KR20140095295A - Composition for adhesion or proliferation of dental pulp cells comprising recombinant dentin phosphoprotein - Google Patents

Abstract

The present invention relates to a composition comprising dentin phosphoprotein as an active ingredient to promote the adhesion or proliferation of dental pulp cells; and to a method to induce the adhesion or proliferation of dental pulp cells, which comprises a step of treating dental pulp cells with the dentin phosphoprotein. It has been verified that the proliferation of dental pulp cells is promoted, cell-adhesion ability increased and the differentiation of the dental pulp cells into odontoblasts can be promoted using recombinant human dentin phosphoprotein capable of being mass-produced by an expression vector. Therefore, the recombinant human dentin phosphoprotein in the present invention can widely be used to promote the proliferation and adhesion of dental pulp cells in the field of developing a tissue-engineering material related to the recovery and regeneration of teeth and osseous tissue, a dental therapeutic agent for osteanagenesis, and a dental medicine.

Description

TECHNICAL FIELD The present invention relates to a composition for promoting attachment or proliferation of a dermal cell comprising a recombinant dentin phosphate protein,

The present invention relates to a composition for promoting adherence or proliferation of dental pulp cells containing dentin phosphoprotein as an active ingredient, and a method for improving the adhesion or proliferation of dental pulp cells, Or a method of inducing proliferation.

The teeth have enamel on the outermost layer, hard tissue in the inner layer, dentin in the dentin, and dentin cells in the center. Teeth are formed by the induction of the developmental process of the fetal period and are functional units built by several cell types, like organs and organs. Therefore, the teeth are not generated by the stem cell system generated in various cell types from stem cells such as hematopoietic stem cells or mesenchymal stem cells in the adult body.

As described above, teeth have a characteristic that they are not spontaneously regenerated in the adult body, but are continuously exposed to the outside in everyday life such as human food intake and language life, and are used by tooth decay, periodontal disease, It is an organ that can be easily lost. Therefore, according to the characteristics of tissues which are not regenerated spontaneously, in many cases, they are supplemented in the same manner as dentures or implants. However, the presence or absence of teeth greatly affects appearance and taste of food, and interest in development of dental tissue regeneration technology for health maintenance and quality of life is increasing.

Recently, many studies have been carried out on the method of regenerating dental tissues using the separated iv bacterium. In J. Dent. Res., 2002, Vo1.81 (10), pp.695-700, The cells of the isolated epithelial cells and the mesenchymal cysts were transplanted into the abdominal cavity of the rats together with the bioabsorbable carrier to regenerate the tooth-like tissue. Japanese Patent Application Laid-Open No. 2004-357567 discloses that a tooth can be formed by culturing an in vitro-isolated oocyte with a carrier containing fibrin. In addition, techniques for forming teeth in iv cells have been invented (International Publication No. 2005/014070, International Publication No. 2006/129672).

On the other hand, dentin sialophosphoprotein (DSPP) is a representative dentin-specific protein belonging to non-collagenous proteins, and dentin sialoprotein (DSP) and dentin phosphoprotein (DPP ) Are synthesized. Unlike osteoblastic osteoblasts, DSPP, known as an iodine-specific gene, plays an important role in the mineralization of dentin, but there is still controversy as to whether it is a factor that regulates or induces the differentiation of dendritic cells.

Dentin phosphate protein (DPP) refers to the carboxy terminal portion where the dentin sialophosphate protein (DSPP) is cleaved. In relation to dental tissues, DPP promotes differentiation into mesenchymal cells when treated with mesenchymal or osteogenic precursor cells (Jadlowiec J et al., J Biol Chem 2004 Dec 17; 279 (51): 53323 -30), and it is known to function in the migration and dentin formation of human dendritic cells (Yasuda Y et al., J Endod. 2008 May; 34 (5): 575-8). However, studies on the dental tissue regeneration of DPP compared to DSPP have not yet been conducted.

Under these circumstances, the inventors of the present invention found that DPP facilitates the attachment, proliferation and differentiation of the dendritic cells by producing and separating DPP which is easy to produce, isolate and purify by using a recombinant expression vector because amino acid sequence is shorter than DSPP Thereby completing the present invention.

One object of the present invention is to provide a composition for promoting adhesion or proliferation of dental pulp cells comprising dentin phosphoprotein as an active ingredient.

It is another object of the present invention to provide a method for inducing attachment or proliferation of a dendritic cell, comprising the step of treating the dendritic phosphate protein to the dendritic cell.

In order to accomplish the above object, the present invention provides a composition for promoting adherence or proliferation of dental pulp cells comprising dentin phosphoprotein as an active ingredient.

The term "dentin" of the present invention is a calcified tissue containing collagen as a source of external mesenchyme, and is a white hard tissue constituting most of teeth. It is also referred to as hemorrhoids. Enamel in the crown, and cement in the root are not exposed on the surface of the tooth. However, as the age increases, the enamel is worn out and the dentin is exposed on the tip or occlusal surface of the crown. Dentin is a kind of bone tissue, but unlike normal bone, the body of the dentin-forming cell is in the dimension and only the protrusion extends into the dentin.

The term "dentin phosphoprotein" of the present invention is a protein found in dental tissues, which means a fragment containing a carboxyl terminal portion when dentin sialophosphoprotein is cleaved, Is referred to as dentin sialoprotein.

In the present invention, the dentin phosphate protein is not limited to the origin, but is preferably a human dentin phosphate protein, more preferably a dentin phosphate protein having the amino acid sequence of SEQ ID NO: 3.

The term "dental pulp" of the present invention is a soft connective tissue that fills the teeth in the teeth, and the nerve and blood vessels are abundantly distributed. The nerve of the dimension is formed in the outermost layer of the dentate by the dental plaque in the dentine beneath the dentine inner surface of the tooth, and the branch reaches the surface layer of the dentin. The "dental pulp cells" of the present invention having the above-mentioned dimensions are differentiated into odontoblasts which form dentin through differentiation to form dentin. But is not limited to its origin, but preferably it may be a human dimensional cell.

The term " odontoblast "of the present invention is present on the surface of the healing wool which is in contact with the enamel cells of the dentin, and the dentin is made by the iota bloom. In the present invention, the iv cells may include not only iv cells but also odontoblast-like cells. The above-mentioned pseudo-iotaeoblast is originally a cell induced to differentiate into an io-acrobat in a stem cell, a progenitor cell, or the like, and refers to a cell having a characteristic similar to that of an i-oocyte.

The term "adherence" of the present invention refers to attachment of cells, including adhesion of cells to each other as well as attachment of cells to the substrate. In order to confirm the influence of the dentin phosphate protein on the cell adhesion ability, the dentin phosphate protein-coated plate was cultured on a plate, and then the degree of adhesion was measured by a crystal violet test assay, and it was confirmed that the dentin phosphate protein promotes the adhesion of the dendritic cells (Example 4). When the adhesion ability is improved, the cells are well adhered to the site and can be easily and uniformly attached to the substrate in a desired shape.

The compositions of the present invention may be used to attach dimensional cells to a particular substrate or site, and may be pre-coated on a particular substrate or site or treated with a dendritic cell.

The term "proliferation" of the present invention means that the number increases as the cells divide while maintaining the same property or differentiation. In the present invention, the proliferation may preferably be the proliferation of dental pulp cells, and more preferably the proliferation of human dental pulp cells (hDPC). In one embodiment of the present invention, the dentin phosphate protein was treated on the dendritic cells to confirm the effect of the dentin phosphate protein on the proliferation of the dendritic cells (Example 5 and Fig. 3). It was confirmed that the proliferation of the dendritic cells was promoted when the dentin phosphate protein was treated.

Accordingly, the composition of the present invention can be used to promote the proliferation of dendritic cells, and thus a large amount of dendritic cells of the same quality can be obtained.

In one embodiment of the present invention, dentin phosphate protein was treated with dentin phosphate protein to measure the activity of alkaline phosphatase (ALP) and Alizarin Red S staining The mineralization level was measured.

First, when ALP activity was observed, there was no difference between the control group treated with rhDPP and the control group treated with rhDPP at day 0, but there was no difference between rhPDP treated group and control group. And an increase in ALP activity of about 6-fold was observed (Fig. 4).

In addition, as the dendritic cells are differentiated into the ibuprocyte, calcium is deposited. Alizarin Red S reagent is a reagent for staining calcium, and the degree of differentiation into iv was detected through the degree of staining with the reagent. When the dentin phosphate protein was treated, no staining was observed on day 0, but the degree of staining was significantly increased on days 7 and 14 (Example 6 and FIG. 5).

In one embodiment of the present invention, the level of expression of Col1 (collagenase 1), ALP (alkaline phosphatase specific activity) and DMP-1 (domain matrix protein-1) The reverse transcription PCR and the cDNA obtained therefrom were determined by quantitative real time PCR (Examples 7, 8 and 6). It was confirmed that DMP-1 did not show any difference when treated with dentin phosphate protein, but Col1 and ALP expression was significantly increased.

That is, the dentin phosphate protein of the present invention can promote the adhesion, proliferation, or differentiation of dendritic cells into iv cells.

The dentin phosphate protein of the present invention may be a recombinant protein. Dentin sialophosphoprotein (DSPP), a protein previously known to be associated with dentin differentiation, was large in size and difficult to express, isolate and purify. In the present invention, DNA of dentin phosphate protein, which has the function of promoting the attachment of the dimensional cell, proliferation and differentiation to the oocyte and which has a short sequence and is easy to be separated and purified and has an increased yield, is extracted and introduced into an expression vector. And the recombinant protein can be produced by transfecting the host cell with the expression vector.

The composition may be used to promote adhesion or proliferation of dendritic cells in vitro or may be used to promote attachment or proliferation of dendritic cells in vivo.

In another aspect, the present invention provides a method for inducing attachment or proliferation of a dendritic cell, comprising the step of treating the dentin phosphate protein to a dendritic cell.

The "treatment of dentin phosphate protein with a dendritic cell" of the present invention includes, without limitation, direct and indirect methods, in vitro and in vivo methods and the like. For example, there may be an in vitro treatment method for treatment of isolated dendritic cells in vitro, and an in vivo treatment method such as direct injection or application to a dental tissue in vivo. In one embodiment of the present invention, the dentin phosphate protein was treated on the separated dendritic cells in vitro, and it was confirmed that the dentin phosphate protein promoted adherence, proliferation and differentiation of the dendritic cells.

The dentin phosphate protein to be treated in the present invention may be prepared by expressing recombinant human dentin phosphate protein in a host cell transfected with an expression vector comprising the amino acid sequence of SEQ ID NO:

The term "expression vector" of the present invention means a DNA or RNA vector capable of transforming a host cell and expressing a specific polynucleotide. Preferably, the expression vector is replicable in a host cell. The expression vector can be a prokaryotic or eukaryotic cell, and typically can be a virus or a plasmid. The expression vector of the present invention can be used to transform a host cell of the present invention, for example, a gene that functions in cells including bacteria, fungal, endoparasite, arthropod, animal and plant cells Lt; / RTI > vector). The vectors of the present invention may also be used to produce polypeptides in cell-free expression systems known in the art. In the present invention, the expression vector may preferably be a pBAD / His-A vector having the cleavage map shown in Fig.

The term "host cell" of the present invention means a cell that can be transformed with an exogenous polypeptide of the present invention, and may also include a transformed recombinant cell. Refers to a cell containing transcription factors, translation factors or post translational factors such that the introduced expression vector can be properly expressed. Host cells include all cells that can be transformed with an expression vector of the invention. The host cell of the present invention can endogenously produce the protein of the present invention or can produce the protein after transformation with the expression vector of the present invention. The host cell of the present invention may be any cell capable of producing the protein of the present invention and includes bacteria, fungi (including yeast), parasites, nematodes, arthropods, animal and plant cells. As examples of the host cell, Salmonella (Salmonella), E. coli (Escherichia), Bacillus (Bacillus), Listeria monocytogenes (Listeria), saccharose in my process (Saccharomyces), sports help TB (Spodoptera), mycobacteria (Mycobacteria), tricot flu cyano ( trichoplusia ), BHK (baby hamster kidney) cells, MDCK cells, CRFK cells, CV-1 cells, COS (e.g., COS-7) cells, and Vero cells. Also, examples of host cells include E. coli including E. coli K12 derivatives; Salmonella (salmonella typhi ); Salmonella typhimurium containing attenuated strains ( salmonella typhimurium ); Sports programs help Terra rugi bereuda (spodoptera frugiperda ); Trichoplusiani ; And non-tumorigenic mouse myoblast G8 cells (e. G., ATCC CRL 1246). In the present invention, the host cell may preferably be a TOP10 cell, which is one kind of E. coli. "Recombinant cells " into which the exogenous polypeptide has been introduced into the host cell include their immediate progeny cells or indirect progeny cells comprising the introduced polynucleotide.

In the present invention, transformation of an exogenous polynucleotide such as the expression vector into a host cell can be carried out by any method capable of inserting a polynucleotide into a cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption and fusion of protoplasts. The transformed polynucleotides of the present invention may remain outside the chromosome, or may be inserted at one or more positions in the chromosome of the transformed cell in such a manner that their ability to be expressed is maintained.

The term "recombinant" as used herein refers to an act of performing an artificial manipulation such as insertion, substitution, or deletion of a specific natural or mutated gene. In the present invention, "recombinant human dentin phosphate protein" Refers to a protein product produced by expressing an expression vector prepared by inserting an expression vector into a host cell.

In one embodiment of the present invention, in order to prepare an expression plasmid expressing recombinant human dentin phosphoprotein (rhDPP), a gene expressing human dentin phosphate protein is amplified by PCR (polymerase chain reaction) . The amplified PCR product thus obtained was subjected to restriction enzyme treatment and introduced into a pBAD-HisA vector to finally prepare a pBAD-HisA-DPP recombinant vector.

In the present invention, the term "dental cell" includes an animal-derived dental cell without limitation, and may include mammalian cells, algae-derived cells, amphibian-derived cells, fish-derived cells and the like. Preferably mammalian-derived dendritic cells, and more preferably human dendritic cells. Dimensional cells are as described above.

By using the recombinant human dentin phosphate protein capable of mass production using the expression vector of the present invention, it is possible to promote the proliferation of the dendritic cells, increase the cell adhesion capacity, and promote the differentiation into the dendritic cells from the dendritic cells Respectively. Therefore, the recombinant human dentin phosphate protein of the present invention is widely used for promoting the proliferation and adhesion of dendritic cells in the fields of tissue engineering materials, dental bone regeneration therapeutic agents and medicament therapeutic agents related to recovery and regeneration of teeth and bone tissues It will be possible.

1 shows the pBAD-HisA-DPP expression vector on the left side, and rhDPP obtained through affinity purification using Ni-NTA resin on the right side through coomassie blue staining.
FIG. 2 is a graph showing the effect of rhDPP treatment on cell adhesion activity of hDPC by a crystal violet assay.
FIG. 3 is a graph showing the effect of rhDPP treatment on hDPC cell proliferation by MTT assay.
FIG. 4 is a graph showing the measurement of ALP activity in order to evaluate the promoting effect of rhDPP on the differentiation of iv cells.
Fig. 5 is a diagram showing Alizarin Red S staining for measuring the degree of mineralization in order to evaluate the stimulation effect of rhDPP on the promotion of the differentiation of iv cells.
FIG. 6 shows quantitative real-time PCR of the levels of mRNA expression of Col1, ALP and DMP-1, which are the mineralization markers for iv-cell differentiation, in order to measure the effect of rhDPP on the differentiation of hDPC into iv- The results are shown in Fig.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are intended to illustrate the present invention, but the scope of the present invention is not limited thereto.

Example  1: Recombinant dentin Phosphate protein ( rhDPP ) Production of expression plasmids

To construct an expression plasmid expressing recombinant human dentin phosphoprotein (rhDPP), a gene expressing human dentin phosphate protein was amplified by polymerase chain reaction (PCR). The PCR reaction was 50 mM KCl, 10 mM Tris- Cl (pH 8.3), 1.5 mM MgCl 2, 0.2 mM dNTPs, Taq polymerase 1.25 U (ELPis, Daejon, Korea), and 50 pmol to the forward primer (SEQ ID NO: 1 ) And a reverse primer (SEQ ID NO: 2).

hDPP forward primer (SEQ ID NO: 1): 5'-TCTCGAGGATGATCCCAATAGC-3 '

hDPP reverse primer (SEQ ID NO: 2): 5'-TGGTACCATTAGTCTGATGTGCTATC-3 '

As a PCR condition, the cycle consisting of annealing at 55 DEG C for 1 minute, elongation at 72 DEG C for 1 minute, and denaturation at 94 DEG C for 1 minute was repeated 30 times. The amplified PCR products obtained above were treated with restriction enzymes Xho I and Kpn I. After restriction enzyme treatment, the PCR product was ligated to the pBAD-HisA vector to prepare a pBAD-HisA-DPP recombinant vector (FIG. 1A).

Example  2: Recombinant dentin Phosphate protein ( rhDPP Production and refining

TOP10 cells transfected with the pBAD-HisA-DPP recombinant vector prepared in Example 1 were grown in LB (Luria broth) -Amp medium overnight at 37 ° C. When the concentration of the medium (A ₆₀₀ ) reached 0.6, 0.1% (w / v) L-arabinose was added to induce DPP expression. After incubation at 20 ° C for 6 hours, the cells were allowed to settle through a centrifuge, lysed and sonicated. The pulverized product was refrigerated (at 4 캜) for 30 minutes at 14,000 g, and the supernatant was transferred to a new tube.

Crude protein obtained from the sonicate-pulverized bacterial supernatant was collected on a nickel-nitrilotriacetic acid resin column (Invitrogen, Carlsbad, Calif., USA) coupled with a hexahistidine tag present at the amino terminus of the protein ) According to the protocol of the manufacturer.

The crude protein and the purified protein were separated using 15% SDS-PAGE (SDS-discontinuous polyacrylamide gel electrophoresis). The purity of the purified protein was confirmed by coomassie brilliant blue staining (Fig. 1).

As can be seen in FIG. 1, rhDPP was obtained at relatively high purity through affinity purification using Ni-NTA resin. Upon induction with L-arabinose, E. coli TOP10 produced a protein with a molecular weight of 12 kDa, corresponding to the expected molecular weight of the fusion protein consisting of amino terminal histidine and rhDPP (Fig. 1B) .

Example  3: human dendritic cells ( hDPC )

Human dendritic cells (hDPC) were obtained from dental and craniofacial clinics of the Dankook University College of Dankook University under the written consent of adult patients aged 19-25 years from which third molars were collected. Specifically, the dental tissues were separated and pulverized from the crown and root and treated with a solution containing 3 mg / ml of type I collagenase and 4 mg / ml of dispase for one hour at 37 ° C. The treated solution was passed through a 70 mu m filter to obtain a single cell suspension.

hDPCs were incubated with 10 μl of heat-inactivated fetal bovine serum (FBS; WELGENE, Daegu, Korea), penicillin G sodium 100 U / ml, streptomycin sulfate 10 μg / ml, and amphotericin B, (A-MEM, WELGENE, Daegu, Korea) containing 25 μg / ml of the culture medium (WELGENE, Daegu, Korea) at 37 ° C in 5% CO ₂ . The cultured cells were treated with 0.25% trypsin-EDTA (WELGENE, Daegu, Korea) for 5 minutes and subcultured. For cell proliferation and differentiation experiments, hDPCs cultured 3-4 passages were used.

Example  4: Dimension cell adhesion experiment

First, a 24-well plate was coated with rhDPP obtained in Example 2 at 4 占 폚 overnight. The rhDPP-coated 24-well plate was blocked with PBS (phosphate-buffered saline) containing 1% (w / v) BSA (bovine serum albumin) for 30 minutes and hDPC was added at a concentration of 5 × 10 ⁴ cells / Inoculated and washed with PBS. After incubation at 37 ° C for 50 minutes, the plates were washed twice with PBS and the adherent cells were fixed with 3% paraformaldehyde (Sigma, St. Louis, MO, USA) / v) 5% (w / v) crystal violet solution in ethanol / water. After washing with distilled water, the plate was dried. The degree of staining was measured by A ₅₇₀ using a microplate reader (BioRad Laboratories, CA, USA), and the case of coating with 1% BSA was used as a control.

As a result, as shown in FIG. 2, the cell adhesion activity of hDPC significantly increased in a concentration-dependent manner when treated with rhDPP (p <0.05) as compared with the control (control). When rhDPP was treated, the cell adhesion activity of hDPC increased dramatically more than 3 times at all concentrations compared to the control. These results show that rhDPP functions to promote the adhesion activity of hDPC. Based on these results, further experiments were carried out with 5 μg / ml of rhDPP.

Example  5: Dimensional cell proliferation experiment

Dimensional cell proliferative activity was measured by MTT (3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide, a yellow tetrazole, AMRESCO Inc., Solon, OH, USA) To measure the number of living cells. Human dendritic cells (hDPC) were cultured in 24-well plates at a concentration of 1 × 10 ³ cells / well for 5 days or 10 days. Then, 500 μl of MTT solution (5 mg / ml, PBS) was added to each well and allowed to stand for 4 hours. Then, the medium was removed, and the resulting aazan crystal was dissolved in 200 μl of DMSO. The absorbance of each well at a wavelength of 540 nm was determined using a microplate reader.

rhDPP treatment significantly promoted hDPC proliferation compared to the control group (Fig. 3). As can be seen in Fig. 3, rhDPP increased the cell proliferative activity of hDPC on days 5 and 10 (p < 0.001).

Example  6: Dimension cell differentiation experiment

In order to evaluate the stimulation effect of rhDPP on the differentiation of iv cells, ALP activity, which is characteristic of iv cells, was measured and an Alizarin Red S staining experiment was conducted to measure the mineralization activity. First, hDPC was cultured at a concentration of 1 × 10 ³ cells / well on days 0, 7, and 14 in a differentiation induction medium with or without rhDPP. The differentiation induction medium contained 100 μmol / l / ml ascorbic acid, 2 mmol / l b-glycerophosphate, and 10 nmol / l dexamethasone.

The hDPC was then washed with PBS and incubated with 4'C, 1 mM MgCl2, and 1% TritonX-100 in lysis buffer containing 1.5 M Tris-HCl (pH 10.2), 1 mM ZnCl2, And dissolved for 10 minutes. After centrifugation, the ALP activity of the cell lysate was measured using an alkaline phosphate assay kit (Sigma, St. Louis, Mo., USA). Absorbance was measured at 405 nm. ALP activity was normalized relative to the control group.

To confirm the mineralization activity, the hDPC is washed with PBS and fixed in 95% methanol for 30 minutes. Next, cells were stained overnight with Alizarin Red S solution, washed three times with PBS, and incubated for 15 minutes to remove non-specific staining. On the 0th, 7th and 14th day, the stained aspect was confirmed by photographs.

ALP activity was not significantly different between the control and rhDPP treated groups at day 0, but the activity of rhDPP was 2.3 times higher at day 7 than at day 6 and about 6 times higher at day 14 ALP activity (Fig. 4).

As a result of the mineralization of rhDPP treated group in hDPC, no cells stained with Alizarin Red S were observed on day 0, and stained cells were observed on day 7 and 14. In particular, almost all of the cells were stained at day 14 (FIG. 5). These results are consistent with ALP activity results.

Example  7: Dimensional cells RNA  Extraction and cDNA  synthesis

Total RNA was extracted using Easy-spin RNA Extraction kit (iNtRON, Seoul, Korea) according to the manufacturer's instructions. The purity of the RNA was assessed by measuring the absorbance at 260 nm and 280 nm, and was considered acceptable when the A ₂₆₀ / A ₂₈₀ ratio was between 1.9 and 2.1. In addition, 18S RNA and 28S RNA were confirmed by ETB (ethidium bromide) staining by gel electrophoresis. RNA concentration was measured via A ₂₆₀ . 2 μg of total RNA was mixed with 50 μl of Super-Script II reverse transcriptase (Invitrogen, Carlsbad, CA, USA), 5 μM DTT, 40 U RNaseOUT recombinant ribonuclease inhibitor, 0.5 μmol random hexanucleotide Primer and 500 mu mol of dNTP mixture. The reverse transcription reaction was carried out at 50 DEG C for 60 minutes. Thereafter, the reaction solution was heated at 70 캜 for 15 minutes to terminate the reaction, and the resulting cDNA was stored at -20 캜.

Example  8: Quantitative real time PCR ( quantitative real - time PCR ) analysis

To determine the effect of rhDPP on the differentiation of hDPC into iv-cells, mRNA levels of Col1, ALP and DMP-1, the mineralization markers for the differentiation of iv cells, were measured. The expression of the gene was confirmed by quantitative real-time PCR using the cDNA obtained in Example 7 as a template. All real-time PCRs were performed in the ABI Step One real-time PCR system. Each reaction consisted of 0.1 μl of forward and reverse primers, 13.5 μl of 2-SYBR Green PCR master mix (Applied Biosystem, AmpliTaq Gold DNA polymerase and buffer, dNTPs mixture, SYBR Green I dye, Rox dye, and 10 mM MgCl ₂ ) , And 1.5 [mu] l of template cDNA. A typical amplification program was used to activate the enzyme at 94 ° C for 10 min followed by denaturation at 94 ° C for 15 sec and annealing and elongation at 60 ° C for 1 min. . The C _T (cycle threshold) value for each gene was determined by the automatic limit analysis function of the ABI device, and the dC _T value was normalized by comparing with C _T (GAPDH). The difference in the number of n between the C _T or the dC _T value means that there is a difference of 2 ⁿ times between the cDNA samples having the target sequence. Primers used in quantitative real-time PCR are listed in Table 1 below.

Primers used in quantitative real-time PCR Gene The forward primer (5'-3 ') The reverse primer (5'-3 ') GAPDH TGGAAGGACTCATGACCACA
(SEQ ID NO: 4) TTCAGCTCAGGGATGACCTT
(SEQ ID NO: 5) Col1 GAAAATGGAGCTCCTGGTCA
(SEQ ID NO: 6) ACCCTTAGCACCAACAGCAC
(SEQ ID NO: 7) ALP CCAAAGGCTTCTTCTTGCTG
(SEQ ID NO: 8) CCACCAAATGTGAAGACGTG
(SEQ ID NO: 9) DMP-1 CCCAGTGACAGCACTCAGTC
(SEQ ID NO: 10) CTCCTTTTCCTGTGCTCCTG
(SEQ ID NO: 11)

The mRNA expression of DMP-1 mRNA was not significantly different when treated with rhDPP, but the mRNA expression of Col1 and ALP was not significantly increased in the control group treated with rhDPP Respectively. In particular, the expression of ALP increased 1.6-fold (Fig. 6). These results, together with the above results, suggest that rhDPP plays a role in the iodoblast differentiation of hDPC.

Example  9: Statistical analysis

Data were expressed as mean ± SD. Statistical analysis was performed through the SAS program. Differences between the two groups were tested by Student t-test. All statistical analyzes showed a p value of less than 0.05.

The above results support that rhDPP plays an important role in the differentiation of hDPC into oocytes and promotes the proliferation and adherence of dendritic cells and thus can be used for the regeneration of teeth.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> Composition for adhesion or proliferation of dental pulp cells comprising recombinant dentin phosphoprotein <130> PA120995 / KR <160> 11 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> hDPP primer F <400> 1 tctcgaggat gatcccaata gc 22 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> hDPP primer R <400> 2 tggtaccatt agtctgatgt gctatc 26 <210> 3 <211> 58 <212> PRT <213> human DPP <400> 3 Asp Asp Pro Asn Ser Ser Asp Glu Ser Asn Gly Asn Asp Asp Ala Asn   1 5 10 15 Ser Glu Ser Asp Asn Asn Ser Ser Ser Arg Gly Asp Ala Ser Tyr Asn              20 25 30 Ser Asp Glu Ser Lys Asp Asn Gly Asn Gly Ser Asp Ser Lys Gly Ala          35 40 45 Glu Asp Asp Asp Ser Asp Ser Thr Ser Asp      50 55 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH primer F <400> 4 tggaaggact catgaccaca 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH primer R <400> 5 ttcagctcag ggatgacctt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Col1 primer F <400> 6 gaaaatggag ctcctggtca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Col1 primer R <400> 7 acccttagca ccaacagcac 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ALP primer F <400> 8 ccaaaggctt cttcttgctg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ALP primer R <400> 9 ccaccaaatg tgaagacgtg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DMP-1 primer F <400> 10 cccagtgaca gcactcagtc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DMP-1 primer R <400> 11 ctccttttcc tgtgctcctg 20

Claims (7)

A composition for promoting adherence or proliferation of dental pulp cells comprising dentin phosphoprotein as an active ingredient.
The composition of claim 1, wherein the dentin phosphate protein is human.
2. The composition of claim 1, wherein the dentin phosphate protein is comprised of the amino acid sequence of SEQ ID NO: 3.
A method of inducing attachment or proliferation of a dendritic cell, comprising the step of treating the dentin phosphate protein to the dendritic cell.
The dentin phosphate protein of claim 4, wherein the dentin phosphate protein is prepared by expressing recombinant human dentin phosphate protein in a host cell transfected with an expression vector comprising a base sequence encoding the amino acid sequence of SEQ ID NO: 3 Way.
6. The method according to claim 5, wherein the expression vector is a pBAD / His-A vector having the cleavage map shown in Fig.
5. The method of claim 4, wherein the dendritic cells are human dendritic cells.

Images