing the plates, each well was treated with anti-sheep IgG-HRP (anti-sheep IgG-HRP, 1: 5,000) and incubated for 60 minutes. For color development, a TMB microwell peroxidase substrate (KPL; Gaithersburg, MD) containing TMB (3,3 ', 5,5'-tetra-methylbezidine) dissolved in 100 μl of acid buffer was added to each well After the treatment, the cells were incubated at room temperature for 5 minutes. For the termination reaction, the absorbance was measured at a wavelength of 450 nm within 30 minutes after treating the solution (1N HCl) recommended by the manufacturer of the same volume. Endpoints of the individual H3N2-HA1-specific IgG antibodies were calculated by subtracting the OD value of the uncoated well from the OD value of the well coated with HA1 protein, the antigen.

Example 5. Determination of Sensitivity and Specificity of Indirect ELISA

5-1. HI test

The HI test was performed according to the OIE manual using the 4HA unit of the influenza virus H3N2. A total of 65 sera were used for indirect ELISA. When the HI titer was 10 or less, it was judged to be negative serum (44 Experimental dogs'sera). There were 16 positive sera (160 ~> 1280 HI titers) and 5 anti-sera against influenza H3N2 virus (160 ~ 640 HI titers).

5-2. ROC analysis and cut-off value determination

The ROC analysis of the indirect ELISA of the present invention prepared in Example 3 and the conventional HI test was performed using a web-based ROC analysis tool (Eng, 2007). The results are shown in Fig.

As shown in Fig. 1, the area under curve (AUV) value was 0.993.

The cut-off value was determined when an optimum value of sensitivity and specificity was obtained. Based on the result of the ROS curve analysis, sensitivity and specificity of the indirect ELISA system of the present invention when the cut- The specificity was 95.7% and 94.7%, respectively. Also, when the cutoff value was 0.36, the sensitivity and specificity of the indirect ELISA system of the present invention were 93.5% and 94.7%, respectively. Therefore, the cut-off value of the indirect ELISA of the present invention was determined when the corrected OD value was 0.17.

To demonstrate the cut-off value, antiserum against the influenza virus H3N2 was serially diluted to 40, 80, 160 and 320 HI titers. FIG. 2 shows the result of performing the indirect ELISA prepared in Example 3 when the diluted dog serum had HI titers of 40, 80, 160, and 320. FIG.

As shown in FIG. 2, the corrected OD value is higher than 0.17 since the diluted dog serum was confirmed to be 160 HI titer. Based on the results, it was confirmed that the cutoff value in the indirect ELISA system of the present invention is closely related to the HI titer in the range of 80 to 160.

Example 6. Comparative experiment between HI test, competitive ELISA and indirect ELISA

Dogs H3N2, seasonal H3N2, and influenza H1N1 influenza virus were inoculated into each nasal passages, and 10 days later, dog serum was obtained. The obtained sera were tested using the conventional HI test, the competitive ELISA being commercialized, and the indirect ELISA system prepared in Example 3 above. Competitive ELISA (Bionote Lt.) Was performed according to the manufacturer's manual, using the NP protein to detect avian influenza A virus-specific antibodies and the results were positive or negative (PI values> 50) positivity). The results are shown in Table 1.

Serum information HI test Competitive ELISA Indirect ELISA Infectious virus individual Canine H3N2 U-45 320 + + (0.75) U-46 <10 + + (0.36) U-54 640 + + (0.74) Seasonal H3N2 U-47 <10 + + (0.72) U-52 <10 + - (0.00) U-51 <10 + - (0.00) Pandemic H1N1 U-48 <10 + - (0.04) U-40 <10 + - (0.03) U-59 <10 - - (0.01) U-53 <10 - - (0.02)

As shown in Table 1, two out of three dog serum samples obtained 10 days after infecting the influenza virus H3N2 were positive and HI titers were 320 and 640, respectively, as a result of HI test. On the other hand, in competitive ELISA and indirect ELISA systems, all dog serum samples were positive.

Also, in dogs isolated from dogs infected with seasonal H3N2 and epidemic H1N1, the HI test of all the sera showed less than 10 HI. On the other hand, competitive ELISAs were identified as positive for 3/3 and 2/4 for seasonal H3N2 and epidemic H1N1, respectively, confirming the problem of cross-reactivity. In addition, the indirect ELISA of the present invention confirmed that 1/3 of the seasonal H3N2 was positive in the same sample, but all of the influenza H1N1 was confirmed to be negative, thereby confirming that the problem of cross reactivity was improved compared to the conventional ELISA .

Therefore, through the above experimental results, it was confirmed that the indirect ELISA system of the present invention is excellent in sensitivity and specificity, and can be used for serum diagnosis and neutralizing antibody screening specific for influenza virus H3N2.

<110> Korea Research Institute of Bioscience and Biotechnology          Industry-Academic Cooperation Foundation, Yonsei University <120> Serodiagnosis kit for canine influenza virus H3N2 comprising HA1          protein of canine influenza virus H3N2 as antigen <130> <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 327 <212> PRT <213> canine influenza virus <400> 1 Asn Leu Pro Gly Asn Glu Asn Asn Ala Ala Thr Leu Cys Leu Gly His   1 5 10 15 His Ala Val Pro Asn Gly Thr Ile Val Lys Thr Ile Thr Asp Asp Gln              20 25 30 Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Asn Ser Ser Thr Gly          35 40 45 Lys Ile Cys Asn Asn Pro His Lys Ile Leu Asp Gly Arg Asp Cys Thr      50 55 60 Leu Ile Asp Ala Leu Leu Gly Asp Pro His Cys Asp Val Phe Gln Asn  65 70 75 80 Glu Thr Trp Asp Leu Phe Val Glu Arg Ser Asn Ala Phe Ser Asn Cys                  85 90 95 Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Ile Val Ala             100 105 110 Ser Ser Gly Thr Leu Glu Phe Ile Thr Glu Gly Phe Thr Trp Ala Gly         115 120 125 Val Thr Gln Asn Gly Gly Ser Gly Ala Cys Lys Lys Gly Pro Ala Asn     130 135 140 Gly Phe Phe Ser Arg Leu Asn Trp Leu Thr Lys Ser Gly Asn Thr Tyr 145 150 155 160 Pro Val Leu Asn Val Thr Met Pro Asn Asn Asn Asn Phe Asp Lys Leu                 165 170 175 Tyr Ile Trp Gly Val His His Pro Ser Thr Asn Gln Glu Gln Thr Ser             180 185 190 Leu Tyr Ile Gln Ala Ser Gly Arg Val Lys Val Ser Thr Arg Arg Ser         195 200 205 Gln Gln Thr Ile Ile Pro Asn Ile Gly Ser Arg Pro Leu Val Arg Gly     210 215 220 Gln Ser Gly Arg Ile Ser Val Tyr Trp Thr Ile Val Lys Pro Gly Asp 225 230 235 240 Val Leu Val Ile Asn Ser Asn Gly Asn Leu Ile Ala Pro Arg Gly Tyr                 245 250 255 Phe Lys Met Arg Ile Gly Lys Ser Ser Ile Met Arg Ser Asp Ala Pro             260 265 270 Ile Asp Thr Cys Ile Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile Pro         275 280 285 Asn Glu Lys Pro Phe Gln Asn Val Asn Lys Ile Thr Tyr Gly Ala Cys     290 295 300 Pro Lys Tyr Val Lys Gln Asn Thr Leu Lys Leu Ala Thr Gly Met Arg 305 310 315 320 Asn Val Pro Glu Arg Gln Thr                 325 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> canine influenza virus F <400> 2 caggatccca atcttccagg aaatgaaaat aa 32 <210> 3 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> canine influenza virus R <400> 3 cagcggccgc tcaatggtga tggtgatgat gggtttgcct ctcagggac 49

Claims (8)

A serum diagnostic kit specific for the influenza virus H3N2, which contains the HA1 protein of canine influenza virus (CIV) H3N2 as an antigen.
2. The serum diagnostic kit according to claim 1, wherein the HA1 protein is composed of the amino acid sequence represented by SEQ ID NO: 1.
The serum diagnostic kit according to claim 1, wherein the kit is an enzyme linked immunosorbent assay (ELISA) kit.
The serum diagnostic kit according to claim 3, wherein the ELISA is at least one selected from the group consisting of a direct ELISA, an indirect ELISA, a direct sandwich ELISA, and an indirect sandwich ELISA.
2. The serum diagnostic kit according to claim 1, wherein the kit identifies a neutralizing antibody specific to the influenza virus H3N2.
(a) contacting HA1 protein antigen of canine influenza virus (CIV) H3N2 with a serum sample of an animal; And
(b) detecting the presence of an antibody bound to the HA1 protein antigen of the influenza virus H3N2 in the serum sample of the step (a).
The method of claim 6, wherein the HA1 protein comprises the amino acid sequence of SEQ ID NO: 1 in step (a).
(a) contacting HA1 protein antigen of canine influenza virus (CIV) H3N2 with a serum sample of an animal; And
(b) detecting the presence of an antibody bound to the HA1 protein antigen of the influenza virus H3N2 in the serum sample of the step (a), and screening for a neutralizing antibody specific for the influenza virus H3N2.

Images