KR20140094765A - Composition for diagnosis of radio-resistance or radio-sensitive MRFAP1 marker and use thereof - Google Patents

Composition for diagnosis of radio-resistance or radio-sensitive MRFAP1 marker and use thereof Download PDF

Info

Publication number
KR20140094765A
KR20140094765A KR1020130007149A KR20130007149A KR20140094765A KR 20140094765 A KR20140094765 A KR 20140094765A KR 1020130007149 A KR1020130007149 A KR 1020130007149A KR 20130007149 A KR20130007149 A KR 20130007149A KR 20140094765 A KR20140094765 A KR 20140094765A
Authority
KR
South Korea
Prior art keywords
radiation
cancer
inpp4b
gene
protein
Prior art date
Application number
KR1020130007149A
Other languages
Korean (ko)
Other versions
KR101432172B1 (en
Inventor
황상구
김재성
엄홍덕
박종국
Original Assignee
한국원자력의학원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국원자력의학원 filed Critical 한국원자력의학원
Priority to KR1020130007149A priority Critical patent/KR101432172B1/en
Publication of KR20140094765A publication Critical patent/KR20140094765A/en
Application granted granted Critical
Publication of KR101432172B1 publication Critical patent/KR101432172B1/en

Links

Images

Classifications

    • BPERFORMING OPERATIONS; TRANSPORTING
    • B42BOOKBINDING; ALBUMS; FILES; SPECIAL PRINTED MATTER
    • B42DBOOKS; BOOK COVERS; LOOSE LEAVES; PRINTED MATTER CHARACTERISED BY IDENTIFICATION OR SECURITY FEATURES; PRINTED MATTER OF SPECIAL FORMAT OR STYLE NOT OTHERWISE PROVIDED FOR; DEVICES FOR USE THEREWITH AND NOT OTHERWISE PROVIDED FOR; MOVABLE-STRIP WRITING OR READING APPARATUS
    • B42D1/00Books or other bound products
    • B42D1/003Books or other bound products characterised by shape or material of the sheets
    • B42D1/007Sheets or sheet blocks combined with other articles
    • AHUMAN NECESSITIES
    • A63SPORTS; GAMES; AMUSEMENTS
    • A63HTOYS, e.g. TOPS, DOLLS, HOOPS OR BUILDING BLOCKS
    • A63H33/00Other toys
    • A63H33/38Picture books with additional toy effects, e.g. pop-up or slide displays
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B42BOOKBINDING; ALBUMS; FILES; SPECIAL PRINTED MATTER
    • B42DBOOKS; BOOK COVERS; LOOSE LEAVES; PRINTED MATTER CHARACTERISED BY IDENTIFICATION OR SECURITY FEATURES; PRINTED MATTER OF SPECIAL FORMAT OR STYLE NOT OTHERWISE PROVIDED FOR; DEVICES FOR USE THEREWITH AND NOT OTHERWISE PROVIDED FOR; MOVABLE-STRIP WRITING OR READING APPARATUS
    • B42D15/00Printed matter of special format or style not otherwise provided for
    • B42D15/0073Printed matter of special format or style not otherwise provided for characterised by shape or material of the sheets
    • B42D15/0086Sheets combined with other articles
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B42BOOKBINDING; ALBUMS; FILES; SPECIAL PRINTED MATTER
    • B42DBOOKS; BOOK COVERS; LOOSE LEAVES; PRINTED MATTER CHARACTERISED BY IDENTIFICATION OR SECURITY FEATURES; PRINTED MATTER OF SPECIAL FORMAT OR STYLE NOT OTHERWISE PROVIDED FOR; DEVICES FOR USE THEREWITH AND NOT OTHERWISE PROVIDED FOR; MOVABLE-STRIP WRITING OR READING APPARATUS
    • B42D3/00Book covers
    • B42D3/12Book covers combined with other articles

Abstract

The present invention relates to: a composition, for diagnosing radiation resistance or sensitivity, which selects a marker for diagnosing the radiation resistance or sensitivity of a cancer and includes a substance which measures the existence of the marker; a kit, for diagnosing radiation resistance or sensitivity, which includes the composition; and a method for diagnosing radiation resistance or sensitivity or predicting the radiation treatment of a cancer patient by using the same. The present invention provides a customized radiation treatment by judging the radiation resistance or sensitivity of a cancer cell which is a radiation treatment object by using the composition for diagnosing radiation resistance or sensitivity of the present invention; and is able to increase a treatment effect and reduce a side effect for a cancer patient through the diversity of the radiation treatment object. The present invention can be used to judge the prognosis of a radiation treatment patient (is able to predict a treatment effect).

Description

MRFAP1을 측정하는 제제를 포함하는 방사선 저항성 또는 민감성 진단용 조성물 및 이의 용도 {Composition for diagnosis of radio-resistance or radio-sensitive MRFAP1 marker and use thereof}A radiation-sensitive or sensitive diagnostic composition comprising an agent that measures MRFAP1 and uses thereof for the diagnosis and /

본 발명은 암의 방사선 저항성 또는 민감성 진단용 마커를 선별하고, 상기 마커의 존재를 측정하는 제제를 포함하는 방사선 저항성 또는 민감성 진단용 조성물, 상기 조성물을 포함하는 방사선 저항성 또는 민감성 진단용 키트 및 이를 이용하여 방사선 저항성 또는 민감성을 진단 또는 암 환자의 방사선 치료 예측방법에 관한 것이다.
The present invention relates to a radiation-sensitive or sensitive diagnostic composition comprising an agent for screening a marker for radiation resistance or sensitivity of a cancer and measuring the presence of the marker, a radiation-sensitive or sensitive diagnostic kit comprising the composition, Or susceptibility to radiation or radiation therapy in cancer patients.

암은 현재 전세계적으로 현대인의 건강 및 죽음을 결정하는 가장 큰 요인으로 대두되고 있다. 통계적으로 암 환자의 약 30-50%는 치료시기 중 한 시점에 방사선 치료를 받는다. 그러나, 방사선 치료의 유효성은 암의 성질, 환자 및 방사선이 기타 치료와 조합되는 것에 따라 다양하다. 일반적으로 방사선 치료가 널리 시행되고 있는 암으로는 두경부암, 후두암, 자궁경부암, 인두암, 폐암, 뇌암, 유방암, 대장암 등이 있다. 이들 암종이 방사선 치료의 주요 대상이 될지라도 방사선 치료시 반응이 좋지 않은 경우가 빈번하므로 치료 효율을 높이는 전략이 필요하다. 이와 더불어 방사선 치료가 잘 되어 초기반응은 좋을지라도 재발하는 경우가 빈번하여 재발 암에 대한 대책을 세우는 것도 방사선 치료의 효율을 높이는데 중요하다. 암세포에 대한 방사선 치료의 감수성의 차이가 존재하지만 방사선 치료 전에 개인별로 방사선에 대한 감수성을 예측할 수 있는 기술을 개발하면, 개인별로 방사선 처리량을 조절하여 암을 치료함으로써, 개인에게 가장 적합한 방사선 치료를 제공할 수 있다. Cancer is now the biggest factor in determining the health and death of modern people worldwide. Statistically, about 30-50% of cancer patients receive radiation therapy at one point in time. However, the effectiveness of radiation therapy varies with the nature of the cancer, the patient, and radiation as it is combined with other therapies. Cancers in which radiation therapy is widely practiced include head and neck cancer, laryngeal cancer, cervical cancer, parietal cancer, lung cancer, brain cancer, breast cancer, and colon cancer. Although these carcinomas may be the main targets of radiation therapy, strategies that improve treatment efficiency are needed because of poor response to radiation therapy. In addition, although the initial response is good due to good radiation therapy, recurrence frequently occurs, and it is important to take measures against recurrent cancer to improve the efficiency of radiation therapy. There is a difference in the sensitivity of radiation therapy to cancer cells. However, by developing a technique that can predict radiation susceptibility to individuals before radiation therapy, it is possible to treat the cancer by controlling individual radiation dose, can do.

이에, 방사선 치료 전에 암세포의 방사선에 대한 감수성을 알아보기 위해, 암세포를 분리하여 방사선을 조사한 후, 암세포의 사멸 정도를 정확하고 신속하게 분석하는 방법이 필요하다. 가장 직접적이고 이상적인 방법은 세포에 트립판 블루(trypan blue) 등을 처리한 후 현미경과 세포수 측정기를 이용하여 살아있는 세포를 세는 것이지만 시간과 너무 많은 노력이 요구되며, 검체 수가 많을 경우에는 사용할 수가 없는 문제점이 있다. 조직학적 소견이나 병기가 같은 암 환자의 경우에도 방사선 감수성은 매우 다르며, 이에 영향을 주는 많은 인자들이 있는 것으로 알려져 있다. 종양이 방사선 저항성을 가지게 되는 이유 중 가장 큰 요인으로 종양 세포의 내적인 방사선 감수성이다. 암세포가 방사선에 조사되면 복잡한 분자생물학적 변화에 의해 사망하거나 회복이 되는데 이러한 과정의 신호전달에 관여된 유전자와 단백질의 기능을 조절하는 기전들이 밝혀졌으며 근래에 와서 이러한 모든 것이 방사선 치료의 효과를 증진시킬 수 있는 표적이 될 수 있는 것으로 알려졌다. 지금까지 방사선 저항성에 대한 연구들이 진행되어 이 중 일부는 방사선 저항성을 극복하기 위한 방사선 민감제의 개발에 기초가 되고 있다. 그러나 종양의 선천적인 또는 후천적인 방사선 저항성은 방사선치료 효과를 제한하는 일부의 세포가 생존하도록 한다. 이러한 현상은 방사선 치료 후 후두암 환자의 좋지 않은 예후를 나타낸다. 일부 연구들은 방사선치료에 대한 진단 및 치료지표로 사용할 수 있는 종양 방사선저항성 마커를 발표하였다. 암세포는 종종 만성 방사선 손상으로부터 보호하기 위한 한 방법으로 세포구성요소를 바꾼다. 예를들어 EGFR(epidermal growth factor receptor), PI3K(phosphoinositide 3-kinase/Akt 및 RAS와 같은 증식 조절 단백질들은 방사선저항성 종양에서 활성화되거나, 과발현된다. p53 또는 Bcl-2/-xl의 상태/발현은 세포주기 및 세포사멸에 중요한 역할을 하며, 종양 방사선저항성과 관련이 있으며 peroxiredoxin-II 및 Mn-SOD(manganese superoxide dismutase)와 같은 세포 항산화 단백질은 자주 암세포의 산화 스트레스 내성에 관여한다. 게다가, 여러 연구자들은 방사선 치료가 P-당단백질 및 다중약물내성과 관련된 단백질을 조절함으로서 후천적 방사선 내성 및 항암제 약물 내성을 일으킬 수 있다고 보고하고 있다. 비록, 이러한 연구결과들이 암세포의 방사선 내성 및 항암제 약물내성에 대하여 일부 이해시킬 수 있을지라도, 이러한 현상을 기반으로 하는 특정 암 종류 및 자세한 분자기작의 바이오 마커는 거의 없다. 현재까지 밝혀진 방사선 저항성과 관련된 인자들로는 시클로옥시게나아제-2(Terakado N, Shintani S, Yano J, Chunnan L,Mihara M, Nakashiro K, et al., Oral Oncol 2004; 40:383-9), 상피세포 성장 인자 수용체(EGFR)(Milas L, FanZ, Andratschke NH, Ang KK., Int J Radiat Oncol Biol Phys 2004; 58(3); 966-71), 시클린 D1(Milas L, Akimoto T, Hunter NR, Mason KA, Buchmiller L, Yamakawa M, et al., Int J Radiat Oncol Biol Phys 2002;52; 514-21), 인슐린-유사 성장인자 1 수용체(IGFBP-1 receptor), 망간 수퍼옥시드 디스뮤타아제, 수르비빈(survivin) 등이 있으나 아직까지는 부분적으로 기전이 밝혀져 있으며 방사선 치료 결과의 유용한 예측 인자로 활용되고 방사선 민감도를 증가시킬 수 있는 마커는 미비한 실정이다.Therefore, in order to examine the sensitivity of cancer cells to radiation before radiation therapy, a method of accurately and rapidly analyzing the degree of death of cancer cells after irradiation with radiation is necessary. The most direct and ideal method is to treat cells with trypan blue and then count the living cells using a microscope and a cell counting device. However, it takes too much time and effort, and can not be used when the number of samples is large There is a problem. Radiotherapy is very different in cancer patients with histologic findings or stage, and it is known that there are many factors influencing the radiation sensitivity. The most important reason for the tumor to have radiation resistance is the intrinsic radiosensitivity of tumor cells. When cancer cells are exposed to radiation, complex molecular biologic changes lead to death or recovery. Mechanisms that regulate the function of genes and proteins involved in signal transduction in these processes have been identified, and all of these have recently been shown to enhance the effectiveness of radiation therapy It could be a target to be known. Studies on radiation resistance have been carried out so far and some of them are based on the development of radiation sensitizers to overcome radiation resistance. However, the inherent or acquired radiation resistance of the tumor allows some cells to survive, limiting the effect of radiation therapy. This phenomenon represents a poor prognosis for laryngeal cancer patients after radiation therapy. Some studies have published tumor radiation resistance markers that can be used as diagnostic and therapeutic indications for radiation therapy. Cancer cells often change cellular components as a way to protect against chronic radiation damage. For example, growth regulatory proteins such as epidermal growth factor receptor (EGFR), phosphoinositide 3-kinase / Akt and RAS are activated or overexpressed in radiation-resistant tumors. The status / expression of p53 or Bcl-2 / -xl Cell cycle and cell death, and is associated with tumor radiation resistance, and cellular antioxidant proteins such as peroxiredoxin-II and Mn-SOD (manganese superoxide dismutase) are frequently involved in the oxidative stress tolerance of cancer cells. Reported that radiation therapy can induce acquired radiation resistance and drug resistance by modulating proteins associated with P-glycoprotein and multidrug resistance. Although these results suggest that some of the radiation resistance and anticancer drug resistance of cancer cells Although it is understandable, the specific cancer types and detailed molecular mechanisms based on these phenomena The radiation resistance-related factors that have been identified so far include cyclooxygenase-2 (Terakado N, Shintani S, Yano J, Chunnan L, Mihara M, Nakashiro K, et al., Oral Oncol 2004; 40: 383-9), epithelial growth factor receptor (EGFR) (Milas L, Fan Z, Andratschke NH, Ang KK., Int J Radiat Oncol Biol Phys 2004; 58 (3) (IGFBP-1 receptor), manganese (IGFBP-1 receptor), and manganese (IGFBP-1) Superoxide dismutase, and survivin. However, the mechanism has been partially elucidated, and there are few markers that can be used as useful predictors of the results of radiation therapy and increase the radiation sensitivity.

후두암은 두경부암에서 가장 큰 하위군으로 세계에서 6번째로 빈번히 발생하는 암이다. 흡연과 알콜 소비가 증가하면서 후두암종의 주요 위험인자가 되며, 사람 유두종 바이러스 또한 또 하나의 잠재적 요소로 작용한다. 악성종양을 제거하기 위한 주요 치료방법 중 하나의 방법으로 방사선치료를 많이 사용하며, 일반적으로 후두암을 치료하기 위해 외과적인 수술, 화학요법과 함께 방사선 치료를 병행하며 다양한 형태의 암을 치료하기 위해 통상적으로 이용된다. 따라서 이러한 후두암에서 저항성을 진단할 수 있는 마커가 필요한 실정이다.
Laryngeal cancer is the sixth most common cancer in the world, the largest subgroup of head and neck cancer. As smoking and alcohol consumption increase, it becomes a major risk factor for laryngeal carcinoma and human papillomavirus is another potential factor. One of the main treatment methods for the removal of malignant tumors is radiation therapy, which is commonly used to treat laryngeal cancer. Surgical surgery, chemotherapy and radiation therapy are commonly used to treat various types of cancer. . Therefore, a marker that can diagnose resistance in such laryngeal cancer is needed.

이에, 본 발명자들은 암의 방사선 저항성 여부를 진단할 수 있는 마커를 찾기 위해 예의 노력한 결과, 방사선 저항성 세포주를 구축하고 방사선 저항성 세포주와 대조군 세포주를 분석하여 발현의 차이를 보이는 유전자를 확인하여, 신규한 방사선 저항성 진단용 마커 및 이의 용도에 대한 본 발명을 완성하였다.
Therefore, the present inventors have made intensive efforts to find a marker capable of diagnosing radiation resistance of cancer, and as a result, they have constructed a radiation resistant cell line and analyzed radiation resistant cell lines and control cell lines to identify genes showing differences in expression, The present invention has been completed on a marker for radiation resistance diagnosis and its use.

본 발명의 하나의 목적은 MRFAP1(Mof4 family associated protein 1, NCBI GenBank Gene ID: 93621) 유전자의 mRNA 또는 이의 단백질의 수준을 측정하는 제제를 포함하는, 암세포의 방사선 저항성 또는 민감성 진단용 조성물을 제공하는 것이다.One object of the present invention is to provide a composition for diagnosing radiation resistance or sensitivity of a cancer cell, which comprises an agent for measuring the level of mRNA of MRFAP1 (Mof4 family associated protein 1, NCBI GenBank Gene ID: 93621) gene or a protein thereof .

본 발명의 다른 목적은 상기 조성물을 포함하는 암세포의 방사선 저항성 또는 민감성 진단용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for the diagnosis of radiation resistance or sensitivity of a cancer cell comprising the composition.

본 발명의 다른 목적은 상기 조성물을 이용하여 암 환자의 방사성 저항성 진단을 위한 정보의 제공 방법을 제공하는 것이다.Another object of the present invention is to provide a method of providing information for diagnosing radioactive resistance of a cancer patient using the composition.

본 발명의 또 다른 목적은 암환자의 방사선 치료 예후 예측에 필요한 정보를 제공하기 위하여, 방사선 저항성 또는 민감성 진단용 마커를 검출하는 방법을 제공하는 것이다.
Another object of the present invention is to provide a method for detecting a marker for radiation resistance or sensitivity in order to provide information necessary for predicting a radiation therapy prognosis of a cancer patient.

상기의 목적을 달성하기 위한 양태로서, 본 발명은 MRFAP1(Mof4 family associated protein 1, NCBI GenBank Gene ID: 93621) 유전자의 mRNA 또는 이의 단백질의 수준을 측정하는 제제를 포함하는, 암세포의 방사선 저항성 또는 민감성 진단용 조성물을 제공한다.In order to accomplish the above object, the present invention provides a method for detecting the radiation resistance or sensitivity of a cancer cell, comprising the step of measuring the mRNA of MRFAP1 (Mof4 family associated protein 1, NCBI GenBank Gene ID: 93621) A diagnostic composition is provided.

본 발명에서 용어, "MRFAP1(Mof4 family associated protein 1)"란 MORF4L1과 망막아종 (Retinoblastoma) 단백질과 상호작용하는 것으로 알려진 단백질이다. 그러나 MRFAP1과 방사선 민감성 및 저항성의 연관성에 대해서는 현재까지 알려진 바가 없다. MRFAP1과 방사선 민감성 및 저항성과의 관계에 대해서는 본 발명자들에 의해 처음으로 구명되었다.The term "MRFAP1 (Mof4 family associated protein 1)" in the present invention is a protein known to interact with MORF4L1 and retinoblastoma proteins. However, the association of MRFAP1 with radiation sensitivity and resistance is currently unknown. The relationship between MRFAP1 and radiation sensitivity and resistance was first described by the present inventors.

바람직하게는 상기 암세포의 방사선 저항성 또는 민감성 진단용 조성물은 MRFAP1(Mof4 family associated protein 1) 이외에도 PSAP(Prosaposin, NCBI GenBank Gene ID: 5660), CDK11A(Cell division cycle2-like 2, NCBI GenBank Gene ID: 728642), HNRNPUL1(Heterogeneous nuclear ribonucleoprotein U-like 1, NCBI GenBank Gene ID: 11100), WDFY3(WD repeat and FYVE domain containing 3, NCBI GenBank Gene ID: 23001) 및 CDC27(Cell division cycle 27 homolog, NCBI GenBank Gene ID: 996)로 이루어진 군에서 선택된 하나 이상의 유전자의 mRNA 또는 이의 단백질의 수준을 측정하는 제제를 포함할 수 있다. 상기 유전자는 하나 이상, 2개 이상, 3개 이상, 4개 이상, 5개 이상, 6개일 수 있으며, 방사선 저항성 또는 방사선 민감성 진단용 마커로 사용될 수 있다.Preferably, the composition for diagnosing radiation resistance or sensitivity of the cancer cell is PSAP (Prosaposin, NCBI GenBank Gene ID: 5660), CDK11A (Cell division cycle 2-like 2, NCBI GenBank Gene ID: 728642) in addition to MRFAP1 (Mof4 family associated protein 1) , HNRNPUL1 (Heterogeneous nuclear ribonucleoprotein U-like 1, NCBI GenBank Gene ID 11100), WDFY3 (WD repeat and FYVE domain containing 3, NCBI GenBank Gene ID 23001) and CDC27 (Cell division cycle 27 homolog, NCBI GenBank Gene ID: 996) or an agent for measuring the level of the mRNA of the mRNA of the at least one gene. The gene may be one or more, two or more, three or more, four or more, five or more, and may be used as a marker for radiation resistance or radiation sensitivity.

상기 6개 유전자인 PSAP, CDK11A, MRFAP1, HNRNPUL1, WDFY3 및 CDC27과 방사선 민감성 및 저항성의 연관성에 대해서는 현재까지 알려진 바가 없다. 상기 6개 유전자와 방사선 저항성 또는 민감성과의 관계에 대해서는 본 발명자들에 의해 최초로 규명되었으며, 본 발명의 일 구현예에 따르면, PSAP, CDK11A, MRFAP1, HNRNPUL1 또는 WDFY3이 방사선 저항성 세포주에서 정상 세포주보다 과발현되고, CDC27이 저발현되는 것을 확인하여(표 1, 도 1A), 상기 6개 유전자가 방사선 저항성 또는 민감성 유전자임을 확인하였다.The association of the six genes PSAP, CDK11A, MRFAP1, HNRNPUL1, WDFY3 and CDC27 with radiation sensitivity and resistance is currently unknown. According to one embodiment of the present invention, PSAP, CDK11A, MRFAP1, HNRNPUL1 or WDFY3 are overexpressed in a radiation-resistant cell line than in a normal cell line. According to one embodiment of the present invention, (Table 1, Fig. 1A), confirming that the above six genes are radiation-resistant or sensitive genes.

또한, 상기 방사선 저항성 또는 방사선 민감성 진단용 조성물은 INPP4B(Inositol polyphosphate-4-phosphatase type II, NCBI GenBank Gene ID: 8821) 유전자의 mRNA 또는 이의 단백질의 수준을 측정하는 제제를 추가로 포함할 수 있다. 바람직하게, 상기 INPP4B 유전자는 항암제 저항성 진단을 추가로 할 수 있는 마커일 수 있다. 항암제는 본 발명의 마커 유전자로 저항성을 진단할 수 있는 항암제는 제한 없이 포함되나, 그 예로 블레오마이신, 시스플라틴, 에토포시드, 독소루비신일 수 있다. 본 발명의 일 구현예에 따르면 INPP4B가 항암제에 저항성을 갖는 마커 유전자임을 확인하였다(도 5).In addition, the radiation-sensitive or radiation-sensitive diagnostic composition may further comprise an agent for measuring the level of the mRNA of INPP4B (Inositol polyphosphate-4-phosphatase type II, NCBI GenBank Gene ID: 8821) gene or its protein. Preferably, the INPP4B gene may be a marker capable of further diagnosing cancer resistance. The anticancer agent includes, but is not limited to, an anticancer agent capable of diagnosing resistance to the marker gene of the present invention, for example, bleomycin, cisplatin, etoposide, doxorubicin. According to one embodiment of the present invention, it was confirmed that INPP4B is a marker gene resistant to an anticancer agent (FIG. 5).

상기 유전자들의 정보는 공지의 데이터 베이스에서 얻을 수 있으며, 그 예로 NCBI GenBank일 수 있으나, 이에 제한되지는 않는다. Information on the genes can be obtained from known databases, such as, but not limited to, NCBI GenBank.

본 발명에서 용어 "방사선 저항성(radio-resistance)"은 방사선 조사에 의해 쉽게 영향을 받지 않으며, 방사선에 노출시 세포 복구 또는 증식에 거의 변화가 없는 상태를 말한다. The term "radio-resistance" in the present invention refers to a state that is not easily affected by irradiation and has little change in cell repair or proliferation upon exposure to radiation.

본 발명에서 용어 "방사선 민감성(radio-sensitive)"은 방사선 조사에 의해 쉽게 영향을 받으며, 방사선에 노출시 세포 복구 또는 증식에 변화를 보이는 상태를 말한다. The term "radio-sensitive" in the present invention refers to a condition that is easily affected by irradiation and shows changes in cell repair or proliferation upon exposure to radiation.

본 발명의 방사선 저항성 또는 민감성 진단용 조성물은 정상 암세포 대비 방사선 저항성 암세포에서 차등적 발현수준을 갖는 유전자로 구성되어, 개체나 세포의 방사선 저항성을 판단할 수 있게 한다. 즉, 본 발명의 방사선 저항성 진단용 조성물의 발현 수준이 대조군 보다 높거나 낮은 개체나 암세포는 방사선 저항성 또는 민감성을 갖는 것으로 판단할 수 있다.The radiation-sensitive or sensitive diagnostic composition of the present invention is composed of a gene having a differential expression level in a radiation-resistant cancer cell versus a normal cancer cell, so that the radiation resistance of an individual or a cell can be judged. That is, it can be judged that the level of expression of the radiation resistance-detecting composition of the present invention is higher or lower than that of the control group, and that cancer cells have radiation resistance or sensitivity.

본 발명의 실시예에서 방사선 민감성 진단용 마커로는 CDC27이 방사선 저항성 암세포주에서 상기 방사선 민감성 진단용 마커의 발현수준이 대조군 보다 낮게 발현되며, 반면에 방사선 저항성 진단용 마커로는 PSAP, CDK11A, MRFAP1, HNRNPUL1, WDFY3, 또는 INPP4B로 방사선 저항성 암세포주에서 상기 방사선 저항성 진단용 마커의 발현수준이 대조군 보다 높게 발현되는 것을 확인하였다.In the examples of the present invention, CDC27 expression level of the radiation sensitive diagnostic marker is lower than that of the control group in the radiation sensitive cancer cell line, while the radiation resistance diagnostic marker is PSAP, CDK11A, MRFAP1, HNRNPUL1, WDFY3, or INPP4B, the expression levels of the radiation resistance diagnostic marker were higher in the radiation-resistant cancer cell lines than in the control group.

방사선 치료 대상 암의 방사선 저항성 또는 민감성 여부 및 그 수준을 판단하면, 이를 반영하여 방사선 치료의 방사선 조사량을 정할 수 있기 때문에, 방사선 치료의 효율 및 치료 결과를 증진시킬 수 있다. If the radiation resistance or sensitivity of the cancer to be treated is judged and the level thereof is determined, the radiation dose of the radiation treatment can be determined in accordance with the determination, so that the efficiency and treatment result of the radiation treatment can be improved.

본 발명에서 용어, "마커 또는 진단 마커(diagnosis marker)"란, 암세포 또는 암 질환을 가진 개체를 방사선 저항성 세포 또는 개체, 방사선 민감성 세포 또는 개체와 구분하여 진단할 수 있는 물질로, 정상 암세포에 비하여 방사선 저항성을 가진 암세포 또는 개체에서 증가 또는 감소를 보이는 폴리펩티드, 단백질 또는 핵산 (예: mRNA 등), 지질, 당지질, 당단백질 또는 당 (예: 단당류, 이당류, 올리고당류 등) 등과 같은 유기 생체 분자들을 포함한다.The term "marker or diagnosis marker" in the present invention means a substance which can be diagnosed by distinguishing a cancer cell or an individual having a cancer disease from a radiation-resistant cell or an individual, a radiation-sensitive cell or an individual, Such as polypeptides, proteins or nucleic acids (such as mRNA), lipids, glycolipids, glycoproteins or sugars (such as monosaccharides, disaccharides, oligosaccharides, etc.) which show an increase or decrease in cancer cells or individuals with radiation resistance .

또한 본 발명의 상기 조성물에 의해 측정할 수 있는 암은 본 발명의 마커 유전자의 발현차이에 의해 구별할 수 있는 암은 제한 없이 포함되나, 바람직하게는 두경부암, 후두암, 자궁경부암, 인두암, 폐암, 뇌암, 유방암, 대장암 등이며, 보다 바람직하게는 폐암, 후두암, 대장암 또는 유방암이다. Also, the cancer which can be measured by the composition of the present invention is not limited to cancer which can be distinguished by the expression difference of the marker gene of the present invention, but preferably includes cancer of head, neck, larynx, cervix, , Brain cancer, breast cancer, and colon cancer, and more preferably lung cancer, laryngeal cancer, colon cancer, or breast cancer.

생물학적 시료 중의 유전자 발현 수준은 mRNA 또는 단백질의 양을 확인함으로써 확인할 수 있다.The level of gene expression in a biological sample can be determined by identifying the amount of mRNA or protein.

본 발명에서 용어,“mRNA 발현수준 측정”이란, 방사선 저항성 및 민감성을 진단하기 위하여 생물학적 시료에서 상기 마커 유전자들의 mRNA 존재 여부와 발현 정도를 확인하는 과정으로 mRNA의 양을 측정한다. 이를 위한 분석 방법으로는 역전사 중합효소반응(RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting), DNA 칩 등이 있으나 이로 제한되는 것은 아니다. The term " measurement of mRNA expression level " in the present invention is used to determine the presence or the mRNA level of the marker genes in a biological sample in order to diagnose radiation resistance and sensitivity. RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection (RPA), and reverse transcriptase-polymerase chain reaction assay, Northern blotting, DNA chip, and the like.

본 발명에서 “단백질 발현수준 측정”이란, 방사선 저항성 또는 민감성을 진단하기 위하여 생물학적 시료에서 상기 마커 유전자로부터 발현된 단백질의 존재 여부와 발현 정도를 확인하는 과정으로, 바람직하게는, 상기 유전자의 단백질에 대하여 특이적으로 결합하는 항체를 이용하여 단백질의 양을 확인할 수 있다. 이를 위한 분석 방법으로는 웨스턴 블롯, 엘라이자(enzyme linked immunosorbent assay, ELISA), 방사선면역분석(Radioimmunoassay, RIA), 방사 면역 확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트(rocket) 면역전기영동, 조직면역 염색, 면역침전 분석법(Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), 유세포분석(Fluorescence Activated Cell Sorter, FACS), 단백질 칩(protein chip) 등이 있으나 이로 제한되는 것은 아니다. In the present invention, " measurement of protein expression level " is a process for determining the presence or the degree of expression of a protein expressed from the marker gene in a biological sample to diagnose radiation resistance or sensitivity. Preferably, The amount of the protein can be confirmed by using an antibody specifically binding to the protein. Methods for analysis include enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket, But are not limited to, immunoelectrophoresis, immunohistochemistry, immunoprecipitation assays, complement fixation assays, fluorescence activated cell sorters (FACS), protein chips, and the like. .

본 발명의 상기 유전자 mRNA의 수준을 측정하는 제제는 상기 유전자에 특이적으로 결합하는 프라이머를 공지의 데이터 베이스에 공지된 상기 유전자의 서열을 바탕으로 당업자가 다양한 프로그램을 이용하여 제작할 수 있다. The agent for measuring the level of the gene mRNA of the present invention can be prepared by a person skilled in the art using various programs based on the sequence of the gene known in known databases in a primer which specifically binds to the gene.

본 발명에서의 용어 "프라이머"란, 짧은 자유 3'말단 수산화기를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. 본 발명의 프라이머는, 각 마커 유전자 특이적인 프라이머로 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산이다. 프라이머는 DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다. 본 발명의 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예: 뉴클레아제, 독소, 항체, 시그날 펩타이드, 폴리-L-리신 등), 삽입제(예: 아크리딘, 프소랄렌 등), 킬레이트화제(예: 금속, 방사성 금속, 철, 산화성 금속 등) 및 알킬화제를 함유할 수 있다. 본 발명의 핵산 서열은 또한 검출 가능한 시그널을 직접적으로 또는 간접적으로 제공할 수 있는 표지를 이용하여 변형시킬 수 있다. 표지의 예로는 방사성 동위원소, 형광성 분자, 비오틴 등이 있다. The term "primer " in the present invention means a short nucleic acid sequence capable of forming a base pair with a complementary template with a short, free 3 'terminal hydroxyl group and functioning as a starting point for template strand copying do. The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. The primer of the present invention is a sense and antisense nucleic acid having 7 to 50 nucleotide sequences for each marker gene-specific primer. Primers can incorporate additional features that do not alter the primer's basic properties that serve as a starting point for DNA synthesis. The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with one or more homologues and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, phosphoramidate , Carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.). The nucleic acid can be in the form of one or more additional covalently linked residues such as a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalator such as acridine, ), Chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. The nucleic acid sequences of the present invention can also be modified using a label that can provide a detectable signal directly or indirectly. Examples of labels include radioactive isotopes, fluorescent molecules, and biotin.

또한 상기 유전자의 단백질 수준을 측정하는 제제는 상기 단백질에 특이적인 항체를 포함하는 것인 암세포의 방사선 저항성 또는 민감성 진단용 조성물이다. And the agent for measuring the protein level of the gene comprises an antibody specific for the protein.

본 발명에서의 용어,“항체”란, 항원성 부위에 대해서 지시되는 특이적인 단백질 분자를 의미한다. 본 발명의 목적상, 항체는 마커 단백질에 대해 특이적으로 결합하는 항체를 의미하며, 다클론 항체, 단클론 항체 및 재조합 항체를 모두 포함한다. 상기한 바와 같이 방사선 저항성 및 민감성 마커 단백질이 규명되었으므로, 이를 이용하여 항체를 생성하는 것은 당업계에 널리 공지된 기술을 이용하여 용이하게 제조할 수 있다. 다클론 항체는 상기한 방사선 저항성 또는 민감성 마커 단백질 항원을 동물에 주사하고 동물로부터 채혈하여 항체를 포함하는 혈청을 수득하는 당업계에 널리 공지된 방법에 의해 생산할 수 있다. 이러한 다클론 항체는 염소, 토끼, 양, 원숭이, 말, 돼지, 소 개 등의 임의의 동물 종 숙주로부터 제조 가능하다. 단클론 항체는 당업계에 널리 공지된 하이브리도마 방법(hybridoma method)(Kohler 및 Milstein (1976) European Jounral of Immunology 6:511-519 참조), 또는 파지 항체 라이브러리(Clackson et al, Nature, 352:624-628, 1991; Marks et al, J. Mol. Biol., 222:58, 1-597, 1991) 기술을 이용하여 제조될 수 있다. 상기 방법으로 제조된 항체는 겔 전기영동, 투석, 염 침전, 이온교환 크로마토그래피, 친화성 크로마토그래피 등의 방법을 이용하여 분리, 정제할 수 있다. The term " antibody " in the present invention means a specific protein molecule directed to an antigenic site. For purposes of the present invention, an antibody refers to an antibody that specifically binds to a marker protein and includes both polyclonal antibodies, monoclonal antibodies, and recombinant antibodies. As described above, since the radiation-resistant and sensitive marker proteins have been identified, the production of antibodies using the same can be easily carried out by using techniques well known in the art. Polyclonal antibodies can be produced by methods well known in the art for obtaining serum containing antibodies by injection of the above-mentioned radiation-sensitive or sensitive marker protein antigens into animals and blood collection from the animals. Such polyclonal antibodies can be prepared from any animal species host, such as goats, rabbits, sheep, monkeys, horses, pigs, small dogs, and the like. Monoclonal antibodies may be obtained from the hybridoma method (see Kohler and Milstein (1976) European Jounal of Immunology 6: 511-519), or the phage antibody library (Clackson et al, Nature, 352: 624 Biol., 222: 58, 1-597, 1991) techniques. The antibody prepared by the above method can be separated and purified by gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, affinity chromatography, and the like.

또한 본 발명의 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라, 항체 분자의 기능적인 단편을 포함한다. 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 뜻하며, Fab, F(ab'), F(ab') 2 및 Fv 등이 있다.The antibodies of the present invention also include functional fragments of antibody molecules as well as complete forms with two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen binding function, and includes Fab, F (ab ') 2, F (ab') 2 and Fv.

본 발명에서의 용어, "암세포"는 다세포 생물체의 조직 또는 기관에서 조절되지 않은 성장을 나타내는 임의의 세포를 말한다. The term "cancer cell" in the present invention refers to any cell that exhibits unregulated growth in the tissues or organs of a multicellular organism.

본 발명의 방사선 저항성 진단용 마커는 후두암세포주를 사용하여 방사선 저항성 세포주를 확립한 뒤 유전자 발현의 양을 대조군(정상 후두암세포;HEp-2 세포)과 비교하여 발굴하였으며, 이 마커들은 방사선 치료의 효과를 증진시키기 위해 이용될 수 있다. The radiation resistance diagnostic marker of the present invention was used to establish a radiation resistant cell line using a laryngeal cancer cell line and to quantify the gene expression level in comparison with a control group (normal laryngeal cancer cell: HEp-2 cell) ≪ / RTI >

본 발명의 일 실시예에 따르면, 방사선 저항성 세포주를 구축하여 확립된 방사선 저항성 세포주를 대상으로 방사선 저항성 여부를 판단하였다. 방사선 저항성 세포주와 대조군 세포주에서 RT-PCR 등으로 두 세포주간에 발현의 차이가 나는 유전자를 확인하였다. 방사선 저항성 세포주에서 대조군에 비해 낮은 발현량을 보이는 것으로 확인된 유전자는 염기서열을 분석해 본 결과, CDC27이며, 이와 반대로, 방사선 저항성 세포주에서 대조군에 비해 높은 발현량을 보이는 것으로 확인된 유전자는 염기서열을 분석해 본 결과, PSAP, CDK11A, MRFAP1, HNRNPUL1 또는 WDFY3으로 모두 6개 였다. 이들 유전자는 아직까지 문헌에서 방사선, 특히 방사선 저항성과 민감성 연관된 기능을 갖는 것으로 개시된 바 없는 신규한 방사선 저항성 또는 민감성 진단용 마커로 확인되었다.According to one embodiment of the present invention, a radiation resistant cell line was constructed, and the established radiation resistant cell line was examined for radiation resistance. RT-PCR was used to confirm the expression of the gene in both the cell lines and the control cells. The gene that was found to show a lower expression level in the radiation-resistant cell line than the control was CDC27 as a result of the nucleotide sequence analysis. On the other hand, the gene confirmed to have a higher expression level in the radiation-resistant cell line than the control group, As a result of analysis, 6 were all of PSAP, CDK11A, MRFAP1, HNRNPUL1 or WDFY3. These genes have yet to be identified in the literature as novel radiolabel or sensitive diagnostic markers that have not been described as having radiation, particularly radiation-resistance and sensitivity-related functions.

본 발명에서의 용어, "방사선조사(irradiation)"란, 예를 들면, X-선, 자외선, 알파 입자 및 감마선을 포함하는 전자기 방사선 또는 알파 또는 베타 입자의 작용에 대한 노출을 포함한다. The term "irradiation " in the present invention includes exposure to the action of electromagnetic radiation or alpha or beta particles including, for example, X-rays, ultraviolet rays, alpha particles and gamma rays.

본 발명에서의 용어, "그레이(Gy)"는 대표적인 생물학 조직 1kg에서 1J을 방출하는 방사선의 양이다.
The term "gray (Gy) " in the present invention is the amount of radiation that releases 1J in 1 kg of representative biological tissue.

또 하나의 양태로서 본 발명은 상기 방사선 저항성 또는 민감성 진단용 조성물을 포함하는 방사선 저항성 또는 민감성 진단용 키트를 제공한다. 상기 키트는 RT-PCR 키트, DNA 칩 키트, 마이크로어레이 또는 단백질 칩 키트인 것을 특징으로 한다. 본 발명에 따른 진단용 키트는 상기 방사선 저항성 또는 민감성 진단용 조성물을 사용하여 당업계에서 사용되는 통상의 방법에 따라 제조할 수 있다. 또한, 상기 방사선 저항성 또는 민감성 유전자의 발현변화 측정은 본 발명에 따른 방사선 저항성 또는 방사선 민감성 진단용 마커를 포함하는 키트를 사용하여 수행할 수 있다.In another aspect, the present invention provides a radiation-sensitive or sensitive diagnostic kit comprising the radiation-sensitive or sensitive diagnostic composition. The kit may be an RT-PCR kit, a DNA chip kit, a microarray, or a protein chip kit. The diagnostic kit according to the present invention can be prepared according to a conventional method used in the art using the above radiation-sensitive or sensitive diagnostic composition. In addition, the expression of the radiation-sensitive or sensitive gene may be measured using a kit containing a radiation-sensitive or radiation-sensitive diagnostic marker according to the present invention.

본 발명에서의 용어, "키트"란, MRFAP1 단독, 또는 추가로 CDK11A, PSAP, HNRNPUL1, WDFY3, CDC27 및 INPP4B로 이루어진 군에서 선택된 하나 이상의 유전자의 mRNA 발현 수준 또는 단백질의 발현 수준을 확인하여 암세포의 방사선 저항성 또는 민감성 여부를 진단할 수 있는 도구를 의미한다. 본 발명의 암세포의 방사선 저항성 여부 진단용 키트에는 방사선저항성 진단마커로서 MRFAP1 단독, 또는 추가로 CDK11A, PSAP, HNRNPUL1, WDFY3, CDC27 및 INPP4B로 이루어진 군에서 선택된 하나 이상의 유전자 발현수준을 측정하기 위한 프라이머, 프로브 또는 선택적으로 마커를 인지하는 항체뿐만 아니라 분석 방법에 적합한 1종 이상의 다른 구성성분 조성물, 용액, 또는 장치가 포함될 수 있다.
The term "kit" in the present invention refers to a mRNA expression level or protein expression level of at least one gene selected from the group consisting of MRFAP1 alone, or further CDK11A, PSAP, HNRNPUL1, WDFY3, CDC27 and INPP4B, Means a tool capable of diagnosing radiation resistance or sensitivity. The kit for diagnosing whether or not radiation resistance of cancer cells according to the present invention includes a primer for measuring the expression level of at least one gene selected from the group consisting of MRFAP1 alone or further CDK11A, PSAP, HNRNPUL1, WDFY3, CDC27 and INPP4B as a radiation resistance diagnostic marker, Or optionally one or more other component compositions, solutions, or devices suitable for the assay, as well as antibodies that recognize the marker.

또 하나의 양태로서, 본 발명은 MRFAP1 유전자에 특이적으로 결합하는 프라이머를 사용하여 암환자의 생물학적 시료로부터 mRNA 수준을 측정하는 단계; 및 상기 mRNA 수준의 변화를 정상 대조구 시료의 mRNA 수준과 비교하는 단계를 포함하는 암 환자의 방사성 저항성 또는 민감성 진단을 위한 정보의 제공 방법을 제공한다.In another aspect, the present invention provides a method for detecting cancer, comprising: measuring mRNA levels from a biological sample of a cancer patient using a primer that specifically binds to the MRFAP1 gene; And comparing the change in the mRNA level with the mRNA level of the normal control sample. The present invention also provides a method for providing information for diagnosing radioactive resistance or sensitivity of a cancer patient.

또한, CDK11A, PSAP, HNRNPUL1, WDFY3, CDC27 및 INPP4B로 이루어진 군에서 선택된 하나 이상의 유전자에 특이적으로 결합하는 프라이머를 사용하여 암환자의 생물학적 시료로부터 mRNA 수준을 추가로 측정 및 비교하는 단계를 포함하는 암 환자의 방사선 저항성 또는 민감성을 진단을 위한 정보의 제공 방법을 포함하는 것이 바람직하다.
Further comprising measuring and comparing mRNA levels from a biological sample of a cancer patient using a primer that specifically binds to one or more genes selected from the group consisting of CDK11A, PSAP, HNRNPUL1, WDFY3, CDC27, and INPP4B It is preferable to include a method of providing information for diagnosing radiation resistance or sensitivity of a cancer patient.

또 하나의 양태로서 본 발명은 MRFAP1 유전자의 단백질에 특이적인 항체를 암 환자의 생물학적 시료와 접촉시켜 항원-항체 복합체 형성으로 단백질 수준을 확인하는 단계; 및 상기 단백질 형성량의 변화를 정상 대조군 시료의 단백질 수준과 비교하는 단계를 포함하는 암 환자의 방사선 저항성 또는 민감성 진단을 위한 정보의 제공 방법을 제공한다.In another aspect, the present invention relates to a method for detecting a protein level of an MRFAP1 gene, comprising: contacting an antibody specific to a protein of the MRFAP1 gene with a biological sample of a cancer patient; And comparing the change of the amount of protein formation with a protein level of a normal control sample. The present invention also provides a method for providing information for diagnosing radiation resistance or sensitivity of a cancer patient.

또한 CDK11A, PSAP, HNRNPUL1, WDFY3, CDC27 및 INPP4B로 이루어진 군에서 선택된 하나 이상의 유전자의 단백질 수준을 추가로 측정 및 비교하는 단계를 포함하는 암 환자의 방사선 저항성 또는 민감성 진단을 위한 정보의 제공 방법을 포함하는 것이 바람직하다.And further comprising measuring and comparing the protein levels of one or more genes selected from the group consisting of CDK11A, PSAP, HNRNPUL1, WDFY3, CDC27 and INPP4B to provide information for diagnosing radiation resistance or sensitivity of cancer patients .

본 발명의 목적상 암세포에서 CDC27 유전자의 mRNA와 단백질의 발현수준이 낮으면 방사선 저항성을 나타내는 암세포로 판단할 수 있으며, 반면에 상기 유전자의 발현수준이 높으면 방사선 민감성을 나타내는 암세포로 판단할 수 있다. 또한, PSAP, CDK11A, MRFAP1, HNRNPUL1, WDFY3 또는 INPP4B 유전자의 mRNA와 단백질의 발현수준이 높으면 방사선 저항성 암세포로 판단할 수 있고, 반면에 낮으면 방사선 민감성 암세포주로 판단할 수 있다.
For the purpose of the present invention, low levels of mRNA and protein expression of CDC27 gene in cancer cells can be judged as cancer cells exhibiting radiation resistance, while cancer cells exhibiting radiation sensitivity when the expression level of the gene is high. In addition, high expression levels of mRNA and protein of PSAP, CDK11A, MRFAP1, HNRNPUL1, WDFY3, or INPP4B genes can be judged as radiation-resistant cancer cells, while low levels can be judged as radiation-sensitive cancer cells.

또 하나의 양태로서, 본 발명은 암환자의 방사선 치료 예후 예측에 필요한 정보를 제공하기 위하여, 방사선 치료를 받은 환자의 시료로부터 MRFAP1 유전자의 mRNA 또는 이의 단백질의 수준을 정상 세포의 발현 수준과 비교하여 방사선 저항성 진단용 마커를 검출하는 방법을 제공한다. 또한, CDK11A, PSAP, HNRNPUL1, WDFY3, CDC27 및 INPP4B로 이루어진 군에서 선택된 하나 이상의 유전자의 mRNA 또는 단백질 수준을 추가로 측정 및 비교하는 단계를 포함하는 방사선 저항성 또는 민감성 진단용 마커를 검출하는 방법을 포함하는 것이 바람직하다. 본 발명의 방법에서, 상기 암세포는 두경부암, 후두암, 자궁경부암, 인두암, 폐암, 뇌암, 유방암, 대장암 유래일 수 있으나, 이에 제한되지 않는다. 바람직하게는 상기 암세포는 폐암, 후두암, 대장암 또는 유방암 유래이다.In another aspect, the present invention provides a method for predicting the prognosis of radiation therapy in a cancer patient, comprising the steps of: comparing the level of MRFAP1 gene mRNA or a protein thereof with a normal cell expression level from a sample of a patient receiving radiation therapy There is provided a method for detecting a marker for diagnostic of radiation resistance. Also included are methods for detecting a radiation-sensitive or sensitive diagnostic marker comprising the further measurement and comparison of mRNA or protein levels of one or more genes selected from the group consisting of CDK11A, PSAP, HNRNPUL1, WDFY3, CDC27 and INPP4B . In the method of the present invention, the cancer cells may be, but are not limited to, head and neck cancer, laryngeal cancer, cervical cancer, parietal cancer, lung cancer, brain cancer, breast cancer and colon cancer. Preferably, the cancer cells are derived from lung cancer, laryngeal cancer, colon cancer or breast cancer.

본 발명에서의 용어, "예후 예측"이란, 방사선 조사 후, 정상 대조군과 비교하여 방사선 저항성 암세포주에서 발현차이를 보이는 유전자를 통해 방사선 저항성 또는 민감성 암세포를 예측하는 것이다.The term "prognosis prediction" in the present invention is to predict radiation-resistant or sensitive cancer cells through a gene showing a difference in expression in a radiation-resistant cancer cell line as compared to a normal control group after irradiation.

본 발명에서의 용어, "차등적 발현"은 샘플 내 본 발명의 동일한 하나 이상의 바이오 마커의 발현 수준과 비교한 것으로서 하나의 샘플 내 바이오 마커의 mRNA의 양 또는 수준을 측정함으로써, 본 발명의 하나 이상의 바이오 마커의 mRNA의 발현 수준에 있어서의 차이를 말한다. "차등적으로 발현된"은 샘플의 집단 내 단백질 발현의 양 또는 수준과 비교하여 샘플 또는 샘플 집단 내 본 발명의 바이오 마커에 의해 암호화된 단백질의 측정을 또한 포함할 수 있다. 차등적 발현은 본 발명에 기술된 바와 같이 및 당해 분야의 숙련자에 의해 이해되는 바와 같이 측정할 수 있다.The term "differential expression" in the present invention refers to the level of expression of one or more identical biomarkers of the invention in a sample, and by measuring the amount or level of mRNA of a biomarker in one sample, Quot; refers to the difference in the expression level of the mRNA of the biomarker. "Differentially expressed" may also include a measure of a protein encoded by a biomarker of the invention in a sample or sample population in comparison to the amount or level of protein expression in the population of samples. Differential expression can be measured as described herein and as understood by those skilled in the art.

본 발명에서의 용어, "유전자 발현 패턴" 또는 "유전자 발현 프로파일" 또는 "유전자 특징"은 암세포의 방사선저항성과 민감성 관련된 유전자의 상대적 발현을 말하며, 조합된 패턴이 본 발명의 바이오 마커 중 2, 3, 4, 5, 6, 7개 또는 모두를 포함하는 본 발명의 1개 이상의 바이오 마커의 발현 수준의 분석 결과임을 나타낸다. 유전자 발현 패턴 또는 유전자 발현 프로파일 또는 유전자 특징은 mRNA 및/또는 본 발명의 바이오 마커에 상응하는 유전자에 의해 발현된 단백질의 발현의 측정으로부터 수득될 수 있다. The term "gene expression pattern" or "gene expression profile" or "gene profile" in the present invention refers to the relative expression of radiation resistance and sensitivity related genes of cancer cells, , 4, 5, 6, 7, or both of the expression levels of one or more biomarkers of the invention. The gene expression pattern or gene expression profile or gene characteristic can be obtained from the measurement of the expression of the mRNA and / or the protein expressed by the gene corresponding to the biomarker of the present invention.

본 발명의 실시예에서는 INPP4B의 기능과 역할에 대해 알아보았다. 보다 상세하게는 HEp-2 모세포, RR-HEp-2 세포에서의 INPP4B의 발현 유도는 방사선 자극이나 특정 세포 유형에 제한되지 않음을 확인하였으며, INPP4B가 ERK-의존성 유도의 HEp-2 세포의 방사선 저항성 표현형을 촉진하는 것을 확인하여, INPP4B가 방사선 저항성을 증가하여, 방사선 유도 세포사멸에 대해 HEp-2 세포를 선택적으로 보호할 수 있음을 확인하였다. 아울러, INPP4B가 항암제 저항성 발생에 양성 바이오 마커임을 확인하였다. 또한, INPP4B가 방사선 또는 항암제와 같은 스트레스에 의한 INPP4B 유도가 암세포에서 Akt 생존 경로에 의한 저항성 표현형을 촉진하는 것을 확인하였다.
In the embodiment of the present invention, the function and the role of INPP4B were examined. More specifically, it was confirmed that induction of INPP4B expression in HEp-2 and RR-HEp-2 cells was not limited to radiation stimulation or specific cell types. In addition, INPP4B inhibited the radiation resistance of HEp-2 cells induced by ERK- Promoted phenotype, confirming that INPP4B increased radiation resistance and could selectively protect HEp-2 cells against radiation-induced cell death. In addition, INPP4B was found to be a positive biomarker for the development of anticancer resistance. Furthermore, INPP4B induces INPP4B induction by stresses such as radiation or anticancer drugs, promoting the resistance phenotype by Akt survival pathway in cancer cells.

본 발명의 방사선 저항성 또는 민감성 진단용 조성물을 사용함으로, 방사선 치료대상 암세포의 방사선 저항성 또는 민감성을 판단하여 맞춤화된 방사선 치료를 제공하며, 암환자에서 방사선 치료 적용 대상의 다양화를 통해 치료 효과 증진 및 부작용을 감소시킬 수 있다. 또한 방사선 치료환자의 예후를 판단(치료효과의 예측이 가능)하는데 사용할 수 있다.
By using the radiation-sensitive or sensitive diagnostic composition of the present invention, it is possible to provide radiation therapy that is customized by judging the radiation resistance or sensitivity of cancer cells to be treated with radiation, and to improve the therapeutic effect and side effects Can be reduced. It can also be used to judge the prognosis of patients treated with radiotherapy (to predict the therapeutic effect).

도 1은 HEp-2 세포에서 방사선 저항성과 관련된 단백질로서 INPP4B를 확인한 도이다. (A) HEp-2 모세포, 및 방사선 저항성 RR-HEp-2 및 RR-#6 클론변이체는 24시간 동안 10 Gy방사선을 처리하거나 처리하지 않았다. 유전자 전사체는 전형적인 RT-PCR을 실시하여 측정하였다. ERBB2 및 Bcl-xl은 양성 대조군으로 사용하였다; P21은 음성 대조군으로 사용하였다; 또한 GAPDH는 로딩 대조군으로 사용하였다. (B) HEp-2 모세포, 및 RR-HEp-2 및 RR-#6 변이체는 표시된 방사선 량으로 처리하였다. 14일 후, 생존분획을 집락형성생존분석법으로 측정하였다; 결과는 생존곡선(상단)으로 표시하였다. INPP4B 단백질 수준은 로딩 대조군으로 β-actin을 사용한 웨스턴 블롯으로 측정하였다(하단). (C) HEp-2 모세포(CON), 방사선 민감성(RS-#7, RS-#9 및 RS- #18) 및 방사선 저항성(RR-#3, RR-#6 및 RR-#13) HEp-2 세포는 4Gy 방사선을 처리하거나(+) 또는 처리하지 않았다. 14일 후 집락형성 생존분획은 자동화 콜로니 계수기에 의해 정량화하였다; 결과는 생존곡선으로 표시하였다(상단). INPP4B 단백질 수준은 로딩 대조군으로 β-actin을 사용한 웨스턴 블롯을 실시하여 측정하였다(하단). 상기 데이터는 형식적인 결과 또는 평균 ± 표준편차로 나타내었다(3회 실시).
도 2는 방사선 또는 항암제를 처리함으로써 INPP4B 발현 암세포의 유도를 나타낸 도이다. (A) HEp-2 모세포(상단), 또는 HEp-2 모세포 및 RR-HEp-2, 및 RR-#6 변이체(하단)는 표시된 시간 동안 10 Gy의 방사선을 조사하였다. (B) A549, H460, HCT116 및 MCF7 세포는 24시간 동안 10 Gy의 방사선을 조사하거나(+) 또는 조사하지 않았다(-). INPP4B 전사수준은 내부 대조군으로 GAPDH를 사용한 정량적인 PCR을 실시하여 측정하였다. (C) HEp-2세포는 24시간 동안 방사선(IR; 10 Gy), bleomycin (Bleo; 10 μM), cisplatin (Cis; 10 μM), etoposide (Eto; 5 μM), 또는 doxorubicin (Doxo; 1 μM)을 조사하거나 또는 조사하지 않았다(CON). INPP4A 및 INPP4B 전사수준은 내부 대조군으로 GAPDH를 사용한 정량적인 PCR을 실시하여 측정하였다. (D) HEp-2 모세포 및 RR-HEp-2, 및 RR-#6 변이체는 24시간 동안 10 Gy의 방사선을 조사하였다. INPP4A, INPP4B 및 PTEN전사 수준은 정량적인 PCR(상단) 또는 전형적인 PCR(하단)을 실시하여 측정하였다. GAPDH는 내부 대조군 또는 로딩 대조군으로 사용하였다. 상기 데이터는 형식적인 결과 또는 평균 ± 표준편차로 나타내었다(4회 실시).
도 3은 HEp-2 세포에서 방사선에 의한 INPP4B 발현의 ERK 의존 유도를 나타낸 도이다. (A) MAPK 단백질 발현 및 인산화 수준은 웨스턴 블롯을 실시하여 측정하였다. (B) HEp-2 세포는 10 μM PD98059(PD), 10 μM SB203580(SB), 또는 SP600125(SP)이 존재하거나 존재하지 않은(vehicle) 상태에 10 Gy의 방사선을 조사하거나(+) 또는 조사하지 않고 (-), 24시간 동안 배양하였다. INPP4B 단백질 수준은 로딩 대조군으로 β-actin을 사용한 웨스턴 블롯을 실시하여 측정하였다(상단). INPP4B 전사 수준은 전형적인 PCR(중간) 또는 정량적인 PCR(하단)을 실시하여 측정하였다. GAPDH는 내부 대조군 또는 로딩 대조군으로 사용하였다. (C) HEp-2 세포는 대조군 siRNA(siCON) 또는 100 nM ERK-1/2 siRNA(siERK)로 48시간 동안 형질트랜스펙션시킨 다음 24시간 동안 10 Gy의 방사선을 조사하거나(+) 또는 조사하지 않았다(-). INPP4B 및 ERK 단백질 수준은 로딩 대조군으로 β-actin을 사용한 웨스턴 블롯을 실시하여 측정하였다. INPP4B 전사 수준은 전형적인 PCR(중간) 또는 정량적인 PCR(하단)을 실시하여 측정하였다. GAPDH는 내부 대조군 또는 로딩 대조군으로 사용하였다. 상기 데이터는 형식적인 결과 또는 평균 ± 표준편차로 나타내었다(3회 실시).
도 4는 HEp-2 세포에서 방사선 민감성의 INPP4B 의존적 조절을 나타낸 도이다. (A 및 B) HEp-2 모세포는 빈 벡터(CON) 또는 MYC-태그된 INPP4B 발현백터(INPP4B)로 형질트랜스펙션시킨 후 24시간 동안 배양하였다. 세포는 방사선(A) 또는 10 Gy 방사선(B)으로 표시한 방사선량으로 조사하였다. 14일 후, 집락형성은 자동화 콜로니 계수기를 사용하여 정량하였다; 결과는 생존곡선(A)으로 나타내었다. 48시간 후, 세포생존률은 FACScan 유세포 분석기를 사용하여 측정하였다; 데이터는 PI-양성세포의 비율로 나타내었다(B, 중간). 절단된 PARP 및 INPP4B 단백질 수준은 로딩대조군으로 β-actin을 사용한 웨스턴 블롯을 실시하여 측정하였다(B, 오른쪽). (C 및 D) RR-HEp-2 세포는 대조군 siRNA (siCON) 또는 100 nM INPP4B siRNA (siINPP4B)로 트랜스펙션시킨 후, 48시간 동안 배양하였다. 상기 세포는 표시된 양의 방사선(C) 또는 10 Gy의 방사선을 조사하였다. (D) 세포생존(C), 세포 생존능력(D, 왼쪽), 세포형태(D, 중간) 및 웨스턴 블롯(D, 오른쪽) 실험을 A 및 B와 유사하게 수행하였다. 상기 데이터는 형식적인 결과 또는 평균 ± 표준편차로 나타내었다(4회 실시).
도 5는 안정적으로 트랜스펙션된 INPP4B-HEp-2 세포에서 항암제 민감성에 대한 INPP4B 의존 조절을 나타낸 도이다. (A 및 B) HEp-2(CON) 및 안정적인 INPP4B-HEp-2(INPP4B)는 vehicle, 10 μM bleomycin, 5 μM etoposide, 또는 1 μM doxorubicin을 24시간 동안 조사하였다. 절단된 PARP 및 Myc-태그된 INPP4B 발현수준은 로딩 대조군으로 β-actin을 사용한 웨스턴 블롯을 실시하여 측정하였다(A, 상단). 세포사멸은 FACScan 유세포 분석기를 사용하여 측정하였다; 상기 데이터는 PI-양성 세포의 비율로 나타내었다(A, 하단). (C 및 D) INPP4B-HEp-2 세포는 대조군 siRNA(siCON) 또는 100 nM INPP4B siRNA(siINPP 4B)를 48시간 동안 트랜스펙션시킨 후, 추가 시간 24시간 동안 vehicle 또는 1 μM doxorubicin을 처리하였다. 웨스턴 블롯(C, 상단), 세포사멸(C, 하단) 및 세포형태(D) 실험은 A 및 B에서와 같이 실시하였다. (E) INPP4B-HEp-2 변이체(INPP4B-#2, INPP4B-#4 및 INPP4B-#6)는 대조군 siRNA(siCON) 또는 100 nM INPP4B siRNA(siINPP4B)를 48시간 동안 트랜스펙션시킨 후, 추가로 24시간 동안 vehicle 또는 1 μM doxorubicin을 처리하였다. 절단된 PARP 및 Myc-태그된 INPP4B는 로딩 대조군으로 β-actin을 사용한 웨스턴 블롯을 실시하여 측정하였다. 상기 데이터는 형식적인 결과 또는 평균 ± 표준편차로 나타내었다(4회 실시).
도 6은 폐암세포에서 INPP4B의 결핍에 의한 세포사멸 유도를 나타낸 도이다. (A) A549 및 H1299 세포는 대조군 siRNA(siCON) 또는 100 nM INPP4B siRNA(siINPP4B)를 48시간 동안 트랜스펙션시켰다. INPP4B 단백질 수준은 로딩 대조군으로 β-actin을 사용한 웨스턴 블롯을 실시하여 측정하였다(상단). INPP4B mRNA수준은 내부대조군으로 GAPDH를 사용한 정량적인 PCR을 실시하여 측정하였다(하단). (B 및 C) A549(B) 및 H1299(C) 세포는 대조군 siRNA(-) 또는 100 nM INPP4B siRNA(+)로 48시간 동안 트랜스펙션시킨 후, 24시간 동안 1 μM doxorubicin을 또는 48시간 동안 10 Gy의 방사선을 조사하거나(+) 또는 조사하지 않았다(-). 절단된 PARP 수준은 로딩 대조군으로 β-actin을 사용한 웨스턴 블롯을 실시하여 측정하였다(상단 및 중간). 세포의 형태는 광학현미경으로 관찰하였다(하단). 상기 데이터는 형식적인 결과 또는 평균 ± 표준편차로 나타내었다(4회 실시).
도 7은 후두암 및 폐암세포에서 INPP4B의 발현으로 인한 Akt 활성 변화를 나타낸 도이다. (A) HEp-2 모세포 및 방사선 저항성 RR-HEp-2 세포는 표시한 시간 동안 10 Gy의 방사선을 조사하였다. Akt 및 GSK3α/β 발현 및 인산화 수준은 로딩 대조군으로 β-actin을 사용한 웨스턴 블롯을 실시하여 측정하였다. (B) RR-HEp-2 세포는 대조군 siRNA(siCON) 또는 100 nM INPP4B siRNA(siINPP4B)으로 48시간 동안 트랜스펙션시킨 후 추가적으로 6시간 동안 10 Gy의 방사선을 조사하거나 또는 조사하지 않았다. Akt 및 GSK3α/β 발현 및 인산화 수준은 로딩 대조군으로 β-actin을 사용한 웨스턴 블롯을 실시하여 측정하였다. (C 및 D) 대조군 HEp-2(CON) 및 안정적으로 트랜스펙션된 INPP4B-HEp-2(INPP4B) 세포(C) 또는 RR-HEp-2, A549 및 H1299 세포(D)는 대조군 siRNA(siCON) 또는 100 nM INPP4B siRNA(siINPP4B)로 48시간 동안 트랜스펙션시켰다. Akt 및 GSK3α/β 발현 및 인산화 수준은 로딩 대조군으로 β-actin을 사용한 웨스턴 블롯을 실시하여 측정하였다. (E 및 F) RR-HEp-2 세포는 대조군 siRNA(siCON) 또는 100 nM INPP4B siRNA siINPP4B)로 48시간 동안 트랜스펙션시킨 후, 추가적으로 6시간 동안 10 Gy의 방사선을 조사하거나 조사하지 않았다. Akt(E) 또는 PP2A(F)는 각 표본으로부터 면역침강을 실시하여 얻은 면역복합체를 PP2A 인산화효소 활성을 측정하기 위하여 사용하였다. PP2A 억제제 okadaic acid은 양성 대조군으로 사용하였다. 상기 데이터는 형식적인 결과 또는 평균 ± 표준편차로 나타내었다(4회 실시).
Figure 1 shows INPP4B as a protein related to radiation resistance in HEp-2 cells. (A) HEp-2 maternal cells, and radiation resistant RR-HEp-2 and RR- # 6 clone variants were not treated or treated with 10 Gy radiation for 24 hours. The gene transcript was measured by performing a typical RT-PCR. ERBB2 and Bcl-xl were used as positive controls; P21 was used as a negative control; GAPDH was also used as a loading control. (B) HEp-2 parent cells, and RR-HEp-2 and RR- # 6 variants were treated with the indicated radiation dose. After 14 days, the survival fraction was measured by colony formation survival assay; Results are expressed as survival curves (top). INPP4B protein levels were measured by Western blot using β-actin as a loading control (bottom). (C) HEp-2 maternal cells (CON), radiation sensitivity (RS- # 7, RS- # 9 and RS- # 18) and radiation resistance (RR- # 3, RR- # 6 and RR- # 13) HEp- 2 cells did not (+) or treat 4Gy radiation. After 14 days, the colony forming survival fraction was quantified by automated colony counter; Results are expressed as survival curves (top). INPP4B protein levels were measured by Western blot using β-actin as a loading control (bottom). The data were expressed as formal results or mean ± standard deviation (performed 3 times).
Fig. 2 shows the induction of INPP4B-expressing cancer cells by treating with radiation or an anticancer agent. (A) HEp-2 parent cells (top), or HEp-2 parent cells and RR-HEp-2, and RR- # 6 variants (bottom) were irradiated with 10 Gy of radiation for the indicated time. (B) A549, H460, HCT116 and MCF7 cells were not irradiated (+) or irradiated (-) with 10 Gy of radiation for 24 hours. INPP4B transcription levels were measured by quantitative PCR using GAPDH as an internal control. (C) HEp-2 cells were exposed to radiation (10 Gy), bleomycin (Bleo; 10 μM), cisplatin (Cis; 10 μM), etoposide (Eto; 5 μM), or doxorubicin (Doxo; ) Or not (CON). INPP4A and INPP4B transcript levels were measured by quantitative PCR using GAPDH as an internal control. (D) HEp-2 and RR-HEp-2, and RR- # 6 variants were irradiated with 10 Gy of radiation for 24 hours. INPP4A, INPP4B and PTEN transcript levels were measured by either quantitative PCR (top) or typical PCR (bottom). GAPDH was used as an internal control or a loading control. The data were expressed as formal results or mean ± SD (4 runs).
FIG. 3 shows ERK-dependent induction of INPP4B expression by radiation in HEp-2 cells. (A) MAPK protein expression and phosphorylation levels were determined by western blotting. (B) HEp-2 cells were irradiated (+) or irradiated with 10 Gy of radiation in the presence or absence of 10 μM PD98059 (PD), 10 μM SB203580 (SB), or SP600125 (-), and cultured for 24 hours. INPP4B protein levels were measured by Western blot using β-actin as a loading control (top). INPP4B transcript levels were measured by performing a typical PCR (intermediate) or quantitative PCR (bottom). GAPDH was used as an internal control or a loading control. (C) HEp-2 cells were transfected with control siRNA (siCON) or 100 nM ERK-1/2 siRNA (siERK) for 48 hours and then irradiated (+) or irradiated with 10 Gy for 24 hours Did not do it(-). INPP4B and ERK protein levels were measured by western blotting using β-actin as a loading control. INPP4B transcript levels were measured by performing a typical PCR (intermediate) or quantitative PCR (bottom). GAPDH was used as an internal control or a loading control. The data were expressed as formal results or mean ± standard deviation (performed 3 times).
Figure 4 shows INPP4B-dependent modulation of radiation sensitivity in HEp-2 cells. (A and B) HEp-2 cells were transfected with empty vector (CON) or MYC-tagged INPP4B expression vector (INPP4B) and cultured for 24 hours. The cells were irradiated with the radiation dose indicated by radiation (A) or 10 Gy radiation (B). After 14 days, colony formation was quantified using an automated colony counter; The results are shown in the survival curves (A). After 48 hours, cell viability was measured using a FACScan flow cytometer; Data were expressed as the ratio of PI-positive cells (B, medium). The cleaved PARP and INPP4B protein levels were determined by Western blotting with β-actin as a loading control (B, right). (C and D) RR-HEp-2 cells were transfected with control siRNA (siCON) or 100 nM INPP4B siRNA (siINPP4B) and cultured for 48 hours. The cells were irradiated with the indicated amount of radiation (C) or 10 Gy of radiation. (D) Cell viability (C), cell viability (D, left), cell morphology (D, medium) and western blot (D, right) experiments were performed similar to A and B. The data were expressed as formal results or mean ± SD (4 runs).
Figure 5 shows INPP4B-dependent modulation of anticancer drug sensitivity in stably transfected INPP4B-HEp-2 cells. (A and B) HEp-2 (CON) and stable INPP4B-HEp-2 (INPP4B) were exposed to vehicle, 10 μM bleomycin, 5 μM etoposide, or 1 μM doxorubicin for 24 h. The truncated PARP and Myc-tagged INPP4B expression levels were measured by Western blotting using β-actin as a loading control (A, top). Cell death was measured using a FACScan flow cytometer; The data are expressed as the ratio of PI-positive cells (A, bottom). (C and D) INPP4B-HEp-2 cells were transfected with either control siRNA (siCON) or 100 nM INPP4B siRNA (siINPP 4B) for 48 h and then treated with vehicle or 1 μM doxorubicin for an additional 24 h. Western blotting (C, top), apoptosis (C, bottom) and cell morphology (D) experiments were performed as in A and B. (INPP4B- # 2, INPP4B- # 4 and INPP4B- # 6) were transfected with control siRNA (siCON) or 100 nM INPP4B siRNA (siINPP4B) for 48 hours Were treated with vehicle or 1 μM doxorubicin for 24 h. Cleaved PARP and Myc-tagged INPP4B were measured by western blotting with beta-actin as a loading control. The data were expressed as formal results or mean ± SD (4 runs).
6 is a graph showing the induction of apoptosis by the deprivation of INPP4B in lung cancer cells. (A) A549 and H1299 cells were transfected with either control siRNA (siCON) or 100 nM INPP4B siRNA (siINPP4B) for 48 hours. INPP4B protein levels were measured by Western blot using β-actin as a loading control (top). The level of INPP4B mRNA was measured by quantitative PCR using GAPDH as an internal control (bottom). (B and C) A549 (B) and H1299 (C) cells were transfected with control siRNA (-) or 100 nM INPP4B siRNA (+) for 48 h and then incubated with 1 μM doxorubicin for 24 hours or 48 hours 10 Gy of radiation was not irradiated (+) or irradiated (-). The cleaved PARP levels were determined by western blotting with β-actin as a loading control (top and middle). The morphology of the cells was observed under an optical microscope (bottom). The data were expressed as formal results or mean ± SD (4 runs).
7 is a graph showing changes in Akt activity due to the expression of INPP4B in laryngeal cancer and lung cancer cells. (A) HEp-2 cells and radiation-resistant RR-HEp-2 cells were irradiated with 10 Gy of radiation for the indicated time. Akt and GSK3 [alpha] / [beta] expression and phosphorylation levels were measured by Western blotting using [beta] -actin as a loading control. (B) RR-HEp-2 cells were transfected with control siRNA (siCON) or 100 nM INPP4B siRNA (siINPP4B) for 48 hours and then irradiated or not irradiated with 10 Gy radiation for an additional 6 hours. Akt and GSK3 [alpha] / [beta] expression and phosphorylation levels were measured by Western blotting using [beta] -actin as a loading control. (C and D) Control HEp-2 (CON) and stably transfected INPP4B-HEp-2 (INPP4B) cells (C) or RR-HEp-2, A549 and H1299 cells ) Or 100 nM INPP4B siRNA (siINPP4B) for 48 hours. Akt and GSK3 [alpha] / [beta] expression and phosphorylation levels were measured by Western blotting using [beta] -actin as a loading control. (E and F) RR-HEp-2 cells were transfected with control siRNA (siCON) or 100 nM INPP4B siRNA siINPP4B) for 48 hours and then irradiated or not irradiated with 10 Gy of radiation for an additional 6 hours. Akt (E) or PP2A (F) were immunoprecipitated from each sample and immunocomplexes were used to measure PP2A phosphorylase activity. The PP2A inhibitor okadaic acid was used as a positive control. The data were expressed as formal results or mean ± SD (4 runs).

이하, 실시예를 통하여 본 발명을 더욱 상세하게 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.
Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not construed as being limited by these embodiments.

실시예Example 1: 세포 준비 및 방사선 저항성 세포주 확립 1: Cell preparation and establishment of radiation resistant cell lines

폐암세포주 A549, H1299 및 H460, 후두암세포주 HEp-2, 대장암세포주 HCT116 및 유방암세포주 MCF7는 ATCC(American Type Culture Collection, Manassas, VA)로부터 구매하였다. 대장암세포주 HCT116 및 유방암세포주 MCF7는 10% FBS(fetal bovine serum), 50 μg/mL streptomycin 및 50 units/mL penicillin이 포함된 DMEM(Dulbecco’s modified Eagle’s medium, HEp-2)배지에서 배양하였으며, 폐암세포주 A549, H1299 및 H460는 10% FBS(fetal bovine serum), 50 μg/mL streptomycin 및 50 units/mL penicillin이 포함된 RPMIM 1640(Roswell Park Memorial Institute medium 1640)배지에서 배양하였다.Lung cancer cell lines A549, H1299 and H460, laryngeal cancer cell line HEp-2, colon cancer cell line HCT116 and breast cancer cell line MCF7 were purchased from ATCC (American Type Culture Collection, Manassas, VA). Colon cancer cell line HCT116 and breast cancer cell line MCF7 were cultured in DMEM (Dulbecco's modified Eagle's medium, HEp-2) medium containing 10% FBS (fetal bovine serum), 50 μg / mL streptomycin and 50 units / mL penicillin, A549, H1299 and H460 were cultured in RPMIM 1640 (Roswell Park Memorial Institute medium 1640) medium containing 10% FBS (fetal bovine serum), 50 μg / mL streptomycin and 50 units / mL penicillin.

방사선 저항성 세포주인 RR-HEp-2 및 이의 변이체는 Proteomics에 개시한 방법으로 확립하였다(Kim JS et al. Chloride intracellular channel 1 identified using proteomic analysis plays an important role in the radiosensitivity of HEp-2 cells via reactive oxygen species production. Proteomics 2010; 10:2589-604). RR-HEp-2 세포 집락에서 분리된 여러가지 서브클론(#3, #6, #7, #9, #13 및 #18)은 4 GY의 방사선 처리 후 자신의 집락 형성 생존분석법(clonogenic survival assay)을 기초로 하여 방사선 저항성 또는 방사선 민감성 HEp-2 변이체를 선정하였다. HEp-2 모세포는 대조군 세포로 유지하였다.The radiation resistant cell line RR-HEp-2 and its mutants were established by the method disclosed in Proteomics (Kim JS et al. Chloride intracellular channel 1 identified using proteomic analysis of the radiosensitivity of HEp-2 cells via reactive oxygen species production. Proteomics 2010; 10: 2589-604). Several subclones (# 3, # 6, # 7, # 9, # 13, and # 18) isolated from the RR-HEp-2 cell colonies had their own clonogenic survival assay after 4 GY of radiation treatment. Were selected for radiation-resistant or radiation-sensitive HEp-2 variants. HEp-2 cells were maintained as control cells.

상기 세포는 3.81Gy/min 방사선량으로 137Cs선(Atomic Energy of Canada, Mssissauga, Canada)을 사용하여 조사하거나, 또는 10 μM bleomycin(Sigma), 10 μM cisplatin(Sigma), 5 μM etoposide(Sigma), 또는 10 μM doxorubicin(Sigma)을 처리하였다. PD98059, SB203580 및 SP600125(Calbiochem)는 각각 ERK, p38 및 JNK를 억제하는데 사용하였다.
The cells were irradiated at a dose of 3.81 Gy / min using a 137 Cs line (Atomic Energy of Canada, Mssissauga, Canada) or 10 μM bleomycin (Sigma), 10 μM cisplatin (Sigma), 5 μM etoposide , Or 10 μM doxorubicin (Sigma). PD98059, SB203580 and SP600125 (Calbiochem) were used to inhibit ERK, p38 and JNK, respectively.

실시예Example 2: 방사선 저항성 또는 민감성  2: Radiation resistance or sensitivity 마커Marker 유전자 선별 Gene selection

HEp-2 모세포 및 RR-HEp-2 세포 주 (RR-HEp-2 및 RR-#6) 간에서 다르게 발현되는 유전자를 선별하여 새로운 방사선 저항성 또는 민간성 마커 유전자를 동정하고자 하였다.
Genes differentially expressed between HEp-2 and RR-HEp-2 cell lines (RR-HEp-2 and RR- # 6) were screened to identify new radiation resistant or fecal marker genes.

<1-1> 전형적인 <1-1> Typical PCRPCR 분석과 정량적인  Analysis and quantitative RTRT -- PCRPCR

RNA STAT-60 (Tel-Test B Inc. USA)을 사용하여 분리한 총 RNA는 ImProm-IITM 역전사효소(Promega)를 사용하여 역전사시켰다. 정량적인 RT-PCR 반응은 Chromo-4 cycler(Bio-Rad) 및 SYBR Premix Ex Taq(Takara Bio)를 사용하여 3회 실시하였다. 전형적인 RT-PCR 실험에서, 타겟 유전자로부터 증폭신호는 동일한 반응에서 GAPDH(glyceraldehyde-3-phosphate dehydrogenase)의 주기임계값(Ct 값, cycle threshold values)으로 표준화하였다.Total RNA isolated using RNA STAT-60 (Tel-Test B Inc. USA) was reverse transcribed using ImProm-IITM reverse transcriptase (Promega). Quantitative RT-PCR reactions were performed three times using Chromo-4 cycler (Bio-Rad) and SYBR Premix Ex Taq (Takara Bio). In a typical RT-PCR experiment, the amplified signal from the target gene was normalized to the cycle threshold values (Ct values) of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the same reaction.

다음과 같은 프라이머 및 조건으로 수행하였다: Bcl-xl(151-bp 생성물, 결합온도 55℃, 32 사이클), 센스 프라이머- 5'-CGG GCA TTC AGT GAC CTG AC-3'(서열번호 1) 및 안티센스 프라이머- 5'-TCA GGA ACC AGC GGT TGA AG-3'(서열번호 2); ERBB2(epidermal growth factor receptor 2)(402-bp 생성물, 결합 온도 55℃, 31 사이클), 센스 프라이머- 5'-CAT ATG TCT CCC GCC TTC TG-3'(서열번호 3) 및 안티센스 프라이머- 5'-CCC ACA CAG TCA CAC CAT AAC-3'(서열번호 4); GAPDH(305-bp 생성물, 결합 온도 55℃; 24 사이클), 센스 프라이머- 5'-CAT CTC TGC CCC CTC TGC TGA-3'(서열번호 5) 및 안티센스 프라이머- 5'-GGA TGA CCT TGC CCA CAG CCT-3'(서열번호 6); INPP4A(inositol polyphosphate 4-phosphatase type I)(404-bp 생성물, 결합 온도 55℃, 33 사이클), 센스 프라이머- 5'-GGC TGC CAG TCC ATA ATC-3'(서열번호 7) 및 안티센스 프라이머- 5'-CAC ACT TTC TCC CAC TCC-3'(서열번호 8); INPP4B(440-bp 생성물, 결합 온도 55℃, 31 사이클), 센스 프라이머 5'-AAA GAA TGC AGG TAC ACA G-3'(서열번호 9) 및 안티센스 프라이머 5'-CTC TGT GCT GCT CTT AGG-3'(서열번호 10); PTEN(580-bp 생성물, 결합 온도 55℃, 31 사이클), 센스 프라이머 5'-GAA AGA CAT TAT GAC ACC G-3'(서열번호 11) 및 안티센스 프라이머 5'-TTA GCA TCT TGT TCT GTT TG-3'(서열번호 12); p21 (439-bp 생성물, 결합 온도 55℃, 34 사이클), 센스 프라이머 5'-TGT CCG TCA GAA CCC ATG-3'(서열번호 13) 및 안티센스 프라이머 5'-GGA GTG GTA GAA ATC TGT CAT G-3'(서열번호 14).
5'-CGG GCA TTC AGT GAC CTG AC-3 '(SEQ ID NO: 1) and Bac-xl (151-bp product, binding temperature 55 ° C, 32 cycles) Antisense primer-5'-TCA GGA ACC AGC GGT TGA AG-3 '(SEQ ID NO: 2); 5'-CAT ATG TCT CCC GCC TTC TG-3 '(SEQ ID NO: 3) and antisense primer-5' -ERBB2 (402-bp product, -CCC ACA CAG TCA CAC CAT AAC-3 '(SEQ ID NO: 4); 3 '(SEQ ID NO: 5) and 5'-GGA TGA CCT TGC CCA CAG (SEQ ID NO: 5) and GAPDH (305-bp product, binding temperature 55 ° C, 24 cycles), sense primer-5'- CAT CTC TGC CCC CTC TGC TGA- CCT-3 '(SEQ ID NO: 6); 5'-GGC TGC CAG TCC ATA ATC-3 '(SEQ ID NO: 7) and antisense primer-5 '-CAC ACT TTC TCC CAC TCC-3' (SEQ ID NO: 8); (440-bp product, binding temperature 55 ° C, 31 cycles), sense primer 5'-AAA GAA TGC AGG TAC ACA G-3 '(SEQ ID NO: 9) and antisense primer 5'- CTC TGT GCT GCT CTT AGG-3 (SEQ ID NO: 10); (580-bp product, binding temperature 55 ° C, 31 cycles), sense primer 5'-GAA AGA CATAT GAC ACC G-3 '(SEQ ID NO: 11) and antisense primer 5'- TTA GCA TCT TGT TCT GTT TG- 3 ' (SEQ ID NO: 12); 3 '(SEQ ID NO: 13) and antisense primer 5'-GGA GTG GTA GAA ATC TGT CAT G- 3 ' (SEQ ID NO: 14).

그 외에, 방사선 저항성 또는 민감성 마커 유전자 확인을 위해 사용된 프라이머 서열 및 발현 양상을 하기 표 1에 나타냈다.
In addition, primer sequences and expression patterns used for identification of radiation resistant or sensitive marker genes are shown in Table 1 below.

유전자gene NCBIIDNCBIID 프라이머primer 서열번호SEQ ID NO: 발현양상Expression pattern INPP4B
INPP4B
8821
8821
F:GAAACAGAAAGAAGAAATACCF: GAAACAGAAAGAAGAAATACC 1515 과발현
Overexpression
R:CCCACTCTTCCTCATCATAGR: CCCACTCTTCCTCATCATAG 1616 PSAP
PSAP
5660
5660
F:GTGGTGCCAGAATGTGAAGF: GTGGTGCCAGAATGTGAAG 1717 과발현
Overexpression
R:CTGAGGGTAGAGGAGGAGAGR: CTGAGGGTAGAGGAGGAGAG 1818 CDK11A
CDK11A
728642
728642
F:GTCTGCACATCACCGAACF: GTCTGCACATCACCGAAC 1919 과발현
Overexpression
R:CATTTCTTCCTCACTTACTTCR: CATTTCTTCCTCACTTACTTC 2020 GLUT1
GLUT1
6513
6513
F:CTCATGGGCTTCTCGAAACF: CTCATGGGCTTCTCGAAAC 2121 과발현
Overexpression
R:CCGACTCTCTTCCTTCATCTCR: CCGACTCTCTTCCTTCATCTC 2222 JTB
JTB
10899
10899
F:CCACCTCTGCTGGTTGCTCF: CCACCTCTGCTGGTTGCTC 2323 과발현
Overexpression
R:CTATATGGACTCGATTTGCTTCCR: CTATATGGACTCGATTTGCTTCC 2424 ABCC5
ABCC5
10057
10057
F:AAACAGGATCAGTAAAGAAGF: AAACAGGATCAGTAAAGAAG 2525 과발현
Overexpression
R:AAGAACACCAGGATAACGR: AAGAACACCAGGATAACG 2626 MRFAP1
MRFAP1
93621
93621
F:ATTATATATGCCGCTCCTACF: ATTATATATGCCGCTCCTAC 2727 과발현
Overexpression
R:TGGCCTTCACTACCTGTTCR: TGGCCTTCACTACCTGTTC 2828 HNRNPUL1
HNRNPUL1
11100
11100
F:ACTCGTGAGGAAACTGCCF: ACTCGTGAGGAAACTGCC 2929 과발현
Overexpression
R:CTTGGAACAGGATCAGGGR: CTTGGAACAGGATCAGGG 3030 WDFY3
WDFY3
23001
23001
F:TTAAATGGTGCAACTCTGF: TTAAATGGTGCAACTCTG 3131 과발현
Overexpression
R:TGGATGGTACTAAGAAGAACR: TGGATGGTACTAAGAAGAAC 3232 NDRG1
NDRG1
10397
10397
F:AGATCTCAGGATGGACCCAAGF: AGATCTCAGGATGGACCCAAG 3333 저발현
Low expression
R: CATGCCCTGCACGAAGTACR: CATGCCCTGCACGAAGTAC 3434 CDC27
CDC27
996
996
F:ACAAATCTTATCTGGTGGAGF: ACAAATCTTATCTGGTGGAG 3535 저발현
Low expression
R:GTATCAGGTGAAATTACAGCR: GTATCAGGTGAAATTACAGC 3636

그 결과, HEp-2와 비교하여 RR-HEp-2에서 ERBB 및 Bcl-xl(양성 대조군)은 증가하였고, p21(음성 대조군)은 감소하는 것을 확인하여 체외시스템의 타당성을 확인하였다(도 1A, 상단). 일반적인 RT-PCR(reverse transcription-polymerase chain reaction)을 실시하여 얻은 자료에서 9가지 유전자의 mRNA 수준은 미처리된 대조군 및 HEp-2와 대조적으로 10 Gy의 방사선에 반응하는 HEp-2 또는 RR-HEp2에서 상향 조절(도 1A, 중간)되는 반면, 2가지 유전자는 하향조절(도 1A, 하단)됨을 확인하였다.As a result, ERBB and Bcl-xl (positive control) were increased in RR-HEp-2 and p21 (negative control) were decreased compared to HEp-2, Top). The mRNA levels of the nine genes in normal RT-PCR (reverse transcription-polymerase chain reaction) were compared with untreated controls and HEp-2 in HEp-2 or RR-HEp2 (FIG. 1A, middle) while the two genes were down-regulated (FIG. 1A, bottom).

아울러, 방사선 저항성 세포가 아닌 Hep-2 모세포에 비하여, 방사선 저항성 세포주인 RR-Hep2 세포주(RR-HEp-2 및 RR-#-6)에서 INPP4B(Inositol polyphosphate-4-phosphatase type II), PSAP(Prosaposin), CDK11A(Cell division cycle2-like 2), GLUT1(Glucose transport type 1), JTB(Jumping transport type 1), ABCC5(ATP-binding cassette, sub-family C (CFTR/MRP), member 5), MRFAP1(Mof4 family associated protein 1), HNRNPUL1(Heterogeneous nuclear ribonucleoprotein U-like 1) 및 WDFY3(WD repeat and FYVE domain containing 3)이 과발현되고, NDRG1(N-myc downstream regulated gene 1) 및 CDC27(Cell division cycle 27 homolog)이 저발현되는 것을 확인하였다(표 1 및 도 1A 내지 1C). 상기 유전자들 중에서 특히, PSAP, CDK11A, MRFAP1, HNRNPUL1, WDFY3 및 CDC27인 6개 유전자가 방사선 저항성과 알려져 있지 않은 신규한 방사선 저항성 또는 민감성 마커가 될 수 있음을 확인하였다.
Inositol polyphosphate-4-phosphatase type II (INPP4B), and PSAP (RR-HEp-2) were detected in the radiation-resistant cell lines RR-Hep2 and RR- Prosaposin, Cell division cycle 2-like 2, GLUT1 (Glucose transport type 1), Jumping transport type 1 (JTB), ABCC5 (ATP-binding cassette, CFTR / MRP) (NF-I) and NF-κB (NF-κB), and NF-κB (NF-κB) 27 homolog) was underexpressed (Table 1 and Figures 1A-1C). Among these genes, 6 genes, specifically PSAP, CDK11A, MRFAP1, HNRNPUL1, WDFY3 and CDC27, were confirmed to be novel radiation resistant or sensitive markers with unknown radiation resistance.

이와 같은 결과들은 상기 유전자가 정상 암세포보다 방사선 저항성 또는 민감성 세포주들에서 발현이 특이적으로 증가하거나 감소하여, 상기 유전자의 발현 양상을 분석하면 방사선 저항성 또는 민감성을 특이적으로 진단할 수 있음을 시사한다.
These results suggest that the gene specifically increases or decreases the expression in radiation resistant or sensitive cell lines than in normal cancer cells and that the expression of the gene can be analyzed to specifically diagnose radiation resistance or sensitivity .

실시예Example 3:  3: INPP4BINPP4B 기능 분석 Function analysis

종양 방사선저항성과 관련되어, 상기 실시예 2에서 선정한 INPP4B(inositol polyphosphate 4-phosphatase type II, 이하'INPP4B'로 명명함)의 기능은 대부분 밝혀지지 않았기 때문에, 본 발명에서는 먼저 방사선저항성 표현형을 중점으로 INPP4B의 역할 확인 및 방사선을 조사한 후, 그 기능을 분석하였다.
Since most of the functions of INPP4B (inositol polyphosphate 4-phosphatase type II, hereinafter referred to as 'INPP4B') selected in Example 2 were not disclosed in relation to tumor radiation resistance, in the present invention, After confirming the role of INPP4B and examining the radiation, its function was analyzed.

<3-1> <3-1> 집량형석Bulk fluoride 분석( analysis( ClonogenicClonogenic assayassay ))

세포생존률을 집락형성분석법으로 측정하였다. 보다 상세하게, 상기세포에 방사선량을 단독으로 조사한 다음 즉시 트립신을 처리해서 떼어내고 희석한 후, 60mm 조직배양접시에 다양한 세포밀도(각 조직배양접시에 각 0, 2, 4 및 6 Gy의 방사선 조사를 위한 200, 400, 1500 및 3000 세포)로 분주하였다. 상기 콜로니를 14일 동안 방사선을 조사한 후, 메탄올로 고정시키고, 트립판블루용액으로 염색하여 관찰하였다. 50개 이상의 세포로 이루어진 콜로니만 콜로니 카운터(Imaging Products)를 사용하여 살아있는 세포 수를 측정하였다.
Cell viability was measured by colony formation assay. More specifically, the cells were irradiated with a single dose of radiation, immediately treated with trypsin, and then diluted. Thereafter, a 60 mm tissue culture dish was coated with various cell densities (0, 2, 4 and 6 Gy of radiation 200, 400, 1500 and 3000 cells for irradiation). The colonies were irradiated for 14 days, fixed with methanol, stained with trypan blue solution and observed. The number of living cells was measured using a colony only colony counter (Imaging Products) composed of 50 or more cells.

그 결과, RR-HEp-2 및 RR-#6 세포주는 집락형성생존분획법(clonogenic survival assays)을 실시한 결과(도 1B, 상단), 뚜렷한 방사선 표현형을 나타내었으며 HEp-2와 대조적으로 높은 농도의 INPP4B가 발현되었다(도 1B, 하단). 또한 본 발명에서는 방사선 민감성 및 방사선 저항성 HEp-2 클론을 사용하여 방사선저항성 표현형과 INPP4B의 관계를 확인하였다. 각 클론의 방사선 민감성은 4 Gy 방사선을 처리한 다음 콜로니 형성 분석을 통하여 확인하였다(도 1C, 상단).As a result, the RR-HEp-2 and RR- # 6 cell lines showed a distinct radiophenotype by clonogenic survival assays (FIG. 1B, top) INPP4B was expressed (Fig. 1B, bottom). In the present invention, the relationship between the radiation resistance phenotype and INPP4B was confirmed by using radiation-sensitive and radiation-resistant HEp-2 clones. The radiation sensitivity of each clone was confirmed by analysis of colony formation after treatment with 4 Gy radiation (Fig. 1C, top).

그 결과, 방사선 저항성 표현형(RR-#3, RR-#13 및 RR-#6)을 나타낸 클론은 HEp-2와 대조적으로 INPP4B 단백질의 두드러진 상향조절이 나타난 반면, INPP4B 수준은 방사선민감성 클론(RS-#7, RS-#9 및 RS-#18)에서 단지 미미하게 변화를 나타냈다(도 1C, 하단). 상기와 같은 결과들은 INPP4B의 증가된 수준이 HEp-2세포에서 방사선 저항성의 발생과 관련이 있을 수 있음을 시사한다.
As a result, the clones displaying the radiation resistant phenotype (RR- # 3, RR- # 13 and RR- # 6) showed pronounced upregulation of the INPP4B protein in contrast to HEp-2, while the INPP4B level was a radiation sensitive clone - # 7, RS- # 9 and RS- # 18) (Fig. 1C, bottom). These results suggest that increased levels of INPP4B may be associated with the development of radiation resistance in HEp-2 cells.

<3-2> 세포사멸 분석(<3-2> Cell death analysis ApoptosisApoptosis analysis분석 ))

2 × 105개의 세포를 60mm 접시에 분주하여 표시된 실험조건에 따라서 처리하였다. 세포사멸은 PARP(cleaved poly (ADP-ribose) polymerase)를 웨스턴 블랏 분석으로 측정하였으며 또한 광학현미경하에서 세포사멸된 세포형태를 관찰하였다. 세포사멸을 정량화하기 위하여 상기 세포를 FACScan flow cytometer (Becton Dickson)으로 분석하였다.
2 x 10 &lt; 5 &gt; cells were dispensed into 60 mm dishes and processed according to the indicated experimental conditions. Cell death was measured by western blot analysis of cleaved poly (ADP-ribose) polymerase (PARP) and cell morphology was observed under an optical microscope. The cells were analyzed with a FACScan flow cytometer (Becton Dickson) to quantify cell death.

<3-3> <3-3> 웨스턴Western 블랏Blat 분석( analysis( WesternWestern blotblot analysis분석 ))

세포를 프로제아제 및 포스파타제 억제제(phosphatase inhibitors)가 포함된 50 mM TRIS-HCl (pH 7.4), 150 mM NaCl, 1% Nonidet P-40 및 0.1% SDS(sodium dodecyl sulfate)를 함유한 완충용액으로 용해하였다. 단백질을 검출하기 위하여 다음과 같은 항체들을 사용하였다: 래빗 폴리클로날 항-phospho-Akt (Ser473), 항-Akt, antiphospho-p38, 항-p38, 항-phospho-JNK, 항-JNK 및 항-절단된-PARP (Asp214) (Cell Signaling Technology); 래빗 모노클로날 항-phospho-GSK3α/β (Ser21/9) (Cell Signaling Technology); 마우스 모노클로날 항-ERK (BD Transduction Laboratories); 마우스 모노클로날 항-phospho-ERK 및 항-myc (Santa Cruz Biotechnology Inc.); 마우스 모노클로날 항-β-actin (Sigma); 고트 폴리클로날 항-INPP4B (Santa Cruz Biotechnology, Inc.).
Cells were lysed with buffer containing 50 mM TRIS-HCl (pH 7.4), 150 mM NaCl, 1% Nonidet P-40 and 0.1% SDS (sodium dodecyl sulfate) containing phosphatase inhibitors and phosphatase inhibitors Respectively. The following antibodies were used to detect the proteins: Rabbit polyclonal anti-phospho-Akt (Ser473), anti-Akt, antiphospho-p38, anti-p38, anti-phospho-JNK, anti- Truncated-PARP (Asp214) (Cell Signaling Technology); Rabbit monoclonal anti-phospho-GSK3? /? (Ser21 / 9) (Cell Signaling Technology); Mouse monoclonal anti-ERK (BD Transduction Laboratories); Mouse monoclonal anti-phospho-ERK and anti-myc (Santa Cruz Biotechnology Inc.); Mouse monoclonal anti-beta-actin (Sigma); Goto-polyclonal anti-INF4B (Santa Cruz Biotechnology, Inc.).

<3-4> <3-4> siRNAsiRNA 에 의한 On by INPP4BINPP4B And ERKdERKd 의 녹다운 분석(Analysis of KnockdownKnockdown ofof INPP4BINPP4B andand ERK  ERK byby siRNAsiRNA ))

인간 INPP4B siRNA 5'-CAG AAU GUU UGA GUC ACU A-3'(서열번호 37), 인간 ERK-1 siRNA 5'-CUC UCU AAC CGG CCC AUC U-3'(서열번호 38) 및 인간 ERK-2 siRNA 5'-CAG AUC UUU ACA AGC UCU U-3'(서열번호 39)를 합성하였다. 밝혀진 유전자서열에 대하여 특별한 상동성을 나타내지 않으며 또한 유전자발현을 조절하지 않는 스크램블된 siRNAs는 음성 대조군으로 사용하였다.Human ERK-1 siRNA 5'-CUC UCU AAC CGG CCC AUC U-3 '(SEQ ID NO: 38) and human ERK-1 siRNA 5'-CAG AUC UUU ACA AGC UCU U-3 '(SEQ ID NO: 39) was synthesized. Scrambled siRNAs that did not show any particular homology to the identified gene sequences and that did not regulate gene expression were used as negative controls.

상기 세포는 제조사의 제조방법에 따라 Metafectene reagent (Biontex)를 사용하여 5시간 동안 무혈청 배양배지에서 100 nM siRNA를 처리하여 일시적으로 트랜스펙션시켰다. 상기 세포를 48 시간 동안 더 유지하여, 타겟 단백질 결손을 웨스턴 블랏 및 정량 RT-PCR 분석으로 측정하였다.
The cells were transiently transfected by treatment with 100 nM siRNA in serum-free culture medium for 5 hours using Metafectene reagent (Biontex) according to the manufacturer's manufacturing method. The cells were further maintained for 48 hours, and target protein defects were determined by Western blot and quantitative RT-PCR analysis.

<3-5> <3-5> INPP4BINPP4B 구조체 및  Structures and 트랜스펙션Transfection

인간 INPP4B에 대한 cDNA는 KpnI 및 XhoI를 도입하기 위하여 설계된 특정 프라이머(센스 5'-GGG GTA CCG AGC CAC CAT GGA AAT TAA AGA GGA AGG G-3':서열번호 40, 및 안티센스 5'-CCG CTC GAG CGG GGT GTC AGC TTT TCC ATA AG-3':서열번호 41) 및 pCMV-Sport6-INPP4B (Open Biosystems)로 RT-PCR을 실시하여 준비하였다. 상기 CDNA를 pcDNA3.1 (+) Myc/His vector (Invitrogen)로 클로닝하였다. HEp-2 세포는 Metafectene reagent (Biontex)를 사용하여 발현 백터로 트랜스펙션시켰다. 안정적인 세포주를 확립하기 위하여, HEp-2 세포를 INPP4B cDNA 벡터로 감염시킨 후, 24시간 동안 기본 배양 배지에서 배양하였다. 배양된 세포에 1 mg/mL G418을 첨가하여 트랜스펙션된 세포를 선택하였다. INPP4B를 발현하는 안정적인 HEp-2세포를 웨스턴 블랏 분석으로 확인하였다.
CDNA for human INPP4B was prepared by PCR using specific primers (sense 5'-GGG GTA CCG AGC CAC CAT GGA AAT TA AGA GGA AGG G-3 ': SEQ ID NO: 40, and antisense 5'-CCG CTC GAG CGG GGT GTC AGC TTT TCC ATA AG-3 ': SEQ ID NO: 41) and pCMV-Sport6-INPP4B (Open Biosystems). The CDNA was cloned into pcDNA3.1 (+) Myc / His vector (Invitrogen). HEp-2 cells were transfected with an expression vector using Metafectene reagent (Biontex). To establish a stable cell line, HEp-2 cells were infected with the INPP4B cDNA vector and cultured in a basic culture medium for 24 hours. Transfected cells were selected by adding 1 mg / mL G418 to the cultured cells. Stable HEp-2 cells expressing INPP4B were identified by Western blot analysis.

<3-6> <3-6> 포스파타제Phosphatase 분석( analysis( PhosphatasePhosphatase assayassay ))

세포는 50 mM TRIS-HCl (pH 7.4), 150 mM NaCl, 0.5% Nonidet P-40, 7.5% glycerol, 1 mM EDTA, 1 mM Na3VO4 및 complete protease inhibitors가 함유된 완충용액으로 용해시켰다. 상기 세포 용해물은 항-Akt 또는 항-PP2A 항체(Santa Cruz Biotechnology, Inc.)로 침전시켰다. 면역혼합물은 protein A sepharose beads를 사용하여 수집하였다; 세척된 비드의 1/4은 Akt 및 PP2A의 면역침강 효율을 확인하기 위하여 웨스턴 블랏 분석을 실시하는데 사용하였다. 나머지 3/4 비드는 제조사의 방법에 따라 RediPlat96 EnzChek Serine/Threonine Phosphatase assay kit [Invitrogen (Molecular Probes)]를 사용하여 PP2A 활성을 분석하였다. 형광물질은 Victor2 fluorescence microplate reader (Perkin Elmer Corp.)를 사용하여 측정하였다. PP2A 활성을 억제하는 오카다산(Okadaic acid, Sigma)을 양성 대조군으로 사용하였다.
Cells were lysed in buffer solution containing 50 mM TRIS-HCl (pH 7.4), 150 mM NaCl, 0.5% Nonidet P-40, 7.5% glycerol, 1 mM EDTA, 1 mM Na3VO4 and complete protease inhibitors. The cell lysate was precipitated with anti-Akt or anti-PP2A antibody (Santa Cruz Biotechnology, Inc.). Immune mixtures were collected using protein A sepharose beads; A quarter of the washed beads were used to perform Western blot analysis to confirm the immunoprecipitation efficiency of Akt and PP2A. The remaining 3/4 beads were analyzed for PP2A activity using the RediPlat96 EnzChek Serine / Threonine Phosphatase assay kit [Invitrogen (Molecular Probes)] according to the manufacturer's method. The fluorescence was measured using a Victor2 fluorescence microplate reader (Perkin Elmer Corp.). Okadaic acid (Sigma), which inhibits PP2A activity, was used as a positive control.

실험예Experimental Example 1:  One: INPP4BINPP4B 유도는 방사선 자극이나 특정세포유형에 제한되지 않음을 확인 Ensure induction is not limited to radiation stimulation or specific cell types

방사선에 대한 INPP4B 반응을 조사하기 위하여, HEp-2 모세포 및 RR-HEp-2에 10 Gy를 처리하였다. 그 결과, 방사선에 대해 INPP4B 단백질 수준은 HEp-2 모세포에서 시간 의존성으로 증가하였다(도 2A, 상단); 이러한 유도는 RR-HEp-2 세포에서 더욱더 심하게 나타났다(도 2A, 하단). 상기 결과는 INPP4B는 방사선 반응 단백질이며 이 단백질의 과다축적은 HEp-2 세포에서 방사선 저항성 표현형을 획득하기 위한 기작이 될 수 있음을 시사한다. INPP4B 발현의 방사선-매개 유도가 HEp-2 세포에 한정되는지를 조사하기 위하여, A549, H460, HCT116 및 MCF7 세포를 포함한 다른 인간 암세포에 10 Gy 방사선을 처리하였다. 정량 RT-PCR을 실시한 결과, 상기 방사선 처리가 모든 암세포주에서 INPP4B 전사수준의 증가를 유도함을 확인하였다(도 2B). 이러한 결과는 상기 현상이 모든 인간 암세포에서 일어나는 것임을 시사한다.
To investigate the INPP4B response to radiation, HEp-2 cells and RR-HEp-2 were treated with 10 Gy. As a result, INPP4B protein levels for radiation increased in a time-dependent manner in HEp-2 cells (Fig. 2A, top); This induction was even more severe in RR-HEp-2 cells (Fig. 2A, bottom). These results suggest that INPP4B is a radiolabeled protein and that the overaccumulation of this protein can be a mechanism to obtain the radiation resistance phenotype in HEp-2 cells. Other human cancer cells, including A549, H460, HCT116 and MCF7 cells, were treated with 10 Gy radiation to investigate whether the radiation-mediated induction of INPP4B expression was restricted to HEp-2 cells. Quantitative RT-PCR showed that the radiation treatment induced an increase in INPP4B transcription level in all cancer cell lines (FIG. 2B). These results suggest that the above phenomenon occurs in all human cancer cells.

또한 방사선 저항성 유전자의 조절은 종종 여러가지 유형의 암에서 항암제 저항성의 발생에 있어서, 하나의 역할을 수행하기 때문에, INPP4B가 HEp-2 세포에서 블레오마이신(bleomycin), 시스플라틴(cisplatin), 에토포시드(etoposide) 및 독소루비신(doxorubicin)을 포함하는 항암치료제에 의해 조절되는지를 조사하였다. 놀랍게도 정량 RT-PCR을 실시한 결과, 모든 약들은 INPP4B mRNA 수준을 증가하도록 유도한 반면, INPP4B 유전자의 상동체인 INPP4A는 상기 약들로 유도되지 않았다(도 2C).In addition, since the regulation of radiation resistance genes often plays a role in the development of resistance to anticancer drugs in various types of cancer, INPP4B has been shown to inhibit bleomycin, cisplatin, and etoposide in HEp- etoposide, and doxorubicin. Surprisingly, quantitative RT-PCR showed that all drugs induced increased levels of INPP4B mRNA, while INPP4A, a homologue of the INPP4B gene, was not induced with these drugs (FIG. 2C).

또한 상기 방사선유도 상향 조절이 다른 지질 포스파타제로 확장되는지, 또는 3-포스포이노시티드(3-phosphoinositide) 지질 네트워크를 조절하는 INPP4B로 제한되는지를 조사하였다. 그 결과, 정량 PCR(도 2D, 상단) 및 일반 PCR(도 2D, 하단) 분석을 통하여 INPP4B와 달리 지질 포스타파제 INPP4A 및 PTEN은 방사선 처리로 유도되지 않음을 확인하였다.
We also investigated whether the radiation-induced up-regulation is extended to other lipid phosphatases, or to INPP4B, which regulates the 3-phosphoinositide lipid network. As a result, it was confirmed that lipid phosphatase INPP4A and PTEN were not induced by radiation treatment, unlike INPP4B, by quantitative PCR (FIG. 2D, top) and general PCR (FIG. 2D, bottom) analysis.

상기와 같은 결과들은 INPP4B가 HEp-2세포의 방사선 저항성 표현형 발생을 조절하는 유일한 지질 포스파타제임을 시사하는 것이다.
These results suggest that INPP4B is the only lipid phosphatase that controls the development of radiation resistant phenotype of HEp-2 cells.

실험예Experimental Example 2:  2: INPP4BINPP4B of ERKERK -의존성 - dependency 유도가Judo HEpHEp -2 세포의 방사선 저항성 표현형 촉진 확인-2 cell to confirm the radiation resistance phenotype promotion confirmation

방사선은 MAPK(mitogen-activated protein kinase) 단백질을 활성화하기 때문에, INPP4B 발현 유도가 HEp-2에서 MAPK 활성에 관여하는지 여부를 조사하였다. 그 결과, 10Gy 방사선은 해당 단백질 수준의 변화없이 ERK, JNK(c-Jun N-terminal kinase) 및 p38 kinase의 활성 형태를 증가시켰다(도 3A).Since radiation activates mitogen-activated protein kinase (MAPK) protein, we investigated whether induction of INPP4B expression is involved in MAPK activity in HEp-2. As a result, 10Gy radiation increased the active forms of ERK, JNK (c-Jun N-terminal kinase) and p38 kinase without changing the level of the corresponding protein (Fig. 3A).

그 다음, 방사선을 처리하기 전에 각 MAPK의 특정 억제제를 세포에 전처리하였다. 그 결과, 도 3B에 나타난 바와 같이, PD98059에 의한 ERK 억제는 INPP4B 단백질(상단) 및 mRNA(중간) 수준에서 방사선 유도 증가를 차단하지만, SP600125에 의한 JNK 억제 또는 SB203580으로 p38 kinase 억제는 INPP4B 수준에 아무런 영향을 미치지 않았다. 정량 PCR을 실시하여 INPP4B 전사수준은 미처리된 대조군 세포와 비교하여 방사선이 처리된 HEp-2 세포에서 3.2배 증가하였고, 이와 같은 유도는 ERK 억제와 함께 1.3배 감소함을 확인하였다(도 3B, 하단).Then, specific inhibitors of each MAPK were pretreated with the cells prior to treatment with radiation. As a result, as shown in Fig. 3B, ERK inhibition by PD98059 blocks radiation-induced increase at the INPP4B protein (upper) and mRNA (intermediate) levels, while JNK inhibition by SP600125 or p38 kinase inhibition by SB203580 is at the INPP4B level It had no effect. Quantitative PCR showed that INPP4B transcription level was 3.2-fold increased in radiation-treated HEp-2 cells compared to untreated control cells, and that this induction decreased 1.3-fold with ERK inhibition (Fig. 3B, bottom ).

INPP4B 발현을 조절하는 내생적 ERK를 확인하기 위하여 HEp-2 세포에서 siRNA(small interfering RNA)를 사용하여, 내생적 ERK를 넉다운(knock down)시켰다. 그 결과, 도 3C에 나타난 바와 같이 siRNA 처리는 ERK 발현을 효과적으로 넉다운시켰다. 특히, 웨스턴 블랏(도 3C, 상단) 및 일반 RT-PCR(도 3C, 중간)을 실시하여, 내생적 ERK 결실이 방사선에 의한 INPP4B유도를 두드러지게 억제함을 확인하였다(도 3C). 정량 PCR분석으로, siRNA로 조절된 ERK 넉다운은 방사선만 처리한 세포와 비교하여 방사선이 유도한 INPP4B mRNA수준을 38% 가까이 감소함을 확인하였다(도 3C, 하단). 이와 같은 결과는, 스트레스에 의해 유도된 INPP4B 발현이 ERK신호에 의존하지만 JNK 또는 p38신호에는 의존하지 않음을 시사하는 것이다.
Endogenous ERKs were knocked down using siRNA (small interfering RNA) in HEp-2 cells to identify endogenous ERKs that regulate INPP4B expression. As a result, siRNA treatment effectively knocked ERK expression as shown in Fig. 3C. In particular, Western blot (FIG. 3C, top) and general RT-PCR (FIG. 3C, middle) were performed to confirm that endogenous ERK deletion significantly inhibited INPP4B induction by radiation (FIG. 3C). Quantitative PCR analysis confirmed that siRNA-regulated ERK knockdown reduced radiation-induced INPP4B mRNA levels by 38% compared to cells treated with radiation only (Fig. 3C, bottom). These results suggest that stress induced induction of INPP4B is dependent on ERK signal but not on JNK or p38 signal.

INPP4B가 암 방사선 저항성에 필수적인 것인지를 확인하기 위하여, HEp-2 모세포에서 야생형 Myc으로 태그된 INPP4B를 과발현시켰다. 집락형성 생존분석을 실시한 결과, INPP4B의 과발현은 방사선에 노출된 후 세포생존을 증가시켰다(도 4A). 유세포분석 결과, 10Gy 방사선을 처리하여 유도된 세포사멸은 HEp-2 모세포(33% 이하)와 비교하여, INPP4B가 과발현된 HEp-2 세포에서 48시간째에 두드러지게 감소함을 확인하였다(도 4B, 왼쪽). 상기 결과는 세포형태를 관찰하여 확정하였다(도 4B, 중간). Overexpression of INPP4B tagged with wild-type Myc in HEp-2 cells was performed to confirm that INPP4B was essential for cancer radiation resistance. As a result of the colony formation survival analysis, overexpression of INPP4B increased cell survival after exposure to radiation (FIG. 4A). As a result of flow cytometry analysis, it was confirmed that cell death induced by treatment with 10 Gy radiation was markedly reduced at 48 hours in HEp-2 cells overexpressing INPP4B compared to HEp-2 cells (below 33%) , left). The results were confirmed by observing the cell morphology (Fig. 4B, middle).

또한 세포사멸의 마커인 절단된 PARP 수준이 방사선이 처리된 HEp-2 모세포와 비교하여 방사선이 처리되어 INPP4B가 과발현되는 HEp-2 세포에서 또한 감소(도4B, 오른쪽)하는 것을 확인하였으며, 이는 상기 결과와 일치한다. 반대로, RR-HEp-2 세포에서 내생적 INPP4B의 siRNA 매개 넉다운이 방사선을 처리한 다음 생존을 감소시킴을 확인하였다(도 4C).In addition, it was confirmed that the cut-off level of PARP, which is a marker of apoptosis, is also reduced in HEp-2 cells in which INPP4B is overexpressed (FIG. 4B, right) compared with radiation treated HEp-2 cells, The results are consistent. Conversely, it was confirmed that siRNA mediated knockdown of endogenous INPP4B in RR-HEp-2 cells reduced survival after radiation treatment (Fig. 4C).

유세포분석으로 측정한 결과, 내생적 INPP4B 결실은 방사선 유도 RR-HEp-2 세포사멸을 16%(방사선 단독)부터 28%(방사선 및 INPP4B 넉다운 처리)까지 증가시켰고(도 4D, 왼쪽), 이와 같은 결과는 세포형태를 관찰하여 다시 확인하였다(도 4D, 중간). INPP4B를 타겟으로 하는 siRNA는 INPP4B를 효과적으로 넉다운시키며 실질적으로 방사선이 처리된 RR-HEp-2 세포에서 절단된-PARP 수준이 증가(도 4D, 오른쪽)함을 확인하였다. 상기와 같은 결과들은 INPP4B이 방사선 저항성을 증가함으로써 방사선 유도 세포사멸에 대해 HEp-2 세포를 선택적으로 보호할 수 있음을 시사한다.
As measured by flow cytometry, endogenous INPP4B deletion increased radiation-induced RR-HEp-2 cell death from 16% (radiation alone) to 28% (radiation and INPP4B knockdown treatment) (FIG. 4D, left) The results were confirmed again by observing the morphology of the cells (Fig. 4D, middle). SiRNA targeting INPP4B effectively knocked INPP4B and found that the -PARP level cleaved in the substantially irradiated RR-HEp-2 cells was increased (Fig. 4D, right). These results suggest that INPP4B can selectively protect HEp-2 cells against radiation-induced cell death by increasing radiation resistance.

실험예Experimental Example 3:  3: INPP4BINPP4B of HEpHEp -2 세포에서 항암제 내성 발생과 관련성 확인-2 Cells with Anti-Cancer Resistance

INPP4B가 항암제에 대한 저항성을 조절할 수 있는지를 확인하기 위하여, Myc가 태그된 INPP4B를 안정적으로 발현하는 HEp-2 세포(INPP4B-HEp-2 세포)를 확립하였다. 그 결과, 놀랍게도 INPP4B-HEp-2 세포는 항암제 bleomycin, cisplatin, etoposide 및 doxorubicin에 의해 추가로 유도된 INPP4B 기초 발현수준이 현저하게 증가하는 것을 확인하였다. 상기 세포는 항암제들에 의해 유도된 세포사멸에 저항성을 갖고 있음을 절단된-PARP에 대한 웨스턴 블랏(도 5A, 상단) 및 유세포분석으로 확인하였다(도 5A, 하단). 비록 개개 약물에 의해 유도된 INPP4B의 정도는 다르나, INPP4B의 항-세포사멸 효과는 모든 항암제-처리 세포에서 형태학의 변화에 의해 확인하였다(도 5B).HEp-2 cells (INPP4B-HEp-2 cells) stably expressing Myc-tagged INPP4B were established in order to confirm whether INPP4B can regulate resistance to anticancer agents. As a result, surprisingly, INPP4B-HEp-2 cells showed markedly increased levels of basal INPP4B expression induced by the anti-cancer agents bleomycin, cisplatin, etoposide and doxorubicin. The cells were found to be resistant to anti-cancer drug-induced apoptosis by Western blot (FIG. 5A, top) and flow cytometry analysis of truncated-PARP (FIG. 5A, bottom). Although the degree of INPP4B induced by individual drugs was different, the anti-apoptotic effect of INPP4B was confirmed by morphological changes in all anticancer-treated cells (Fig. 5B).

또한, INPP4B-HEp-2 세포에서 항-세포사멸 표현형에 대한 INPP4B 의존성을 확인하기 위하여, siRNA로 INPP4B를 억제하였다. 그 결과, INPP4B siRNA는 INPP4B발현을 효과적으로 차단하였고, 항암제로 유도된 세포사멸에 대해 현저하게 재감작시킴을 웨스턴 블랏으로 확인하였다(도 5C, 상단). 유세포분석 결과, INPP4B 결실은 세포사멸을 촉진하며, 33%(doxorubicin이 처리된 INPP4B-HEp-2 세포)에서 60%(INPP4B 에 대한 siRNA로 감염된 doxorubicin이 처리된 INPP4B-HEp-2 세포)까지 세포사멸을 점진적으로 증가시킴을 확인하였다(도 5C, 하단). 이와 유사한 결과는 형태학적 변화 관찰로 확인하였다(도 5D). 다른 안정적인 INPP4B-HEp-2 클론((#2, #4 및 #6)을 사용하여 이와 같은 민감화 효과를 추가로 확인하였다. 또한, 상기 항암제-저항성 변이체들은 절단된-PARP에 대한 웨스턴 블랏 결과, INPP4B 넉다운후, 독소루비신-유도 세포사멸이 증가하는 것을 확인하여, 항암제 저항성 발생에 있어서, INPP4B가 양성 바이오 마커임을 확인할 수 있었다(도 5E).
In addition, INPP4B was inhibited by siRNA in order to confirm INPP4B dependence on anti-apoptotic phenotype in INPP4B-HEp-2 cells. As a result, INPP4B siRNA effectively blocked INPP4B expression, and remarkably re-sensitized to anti-cancer drug-induced apoptosis was confirmed by Western blot (Fig. 5C, top). As a result of the flow cytometry analysis, INPP4B deletion promoted apoptosis, and up to 60% (INPP4B-HEp-2 cells treated with doxorubicin infected with siRNA for INPP4B) in 33% (INPP4B-HEp-2 cells treated with doxorubicin) (Fig. 5C, bottom). &Lt; tb &gt;&lt; TABLE &gt; Similar results were confirmed by observation of morphological changes (Fig. 5D). This sensitization effect was further confirmed using other stable INPP4B-HEp-2 clones (# 2, # 4 and # 6). Further, the anticancer-resistant mutants were confirmed by western blotting on truncated- After INPP4B knockdown, it was confirmed that doxorubicin-induced cell death was increased, and it was confirmed that INPP4B was a positive biomarker in generation of anticancer resistance (Fig. 5E).

실험예Experimental Example 4: 저항성 표현형에서  4: Resistant phenotype INPP4BINPP4B 역할의 폐암세포에서  In the role of lung cancer cells AktAkt 활성 변화 확인 Check for changes in activity

INPP4B의 저항성 기능이 HEp-2 후두암세포에 한정되는지를 확인하기 위하여, 방사선 및 항암제에 대한 저항성을 갖는 A549 및 H1299 폐암세포를 조사하였다. 그 결과, 도 6A에 나타난 바와 같이, 웨스턴 블랏(상단) 및 정량 PCR분석(하단)으로, INPP4B siRNA가 A549 및 H1299 세포의 INPP4B를 효과적으로 넉다운시킴을 확인하였다. HEp-2 세포에서 얻어진 결과와 동일하게, 절단된 PARP에 대한 웨스턴 블랏(도 6B, 상단 및 중간) 및 형택학적 변화를 조사(도 6B, 하단)함으로써, INPP4B 침묵현상은 A549세포에서 독소루비신 및 방사선에 의해 유도된 세포사멸을 현저하게 증가시킴을 확인하였다. 상기 실험과 동일한 조건 하에서, 이러한 민감화 효과는 A549 세포에서보다 H1299 세포에서 더 크게 나타났다(도 6C). p53은 H1299 세포(p53 결핍) 및 A549세포(야생형 p53) 사이에 차이가 있기 때문에, 상기 결과는 저항성에 대한 INPP4B의 역할은 p53 신호와 독립적임을 시사한다.In order to confirm that the resistance function of INPP4B is restricted to HEp-2 laryngeal cancer cells, A549 and H1299 lung cancer cells having resistance to radiation and anticancer drugs were investigated. As a result, it was confirmed that INPP4B siRNA efficiently knockdown INPP4B of A549 and H1299 cells with Western blotting (top) and quantitative PCR analysis (bottom), as shown in Fig. 6A. Similar to the results obtained in HEp-2 cells, the INPP4B silent phenomenon was detected in A549 cells by doxorubicin and radiation (Fig. 6B, top and middle) Lt; RTI ID = 0.0 &gt; cell death &lt; / RTI &gt; Under the same conditions as in the above experiment, this sensitization effect was greater in H1299 cells than in A549 cells (Fig. 6C). Because p53 differs between H1299 cells (p53 deficient) and A549 cells (wild type p53), the results suggest that the role of INPP4B for resistance is independent of the p53 signal.

이에, 방사선이 Akt 활성을 조절할 수 있는지 여부를 조사하였다. 또한 INPP4B가 Akt 활성을 양성적으로 조절하는지를 확인하기 위하여, RR-HEp-2 세포를 siRNA로 트랜스펙션시켜서, 내생적 INPP4B를 넉다운하였다. Akt 인산화는 Akt 활성을 나타내는 HEp-2 모세포와 비교하여 방사선에 노출된 RR-HEp-2 세포에서 높게 유도되었다; 이와 일치하게, Akt의 알려진 주요 타겟인 GSK3α/β 인산화 또한 증가되었다(도 7A). 비록, RR-HEp-2 세포가 방사선 처리 후, 인산화된 높은 Akt 수준을 포함하고 있다고 할지라도, 이와 같은 Akt활성은 Akt 기초수준을 변경하지 않고 INPP4B 결실로 크게 억제되었다(도 7B). 게다가 인산화된 Akt 수준은 INPP4B-HEp-2 세포에서 아주 높게 나타났지만, INPP4B 발현 및 Akt 활성 수준 사이에 밀접한 관계를 나타내는 INPP4B 넉다운으로 극적으로 하향조절되었다(도 7C). RR-HEp-2 세포에서 얻어진 결과와 동일하게, Akt 인산화 수준은 인산화된 GSK3α/β 수준에서 수반되는 감소와 더불어서 A549 및 H1299에서 INPP4B 결실로 두드러지게 감소하였다(도 7D). 포스파타제 PP2A는 Akt 활성을 직접적으로 억제하는 것으로 알려져 있기 때문에, 본 발명에서는 INPP4B가 PP2A 활성을 조절하는지를 측정하였다. PP2A 활성은 양성 대조군으로 사용된 오카다산(okadaic acid)을 처리한 RR-HEp-2 세포에서 크게 억제되었다(도 7E 및 도 7F). 그러나 방사선 처리 또는 INPP4B siRNA 감염이 RR-HEp-2 세포에서 PP2A 활성에 영향을 미치지 않음를 Akt 및 PP2A 면역복합침전분석법(도 7E 및 도 7F)으로 측정하여, PP2A 활성이 INPP4B 매개 Akt 활성과 관련이 없음을 확인하였다.Thus, whether or not the radiation can regulate Akt activity was examined. In order to confirm that INPP4B positively regulates Akt activity, RR-HEp-2 cells were transfected with siRNA and knockdown of endogenous INPP4B. Akt phosphorylation was highly induced in RR-HEp-2 cells exposed to radiation compared to HEp-2 cells expressing Akt activity; Consistent with this, GSK3? /? Phosphorylation, a known major target of Akt, was also increased (FIG. 7A). Although the RR-HEp-2 cells contained high phosphorylated Akt levels after irradiation, such Akt activity was largely inhibited by INPP4B deletion without altering Akt basal levels (FIG. 7B). In addition, phosphorylated Akt levels were very high in INPP4B-HEp-2 cells, but were dramatically down-regulated in INPP4B knockdown, which shows a close relationship between INPP4B expression and Akt activity levels (FIG. 7C). Similar to the results obtained in RR-HEp-2 cells, Akt phosphorylation levels were markedly reduced with INPP4B deletion in A549 and H1299, with a concomitant decrease in phosphorylated GSK3a / beta levels (Fig. 7D). Since phosphatase PP2A is known to directly inhibit Akt activity, it was determined in this invention whether INPP4B regulates PP2A activity. PP2A activity was greatly inhibited in RR-HEp-2 cells treated with okadaic acid used as a positive control (Fig. 7E and Fig. 7F). However, PP2A activity was associated with INPP4B mediated Akt activity as measured by Akt and PP2A immunoprecipitation assays (Figure 7E and Figure 7F), indicating that radiation treatment or INPP4B siRNA infection did not affect PP2A activity in RR-HEp-2 cells Respectively.

상기와 같은 결과들은 스트레스(방사선, 항암제)에 의한 INPP4B의 유도가 암세포에서 Akt 생존 경로에 의해 저항성 표현형을 촉진하는 것을 뒷받침한다.
These results support that the induction of INPP4B by stress (radiation, anticancer agent) promotes the resistance phenotype by the Akt survival pathway in cancer cells.

이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> KOREA INSTITUTE OF RADIOLOGICAL & MEDICAL SCIENCES <120> Composition for diagnosis of radio-resistance or radio-sensitive MRFAP1 marker and use thereof <130> PA130016/KR <160> 41 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bcl-xl Primer <400> 1 cgggcattca gtgacctgac 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bcl-xl Primer <400> 2 tcaggaacca gcggttgaag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ERBB2 Primer <400> 3 catatgtctc ccgccttctg 20 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ERBB2 Primer <400> 4 cccacacagt cacaccataa c 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Primer <400> 5 catctctgcc ccctctgctg a 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Primer <400> 6 ggatgacctt gcccacagcc t 21 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> INPP4A Primer <400> 7 ggctgccagt ccataatc 18 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> INPP4A Primer <400> 8 cacactttct cccactcc 18 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 9 aaagaatgca ggtacacag 19 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 10 ctctgtgctg ctcttagg 18 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PTEN Primer <400> 11 gaaagacatt atgacaccg 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PTEN Primer <400> 12 ttagcatctt gttctgtttg 20 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> p21 Primer <400> 13 tgtccgtcag aacccatg 18 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> p21 Primer <400> 14 ggagtggtag aaatctgtca tg 22 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 15 gaaacagaaa gaagaaatac c 21 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 16 cccactcttc ctcatcatag 20 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PSAP Primer <400> 17 gtggtgccag aatgtgaag 19 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PSAP Primer <400> 18 ctgagggtag aggaggagag 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CDK11A Primer <400> 19 gtctgcacat caccgaac 18 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CDK11A Primer <400> 20 catttcttcc tcacttactt c 21 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GLUT1 Primer <400> 21 ctcatgggct tctcgaaac 19 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GLUT1 Primer <400> 22 ccgactctct tccttcatct c 21 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> JTB Primer <400> 23 ccacctctgc tggttgctc 19 <210> 24 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> JTB Primer <400> 24 ctatatggac tcgatttgct tcc 23 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ABCC5 Primer <400> 25 aaacaggatc agtaaagaag 20 <210> 26 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ABCC5 Primer <400> 26 aagaacacca ggataacg 18 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MRFAP1 Primer <400> 27 attatatatg ccgctcctac 20 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MRFAP1 Primer <400> 28 tggccttcac tacctgttc 19 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HNRNPUL1 Primer <400> 29 actcgtgagg aaactgcc 18 <210> 30 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HNRNPUL1 Primer <400> 30 cttggaacag gatcaggg 18 <210> 31 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> WDFY3 Primer <400> 31 ttaaatggtg caactctg 18 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> WDFY3 Primer <400> 32 tggatggtac taagaagaac 20 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NDRG1 Primer <400> 33 agatctcagg atggacccaa g 21 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NDRG1 Primer <400> 34 catgccctgc acgaagtac 19 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CDC27 Primer <400> 35 acaaatctta tctggtggag 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CDC27 Primer <400> 36 gtatcaggtg aaattacagc 20 <210> 37 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> INPP4B siRNA <400> 37 cagaauguuu gagucacua 19 <210> 38 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ERK-1 siRNA <400> 38 cucucuaacc ggcccaucu 19 <210> 39 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ERK-2 siRNA <400> 39 cagaucuuua caagcucuu 19 <210> 40 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 40 ggggtaccga gccaccatgg aaattaaaga ggaaggg 37 <210> 41 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 41 ccgctcgagc ggggtgtcag cttttccata ag 32 <110> KOREA INSTITUTE OF RADIOLOGICAL & MEDICAL SCIENCES <120> Composition for diagnosis of radio-resistance or radio-sensitive          MRFAP1 marker and use thereof <130> PA130016 / KR <160> 41 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bcl-xI Primer <400> 1 cgggcattca gtgacctgac 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Bcl-xI Primer <400> 2 tcaggaacca gcggttgaag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ERBB2 Primer <400> 3 catatgtctc ccgccttctg 20 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ERBB2 Primer <400> 4 cccacacagt cacaccataa c 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Primer <400> 5 catctctgcc ccctctgctg a 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Primer <400> 6 ggatgacctt gcccacagcc t 21 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> INPP4A Primer <400> 7 ggctgccagt ccataatc 18 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> INPP4A Primer <400> 8 cacactttct cccactcc 18 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 9 aaagaatgca ggtacacag 19 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 10 ctctgtgctg ctcttagg 18 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PTEN Primer <400> 11 gaaagacatt atgacaccg 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PTEN Primer <400> 12 ttagcatctt gttctgtttg 20 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> p21 Primer <400> 13 tgtccgtcag aacccatg 18 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> p21 Primer <400> 14 ggagtggtag aaatctgtca tg 22 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 15 gaaacagaaa gaagaaatac c 21 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 16 cccactcttc ctcatcatag 20 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PSAP Primer <400> 17 gtggtgccag aatgtgaag 19 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PSAP Primer <400> 18 ctgagggtag aggaggagag 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> CDK11A Primer <400> 19 gtctgcacat caccgaac 18 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CDK11A Primer <400> 20 catttcttcc tcacttactt c 21 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GLUT1 Primer <400> 21 ctcatgggct tctcgaaac 19 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GLUT1 Primer <400> 22 ccgactctct tccttcatct c 21 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> JTB Primer <400> 23 ccacctctgc tggttgctc 19 <210> 24 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> JTB Primer <400> 24 ctatatggac tcgatttgct tcc 23 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ABCC5 Primer <400> 25 aaacaggatc agtaaagaag 20 <210> 26 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ABCC5 Primer <400> 26 aagaacacca ggataacg 18 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MRFAP1 Primer <400> 27 attatatatg ccgctcctac 20 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MRFAP1 Primer <400> 28 tggccttcac tacctgttc 19 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HNRNPUL1 Primer <400> 29 actcgtgagg aaactgcc 18 <210> 30 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> HNRNPUL1 Primer <400> 30 cttggaacag gatcaggg 18 <210> 31 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> WDFY3 Primer <400> 31 ttaaatggtg caactctg 18 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> WDFY3 Primer <400> 32 tggatggtac taagaagaac 20 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NDRG1 Primer <400> 33 agatctcagg atggacccaa g 21 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NDRG1 Primer <400> 34 catgccctgc acgaagtac 19 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CDC27 Primer <400> 35 acaaatctta tctggtggag 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CDC27 Primer <400> 36 gtatcaggtg aaattacagc 20 <210> 37 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> INPP4B siRNA <400> 37 cagaauguuu gagucacua 19 <210> 38 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ERK-1 siRNA <400> 38 cucucuaacc ggcccancer 19 <210> 39 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> ERK-2 siRNA <400> 39 caggiuuua caagcucuu 19 <210> 40 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 40 ggggtaccga gccaccatgg aaattaaaga ggaaggg 37 <210> 41 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> INPP4B Primer <400> 41 ccgctcgagc ggggtgtcag cttttccata ag 32

Claims (15)

MRFAP1(Mof4 family associated protein 1, NCBI GenBank Gene ID: 93621) 유전자의 mRNA 또는 이의 단백질의 수준을 측정하는 제제를 포함하는, 암세포의 방사선 저항성 또는 민감성 진단용 조성물.
A composition for the diagnosis of radiation resistance or sensitivity of cancer cells, comprising an agent for measuring the level of MRFAP1 (Mof4 family associated protein 1, NCBI GenBank Gene ID: 93621) gene mRNA or a protein thereof.
제1항에 있어서, 상기 조성물은 HNRNPUL1(Heterogeneous nuclear ribonucleoprotein U-like 1, NCBI GenBank Gene ID: 11100), WDFY3(WD repeat and FYVE domain containing 3, NCBI GenBank Gene ID: 23001), CDC27(Cell division cycle 27 homolog, NCBI GenBank Gene ID: 996) 및 INPP4B(Inositol polyphosphate-4-phosphatase type II, NCBI GenBank Gene ID: 8821)로 이루어진 군에서 선택된 하나 이상의 유전자의 mRNA 또는 이의 단백질의 수준을 측정하는 제제를 추가로 포함하는, 암세포의 방사선 저항성 또는 민감성 진단용 조성물.
2. The method of claim 1, wherein the composition is selected from the group consisting of HNRNPUL1 (Heterogeneous nuclear ribonucleoprotein U-like 1, NCBI GenBank Gene ID 11100), WDFY3 (WD repeat and FYVE domain containing 3, NCBI GenBank Gene ID 23001), CDC27 27 homolog, NCBI GenBank Gene ID: 996) and INPP4B (Inositol polyphosphate-4-phosphatase type II, NCBI GenBank Gene ID: 8821) Wherein the composition is for detecting radiation resistance or sensitivity of cancer cells.
제2항에 있어서, 상기 INPP4B 유전자의 mRNA 또는 이의 단백질의 수준을 측정하는 제제를 추가로 포함하는 조성물은 항암제 저항성 진단을 추가로 할 수 있는 것인, 암세포의 방사선 또는 민감성 진단용 조성물.
The composition for diagnosing radiation or sensitivity of cancer cells according to claim 2, wherein the composition further comprising an agent for measuring the level of the mRNA of the INPP4B gene or a protein thereof is capable of further diagnosing cancer resistance.
제1항에 있어서, 상기 암은 폐암, 후두암, 대장암 또는 유방암인 것인, 암세포의 방사선 저항성 또는 민감성 진단용 조성물.
The composition of claim 1, wherein the cancer is lung cancer, laryngeal cancer, colorectal cancer, or breast cancer.
제1항 또는 제2항에 있어서, 상기 유전자 mRNA의 수준을 측정하는 제제는 상기 유전자에 특이적으로 결합하는 프라이머를 포함하는 것인 암세포의 방사선 저항성 또는 민감성 진단용 조성물.
4. The composition for diagnosing radiation resistance or sensitivity of cancer cells according to any one of claims 1 to 3, wherein the agent for measuring the level of the gene mRNA comprises a primer that specifically binds to the gene.
제1항 또는 제2항에 있어서, 상기 유전자의 단백질 수준을 측정하는 제제는 상기 단백질에 특이적인 항체를 포함하는 것인 암세포의 방사선 저항성 또는 민감성 진단용 조성물.
3. The composition for diagnosing radiation resistance or sensitivity of cancer cells according to claim 1 or 2, wherein the agent for measuring the protein level of the gene comprises an antibody specific to the protein.
제1항 또는 제2항의 조성물을 포함하는 암세포의 방사선 저항성 또는 민감성 진단용 키트.
A kit for the diagnosis of radiation resistance or sensitivity of cancer cells comprising the composition of claim 1 or 2.
제7항에 있어서, 상기 키트는 RT-PCR 키트, DNA 칩 키트, 마이크로어레이 및 단백질 칩 키트인 것을 특징으로 하는 암세포의 방사선 저항성 또는 민감성 진단용 키트.
8. The kit for diagnosing radiation resistance or sensitivity of cancer cells according to claim 7, wherein the kit is an RT-PCR kit, a DNA chip kit, a microarray and a protein chip kit.
MRFAP1 유전자에 특이적으로 결합하는 프라이머를 사용하여, 분리된 생물학적 시료로부터 mRNA 수준을 측정하는 단계; 및
상기 mRNA 수준의 변화를 정상 대조구 시료의 mRNA 수준과 비교하는 단계를 포함하는, 암 환자의 방사성 저항성 또는 민감성 진단을 위한 정보의 제공 방법.
Measuring mRNA levels from the isolated biological sample using primers that specifically bind to the MRFAP1 gene; And
Comparing the change in mRNA level with the level of mRNA in a normal control sample. &Lt; Desc / Clms Page number 20 &gt;
제9항에 있어서, HNRNPUL1, WDFY3, CDC27 및 INPP4B로 이루어진 군에서 선택된 하나 이상의 유전자의 mRNA 수준을 추가로 측정 및 비교하는 단계를 포함하는, 암 환자의 방사선 저항성 또는 민감성 진단을 위한 정보의 제공 방법.
10. The method according to claim 9, further comprising measuring and comparing mRNA levels of one or more genes selected from the group consisting of HNRNPUL1, WDFY3, CDC27 and INPP4B to provide information for diagnosing radiation resistance or sensitivity in cancer patients .
MRFAP1 유전자의 단백질에 특이적인 항체를, 분리된 생물학적 시료와 접촉시켜 항원-항체 복합체 형성으로 단백질 수준을 확인하는 단계; 및
상기 단백질 형성량의 변화를 정상 대조군 시료의 단백질 수준과 비교하는 단계를 포함하는, 암 환자의 방사선 저항성 또는 민감성 진단을 위한 정보의 제공 방법.
Contacting an antibody specific for the protein of the MRFAP1 gene with an isolated biological sample to identify protein levels by antigen-antibody complex formation; And
And comparing the change in the amount of protein formation with a protein level in a normal control sample.
제11항에 있어서, HNRNPUL1, WDFY3, CDC27 및 INPP4B로 이루어진 군에서 선택된 하나 이상의 유전자의 단백질 수준을 추가로 측정 및 비교하는 단계를 포함하는, 암 환자의 방사선 저항성 또는 민감성 진단을 위한 정보의 제공 방법.
12. The method of claim 11, further comprising measuring and comparing the protein levels of one or more genes selected from the group consisting of HNRNPUL1, WDFY3, CDC27, and INPP4B to provide information for diagnosing radiation resistance or sensitivity in cancer patients .
암환자의 방사선 치료 예후 예측에 필요한 정보를 제공하기 위하여, 방사선 치료를 받은 환자의 분리된 시료로부터 MRFAP1 유전자의 mRNA 또는 이의 단백질의 수준을 정상 세포의 발현 수준과 비교하여 방사선 저항성 또는 민감성 진단용 마커를 검출하는 방법.
In order to provide information for predicting the prognosis of radiation therapy for cancer patients, the MRFAP1 gene mRNA or its protein level is compared with the normal cell expression level from a separate sample of patients who received radiation therapy, and a radiation resistance or sensitivity diagnostic marker / RTI &gt;
제13항에 있어서, HNRNPUL1, WDFY3, CDC27 및 INPP4B로 이루어진 군에서 선택된 하나 이상의 유전자의 mRNA 또는 이의 단백질 수준을 추가로 측정 및 비교하는 단계를 포함하는, 방사선 저항성 또는 민감성 진단용 마커를 검출하는 방법.
14. The method of claim 13, further comprising measuring and comparing the mRNA or protein level thereof of one or more genes selected from the group consisting of HNRNPUL1, WDFY3, CDC27 and INPP4B.
제13항 또는 제14항에 있어서, 상기 암은 폐암, 후두암, 대장암 또는 유방암인 것인 방법.15. The method according to claim 13 or 14, wherein the cancer is lung cancer, laryngeal cancer, colon cancer or breast cancer.
KR1020130007149A 2013-01-22 2013-01-22 Composition for diagnosis of radio-resistance or radio-sensitive MRFAP1 marker and use thereof KR101432172B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130007149A KR101432172B1 (en) 2013-01-22 2013-01-22 Composition for diagnosis of radio-resistance or radio-sensitive MRFAP1 marker and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130007149A KR101432172B1 (en) 2013-01-22 2013-01-22 Composition for diagnosis of radio-resistance or radio-sensitive MRFAP1 marker and use thereof

Publications (2)

Publication Number Publication Date
KR20140094765A true KR20140094765A (en) 2014-07-31
KR101432172B1 KR101432172B1 (en) 2014-08-22

Family

ID=51740284

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130007149A KR101432172B1 (en) 2013-01-22 2013-01-22 Composition for diagnosis of radio-resistance or radio-sensitive MRFAP1 marker and use thereof

Country Status (1)

Country Link
KR (1) KR101432172B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3460476A4 (en) * 2016-05-17 2020-03-11 University Of Ulsan Foundation For Industry Cooperation Biomarker composition comprising lrp-1 as active ingredient, for diagnosis of radiation-resistant cancer or prediction of radiation therapy prognosis

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005304497A (en) * 2004-03-25 2005-11-04 Joji Inasawa Method for detecting cancer using specified cancer-related gene and method for inhibiting the cancer
EP3118328A1 (en) * 2009-01-07 2017-01-18 Myriad Genetics, Inc. Cancer biomarkers
KR101122628B1 (en) * 2009-02-16 2012-04-12 한국화학연구원 The biomarkers for diagnosis of reproductive toxicity induced by nonylphenol and the method for diagnosis thereof
KR101354023B1 (en) * 2011-02-25 2014-01-23 한국화학연구원 The kit for detection of reproductive toxicants using toxicity of endocrine disrupting chemicals and the method for diagnosis thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3460476A4 (en) * 2016-05-17 2020-03-11 University Of Ulsan Foundation For Industry Cooperation Biomarker composition comprising lrp-1 as active ingredient, for diagnosis of radiation-resistant cancer or prediction of radiation therapy prognosis

Also Published As

Publication number Publication date
KR101432172B1 (en) 2014-08-22

Similar Documents

Publication Publication Date Title
KR101347107B1 (en) Method for measuring resistance or sensitivity to docetaxel
JP4759612B2 (en) In vitro identification method for cancer therapeutic compounds
KR101228148B1 (en) Composition for diagnosis of radio-resistance or radio-sensitive marker and use thereof
JP5224309B2 (en) Proteins specifically expressed in ovarian clear cell adenocarcinoma and their applications
WO2012096545A2 (en) Novel pancreatic cancer biomarker using the characteristics of pancreatic cancer stem cells, and use thereof
KR101432174B1 (en) Composition for diagnosis of radio-resistance or radio-sensitive CDC27 marker and use thereof
KR101467289B1 (en) Composition for diagnosis of radio-resistance or radio-sensitive WDFY3 marker and use thereof
KR101432172B1 (en) Composition for diagnosis of radio-resistance or radio-sensitive MRFAP1 marker and use thereof
KR101432171B1 (en) Composition for diagnosis of radio-resistance or radio-sensitive CDK11A marker and use thereof
KR101469917B1 (en) Composition for diagnosis of radio-resistance or radio-sensitive PSAP marker and use thereof
KR101952649B1 (en) Biomarker composition for diagnosing radiation resistant cancer or predicting prognosis of radiation therapy comprising LRP-1
KR101432173B1 (en) Composition for diagnosis of radio-resistance or radio-sensitive HNRNPUL1 marker and use thereof
KR102328655B1 (en) Composition For Predicting Radiation Resistance Of Cancer
KR101859652B1 (en) Composition for predicting of preoperative chemoradiotherapy comprising PSMB8 marker and uses thereof
EP1921170A2 (en) A method for determining the efficacy of an antharcycline anticancer agent and a device therefor
WO2014017106A1 (en) Compositions Comprising RAC Mutants, and Methods of Use Thereof
KR102416614B1 (en) Radio-resistance biomarker and detecting method thereof
KR102416607B1 (en) Radio-resistance biomarker and detecting method thereof
WO2018025869A1 (en) Biomarker for predicting therapeutic effect of fstl1 inhibitor in cancer patient
KR20190059237A (en) Biomarker composition for diagnosing radiation resistant cancer or predicting prognosis of radiation therapy comprising PMVK
KR101927577B1 (en) Use of H2A.Z.1 as a hepatocellular carcinomar biomarker

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20170629

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180625

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20190626

Year of fee payment: 6