KR20140092205A

KR20140092205A - Pharmaceutical composition containing catechin or its derivatives for prevention or treatment of disorders of follicular keratinization

Info

Publication number: KR20140092205A
Application number: KR1020130117831A
Authority: KR
Inventors: 서대헌
Original assignee: 서울대학교산학협력단
Priority date: 2013-01-14
Filing date: 2013-10-02
Publication date: 2014-07-23

Abstract

The present invention provides a pharmaceutical composition to prevent or treat Dyskeratosis follicularis containing catechin, a derivative thereof, or a combination of a catechin or a derivative thereof and a skin peeling agent; or a cosmetic composition to alleviate or relieve Dyskeratosis follicularis containing the ingredient. According to the present invention, the composition can effectively be used to treat or alleviate Dyskeratosis follicularis without irritating the skin while causing no resistance to antibiotics.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a pharmaceutical composition for preventing or treating follicular keratinization comprising catechin or a derivative thereof,

카테킨(catechins) 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료제 분야에 관한 것이다.
The present invention relates to the field of prophylactic or therapeutic agents for follicular keratosis including catechins or derivatives thereof.

주사, 모공각화증, 안면경부모낭성홍색흑피증 또는 여드름 등을 포함하는 모낭각화 이상 및 피지분비 이상을 초래하는 피부질환은 특히 사춘기 청소년기에 유병률이 높은 매우 흔한 질환이며 생명을 위협하는 질병은 아니지만, 안면 및 구간 영역에서 발생하고 적절한 치료를 하지 않을 경우 흉터가 생긴다. 또한 이러한 질환은 환자의 외모에 영향을 미쳐 어떠한 질병보다 정신적인 고민을 안겨주는 질환이므로 국민들의 생활수준이 높아짐에 따라서 이러한 질환으로 인한 병변 및 흉터에 대한 치료를 하려는 사람들이 점차 증가하고 있다.Skin diseases that cause abnormal hair folliculogenesis and sebum secretion including injections, keratosis, facial nerve follicular redness, or acne are very common diseases with high prevalence especially in adolescent adolescents and are not life-threatening diseases, Scarring occurs in the face and in the intercostal area and is not treated properly. In addition, these diseases affect the appearance of the patient and cause psychological distress rather than any disease. Therefore, as the standard of living of the people increases, people who are trying to treat lesions and scars due to these diseases are increasing.

모낭각화질환 중 하나인 여드름은 다양한 병인과 관련되어 있다고 알려져 있는데, 피지선에서 피지가 과다 생성되면 여드름 등의 피부 질환을 야기시키는 원인이 된다. 특히, 여드름이라 지칭되는 질병의 부류에 공통적인 병인은 모낭에 발생하는 면포(comedo)이며, 이는 모낭 단위의 손상을 수반하기도 한다. 여드름에서 발생하는 초기의 면포는 점착성 케라틴 물질로 이루어져있다. 이러한 각질의 매복(impaction)으로 박테리아가 번식하게 되어 농포, 구진, 낭종 및 소결절의 형태의 염증 증상을 유발한다. Acne, one of the follicular keratosis diseases, is known to be associated with a variety of pathologies. When sebaceous glands are overgrown in the sebaceous glands, it causes skin diseases such as acne. In particular, a common etiology for the class of diseases referred to as acne is comedo occurring in the hair follicle, which may also involve damage to the follicular unit. The initial cotton glands that occur in acne consist of sticky keratin materials. The impaction of these keratinous bacteria causes the bacteria to multiply, causing inflammation symptoms in the form of pustules, papules, cysts, and nodules.

기존 여드름 치료제는 효과의 한계와 함께 여러 가지 부작용으로 인해 환자들이 불편해하는 경우가 많았다. 먹는 여드름 치료제인 경구 이소트레티노인(isotretinoin)은 기형아 유발, 간기능 이상, 지질대사이상 등을 초래할 수 있는 문제점이 제기되었으며, 통상적인 국소 치료제는 특별히 효과적인 것이 밝혀지지 않았다. 더욱이 여드름 도포 치료제 중 레티노이드는 화끈거리고 붉어지는 자극증상을 유발하고, 항생제는 항균제 내성이 문제되어 왔다. Existing acne remedies were often uncomfortable due to various side effects as well as limitations of effectiveness. Oral isotretinoin, a treatment for eating acne, has been associated with problems that can lead to birth defects, liver dysfunction, and lipid metabolism abnormalities, and conventional topical treatments have not been found to be particularly effective. Furthermore, among the acne application treatments, retinoids cause irritation symptoms that are hot and red, and antibiotics have been problematic in antimicrobial resistance.

한편, 카테킨(catechins)은 녹차의 주요 폴리페놀 성분으로서 종양의 진행을 저해하고, 당뇨, 알러지 등과 같은 염증성 질환을 개선시키는 것으로 알려져 있다. 한국 출원번호 제 2006-0024905호에는 녹차 추출물 또는 녹차 구성 성분인 카테킨(catechins)류, 플라보놀 (flavonols)류 및 그 유도체로 이루어진 군에서 선택된 1종 이상과 백자인 추출물을 일정한 성분비로 함유하는 화장료 조성물이 개시되어 있다. On the other hand, catechins are major polyphenol components of green tea, which inhibit tumor progression and improve inflammatory diseases such as diabetes and allergies. Korean Patent Application No. 2006-0024905 discloses a cosmetic composition containing green tea extract or at least one selected from the group consisting of catechins, flavonols and derivatives thereof and a white porcelain extract at a predetermined ratio .

그러나 모공각화증 또는 여드름과 같은 피부 모낭각화 이상을 치료하는 치료제의 개발은 아직 요원한 상태이다. 특히 부작용이 적은 천연물 유래의 물질이 바람직하나, 천연물은 종류가 매우 다양하고 무한한 잠재력을 가지고 있어, 천연물에서 새로운 활성성분의 개발을 통한 모낭각화 치료제의 개발이 요구된다.
However, the development of therapeutic agents for treating skin follicular keratinizing disorders such as pore keratosis or acne is still in a state of urgency. Particularly, a substance derived from a natural substance having a small side effect is preferable. However, since natural products have a wide variety and wide potential, it is required to develop a therapeutic agent for follicular keratinization through development of new active ingredients in natural products.

본원은 모낭각화 이상 발생 기전에 근거한 신규 천연물질 유래의 모낭각화 질환의 예방, 완화, 또는 치료에 효과가 있는 물질을 제공하고자 한다.
The present invention seeks to provide a substance that is effective for preventing, alleviating, or treating a new natural substance-derived follicular keratosis based on the mechanism of follicular keratosis.

한 양태에서 본원은 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물을 제공한다. In one embodiment, the present invention provides a pharmaceutical composition for preventing or treating follicular keratosis comprising catechin or a derivative thereof.

본원에는 본원의 효과를 달성하는 한 다양한 카테킨 및/또는 그 유도체가 포함될 수 있으며, 예를 들면 상기 카테킨 또는 그 유도체는 EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), ECG(epicathechin 3-gallate), GC (gallocatechin), CG(cathechin 3-gallate), EC (epicatechin), C (catechin), 카엠페롤(Kaempferol), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 또는 엘라직산(Ellagic acid)를 포함하나 이로 제한하는 것은 아니다. 일 구현예에서는 특히 EGCG (epigallocatechin gallate)가 사용될 수 있다. Various catechins and / or derivatives thereof may be used herein to achieve the effect of the present invention. For example, the catechin or a derivative thereof may be an epigallocatechin gallate (EGCG), a gallocatechin gallate (GCG), an epigallocatechin (EGC) 3-gallate, gallocatechin, cathechin 3-gallate, epicatechin, catechin, kaempferol, formononetin, quercetin, or But are not limited to, Ellagic acid. In one embodiment, in particular EGCG (epigallocatechin gallate) may be used.

본원에 따른 카테킨 또는 그 유도체는 본원에 따른 효과를 나타내기에 적절한 양으로 포함될 수 있으며, 당업자라면 치료의 구체적 목적 및 선택하는 특정 성분의 특징에 따라 포함되는 양을 적의 선택할 수 있으며, 예를 들면 카테킨 또는 그 유도체는 약 0.1 % 내지 30 % (w/v)로 포함될 수 있으나, 이 범위를 벗어나는 것을 제외하는 것은 아니다. The catechin or derivative thereof according to the present invention may be contained in an appropriate amount to exhibit the effect according to the present invention, and those skilled in the art can select the included amount depending on the specific purpose of the treatment and the characteristics of the selected ingredient, Or a derivative thereof may be contained in an amount of about 0.1% to 30% (w / v), but does not exclude a range outside this range.

본원에 따른 일 구현예에서, 상기 모낭각화 이상은 염증을 수반하며, 상기 염증은 예를 들면 프로피오니박테리움 아크네스 (Propionibacterium acnes), 스타필로코쿠스 아우레우스(Staphylococcus aureus), 또는 스타필로코쿠스 에피데르미데스(Staphylococcus epidermidis)에 의해 발생하나, 이로 제한하는 것은 아니다. In one embodiment according to the present application, the hair follicle keratinocytes above involves the inflammation, the inflammation is, for example propynyl sludge tumefaciens arc Ness (Propionibacterium acnes), Staphylococcus aureus (Staphylococcus aureus), or Staphylococcus It is caused by, but is not limited to, Staphylococcus epidermidis .

본원에 따른 카테킨 또는 그 유도체를 포함하는 조성물 모낭각화 이상과 관련된 기전에 영향을 미쳐 효과를 나타내며, 본 기전으로 한정하는 것은 아니나, AMPK-SREBP-1 세포신호 전달의 조절, IGF-1/PI3K/Akt 세포신호 전달 저해, NF-kB 및 AP-1 세포신호 전달을 저해, 케라틴 세포에서 IL-1α를 감소시킨다. AMPK-SREBP-1 cell signal transduction, IGF-1 / PI3K / IGF-1 / IGFBP-1 signaling pathway, Inhibits Akt signaling, inhibits NF-kB and AP-1 cell signaling, and reduces IL-1α in keratinocytes.

본원에 따른 일 구현예에서 모낭각화 이상 질환은 주사, 모공각화증, 안면경부모낭성홍색흑피증 또는 염증성 또는 비염증성 여드름을 들 수 있으나, 이로 제한하는 것은 아니다. 다른 측면에서 상기 질환은 모낭각화 이상에 의해 유발되는 것으로 해석될 수 있다. In one embodiment according to the present application, the disorder of follicular keratosis can include, but is not limited to, injection, pouch keratosis, facial nerve follicular hypochromatosis or inflammatory or noninflammatory acne. In another aspect, the disease can be interpreted to be caused by a follicular keratinization abnormality.

다른 양태에서 본원은 또한 카테킨 또는 그 유도체와 피부 박피제를 추가로 포함하는 낭각화 이상의 예방 또는 치료용 약학적 조성물에 관한 것이다. 본원에 따른 조성물에 포함되는 박피제는 대표적인 것으로 AHA (Alpha-Hydroxy Acid) 또는 BHA (Beta-Hydroxy Acid) 중 하나 이상을 포함할 수 있으며, 전자의 예로는 글리콜산, 후자의 예로는 살리실산을 들 수 있으나, 이로 제한하는 것은 아니다. 본원에따른 위의 성분을 조합으로 포함하는 조성물은 단독으로 사용한 것과 비교하여 상승효과를 가져오며, 이러한 효과를 나타내도록 포함될 수 있으며, 예를 들면 상기 카테킨 또는 그 유도체는 약 0.1 % 내지 30 %(w/v) 로 포함되고, 상기 박피제는 약 1 내지 70% (w/v)로 포함된다. In another aspect, the present invention also relates to a pharmaceutical composition for preventing or treating cirrhosis, comprising catechin or a derivative thereof and a skin peeling agent. The peeling agent included in the composition according to the present invention may include one or more of AHA (Alpha-Hydroxy Acid) or BHA (Beta-Hydroxy Acid). Examples of the former include glycolic acid, and examples of the latter include salicylic acid But is not limited thereto. Compositions comprising the above components in combination according to the present application may have synergistic effects as compared with those used alone and may be included to exhibit such effects, for example, the catechin or its derivative may be present in an amount of about 0.1% to 30% w / v), and the peeling agent is included at about 1 to 70% (w / v).

다른 양태에서 카테킨 또는 그 유도체 또는 이와 피부 박피제를 조합으로 포함하는 모낭각화 이상의 완화 및/또는 개선을 위한 화장 조성물을 제공하며, 이러한 조성물은 예를 들면 세안제, 비누, 샴푸, 화장수, 로션, 크림 또는 팩용으로 제공될 수 있다. 화장 조성물에 포함되는 상기 카테킨 또는 그 유도체는 0.1 % 내지 30 %(w/v) 로 포함되고, 상기 박피제는 약 1 내지 10% (w/v)로 포함된다. In another embodiment, the present invention provides a cosmetic composition for alleviating and / or improving follicular keratinization comprising a combination of a catechin or a derivative thereof or a skin exfoliation agent, wherein the composition is, for example, a cleanser, a soap, a shampoo, Or pack. The catechin or the derivative thereof contained in the cosmetic composition is contained in an amount of 0.1 to 30% (w / v), and the peeling agent is contained in an amount of about 1 to 10% (w / v).

또 다른 양태에서 카테킨 또는 그 유도체를 포함하는 모낭각화 이상의 완화 및/또는 개선을 위한 건강보조식품, 기능성 식품, 또는 식품첨가제를 제공한다. In another embodiment, there is provided a health supplement, a functional food, or a food additive for alleviating and / or improving follicular keratinization comprising catechin or a derivative thereof.

또다른 양태에서 본원은 카테킨 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학 조성물의 제조방법에 관한 것으로, 상기 방법은 카테킨 또는 그 유도체를 알코올에 용해한 후, 물을 이용하여 카테킨 또는 그 유도체가 약 0.1 % 내지 30 % (w/v)로 포함된 용액을 제조하는 것을 특징으로 하는, 제조방법을 제공한다. 상기 방법에서 박피제를 포함하는 경우, 박피제는 약 1 내지 70% (w/v)로 포함될 수 있으며, 구체적 목적에 따라 양이 변할 수 있다. In another embodiment, the present invention relates to a method for preparing a pharmaceutical composition for preventing or treating follicular keratinization comprising a catechin derivative, wherein the catechin or a derivative thereof is dissolved in an alcohol, To 0.1% to 30% (w / v). When the method includes a peeling agent, the peeling agent may be included in an amount of about 1 to 70% (w / v), and the amount may vary depending on the specific purpose.

본원의 방법에서 상기 카테킨 유도체는 EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), ECG(epicathechin 3-gallate), GC (gallocatechin), CG(cathechin 3-gallate), EC (epicatechin), C (catechin), 카엠페롤(Kaempferol), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 또는 엘라직산(Ellagic acid) 중에서 선택되는 적어도 하나 이상이며, 특히 상기 카테킨 또는 그 유도체는 EGCG (epigallocatechin gallate)이다.
In the method of the present invention, the catechin derivatives include epigallocatechin gallate (EGCG), gallocatechin gallate (GCG), epigallocatechin (EGC), epicathechin 3-gallate (ECG), gallocatechin (GC), cathechin 3- , Catechin, kaempferol, formononetin, quercetin, or ellagic acid. Particularly, the catechin or a derivative thereof is at least one selected from the group consisting of EGCG (epigallocatechin gallate).

본원에 따른 카테킨(catechins) 또는 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물로 항생제에 대한 내성을 유발하지 않으면서도 피부에 자극이 없이 효과적으로 모낭각화 이상을 예방하여 여드름과 같은 모낭각화 이상으로 인한 피부 질환에 효과적으로 사용될 수 있으며, 피부박피제를 조합으로 포함하는 경우, 상승효과를 가져온다.
A pharmaceutical composition for prevention or treatment of follicular keratosis comprising catechins or a derivative thereof according to the present invention is a pharmaceutical composition for preventing or treating hair follicle keratinization such as acne by effectively preventing skin irritation without causing resistance to antibiotics, It can be effectively used for skin diseases caused by abnormalities, and when a combination of skin-peeling agents is included, a synergistic effect is obtained.

도 1은 EGCG가 AMP 활성화 단백질 카이나제 (AMPK) 경로를 통해 스테롤 조절부위 결합 단백질 (SREBP)-1 단백질의 발현을 억제하여 SEB-1 피지선세포에서 지질생성을 억제하는 것을 나타내는 결과로, 도 1a 는 EGCG 처리 24시간 후에 ¹⁴C 아세테이트의 존재하의 SEB-1 피지선세포의 총 지질 분석 결과이고; 도 1b 는 박층 크로마토크래피에서 지질 성분들의 변화를 보여주는 결과 (C: cholesterol, FOH: fatty alcohol, OA: oleic acid, TAG: triglyceride, WE: wax ester, CO: cholesterol oleate, SQ: squalene), Unit: mean± SE c.p.m/10³ 세포/hour; 도 1c 는 EGCG 농도에 따른 SREBP의 전구체(precursor) 또는 성숙체(mature)를 검출한 웨스턴 블랏 결과이고; 도 1d 는 EGCG 처리 24시간 후에 SREBP-1a, SREBP-1c, SREBP-2, fatty acid synthase (FAS), 및 acetyl-CoA carboxylase(ACC) RNA를 실시간 정량 PCR로 분석한 결과이다.
도 2는 EGCG가 AMP 활성화 단백질 카이나제 (AMPK) 경로를 통해 스테롤 조절부위 결합 단백질 (SREBP)-1 단백질의 발현을 억제하여 SEB-1 피지선세포에서 지질생성을 억제하는 것을 나타내는 결과로 도 2a는 SBE-1 세포를 30분간 표시된 농도의 화합물 C로 처리하고/하거나 EGCG로 처리한 후, 각각 3시간 및 12시간 후에 phospho-/total AMPK 및 phospho-ACC의 농도를 측정한 웨스턴 블랏 결과이고, 대조군 대비 *P< 0.05, **P< 0.01 (Student's t-test, a-e)이며; 도 2b는 Nile Red 염색을 정량화 한 결과로 대조군과 비교한 상대적 비를 나타낸 것으로 표시된 농도의 EGCG 처리하여 상대적 비를 얻고 화합물 C를 처리한 군과 처리하지 않는 군을 비교하여, 처리군과 비처리군은 유의한 차이를 보였으며, (*P< 0.05, Ŧ P<0.05; Student's t-test, g) 도 2c는 SEB-1 세포를 30분간 20μM 화합물 C로 처리하고/하거나 24시간 동안 EGCG로 처리한 후, Nile Red로 염색한 결과이다. (scale bar 10μm) 모든 실험은 최소 5회 반복되었으며 결과는 mean±SEM로 나타냈다.
도 3은 EGCG가 NF-kB 및 활성화 단백질 1 (AP-1) 경로를 억제하여 열로 불활성화된 P. acnes로 인해 SEB-1 세포에 야기된 염증을 감소시키는 것을 나타내는 결과로 도 3a는 P. acnes로 자극된 SEB-1 세포를 EGCG로 24시간 동안 처리한 뒤, 사이토카인 (IL-1α, IL-1β, tumor necrosis factor (TNF)-α 및 IL-8)의 정량 RT-PCR 데이터를 보여주는 결과이고; 도 3b 는 (a)와 같이 처리된 세포의 배양액에서 추출한 TNF-α 및 IL-8의 단백질의 ELISA 결과이고; 도 3c 는 20 μM 화합물 C로 30분간 및/또는 EGCG로 처리 시에 열로 불활성화된 P. acnes로 자극된 SEB-1 세포에서 추출한 단백질에 대한 phospho-c-Jun, phospho IkBα, matrix metalloproteinase (MMP)-2, 및 MMP-9의 웨스턴 블랏을 보여주는 결과이고; 도 3d 는 열로 불활성화된 P. acnes로 자극된 SEB-1 세포를 EGCG로 30분 및 24 시간 처리한 후 핵 및 세포질 분획에 대한 NF-kB p65의 웨스턴 블랏 결과이고; 도 3e 는 열로 불활성화된 P. acnes로 자극된 HaCaT 케라티노사이트에서 EGCG로 24 시간 처리 전 및 후의 phospho-IkBα, NF-kB p65, 및 IL-1α의 웨스턴 블랏 결과이고; 도 3f는 (e)와 동일하게 처리된 세포에서 분리한 RNA를 이용한 IL-1α에 대한 정량적 RT-PCR 결과이다. 모든 실험 (a-e) 는 최소 5회 반복하였으며, 데이터 (a, b, f)는 mean ± SEM로 나타냈고, Student's t-test를 이용하여 통계분석을 하였다: *P<0.05 (대조군과 각 P. acnes 처리 군); Ŧ P<0.05 (P. acnes 처리군과 EGCG-비처리군 또는 각 EGCG 처리군).
도 4는 EGCG의 SEB-1 세포에 대한 사멸효과 및 P. acnes에 대한 성장 억제 효과를 나타내는 것으로 도 4a 는 SEB-1 피지선세포 및 HaCaT 케라틴 세포에서의 EGCG 처리 24시간 또는 48 시간 처리 시 각 세포의 생존을 MTT 분석으로 측정한 결과이고; 도 4b 는 DAPI 염색을 보여주는 현미경 관찰 결과이고 (scale bar, 10 μm; X400); 도 4c 는 세포의 핵을 메틸 그린으로 염색한 TUNEL-양성 염색 세포를 보여주는 결과 (bar. 20μm)이고; 도 4d 는 (c)를 정량화한 결과이고; 도 4e 는 EGCG 처리 12, 24 및 48 시간 후 Bcl-2, Bax, capase-3, 및 cyclin D1의 발현 정도를 나타내는 웨스턴 블랏 결과이고, Bax/Bcl-2 단백질의 비율은 밴드의 강도를 상대적으로 비교하여 계산하였고, 도 4f 는 상이한 각 EGCG의 농도에 따른 P. acnes의 성장에 미치는 효과를 보여주는 결과이고; 도 4g 는 증가하는 EGCG의 농도에 따라 생성된 P. acnes의 콜로니 수를 대조군과 비교하여 백분율로 나타낸 결과이다. 모든 실험 (a-g) 은 최소 5회 반복되었고 결과는 mean ± SEM로 나타내고, 통계분석은 Student's t-test를 이용하였으며, 대조군과 비교하여 * P<0.05; ** P<0.01로 표시하였다.
도 5는 임상에서 8 주간 수행된 여드름 병변에 대한 5% EGCG의 효과를 나타내는 결과로, 도 5a 는 본원의 한 구현예에 따른 EGCG를 환자의 피부에 적용한 8주 후의 결과를 보여주는 사진이고; 도 5b 는 수정된 리드 등급을 나타내는 결과이며 도 5c 는 비염증성 부위 (comedones)이며, 도 5d 는 염증성 부위 (papules, pustules, 및 nodules)의 변화를 보여주는 결과이고; 도 5e 는 주관적 평가를 위해 VAS (visual analogue scale) 측정 결과를 나타낸다. 통계적 유의성은 Wilcoxon signed rank test로 수행하였다: *P<0.05 (각 EGCG 처리 군 및 기저군간의 비교); Ŧ P<0.05 (각 EGCG 처리 군 및 대조군간의 비교)
도 6은 임상에서 8주간 EGCG 처리 후 조직학적 변화를 나타내는 결과로 IL-8, phospho-c-JUN, SREBP-1, 및 NF-kB p65의 항체를 이용한 염색 결과 및 TUNEL 분석결과를 나타낸다. Scale Bar: 100μm, 모든 실험은 최소 5회 반복되었고 결과는 mean ± SEM로 나타내고, Wilcoxon signed rank test로 수행하였으며, *P<0.05를 기본값과 비교하여 통계적으로 유의한 것으로 판단하였다.
도 7은 본원의 한 구현예에 따른 카엠페롤(Kaempferol), 에피갈로카테킨(EGC, Epigallocatechin), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 카테킨(Catechin), 엘라직산 (Ellagic acid)의 오일레드 O 및 MTT 분석을 보여주는 결과이다.
도 8은 하루 2회 1% EGCG를 모낭각화가 발생한 팔의 환부에 도포하기 전 및 후의 사진이다.
도 9는 EGCG 및 글리콜산 혼합 용액을 환부에 도포하기 전 및 후의 사진이다.
도 10은 EGCG 및 살리실산 혼합 용액을 환부에 도포하기 전 및 후의 사진이다.Figure 1 shows that EGCG inhibits the expression of sterol regulatory site binding protein (SREBP) -1 protein through the AMP activation protein kinase (AMPK) pathway and inhibits lipogenesis in SEB-1 sebaceous cells. 1a is the result of total lipid analysis of SEB-1 sebaceous cells in the presence of ¹⁴ C acetate after 24 hours of EGCG treatment; FIG. 1B shows the results (C: cholesterol, fatty alcohol, OA: TEA: triglyceride, WE: wax ester, CO: cholesterol oleate, SQ: squalene) showing the change of lipid components in the thin layer chromatography, : mean 占 SE cpm / 10 ³ cells / hour; FIG. 1C is a Western blot result of detecting a precursor or mature of SREBP according to the concentration of EGCG; FIG. FIG. 1D shows the result of real-time quantitative PCR analysis of SREBP-1a, SREBP-1c, SREBP-2, fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC) RNA after 24 hours of EGCG treatment.
Figure 2 shows that EGCG inhibits the expression of sterol regulatory site binding protein (SREBP) -1 protein through the AMP activation protein kinase (AMPK) pathway and inhibits lipogenesis in SEB-1 sebaceous cells. Were Western blotting results in which phospho / total AMPK and phospho-ACC concentrations were measured after 3 and 12 hours, respectively, after treatment of SBE-1 cells with the indicated concentrations of compound C for 30 minutes and / or treatment with EGCG, * P < 0.05, ** P < 0.01 (Student's t-test, ae) compared to the control group; FIG. 2B is a graph showing the relative ratios compared with the control group as a result of quantifying Nile Red staining. The relative ratios were obtained by EGCG treatment at the indicated concentrations, and the groups treated with Compound C and the untreated group were compared. a; (Student's t-test, g * P <0.05, Ŧ P <0.05) Figure 2c and process the SEB-1 cells in 30 minutes 20μM compound C / or for 24 hours EGCG group showed a significant difference, Treated and then stained with Nile Red. (scale bar 10 μm) All experiments were repeated at least 5 times and the results were expressed as mean ± SEM.
Figure 3 shows that EGCG reduces inflammation caused by SEB-1 cells due to heat-inactivated P. acnes by inhibiting NF-kB and activation protein 1 (AP-I) pathway . SEP -1 cells stimulated with acnes were treated with EGCG for 24 hours and then analyzed for quantitative RT-PCR data of cytokines (IL-1 alpha, IL-1 beta, tumor necrosis factor (TNF) -a and IL-8) Result; FIG. 3b shows the results of ELISA of TNF-a and IL-8 proteins extracted from the culture medium of cells treated as in (a); Fig. 3c shows the phospho-c-Jun, phospho IkBa, and matrix metalloproteinase (MMP) of proteins extracted from heat-inactivated P. acnes stimulated SEB-1 cells for 30 minutes and / or with EGCG ) -2, and Western blot of MMP-9; FIG. 3D is the Western blot results of NF-KB p65 on nuclear and cytoplasmic fractions after treatment of heat-inactivated P. acnes stimulated SEB-1 cells with EGCG for 30 minutes and 24 hours; Figure 3e is the Western blot results of phospho-IkBa, NF-kB p65, and IL-lal before and after 24 hours treatment with heat-inactivated P. acnes stimulated HaCaT keratinocytes with EGCG; Figure 3f shows the results of quantitative RT-PCR of IL-1α using RNA isolated from cells treated in the same manner as in (e). All experiments (ae) was repeated at least 5 times, the data (a, b, f) are showed as mean ± SEM, using a Student's t-test was the statistical analysis: * P <0.05 (control group and each P. acnes treated group); P <0.05 (P. acnes treated group and EGCG untreated group or each EGCG treated group).
FIG. 4 shows the killing effect of EGCG on SEB-1 cells and growth inhibitory effect on P. acnes . FIG. 4a shows the effect of EGCG treatment on SEB-1 sebaceous cells and HaCaT keratin cells for 24 hours or 48 hours, The results of MTT analysis of survival were; Figure 4b is a microscopic observation showing DAPI staining (scale bar, 10 [mu] m; X400); FIG. 4C shows the result (bar. 20 .mu.m) showing TUNEL-positive staining cells stained with methyl green at the nucleus of the cells; Figure 4d is the result of quantifying (c); FIG. 4E shows Western blot results showing the expression levels of Bcl-2, Bax, capase-3 and cyclin D1 after 12, 24 and 48 hours of EGCG treatment, and the ratio of Bax / Bcl- 4f shows the effect on the growth of P. acnes according to the concentration of each different EGCG; Fig. Figure 4g shows the percentage of colonies of P. acnes produced according to the increasing concentration of EGCG compared to the control. All experiments (ag) were repeated at least 5 times and the results were expressed as mean ± SEM. Student's t-test was used for statistical analysis and * P < 0.05 compared with the control group. ** P < 0.01.
FIG. 5 is a photograph showing the effect of 5% EGCG on acne lesions performed in the clinic for 8 weeks, FIG. 5A is a photograph showing the results after 8 weeks of application of EGCG according to one embodiment of the present invention to the skin of a patient; Fig. 5b shows the results showing a modified lead grade, Fig. 5c is the non-inflammatory area, Fig. 5d is the result showing changes in inflammatory sites (papules, pustules, and nodules); 5E shows the result of VAS (visual analogue scale) measurement for subjective evaluation. Statistical significance was performed with the Wilcoxon signed rank test: * P < 0.05 (comparison between each EGCG treated group and baseline group); P < 0.05 (comparison between each EGCG treated group and control group)
FIG. 6 shows the results of staining and TUNEL analysis using antibodies to IL-8, phospho-c-JUN, SREBP-1, and NF-kB p65 as a result of histological changes after 8 weeks of EGCG treatment in clinical setting. Scale Bar: 100μm, all experiments were repeated at least 5 times the result is indicated by mean ± SEM, was performed by Wilcoxon signed rank test, * P <0.05 was judged as compared with the default value to be statistically significant.
FIG. 7 is a graphical representation of the effect of a compound of formula (I) according to one embodiment of the present invention on Kaempferol, Epigallocatechin, Formononetin, Quercetin, Catechin, Ellagic acid in oil-red O and MTT analysis.
FIG. 8 is a photograph before and after applying 1% EGCG twice a day to the affected part of the arm where follicular keratinization occurred.
FIG. 9 is a photograph before and after applying the mixed solution of EGCG and glycolic acid to the lesion.
10 is a photograph of EGCG and salicylic acid mixed solution before and after application to the lesion.

본원은 카테킨 및 그 유도체가 피부의 모낭각화 이상을 제어할 수 있다는 발견에 근거한 것이다. The present invention is based on the discovery that catechin and its derivatives can control the keratinization abnormalities of the skin.

따라서 한 양태에서 본원은 카테킨 및 그 유도체를 포함하는 모낭각화 이상의 예방 또는 치료용 약학적 조성물에 관한 것이다. Accordingly, in one aspect, the present invention relates to a pharmaceutical composition for preventing or treating follicular keratosis comprising catechin and a derivative thereof.

본원에서 사용된 용어 "카테킨"은 폴리페놀 화합물의 일종으로 플라보노이드의 한 종류이다. "플라보노이드"는 페닐기 2개가 C3사슬을 매개하여 결합한 C6-C3-C6형 탄소골격구조로 되어 있는 식물에 들어있는 비질소성 색소를 말하며, 치환기의 구조와 위치에 따라 플라보노이드의 기본골격에 따라 플라보노이드(flavonoids), 플라본(flavone), 안토시아닌(anthocyanin), 이소플라본(isoflavonoids), 네오플라보노이드(Neoflavonoids)의 5 종류로 나누어진다. 본원의 카테킨이 속하는 플라보노이드의 종류는 하기에 나열된 바와 같으나, 이에 한정되는 것은 아니다: The term "catechin" as used herein is a type of polyphenol compound and a kind of flavonoid. "Flavonoid" refers to a non-lipophilic pigment contained in a plant having a C6-C3-C6 type carbon skeleton structure in which two phenyl groups are bonded via a C3 chain. Depending on the structure and position of the substituent group, the flavonoid flavonoids, flavones, anthocyanins, isoflavonoids, and neoflavonoids. The classes of flavonoids to which the catechins of the present invention belong include, but are not limited to, those listed below:

플라보노이드: 플라본-3-올 (Flavan-3-ols)인 GCG (gallocatechin gallate), GC (gallocatechin), CG(cathechin 3-gallate), C (catechin), EGCG (epigallocatechin gallate), EGC (epigallocatechin), ECG(epicathechin 3-gallate), EC (epicatechin), 플라본-4-올 (Flavan-4-ols), 플라본-3, 4-디올 (Flavan-3, 4-diols)인 루코안토시아니딘(Leucoanthocyanidin), 플라보놀; 플라본(flavone): 루테올린(Luteolin), 아피젠(apigen), 탠저리틴(Tangeritin), 쿠에르세틴(Quercetin), 캄페롤(Kaempferol), 미리세틴(Myricetin), 피세틴(Fisetin), 이소함네틴(Isorhamnetin), 파키포디움(Pachypodium), 르함나진(Rhamnazin), 헤스페레틴(Hesperetin), 나링제닌(Naringenin), 에리딕티올(Eridictyol), 호모크리오딕티올(homocriodictyol), 탁시폴린(Taxifolin), 디하이드로쿠에르세틴(Dihydroquercetin), 디하이드로캄페롤(Dihydrokaempferol); 안토시아닌: 안토시아닌(anthocyanin), 시아니딘(cyanidin), 델피니딘(delphinidin), 말비딘(Malvidin), 페라르고니딘(Pelargonidin), 페오니딘(Peonidin), 페투니딘(Petunidin); 이소플라본(isoflavonoids) : 피토에스트로겐(Phytoestrogen), 게니스테인(Genistein), 데이드자인(Daidzein), 글리드테인(Glydtein), 에쿠올(equol), 론조카르판(Lonchocarpan), 락시플로란(Laxifloran); 네오플라보노이드(Neoflavonoids): 칼로필라드(Calophyllalld), 달페르기크로멘(Dalbergichromene), 쿠타레아게닌(Coutareagenin), 달베르긴(Dalbergin), 니베틴(Nivetin). Flavonoids: Flavan-3-ols (gallocatechin gallate), GC (gallocatechin), CG (cathechin 3-gallate), C (catechin), EGCG (epigallocatechin gallate), EGC (epigallocatechin) (EC), epicatechin, Flavan-4-ols, Flavan-3, 4-diols, Leucoanthocyanidin ), Flavonol; Flavones: Luteolin, apigen, Tangeritin, Quercetin, Kaempferol, Myricetin, Fisetin, iso But are not limited to, Isorhamnetin, Pachypodium, Rhamnazin, Hesperetin, Naringenin, Eridictyol, homocriodictyol, Taxifolin, ), Dihydroquercetin, Dihydrokaempferol; Anthocyanins: Anthocyanin, cyanidin, delphinidin, Malvidin, Pelargonidin, Peonidin, Petunidin; Isoflavonoids: Phytoestrogen, Genistein, Daidzein, Glydtein, equol, Lonchocarpan, Laxifloran, ; Neoflavonoids: Calophyllalld, Dalbergichromene, Coutareagenin, Dalbergin, Nivetin, and the like. Neoflavonoids: Calophyllalld, Dalbergichromene, Coutareagenin, Dalbergin, Nivetin.

본원에 따른 일 구현예에서는 특히 상기 플라보노이드 중 특히 EGCG (epigallocatechin gallate), GCG (gallocatechin gallate), EGC (epigallocatechin), ECG(epicathechin 3-gallate), GC (gallocatechin), CG(cathechin 3-gallate), EC (epicatechin), C (catechin), 카엠페롤(Kaempferol), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 또는 엘라직산(Ellagic acid) 이 사용되나, 이로 제한하는 것은 아니다. In one embodiment according to the present invention, in particular, epigallocatechin gallate (EGCG), gallocatechin gallate (EGC), epigallocatechin (EGC), epicathechin 3-gallate (ECG), gallocatechin (GC), cathechin 3-gallate But are not limited to, EC (epicatechin), C (catechin), Kaempferol, Formononetin, Quercetin, or Ellagic acid.

본원에서 사용된 용어 " 피지" 는 특히 트리글리세라이드, 유리 지방산, 왁스 에스테르, 스쿠알렌, 콜레스테롤 및 콜레스테릴 에스테르를 포함하는 피지선의 분비물을 의미한다. As used herein, the term "sebum" refers in particular to secretions of sebaceous glands including triglycerides, free fatty acids, wax esters, squalene, cholesterol and cholesteryl esters.

본원에서 사용된 용어 "세포사멸"는 세포(細胞)가 유전자에 의해 제어되어 사멸하는 방식의 한 형태로 세포의 자발적인 사멸을 유도한다. As used herein, the term "apoptosis" induces spontaneous apoptosis of a cell in a manner in which cells (cells) are controlled by the gene and die.

본원에서 사용된 용어 "모낭각화" 는 피부를 보호하는 단백질 중 하나인 각질(케라틴)이 과도하게 모낭에 생성되어, 털구멍을 막으면서 오돌토돌한 돌기를 만들기도 하고 피지 및 면포의 배출을 막아 염증을 유발할 수 있는 각질형성이 지나치게 많이 일어나는 것을 의미한다. As used herein, the term "follicular keratinization" refers to a process whereby keratin, one of the proteins that protects the skin, is excessively produced in the hair follicle, creating hairy pores and odontoid processes, Which may be caused by excessive keratinization.

본원에서 사용된 용어 "모낭각화 이상"또는 "모낭과각화"는 모낭에 박힌 각질 마개에 의해 때때로 모공 주위가 붉거나 갈색으로 보여 미관상 문제를 일으키는 것으로 피부가 건조하거나, 아토피에 의하여도 발생할 수 있다. 본원의 한 구현예에 따르면 모낭각화 이상으로 인한 질환은 여드름, 주사, 모공각화증, 또는 안면경부모낭성홍색흑피증을 들 수 있으나, 이로 제한하는 것은 아니다. The term "follicular keratinization disorder" or "hair follicle hyperalgesia ", as used herein, refers to the appearance of reddish or brownish pores around the pores sometimes caused by a keratin plug embedded in the hair follicle. According to one embodiment of the invention, the disease caused by abnormal hair follicle keratosis includes, but is not limited to, acne, injection, pouch keratosis, or facial nerve folliculitis.

본원에서 사용된 용어 "여드름"은 당업계에서 여드름으로 통칭되는 모든 피부질환, 또는 여드름과 유사한 기전을 통해 발명되는 모든 피부 질환을 포함하며, 염증성, 비염증성 및 여드름 병변을 포함한다. 또한 원인별로는 예컨대, 집합성 여드름, 일반적 여드름, 응괴성 여드름(congoblate acne), 화장품 사용에 의한 여드름, 세제성 여드름(acne detergicans), 청춘기 여드름, 전격성 여드름(acne fulminans), 절성 여드름(acne furunculoid), 할로겐에 의한 여드름, 경결성 여드름, 켈로이드성 여드름, 물리적 자극에 의한 여드름(mechanical acne), 약물성 여드름, 괴사성 여드름, 속립성 여드름, 신생아 여드름(acne neonatorum), 지성 여드름(acne oil), 구진성 여드름, 적창(pomade acne), 월경 전 여드름, 주사 여드름(acne rosacea), 모창성 여드름, 열대성 여드름(tropical acne), 중독성 여드름 (acne venenata), 성인 여드름 또는 심상성 여드름 등을 포함할 수 있으나, 이에 제한되는 것은 아니다.The term "acne " as used herein includes all skin diseases commonly referred to in the art as acne, or all skin conditions that are invented through a mechanism similar to acne, and includes inflammatory, noninflammatory, and acne lesions. Acne fungi, acne fulminculoid, acne fulminculoid, acne fulminculosis, acne fulminculosis, acne dermatitis, acne dermatitis, acne dermatitis, acne dermatitis, , Acne by halogen, acne acne, keloid acne, mechanical acne, drug acne, necrotic acne, acne vulgaris, acne neonatorum, acne oil, Can include acne, acne, pomade acne, premenstrual acne, acne rosacea, migratory acne, tropical acne, addictive acne venenata, adult acne or acne. But is not limited thereto.

본원에서 사용된 용어 "주사"는 코와 뺨 등 얼굴의 중간 부위에 홍반을 동반하는 구진, 농포, 부종 등을 주 증상으로 하는 만성질환이다 (Meyer-Hoffert U et al., J Investig Dermatol Symp Proc 2011 Dec; 15(1):16-23). As used herein, the term "injection " is a chronic disease with major symptoms such as papules, pustules, edema, and the like, which are accompanied by erythema on the middle part of the face such as the nose and cheeks (Meyer-Hoffert U et al., J Investig Dermatol Symp Proc Dec. 15 (1): 16-23).

본원에서 사용된 용어 "모공각화증"은 팔, 다리 등에 모공을 따라 작은 돌기가 나타나고 외관상 닭살 모양의 피부를 보이는 질환이다. (Lateef A et al., Cutis 1999, Apr; 63(4):205-7). As used herein, the term "pouch keratosis" refers to a disease in which a small protuberance appears along the pores in the arms and legs and the appearance of the skin in the appearance of a chicken skin. (Latee et al., Cutis 1999, Apr; 63 (4): 205-7).

본원에서 사용된 용어 "안면모낭성홍색흑피증"은 모낭을 중심으로 나타나는 홍반과 적갈색의 경계가 뚜렷한 색소침착이 안면부와 경부에 주로 나타나는 질환이다 (van Pelt HP et al., Acta Derm Venereol 1999, Jan; 79(1):65-6)As used herein, the term "facial follicular red sclerosis" refers to a disease in which the pigmentation of the erythema and reddish brown color appears mainly in the facial region and the neck region (van Pelt HP et al., Acta Derm Venereol 1999, Jan; 79 (1): 65-6)

모낭각화 이상 질환에는 염증이 수반될 수 있으며, 이러한 염증의 원인균으로는 예를 들면 프로피오니박테리움 아크네스 (Propionibacterium acnes), 스타필로코쿠스 아우레우스(Staphylococcus aureus), 또는 스타필로코쿠스 에피데르미데스(Staphylococcus epidermidis)를 들 수 있다. 특히 프로피오니박테리움 아크네스(Propionibacterium acnes)에 의하여 발생될 수 있으나, 이에 한정되는 것은 아니며, 본원의 조성물은 이러한 다양한 원인균으로 인한 질환에 효과가 있다. The abnormal follicular keratosis may be accompanied by inflammation. Examples of causative microorganisms of such inflammation include Propionibacterium acnes, Staphylococcus aureus, or Staphylococcus epi. And Staphylococcus epidermidis . Particularly, Propionibacterium acnes. However, the composition of the present invention is effective for diseases caused by these various causative bacteria.

상술한 질환들은 모두 과각화나 이상각화 등 정상 각화 과정에 문제가 있는 질환으로 본원에 따른 조성물은 이러한 각화 이상을 치료하여 상기 질환을 개선 또는 치료한다. All of the above-mentioned diseases have problems in normal keratinization processes such as hyperkeratinization and abnormal keratinization. The composition according to the present invention treats or alleviates the keratinizing disorders.

본원에 따른 카테킨 또는 그 유도체는 모낭각화 이상 개선, 완화, 예방, 또는 치료에 효과가 있다. 본원에서 사용된 용어 "치료" , "완화" 또는 "개선" 이란 본원 조성물의 투여로 관련 질환의 증세를 호전시키거나 이롭게 변경하는 모든 행위를 의미한다. 본원이 속하는 기술분야에서 통상의 지식을 가진 자라면, 대한의학협회 등에서 제시된 자료를 참조하여 질환의 정확한 기준을 알고, 개선, 향상 및 치료된 정도를 판단할 수 있을 것이다.The catechins or derivatives thereof according to the present invention are effective for improving, alleviating, preventing, or treating follicular keratinization abnormalities. The term " treatment ", "alleviation" or "improvement ", as used herein, refers to any act that improves or alleviates symptoms of a related disorder by administration of the composition. Those skilled in the art will be able to ascertain the precise criteria of the disease by referring to the data provided by the Korean Medical Association, and to judge the degree of improvement, improvement, and treatment of the disease.

본 명세서에서 사용된 용어 "예방"은 본원 조성물의 투여로 여드름을 포함하는 모낭각화 이상 관련 질환의 발병을 억제 또는 지연시키는 모든 행위를 의미한다. 본원 조성물은 모낭각화 초기 증상, 또는 나타나기 전에 투여할 경우 이러한 질환을 예방할 수 있다는 것은 당업자에게 자명할 것이다. The term "prophylactic, " as used herein, refers to any act that inhibits or delays the onset of a follicular keratinocyte related disorder, including acne, by administration of the composition herein. It will be apparent to those skilled in the art that the compositions herein can prevent early onset symptoms of follicular keratinization, or even if they are administered prior to appearance.

본 발명은 카테킨 유도체가 피지선세포 및 케라틴 세포에서 AP(activator protein)-1 및 NF-kB(nuclear factor kappa-light-chain-enhancer of activated B cells) 신호경로를 조절하고 세포사멸을 저해함으로써 모낭각화 이상을 예방 또는 치료할 수 있는 약학적 조성물에 관한 것이다. The present invention is based on the finding that catechin derivatives control the signaling pathway of AP (activator protein) -1 and nuclear factor kappa-light-chain-enhancer of activated B cells in sebaceous and keratinocytes and inhibit apoptosis, Or a pharmaceutically acceptable salt thereof.

AP-1은 TPA(12-O -테트라데카노일포볼 13-아세트산)의 표적이 되는 단백질인산화효소 C에 의해 조절되는 주요 전사인자의 하나로서, AP-1은 원암유전자 산물 Jun(c Jun은 340개 아미노산 잔기로 구성)과 Fos(c-Fos는 380개 아미노산 잔기로 구성)의 복합체이다. 또한, NF-κB는 면역 세포에서 염증 기전에 관여하는 가장 중요한 전사인자 중 하나로서, NF-κB는 T세포 수용체, B세포 수용체, CD40 등 면역에 관여하는 다양한 수용체의 자극으로 인하여 세포활성 물질과 성장 인자의 발현을 조절한다. 다양한 원인에 의한 비정상적인 NF-κB의 활성은 아토피, 알레르기, 루푸스, 관절염 등 여러 가지 자가면역 질환의 기전으로 알려져 있으며, 면역 세포 외에도 발달 및 뇌, 피부, 뼈 등 다양한 생리 조절 기전에 관여한다.AP-1 is one of the major transcription factors regulated by protein kinase C that is the target of TPA (12-O-tetradecanoylpolys-13-acetic acid) (Consisting of 380 amino acid residues) and Fos (c-Fos consists of 380 amino acid residues). In addition, NF-κB is one of the most important transcription factors involved in the inflammation mechanism in immune cells. NF-κB stimulates various receptors involved in immunity such as T cell receptor, B cell receptor and CD40, Regulates the expression of growth factors. Abnormal NF-κB activity due to various causes is known to be a mechanism of various autoimmune diseases such as atopy, allergies, lupus, and arthritis. In addition to immune cells, it also participates in various physiological control mechanisms such as development and brain, skin and bone.

본 발명의 한 구현예에서는 카테킨 유도체 중 EGCG (epigallocatechin gallate)가 피지선세포 및 케라틴 세포에서 AP-1 및 NF-kB 신호경로를 조절하고 세포사멸를 저해함으로써 모낭각화 이상을 예방 또는 치료할 수 있다.In one embodiment of the present invention, EGCG (epigallocatechin gallate) among the catechin derivatives controls the AP-1 and NF-kB signaling pathways in sebaceous and keratinocytes and inhibits apoptosis, thereby preventing or treating follicular keratinization.

본 발명의 카테킨 유도체를 포함하는 약학적 조성물은 AMPK-SREBP-1 신호전달 경로를 조절함으로써 피지 생성 및 이로 인한 모낭각화 이상을 억제할 수 있다. The pharmaceutical compositions comprising the catechin derivatives of the present invention can inhibit sebum production and thereby abnormal hair follicle keratinization by modulating the AMPK-SREBP-1 signaling pathway.

본 발명의 한 구현예에서 카테킨 유도체인 EGCG는 피지선 세포에서 AMP-activated protein kinase(AMPK)를 활성화시키고, 활성화된 AMPK는 지질생성 및 SREBP(Sterol regulatory element-binding protein)의 발현을 감소시킨다. AMPK는 세포내에서 에너지 항상성을 조절하는 역할을 하는 효소로서, 콜레스테롤 합성, 지질생성, 중성지방 합성을 저해하고, 인슐린 분비를 조절한다. SREBP는 스테롤 조절 DNA에 결합하는 전사인자로서 콜레스테롤 생합성 및 지방산 생합성과 흡수에 관여한다. In one embodiment of the present invention, EGCG, a catechin derivative, activates AMP-activated protein kinase (AMPK) in sebaceous cells, and activated AMPK decreases lipid production and SREBP (Sterol regulatory element-binding protein) expression. AMPK is an enzyme that regulates energy homeostasis in cells. It inhibits cholesterol synthesis, lipid production, triglyceride synthesis, and regulates insulin secretion. SREBP is a transcription factor that binds to sterol regulatory DNA and is involved in cholesterol biosynthesis and fatty acid biosynthesis and uptake.

또한, 본 발명의 카테킨 유도체를 포함하는 약학적 조성물은 AMPK 의존적으로 IGF-1/PI3K/Akt 세포신호 전달을 저해하는데, IGF-1/PI3K/Akt 신호전달 경로는 SREBP를 통하여 지질 생성 및 이로 인한 모낭각화 이상을 억제할 수 있다. IGF-1(Insulin-like growth factor-1)은 세포성장 및 발달에 중요한 역할을 하며, PI3K(phosphatidylinositol 3-kinase)/Akt 신호전달 경로는 항암에도 관련되어 있다.In addition, the pharmaceutical composition comprising the catechin derivative of the present invention inhibits IGF-1 / PI3K / Akt cell signaling in an AMPK-dependent manner, wherein the IGF-1 / PI3K / Akt signaling pathway mediates lipid production through SREBP Can inhibit follicular keratinization abnormality. Insulin-like growth factor-1 (IGF-1) plays an important role in cell growth and development, and the PI3K (phosphatidylinositol 3-kinase) / Akt signaling pathway is also involved in anticancer.

또한, 본 발명의 카테킨 유도체를 포함하는 약학적 조성물은 염증 조절의 매우 중요한 신호전달 경로인 NF-kB 및 AP-1 신호전달 경로를 저해함으로써 염증 반응을 억제할 수 있다. 특히, 본 발명의 한 구현예에서 카테킨 유도체인 EGCG는 피지선세포에서 IkB의 인산화를 감소시킴으로써 P. acnes에 의하여 유도된 염증 반응 및 NF-kB 및 AP-1의 신호전달 경로를 억제하였고, 이러한 저해는 모낭각화 이상 교정으로 연결될 수 있다. 또한, AMPK를 억제하면 EGCG에 의하여 억제되었던 NF-kB 및 AP-1의 신호전달 경로를 복구시켰다. IkB의 인산화는 NF-kB 및 AP-1 신호전달 경로의 상위에서 이루어지는 것으로서, 이러한 결과는 카테킨 유도체에 의하여 활성화된 AMPK가 NF-kB 경로, 염증 반응을 억제시키고 및 이로 인한 모낭각화 이상을 교정하는 것을 보여주는 것이다. In addition, the pharmaceutical composition containing the catechin derivative of the present invention can inhibit the inflammatory reaction by inhibiting the NF-kB and AP-1 signaling pathways, which are very important signal transduction pathways of inflammation regulation. In particular, in one embodiment of the present invention, EGCG, a catechin derivative, inhibited the inflammatory response induced by P. acnes and the signaling pathways of NF-kB and AP-1 by reducing the phosphorylation of IkB in sebaceous cells, Can be linked to correction of abnormal follicular keratinization. In addition, inhibition of AMPK restored signal transduction pathways of NF-kB and AP-1, which were inhibited by EGCG. IkB phosphorylation occurs at higher levels of the NF-kB and AP-1 signaling pathways, suggesting that AMPK activated by catechin derivatives inhibits the NF-kB pathway, inflammatory response, .

또한, 본 발명의 카테킨 유도체를 포함하는 약학적 조성물은 케라틴 세포에서 IL-1α를 감소시킴으로써 모낭 케라틴세포의 모낭각화 이상을 저해한다. In addition, the pharmaceutical composition comprising the catechin derivative of the present invention inhibits follicular keratinization abnormality of hair follicular keratin cells by decreasing IL-1 alpha in keratinocytes.

또한, 본 발명의 카테킨 유도체를 포함하는 약학적 조성물은 NF-kB 또는 Akt 신호전달 경로를 저해함으로써 세포의 세포사멸 및 세포주기 휴지(cell cycle arrest)를 감소시킨다. 이러한 세포사멸 및 세포주기 휴지 감소는 카테킨 유도체의 항증식 작용(antiproliferation)에 의한 것으로서 피지선 부위에서의 피지 분비 및 모낭각화를 억제할 수 있도록 한다. In addition, the pharmaceutical composition comprising the catechin derivative of the present invention inhibits the cell apoptosis and cell cycle arrest by inhibiting the NF-kB or Akt signaling pathway. Such apoptosis and reduction of cell cycle arrest are caused by antiproliferation of catechin derivatives, which can inhibit sebaceous secretion and follicular keratinization in the sebaceous glands.

본원 조성물은 여드름, 주사, 모공각화증, 또는 안면경부모낭성홍색흑피증을 포함하는 모낭각화 이상으로 인한 질환의 예방 또는 치료를 위한 약학 조성물은 물론 화장용 조성물, 특히 여드름 치료, 개선, 완화 또는 예방용 화장 조성물로 이용될 수 있다. 이때, 상기 조성물이 적용될 수 있는 범위는 모낭각화 이상이 발생할 수 있는 부위라면 특별히 제한되지 않으며, 바람직하게는 얼굴, 두피 또는 등 부위에 다양한 투여 경로, 예를 들면 전신 또는 국소, 특히 국소 투여, 경구, 경피, 또는 주사, 특히 경피 경로로 투여될 수 있다. The present invention relates to a pharmaceutical composition for preventing or treating diseases caused by abnormal hair follicular keratosis including acne, injection, pore keratosis, or facial nerve follicular hypochromatosis, as well as a cosmetic composition, particularly a composition for treating, improving, May be used as a cosmetic composition. Herein, the range to which the composition can be applied is not particularly limited as long as it is a site where follicular keratinizing abnormalities can occur. Preferably, various routes of administration such as face, scalp or back region such as systemic or topical, , Transdermal, or injection, particularly by the transdermal route.

본원에 따른 일 구현예에서는 카테킨 또는 그 유도체를 포함하는 모낭각화 이상으로 인한 질환 예를 들면 여드름 예방, 개선 또는 완화용 화장용 조성물을 개시하며, 함량은 목적하는 제품의 구체적 용도 또는 제형 등에 따라 달라질 수 있으나, 전체 조성물 중에 약 0.1 내지 30 % (w/v)로 함유될 수 있으며, 약 5 내지 25 % (w/v), 약 5 내지 20 % (w/v)로 포함될 수 있다. In one embodiment according to the present application, a cosmetic composition for preventing, ameliorating or alleviating acne, for example, a disease caused by abnormality of follicular keratin containing catechin or a derivative thereof is disclosed. The content varies depending on the specific use or formulation of the desired product , But may be included in the total composition in an amount of about 0.1 to 30% (w / v), and may be included in about 5 to 25% (w / v), about 5 to 20% (w / v).

본원의 화장 조성물은 상기 카테킨 또는 그 유도체 이외에 항산화제, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제 및 담체를 포함할 수 있다. The cosmetic composition of the present invention may contain, in addition to the catechin or a derivative thereof, conventional additives and carriers such as antioxidants, stabilizers, solubilizers, vitamins, pigments and fragrances.

또한 본원의 화장 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이크림, 헤어토닉, 샴푸, 린스, 클렌징 크림, 클렌징 폼, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.The cosmetic composition of the present invention may be prepared in any form conventionally produced in the art and may be in the form of solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. More specifically, it can be prepared in the form of a flexible lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, an eye cream, a hair tonic, a shampoo, a rinse, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder .

본원 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.When the composition of the present invention is a paste, cream or gel, an animal oil, a vegetable oil, a wax, a paraffin, a starch, a tracer, a cellulose derivative, polyethylene glycol, silicon, bentonite, silica, talc or zinc oxide may be used as a carrier component .

본원 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.When the composition of the present composition is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, a mixture of chlorofluorohydrocarbons, propane / Propane or dimethyl ether.

본원 조성물의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 사용될 수 있다. When the formulation of the composition is a solution or an emulsion, a solvent, a solubilizing agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, , 3-butyl glycol, glycerol aliphatic ester, polyethylene glycol or fatty acid esters of sorbitan can be used.

본원 조성물의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소 결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 사용될수 있다.When the formulation of the present composition is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspension such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tracant, etc. may be used.

본원 조성물의 제형이 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리움 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.바람직한 투여 유형에 따르면, 본 발명의 조성물은 최소한 하나의 약학적으로 허용되는 부형제, 특히 피부학적으로 허용 가능한 부형제를 포함할 수 있다. When the formulation of the composition of the present invention is an interface-active agent-containing cleansing, the carrier component is selected from the group consisting of aliphatic alcohol sulfates, aliphatic alcohol ether sulfates, sulfosuccinic acid monoesters, isethionates, imidazolium derivatives, methyltaurates, sarcosinates, fatty acid amide ethers A fatty acid glyceride, a fatty acid diethanolamide, a vegetable oil, a lanolin derivative, or an ethoxylated glycerol fatty acid ester, etc. According to a preferred administration type, the composition of the present invention contains at least one Of a pharmaceutically acceptable excipient, especially a dermatologically acceptable excipient.

또한, 상기 각 제형의 피부용 조성물에 있어서, 상기한 필수 성분 이외의 다른 성분들은 기타 피부용 조성물 또는 사용목적 등에 따라 당업자가 어려움 없이 선정하여 배합할 수 있다.Further, in the composition for dermatological preparation of each of the formulations, components other than the above-mentioned essential components may be selected and mixed without difficulty by those skilled in the art depending on other compositions for dermal use or the purpose of use.

본원에 따른 조성물은, 본 분야의 숙련가에게 알려진 약학적 보조제인, 증점제, 보존제, 향료, 착색제, 화학 또는 무기염류 필터, 보습제, 열 온천수 등에서 선택되는 최소한 하나의 보조제를 또한 포함할 수 있다. 예들 들면 화장품 또는 기능식품에서 통상 사용되는 보존제는, 항균 활성을 가지는 분자, 예를들면 카프릴 유도체 (카프릴로일글리신 및 글리세릴 카프릴레이트), 예를들면 헥산디올 및 소듐 레불리네이트, 아연 및 구리 유도체 (글루콘 산염 및 PCA), 피토스핑고신 및 이의 유도체, 벤조일 페록사이드, 피록톤올아민, 아연 피리치온 및 셀레늄 황화물, 에코나졸, 케토코나졸, 또는 국소용 항생제 예를 들면 에리트로마이신 및 클린다마이신을 들 수 있다. The composition according to the invention may also comprise at least one adjuvant selected from the group of pharmaceutical adjuvants known to the person skilled in the art, thickeners, preservatives, flavors, coloring agents, chemical or mineral salts filters, moisturizers, hot spring water and the like. Preservatives commonly used in cosmetics or functional foods are, for example, molecules having antimicrobial activity, such as capryl derivatives (capryloylglycine and glyceryl caprylate), such as hexanediol and sodium levorinate, zinc And copper derivatives (gluconate and PCA), phytosphingosine and derivatives thereof, benzoyl peroxide, pyrrothonol amine, zinc pyrocite and selenium sulfide, econazole, ketoconazole or topical antibiotics such as erythromycin and Clindamycin can be called.

또한 본원의 조성물은 필요한 경우 피지조절제, 항균제, 항진균제, 각질용해제, 각질조절인자, 수렴제 (astringent), 항-염증제/항-자극제, 항산화제/자유라디칼 포획제, 상처 치료제, 항-노화제 및/또는 보습제에서 선택 되는 최소한 하나의 항-여드름 화합물을 더욱 포함할 수 있다.The composition of the present invention may also contain, if necessary, other ingredients such as an anti-inflammatory agent, an antimicrobial agent, an antifungal agent, a keratolytic agent, an exfoliation regulator, an astringent, an anti-inflammatory / anti- irritant, an antioxidant / free radical capturing agent, / RTI > and / or at least one anti-acne compound selected from moisturizers.

한 구현예에서 본원 조성물은 카테킨 또는 그 유도체를 일정량의 메탄올, 에탄올, 프로판올, 부탄올 등의 유기용매를 이용하여 용해한 후 물을 이용하여 카테킨 유도체 약 0.1 % 내지 30 % (w/v) 수용액으로 제조할 수 있으나, 이에 한정되는 것은 아니다. 한 구현예에서 카테킨 유도체 중 EGCG (epigallocatechin gallate)를 에탄올에 녹이고 증류수로 약 1 % 또는 5 %(v/v) EGCG 용액을 제조한다. In one embodiment, the composition of the present invention is prepared by dissolving catechin or a derivative thereof in an amount of an organic solvent such as methanol, ethanol, propanol, butanol or the like, and then using an aqueous solution of catechin derivative in an amount of about 0.1% to 30% (w / v) But is not limited thereto. In one embodiment, EGCG (epigallocatechin gallate) in catechin derivatives is dissolved in ethanol and about 1% or 5% (v / v) EGCG solution is prepared with distilled water.

본 발명의 조성물은 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경피, 경구, 또는 정맥, 근육 또는 피하 주사에 의해 투여될 수 있으나, 경구 또는 피부에 직접 투여하는 것이 바람직하다, 그러나 상기 투여 방법은 환자의 상태에 따라 적절히 수정되는 것이 가능하다. 본원의 한 구현예에서는 경피 투여가 바람직하며, 이 경우, 카테킨 또는 그 유도체를 약 0.1 % 내지 30 % (w/v)로 포함하는 조성물을 환부에 하루에서 여드름이 호전될 때까지 부정기간 하루 일회 내지 여러 번 도포할 수 있다. The composition of the present invention may be administered by various routes. All modes of administration may be expected, for example, transdermal, oral, or by intravenous, intramuscular or subcutaneous injection, although oral administration or direct administration to the skin is preferred, It is possible to modify it appropriately according to the state. In one embodiment of the invention, transdermal administration is preferred, wherein a composition comprising about 0.1% to 30% (w / v) of catechin or a derivative thereof is added to the affected part once a day for an irregular period To several times.

본원에 따른 약학 또는 화장 조성물은 박피제를 추가로 포함할 수 있다. 박피제는 특정한 산성의 화학 물질을 사용하여 원하는 깊이까지 상처를 만들 수 있는 물질로, AHA (Alpha-Hydroxy Acid) 또는 BHA (Beta-Hydroxy Acid)이 사용될 수 있다. AHA의 예로는 글리콜산을 들 수 있고, BHA의 예로는 살리실산을 들 수 있으나, 이로 제한하는 것은 아니다.The pharmaceutical or cosmetic composition according to the present invention may further comprise a peeling agent. A peeling agent is a material that can be cut to a desired depth using a specific acidic chemical, such as Alpha-Hydroxy Acid (BHA) or Beta-Hydroxy Acid (BHA). Examples of AHA include glycolic acid, and examples of BHA include, but are not limited to, salicylic acid.

본원에 따른 일 구현예에서, ECGC는 저농도의 피부 박피제와 혼합되며, 예를 들면 1) EGCG 의 여드름 병변 으로의 흡수를 방해하는 각질층 및 표피 장벽을 피부 박피제 성분이 제거하여 EGCG 의 병변 주변 국소 농도를 상승시키고, 2) 약한 산성 환경에서 EGCG 분자 자체의 안정도를 높이며, 3) 피부 박피제 성분 역시 독립적인 기전으로 여드름 병변을 호전시킬 것으로 기대되어 단순히 각각의 두 물질에서 기대할 수 있는 여드름의 치료 효과를 합한 것보다 더욱 상승 효과가 날 수 있을 농도로 포함된다. 예를 들면 약학 조성물의 경우, 박피제는 약 1 내지 70% (w/v), 화장 조성물의 경우에는 약 1 내지 10% (w/v)의 양으로 포함될 수 있다. 본원에 따른 일 구현예에서, 글리콜산은 약 5%, 살리실산은 약 2%의 농도로 포함되고, EGCG는 5%의 농도로 포함될 수 있으나 이로 제한하는 것은 아니다.
In one embodiment according to the present application, the ECGC is mixed with a low density skin cleansing agent, for example 1) removing the skin layer and epidermal barrier, which interfere with the absorption of EGCG into acne lesions, (2) increase the stability of the EGCG molecule itself in a weakly acidic environment; and (3) it is expected to improve acne lesions with an independent mechanism of skin peeling. Thus, It is included as a concentration that can be more synergistic than combined treatment effects. For example, in the case of pharmaceutical compositions, the peeling agent may be included in an amount of about 1 to 70% (w / v), and in the case of a cosmetic composition, about 1 to 10% (w / v). In one embodiment according to the present application, glycolic acid is included at a concentration of about 5%, salicylic acid at a concentration of about 2%, and EGCG may be included at a concentration of 5%, but is not limited thereto.

나아가 본 발명의 조성물은 모낭각화 이상의 예방 및 개선을 위한 건강식품 및 음료 등에 다양하게 이용될 수 있다. 본 발명의 조성물을 첨가할 수 있는 식품으로는, 예를 들어, 각종 식품류, 음료, 껌, 차, 비타민 복합제, 건강보조 식품류 등이 있고, 분말, 과립, 정제, 캡슐 또는 음료인 형태로 사용할 수 있다.Furthermore, the composition of the present invention can be widely used for health foods and beverages for prevention and improvement of follicular keratinization and the like. Examples of foods to which the composition of the present invention can be added include various foods, beverages, gums, tea, vitamin complexes, health supplements and the like, and they can be used in the form of powders, granules, tablets, have.

본 발명의 조성물은 독성 및 부작용은 거의 없으므로 예방 목적으로 장기간 복용 시에도 안심하고 사용할 수 있는 약제이다.Since the composition of the present invention has little toxicity and side effects, it can be safely used even for long-term administration for preventive purposes.

한 구현예에서 본 발명의 상기 조성물은 모낭각화 이상의 예방 및 개선을 목적으로 식품 또는 음료에 첨가될 수 있다. 이 때, 식품 또는 음료 중의 상기 조성물의 양은 일반적으로 본 발명의 건강식품 조성물은 전체 식품 중량의 0.01 내지 15 중량%로 가할 수 있으며, 건강 음료 조성물은 100 ㎖를 기준으로 0.02 내지 30 g, 바람직하게는 0.3 내지 10 g의 비율로 가할 수 있으나, 이에 한정되는 것은 아니다.In one embodiment, the composition of the present invention may be added to a food or beverage for the purpose of preventing and improving follicular keratinization. At this time, the amount of the composition in the food or beverage is generally 0.01 to 15% by weight of the total food weight of the health food composition of the present invention, and the health beverage composition is 0.02 to 30 g based on 100 ml, May be added at a ratio of 0.3 to 10 g, but is not limited thereto.

상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그밖에 본 발명의 조성물들은 천연 과일 쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 본 발명의 조성물 100 중량당 0 내지 약 20 중량의 범위에서 선택되는 것이 일반적이나, 이에 한정되는 것은 아니다.
In addition to the above-mentioned composition, the composition of the present invention can be used as a flavoring agent such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, coloring agents and intermediates (cheese, chocolate etc.), pectic acid and its salts, Salts, organic acids, protective colloid thickening agents, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated beverages and the like. In addition, the compositions of the present invention may contain flesh for the production of natural fruit juices and fruit juice drinks and vegetable drinks. These components may be used independently or in combination. The ratio of such additives is generally selected from the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention, but is not limited thereto.

이하, 본 발명을 하기의 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

본 발명은 달리 언급이 없는 한 세포생물학, 세포배양, 분자생물학, 유전자 형질전환 기술, 미생물학, DNA 재조합기술에 관한 당업자의 기술수준 내인 통상의 기술을 사용하여 실시될 수 있다. 또한 일반적인 기술에 관한 보다 자세한 설명은 Molecular Biotechnology: (Bernard et al., ASM press 1994); Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley &Sons 1999); DNA Cloning, Volumes I and II (Glover ed., 1985)을 참고할 수 있다.
The present invention may be practiced using conventional techniques within the skill of those skilled in the art of cell biology, cell culture, molecular biology, gene transformation techniques, microbiology, DNA recombinant techniques, unless otherwise indicated. A more detailed description of common techniques can also be found in Molecular Biotechnology: (Bernard et al., ASM press 1994); Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al., Eds., John Wiley & Sons 1999); DNA Cloning, Volumes I and II (Glover ed., 1985).

실시예 1: EGCG 의 지방 생성 억제 효과Example 1: Inhibitory effect of EGCG on fat production

EGCG가 인간 SEB-1 피지선세포(sebocyte)에서 지질을 조절할 수 있는지를 확인하기 위하여 Thiboutot et al. ,(Human skin is a steroidogenic tissue: steroidogenic enzymes and cofactors are expressed in epidermis, normal sebocytes, and an immortalized sebocyte cell line(SEB-1). J Invest Dermatol 120:905-14, 2003)에 기재된 피지선 활성 모델을 사용하였다. 요약하면, SEB-1에 도 1에 기재된 각각 다른 농도의 EGCG로 처리하고 24시간 후 ¹⁴C-아세테이트의 존재 하에서 SEB-1 피지선세포로부터 지질의 총량을 분석하였다. 주요 지질 성분의 변화는 박층크로마토그래피(thin-layer chromatography)를 사용하여 분석하였다. 그 결과 도 1a에 나타낸 바와 같이 ¹⁴C-아세테이트 와 결합하는 총지질의 양이 유의하게 감소하였으며, 40 μM의 EGCG로 처리한 SEB-1 피지선세포에서 세포내 지질의 수준이 55% 감소하는 것으로 나타났다. 이러한 지질의 감소는 콜레스테롤과 중성지방(triglyceride)의 감소에 따른 것이었다. (도 1 b) To determine whether EGCG can regulate lipid in human SEB-1 sebaceous cells (sebocytes), Thiboutot et al. , And the sebaceous gland activity model described in J Invest Dermatol 120: 905-14, 2003), which is expressed in the sebaceous gland, Respectively. Briefly, SEB-1 was treated with different concentrations of EGCG as described in Fig. 1 and the total amount of lipids was analyzed from SEB-1 sebaceous cells in the presence of ¹⁴ C-acetate after 24 hours. Changes in major lipid components were analyzed using thin-layer chromatography. As a result, the amount of total lipid binding to ¹⁴ C-acetate was significantly decreased as shown in FIG. 1A, and the level of intracellular lipid was reduced by 55% in SEB-1 sebaceous cells treated with 40 μM of EGCG . This decrease in lipid was due to a decrease in cholesterol and triglyceride. (Fig. 1B)

EGCG의 지방생성억제 효과를 이해하기 위하여 콜레스테롤/지방산 대사의 주요 전사인자로 알려진 SREBPs (sterol regulatory element-binding proteins)가 관련되는지의 여부를 테스트 하였다. 그 결과 도 1c에 나타난 바와 같이 EGCG 처리 24시간 후 SREBPs의 전구체(precursor) 또는 성숙체(mature)는 유의하게 감소되었다. 또한 정량 실시간 PCR에서 EGCG는 SREBP의 아이소형(isoform)인 SREBP-1a, SREBP-1c 및 SREBP-2의 mRNA 수준을 모두 감소시키는 것으로 나타났다. 이는 EGCG가 전사 수준에서 SREBPs의 발현을 저해하는 것을 나타내는 것이다. 도 1d에서 나타낸 바와 같이 SREBPs의 2개의 하위 표적(downstream targets)인 지방산 생성효소(fatty acid synthase) 및 acetyl-CoA carboxylase의 발현이 감소하는 것을 확인하였다. In order to understand the inhibitory effect of EGCG on lipogenesis, it was tested whether sterol regulatory element-binding proteins (SREBPs), which are known as major transcription factors of cholesterol / fatty acid metabolism, are involved. As a result, the precursor or mature of SREBPs was significantly reduced after 24 hours of EGCG treatment as shown in Fig. 1C. In addition, in quantitative real-time PCR, EGCG reduced both mRNA levels of SREBP-1a, SREBP-1c and SREBP-2, the isoforms of SREBP. This indicates that EGCG inhibits the expression of SREBPs at the transcriptional level. As shown in FIG. 1d, it was confirmed that expression of two downstream targets SREBPs, fatty acid synthase and acetyl-CoA carboxylase, was decreased.

이러한 결과들은 모두 SREBP 신호 전달을 저해를 통하여 EGCG가 피지를 억제함을 나타내는 결과이다.
These results indicate that EGCG inhibits sebum through inhibition of SREBP signal transduction.

실시예 2: EGCG 처리시 지방 생성 억제에 의한 AMPK 신호전달 조절Example 2: Regulation of AMPK signaling by inhibiting lipogenesis in EGCG treatment

AMPK 활성이 EGCG에 의한 SREBP-1의 감소에 필요한 것인지를 확인하기 위하여 McCullough LD. et al.에 기재된 AMPK 선택적 저해제인 화합물 C( (Pharmacological inhibition of AMP-activated protein kinase provides neuroprotection in stroke. J Biol Chem 280: 20493-502, 2005)를 사용하였다. To determine whether AMPK activity is required for the reduction of SREBP-1 by EGCG, McCullough LD. (Pharmacological inhibition of AMP-activated protein kinase-providing neuroprotection in stroke. J Biol Chem 280: 20493-502, 2005), which is an AMPK selective inhibitor, was used.

도 2a에서 나타낸 바와 같이 EGCG는 AMPK Thr172 및 acetyl-CoA 카르복실라제 Ser79의 인산화를 증가시켰다. 이는 Hwang et al.,(Genistein, EGCG, and capsaicin inhibit adipocyte differentiation process via activating AMP-activated protein kinase. Biochem Biophys Res Commun 338:694-9, 2005) 및 Collins et al.,(Epigallocatechin-3-gallate (EGCG), a green tea polyphenol, suppresses hepatic gluconeogenesis through 50-AMP-activated protein kinase. J Biol Chem 282:30143-9, 2007)에서 보여주었던 다른 세포에서의 결과와 같이 EGCG가 SEB-1 피지선세포에서 AMPK를 활성화시킨다는 것을 보여주는 결과이다. 20μM의 화합물 C를 30분간 전처리하고, EGCG를 처리한 후, 인산화/ 총 AMPK 및 인산화-ACC를 3시간 후 측정하였다. 성숙체 SREBP-1을 12시간 후 측정한 결과, 화합물 C는 EGCG에 의하여 유도된 AMPK 활성을 효과적으로 저해하였다. 또한, 화합물 C는 EGCG에 의하여 유도된 SREBP-1 발현을 차단하였는데, 이는 AMPK가 EGCG로 인한 SREBP-1 발현의 저해에 중요한 매개체임을 보여주는 것이다. 이러한 결과로 AMPK의 저해는 EGCG의 피지억제 효과를 차단한다는 것을 알 수 있었다. As shown in FIG. 2A, EGCG increased phosphorylation of AMPK Thr172 and acetyl-CoA carboxylase Ser79. (Genistein, EGCG, and capsaicin inhibitory adipocyte differentiation process via activating AMP-activated protein kinase. Biochem Biophys Res Commun 338: 694-9, 2005) and Collins et al., (Epigallocatechin-3-gallate EGCG, a green tea polyphenol, suppresses hepatic gluconeogenesis through 50-AMP-activated protein kinase. J Biol Chem 282: 30143-9, 2007) To activate the < / RTI > 20 [mu] M of Compound C was pretreated for 30 minutes, treated with EGCG, and then phosphorylated / total AMPK and phosphorylated-ACC were measured after 3 hours. Mature SREBP-1 was measured after 12 hours, and Compound C effectively inhibited AMPK activity induced by EGCG. In addition, Compound C blocked expression of SREBP-1 induced by EGCG, indicating that AMPK is an important mediator of inhibition of SREBP-1 expression due to EGCG. As a result, it was found that inhibition of AMPK blocks the sebaceous gland inhibitory effect of EGCG.

EGCG 로 처리된 SEB-1 피지선세포의 세포내 지질 농도를 관찰하기 위하여 20μM의 화합물 C를 30분간 전처리하고, EGCG를 24시간 동안 처리한 SEB-1 세포를 나일레드 O 염색으로 관찰하였다. 그 결과 도 2 b 및 c에 나타난 바와 같이 EGCG 로 처리된 SEB-1 피지선세포의 세포내 지질 수준은 감소되었으나, SEB-1이 화합물 C로 선처리된 경우에는 EGCG는 세포내 지질 수준을 감소시키지 못하였다. 이러한 결과들은 SEB-1 피지선세포에서 AMPK-SREBP-1 경로를 통하여 지방 생성이 억제됨을 보여주는 것이다.
To observe the intracellular lipid concentration of SEB-1 sebaceous cells treated with EGCG, 20μM of Compound C was pretreated for 30 minutes and SEB-1 cells treated with EGCG for 24 hours were observed with Nile Red O staining. As a result, intracellular lipid levels of SEB-1 sebaceous cells treated with EGCG were decreased as shown in FIGS. 2 b and c, but when SEB-1 was pretreated with compound C, EGCG did not decrease the intracellular lipid level Respectively. These results demonstrate that fat production is inhibited by the AMPK-SREBP-1 pathway in SEB-1 sebaceous cells.

실시예 3: EGCG 열-불활성화 Example 3: EGCG heat-inactivation P. acnesP. acnes 에 의하여 유도된 염증 감소&Lt; / RTI > induced inflammation <

열-불활성화된 P. acnes로 자극된 SEB-1 세포를 24시간 동안 EGCG로 처리하고 RNA를 분리한 후, 정량 역전사 PCR을 이용하여 사이토카인 농도를 측정하였다. 도 3a에서 나타난 바와 같이, 열-불활성화 P. acnes는 피지선세포에서 IL-1α, IL-1β, TNF (tumor necrosis factor)-α 및 IL-8를 포함하는 염증 분자마커의 발현을 유도하였으나, EGCG를 24시간 처리한 경우에는 IL-1α, IL-1β, TNF-α, 및 IL-8의 mRNA 수준을 유의하게 감소시켰다. 이는 EGCG의 항염 효과를 보여주는 것이다. SEB-1 cells stimulated with heat-inactivated P. acnes were treated with EGCG for 24 hours, RNA was isolated, and cytokine concentration was measured using quantitative reverse transcription PCR. As shown in FIG. 3A, heat-inactivated P. acnes induced the expression of inflammatory molecule markers including IL-1α, IL-1β, TNF (tumor necrosis factor) -α and IL-8 in sebaceous glands, When EGCG was treated for 24 hours, mRNA levels of IL-1α, IL-1β, TNF-α, and IL-8 were significantly decreased. This shows the anti-inflammatory effect of EGCG.

또한, 도 3b, 3c에서 나타난 바와 같이, 열-불활성화된 P. acnes로 자극된 SEB-1 세포에서 TNF-α, 및 IL-8의 발현이 증가하는 것을 ELISA로 확인하였으며, 젤라티나제(gelatinases), MMP(matrix metalloproteinase)-2 및 MMP-9의 수준이 증가하는 것을 웨스턴 블랏으로 확인하였다(도 3b 및 c). 그 결과 AP-1 및 NF-kB 경로의 분자 마커인 인산화 c-Jun 및 인산화 IkB가 유의하게 증가하였고, 도 3d에 나타난 바와 같이 NF-kB p65 의 핵내 전좌(translocation) 역시 증가됨을 확인하였다. 모낭 상피 과각화증(hyperkeratosis)에 관여하는 사이토카인인 IL-1α가 열-불활성화 P. acnes로 자극된 HaCaT 케라틴 세포로부터 유도되었음을 확인할 수 있었다(도 3e 및 f) 그러나, EGCG를 24시간 처리한 실험군에서는 IL-8, TNF-α, MMP-2, MMP-9, c-Jun 및 phospho-IkB를 유의하게 감소시켰으며, 표적 단백질 발현도 동일하게 감소하는 결과를 보여주었다. In addition, as shown in FIGS. 3b and 3c, the expression of TNF-α and IL-8 was increased in heat-inactivated P. acnes -stimulated SEB-1 cells by ELISA, gelatinases, MMP (matrix metalloproteinase) -2 and MMP-9 were increased by Western blotting (Fig. 3b and c). As a result, phosphorylated c-Jun and phosphorylated IkB, which are molecular markers of the AP-1 and NF-kB pathways, were significantly increased, and nuclear translocation of NF-kB p65 was also increased as shown in FIG. It was confirmed that IL-1α, a cytokine involved in hair follicle epithelial hyperkeratosis, was induced from heat-inactivated P. acnes -stimulated HaCaT keratinocytes (FIGS. 3e and 3f) , But the expression of IL-8, TNF-α, MMP-2, MMP-9, c-Jun and phospho-IkB was also decreased.

EGCG를 처리한 경우에는 NF-kB 신호전달의 상류인 NF-kB p65 의 핵내 전좌를 역시 저해하였으며(도 3d), HaCaT 케라틴 세포에서 IL-1α, NF-kB, phospho-IkB의 증가된 수준을 감소시켰다(도 3e 및 f). 이러한 결과는 여드름에 관련된 염증반응에서 EGCG의 피부를 구성하는 주세포에 대한 염증 억제 효과를 보여주는 것이다. EGCG also inhibited nuclear translocation of NF-kB p65 upstream of NF-kB signaling (FIG. 3D), and increased levels of IL-1α, NF-kB and phospho-IkB in HaCaT keratinocytes (Figs. 3e and f). These results demonstrate the anti-inflammatory effect of the main cells constituting the skin of EGCG in the acne-related inflammation reaction.

또한, 열-불활성화된 P. acnes로 자극된 SEB-1 피지선세포를 20μM의 화합물 C로 전처리한 경우에는 phospho-c-JUN, phospho-IkB, 및 젤라티나제(gelatinases)의 결과는 바뀌었으며, 이는 AMPK 경로가 EGCG의 항염 효과에 역할을 하고 있음을 나타내는 것이다.In addition, the results of phospho-c-JUN, phospho-IkB, and gelatinases were altered when pretreating SEB-1 sebaceous cells stimulated with heat-inactivated P. acnes with 20 μM Compound C , Indicating that the AMPK pathway plays a role in the anti-inflammatory effect of EGCG.

이러한 결과들은 EGCG가 P. acnes에 의해 유발되는 SEB-1 피지선세포 및 HaCaT 케라틴 세포의 염증과 관련된 분자경로인 AP-1 및 NF-kB 신호경로를 조절함으로써, 염증 반응을 감소시킨다는 것을 보여주는 결과이다.
These results show that EGCG reduces the inflammatory response by modulating the AP-1 and NF-kB signaling pathways, which are the molecular pathways involved in the inflammation of SEB-1 sebaceous cells and HaCaT keratin cells induced by P. acnes .

실시예 4: EGCG의 세포사멸을 통한 SEB-1 피지선세포의 세포독성 유도Example 4: Cytotoxicity of SEB-1 sebaceous cells induced by EGCG apoptosis

SEB-1 피지선세포 생존에 EGCG의 효과를 확인하기 위하여 배양된 세포에 24 및 48시간 동안 EGCG를 처리한 후 MTT (3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) 분석을 수행하였다. SEB-1은 96웰 플레이트의 각 웰에 1ⅹ10⁴ 개 정도의 밀도로 초기에 추가하였다. 24 시간 배양 후 EGCG를 처리하고 한 웰은 처리하지 않고 대조군으로 두었다. 농도별로 EGCG를 처리하고 72 시간 후에 각각의 웰 상층액을 MTT로 처리한 다음 37℃에서 24 및 48시간 동안 배양하였다. 살아있는 세포는 미토콘드리아의 석시네이트 디하이드로게나제(succinate dehydrogenase)에 의해 MTT를 분해하여 MTT 포마존(formazon)을 형성하였다. 전환된 염료(Converted dye)를 DMSO에 녹인 다음 540 nm에서 마이크로플레이트 판독기를 이용하여 대조군과 비교하였다.In order to confirm the effect of EGCG on SEB-1 sebaceous cell survival, the cultured cells were treated with EGCG for 24 and 48 hours and then MTT (3- (4,5-dimethylthiazol-2-yl) -2,5- diphenyltetrazolium bromide ) Analysis. SEB-1 was initially added to each well of a 96-well plate at a density of about 1 x 10 ⁴ . After incubation for 24 hours, EGCG was treated and one well was left untreated as a control. EGCG was treated at different concentrations and 72 hours later, each well supernatant was treated with MTT and then cultured at 37 ° C for 24 hours and 48 hours. Live cells were degraded by succinate dehydrogenase of mitochondria to form MTT formazan. The converted dye (Converted dye) was dissolved in DMSO and compared with the control group using a microplate reader at 540 nm.

그 결과 도 4a에서 나타낸 바와 같이 EGCG로 처리된 경우 세포 성장의 유의한 감소가 확인되었다. 유사한 감소가 HaCaT 세포에서 확인되었으나, 감소 정도는 다소 적었다. 이는 EGCG에 의한 성장 저해가 SEB-1 피지선세포에서 보다 민감함을 보여준다. 48시간 배양 후 DAPI (4',6-diamidino-2-phenylindole) 염색을 실시하고 핵을 메틸 그린으로 염색한 결과, SEB-1 피지선세포의 핵이 응축되어 있었으나 EGCG 처리 후에는 세포사멸이 일어난 핵과 같이 해체됨을 보여주었다(도 4b). As a result, a significant decrease in cell growth was observed when treated with EGCG as shown in Figure 4a. A similar decrease was observed in HaCaT cells, but the degree of reduction was somewhat less. This suggests that the growth inhibition by EGCG is more sensitive in SEB-1 sebaceous cells. After 48 h of incubation, DAPI (4 ', 6-diamidino-2-phenylindole) was stained and the nuclei were stained with methyl green. As a result, nuclei of SEB-1 sebaceous glands were condensed, but after EGCG treatment, (Fig. 4B).

EGCG가 세포사멸를 유도하는지를 확인하기 위하여 SEB-1를 EGCG로 처리하고, TUNEL 염색을 수행하였다. EGCG 처리 48시간 후 TUNEL양성 핵이 증가하였으며, 이러한 결과는 세포사멸 증가를 보여주는 결과이다(도 4c 및 d). EGCG 유도되는 세포사멸에 관여하는 분자 메커니즘을 확인하기 위하여 세포사멸 경로에 관련된 단백질 발현 수준을 조사하였다. EGCG로 처리된 SEB-1 피지선세포에서 내재적 세포사멸 경로의 중요 마커인 Bax 및 Bcl-2 사이의 비율이 통계적으로 유의하게 증가함을 확인하였다. 또한 EGCG는 활성 caspase-3를 증가시켰다. G1-/S-phase 진행의 중요 조절자인 cyclin D1 역시 유의하게 감소하였으며, 이는 EGCG가 세포주기 진행을 중단시킨다는 것을 보여준다(도 4e). To determine whether EGCG induces apoptosis, SEB-1 was treated with EGCG and TUNEL staining was performed. TUNEL-positive nuclei were increased 48 hours after EGCG treatment, and these results are indicative of increased cell death (FIGS. 4C and D). In order to confirm the molecular mechanism involved in EGCG induced apoptosis, the level of protein expression related to the apoptotic pathway was examined. It was confirmed that the ratio between Bax and Bcl-2, which are important markers of the intrinsic apoptosis pathway, in SEB-1 sebaceous cells treated with EGCG was statistically significantly increased. EGCG also increased active caspase-3. Cyclin D1, an important regulator of G1- / S-phase progression, was also significantly reduced, indicating that EGCG abrogated cell cycle progression (Fig. 4e).

이러한 결과들은 EGCG가 세포사멸을 증가시킴으로써 SEB-1 피지선세포의 생존을 저해하고 세포주기의 진행을 멈추게 하며, 여드름 부위에서 피지선세포의 과증식을 저해한다는 것을 보여준다.
These results show that EGCG inhibits the survival of SEB-1 sebaceous cells by increasing cell death, stops cell cycle progression, and inhibits the hyperplasia of sebaceous cells at the acne site.

실시예 5: EGCG의 Example 5: Preparation of EGCG P. acnesP. acnes 성장 저해 Growth inhibition

EGCG가 P. acnes에 대하여 항박테리아 효과를 조사하기 위해 다음의 실험을 수행하였다. 다른 농도의 EGCG에서 배양한 P. acnes의 콜로니 형성 단위를 측정하였다. 그 결과 도 4의 g에서 나타낸 바와 같이 EGCG가 P. acnes의 성장을 저해하는 것으로 나타났으며, 이는 EGCG가 여드름 발달에서 P. acnes의 비정상적인 콜로니화를 표적으로 함을 보여준다.
The following experiment was conducted to investigate the antibacterial effect of EGCG against P. acnes . Colony forming units of P. acnes cultured in different concentrations of EGCG were measured. As a result, EGCG was shown to inhibit the growth of P. acnes as shown in Fig. 4 (g), indicating that EGCG targets abnormal colony formation of P. acnes in acne development.

실시예 6: EGCG의 여드름 개선 효과 및 지속성Example 6: Efficacy and persistence of EGCG on acne improvement

얼굴의 여드름의 치료에서 EGCG의 효능 및 지속성을 알아보기 위하여 환자를 대상으로 임상시험을 실시하였다. 임상 시험은 Helsinki Declaration (2000)에 따라 실시하였으며, 서울대학교 병원(Institutional Review Board of Seoul National University Hospital)으로부터 승인되었다. To evaluate the efficacy and persistence of EGCG in the treatment of facial acne, clinical trials were conducted in patients. Clinical trials were conducted according to the Helsinki Declaration (2000) and approved by the Institutional Review Board of Seoul National University Hospital.

8주 동안 임의로 선택된 35명 (남:17명 여:18명 평균나이:22.1세)의 환자가 이중맹검 임상시험을 수행하였다. 이중 17명은 1 % EGCG(w/v)를 처리하였으며, 18명은 5% EGCG(w/v)를 처리하여 용량과 반응의 관련성을 측정하였다. 환자의 얼굴의 절반에는 1 또는 5 % EGCG(w/v) 용액을 하루에 2번 도포하였고, 다른 반쪽은 대조군으로 3% 에탄올만을 도포하였다. 기본 방문 스케줄은 1, 2, 4, 6, 및 8주로 하였다. 구진(papule), 농포(pustule), 결절(nodule), 낭종(cyst)과 같은 염증성 여드름 병변 및 면포(comedone)와 같은 비염증성 여드름 병변이 반영된 수정된 리즈점수가 여드름의 상태 측정에 사용되었다. 기본 값에서의 수정된 리즈 점수 구간 평균은 5.1±0.4(평균±표준편차, 범위 2-7)이었으며, 이는 O'Brien et al., (Leeds revised acne grading system. J Dermatol Treat 9:215-20, 1998)에 따른 것이다. A double-blind trial of 35 patients randomly selected for 8 weeks (male: 17 female: 18 mean age: 22.1 years) was performed. Of these, 17 were treated with 1% EGCG (w / v) and 18 were treated with 5% EGCG (w / v) to determine the dose and response. One half of the patient's face was coated with 1 or 5% EGCG (w / v) solution twice a day, and the other half was applied with 3% ethanol as a control. The basic visit schedules were 1, 2, 4, 6, and 8 weeks. Modified Leeds scores reflecting inflammatory acne lesions such as papules, pustules, nodules, cysts, and noninflammatory acne lesions such as comedones were used to measure acne status. The mean modified Leeds score interval at baseline was 5.1 ± 0.4 (mean ± SD, range 2-7), which was calculated by O'Brien et al., (Leeds revised acne grading system, J Dermatol Treat 9: 215-20 , 1998).

도 5의 b에서 나타난바와 같이 1 또는 5 % EGCG(w/v) 용액을 처리한 경우 8주 후 수정된 리즈 스코어는 각각 1.2±0.4 및 1.7±0.6로 현저히 감소하였다. 특히 염증성 및 비염증성 부위의 수는 1% EGCG(w/v) 용액을 도포한 경우에 각각 53.8±19.8 및 10.0±3.1에서 15.6±6.2 및 1.1±0.5로 현저히 감소하였다. 이는 기본값과 비교하여 각각 79 및 89 % 감소한 수치이다(도 5c 및 d). 5 % EGCG(w/v)를 처리한 경우에도 유사한 결과가 나타났다. 환자의 주관적 평가는 0에서 10의 VAS (visual analogue scale) 등급을 사용하여 분석하였고, 모든 환자의 기본 값은 10에 맞추었다. 1 및 5% EGCG(w/v) 처리 2주 후 VAS 점수가 현저하게 감소하였고, 8주 방문에서는 각각 3.5 및 4.9로 감소되었다(도 4e). When treated with 1 or 5% EGCG (w / v) solution as shown in Figure 5b, the modified Leeds score after 8 weeks decreased significantly to 1.2 ± 0.4 and 1.7 ± 0.6, respectively. In particular, the number of inflammatory and noninflammatory sites was significantly reduced from 53.8 ± 19.8 and 10.0 ± 3.1 to 15.6 ± 6.2 and 1.1 ± 0.5 when 1% EGCG (w / v) solution was applied, respectively. This is a 79 and 89% reduction compared to the default (Figures 5c and d). Similar results were obtained with 5% EGCG (w / v) treatment. The patient's subjective assessment was analyzed using a VAS (visual analogue scale) rating of 0 to 10, with a default value of 10 for all patients. The VAS score was significantly decreased after 2 weeks of treatment with 1 and 5% EGCG (w / v), and decreased to 3.5 and 4.9 at 8 week visits (Fig. 4e).

또한, 여드름과 관련된 몇 개의 단백질 발현을 인비보에서 확인하였다. 피부 시료는 여드름 부위로부터 얻었으며, 면역조직화학염색(immunohistochemistry) 결과 IL-8, SREBP-1, phospho-c-Jun, 및 NF-kB이 현저히 감소하였는데 이는 인비트로 결과와 일치하는 것이다. TUNEL-양성 핵은 EGCG 도포 후 증가하였으며, 이는 EGCG 처리가 세포사멸를 유도하여 여드름 부위에서 피지선세포의 과다증식을 억제하는 것을 보여주는 것이다. 이러한 면역조직화학염색 결과는 인비보 여드름 부위에서 EGCG 처리가 염증 반응을 감소시키고 세포사멸을 증가시킨다는 것을 설명한다.In addition, several protein expression related to acne was confirmed in Invivo. Skin samples were obtained from acne sites and immunohistochemistry showed a significant decrease in IL-8, SREBP-1, phospho-c-Jun, and NF-kB, consistent with the in vitro results. TUNEL-positive nuclei were increased after EGCG application, indicating that EGCG treatment induced cell death and inhibited the overgrowth of sebaceous gland cells at the acne site. This immunohistochemical staining demonstrates that EGCG treatment reduces inflammation and increases apoptosis in the in vivo acne site.

EGCG 처리는 일반적으로 잘 지속되었으며, 심각한 부작용도 관찰되지 않았다. 5 % EGCG(w/v)로 처리한 4명의 환자에게 홍반이나 가벼운 자극이 관찰되었으나 몇 시간 후 진정되었다. 1 % EGCG(w/v)로 처리한 환자는 어떠한 부작용도 관찰되지 않았다.
EGCG treatment was generally well tolerated and no serious side effects were observed. Four patients treated with 5% EGCG (w / v) experienced erythema or mild irritation but remained calm after a few hours. No side effects were observed in patients treated with 1% EGCG (w / v).

실시예 7: 플라보노이드의 지방 생성 억제 효과Example 7 Effect of Flavonoid on Fat Production

플라보노이드 계열인 카엠페롤(Kaempferol), 에피갈로카테킨(EGC, Epigallocatechin), 포모노네틴(Formononetin), 쿠에르세틴(Quercetin), 카테킨(Catechin), 엘라직산(Ellagic acid)의 피지선세포 SEB-1의 세포질(cytoplasm) 내에 축적되는 지질방울(lipid droplets)의 증감을 측정하기 위해 오일레드 O (oil red O) 염색을 수행하였다. 각 물질을 0, 0.5, 1, 5, 및 10 μM 의 농도별로 각각 배양된 세포에 72 시간 동안 처리한 후 지질 염색을 수행하여 결과를 얻었다. 현미경으로 세포질 내에 축적된 지질방울의 증감을 세포당 오일레드 O로 염색된 총 면적으로 나타내어 물질의 효과를 평가하였다. 그 결과 도 7에서 나타나는 것처럼 카엠페롤, 포모노네틴, 카테킨, 쿠에르세틴, 엘라직산을 처리한 결과 농도가 증가함에 따라 지질방울이 줄었고 SEB-1 세포 생존률이 감소하였음을 확인하였다. 에피갈로카테킨을 처리한 경우에는 농도가 증가함에 따라 지질방울이 줄었고 SEB-1 세포 생존률에는 변화가 없었다.
The sebaceous cell SEB-1 of the flavonoid family Kaempferol, Epigallocatechin, Formononetin, Quercetin, Catechin, Ellagic acid, Oil red O staining was performed to measure the increase and decrease of lipid droplets accumulated in the cytoplasm of the cells. Each material was treated with the cells cultured for 0, 0.5, 1, 5, and 10 μM for 72 hours, and lipid staining was performed. The effect of the substance was evaluated by showing the increase and decrease of the lipid droplets accumulated in the cytoplasm by the microscope as the total area stained with Oil Red O per cell. As a result, as shown in FIG. 7, treatment with kaempferol, pomanonethine, catechin, quercetin and elacic acid showed that lipid droplets decreased and SEB-1 cell survival rate decreased as the concentration increased. In the treatment of epigallocatechin, lipid droplets decreased with increasing concentration and there was no change in SEB-1 cell survival.

실시예 8: EGCG 및 글리콜산 혼합 조성물에 의한 상승효과Example 8: Synergistic effect of EGCG and glycolic acid mixed composition

자원자 얼굴의 반쪽을 한 종류 용액의 처리군으로 삼았다. 총 처리 용액은 다섯 종류이다: (1) EGCG 5 % 용액, (2) EGCG 5 % +글리콜산 (Sigma USA) 5%, (3) 글리콜산 5%, (4) EGCG 5% + 살리실산 (Sigma) 2% + (폴리에틸렌클라이콜) 용액, (5) 살리실산 2% + (폴리에틸렌글라이콜). 각 군의 기본 용매는 이전 임상 시험과 같이 증류수와 3 % 에탄올로 하였으며, 폴리에틸렌콜라이콜은 지용성인 살리실산을 용해시키기 위해 소량 사용한 물질로서 이전 연구들에서 여드름 병변에는 특별한 영향을 끼치지 않으면서 살리실산을 균일하게 용해하는 기능을 가진다고 알려져 있다. 각 용액은 두 박피제 성분 모두가 약산 물질이므로 산성을 띄었으며, PH meter 를 이용하여 PH 5로 보정하였고 무균 처리를 추가적으로 시행하였다. 모든 용액이 균일하게 혼합되었다. Half of the volunteers' faces were treated with one kind of solution. Total treatment solutions are of five types: (1) EGCG 5% solution, (2) EGCG 5% + glycolic acid 5%, (3) glycolic acid 5%, (4) EGCG 5% + salicylic acid ) 2% + (polyethylene glycol) solution, (5) salicylic acid 2% + (polyethylene glycol). The primary solvent for each group was distilled water and 3% ethanol as in previous clinical trials. Polyethylene colicol was used in small quantities to dissolve liposoluble salicylic acid. Previous studies have shown that salicylic acid And has a function of dissolving uniformly. Each of the solutions was acidic because the two peeling agents were weakly acidic, and PH 5 was corrected using a PH meter and an aseptic treatment was additionally performed. All solutions were homogeneously mixed.

총 8 명의 환자군을 대상으로 하였으며 개인 당 얼굴의 두 면씩 총 16 처리 대상군 각각에 대해서, EGCG 5% 용액은 네 명의 환자 얼굴 반쪽, 다른 네 개의 처리군은 각각 세 명의 환자 얼굴 반쪽에다 무작위 배정하였다. 모든 환자에게 하루에 두 번 여드름 병변에 배정된 용액을 도포하도록 하였다. 도포 후 2 주 후에 내원하도록 하였고 염증성 여드름의 개수, 비염증성 여드름의 개수, 주관적인 만족도를 기록하였다. 주관적인 불편감이 있을 경우 한번으로 감량하거나 도포를 중단하라고 사전에 교육하였으나 연구 기간 동안 회수를 줄인 환자는 없었다.EGCG 5% solution was randomly assigned to four patients 'face halves, and the other four treatment groups to three patients' face halves, for each of the 16 treatment groups, . All patients were dosed twice daily with the solution assigned to the acne lesion. The number of inflammatory acne, the number of non-inflammatory acne, and subjective satisfaction were recorded. In the event of subjective discomfort, the patient was instructed to lose one dose or discontinue application, but no patient experienced a reduction in recovery during the study period.

초기 내원 시 측정한 염증성-비염증성 여드름의 개수에 비해 감소한 정도 (혹은 증가한 정도)를 백분율로 환산하여 비교하였다. EGCG 와 글리콜산 혼합 처리군이 EGCG 혹은 글리콜산 개별 처리군에 비해 얼마나 감소했는지, 그리고, EGCG 와 살리실산 혼합 처리군이 EGCG 혹은 살리실산 개별 처리군에 비해 얼마나 감소했는지가 주로 알아보고자 하는 사항이다. 치료 효과뿐만 아니라 각 처리군에서 환자들의 주관적 만족도 역시 추가로 비교 분석하였다.(Or increased) compared to the number of inflammatory - noninflammatory acne measured at the initial visit. It is important to understand how much the EGCG and glycolic acid mixture treatment groups are reduced compared with the EGCG or glycolic acid treatment group and how much the EGCG and salicylic acid mixture treatment groups are reduced compared to the EGCG or the salicylic acid individual treatment group. In addition to the therapeutic effect, subjective satisfaction of patients in each treatment group was also compared and analyzed.

결과는 도 9에 기재되어 있으며, 비염증성 및 비염증성 여드름에 모두 효과가 있었으며, EGCG와 글리콜산의 혼합에 의한 상승효과가 나타났다. The results are shown in FIG. 9, and both of non-inflammatory and non-inflammatory acne were effective and synergistic effects were obtained by mixing EGCG and glycolic acid.

구체적으로 비염증성 여드름의 경우, EGCG 를 바른 얼굴 면에서 비염증성 여드름이 평균 23.4 % 가 감소하였고, 글리콜산 용액을 바른 얼굴 면에서는 평균 15.2 % 가 감소하였다. EGCG 와 글리콜산 혼합 용액을 바른 얼굴 면에서는 평균 56.5 % 가 감소하였다. 통계적으로 혼합 용액의 감소 폭 평균이 개별 용액 감소 폭의 합에 대한 평균 보다 유의하게 더 높은 상승 효과를 보이는 것을 확인하였다 (P < 0.05).In non - inflammatory acne, on average, non - inflammatory acne decreased by 23.4% on the face with EGCG and average 15.2% on the face with glycolic acid solution. EGCG and glycolic acid mixed solution decreased 56.5% on the face. Statistically, it was found that the decreasing width average of the mixed solution showed a significantly higher synergistic effect than the average of the sum of the individual solution decreasing widths ( P <0.05).

염증성 여드름의 경우에도, EGCG 를 바른 얼굴 면에서 염증성 여드름이 평균 33.2 % 가 감소하였고, 글리콜산 용액을 바른 얼굴 면에서는 평균 20.7 % 가 감소하였다. EGCG 와 글리콜산 혼합 용액을 바른 얼굴 면에서는 평균 61.4 % 가 감소하였다. 통계적으로 혼합 용액의 감소 폭 평균이 개별 용액 감소 폭의 합에 대한 평균 보다 유의하게 더 높은 상승 효과를 보이는 것을 확인하였다 (P < 0.05).In the case of inflammatory acne, inflammatory acne decreased by an average of 33.2% on the face with EGCG, and on the face with glycolic acid solution, the average face decreased by 20.7%. EGCG and glycolic acid mixed solution decreased 61.4% on the face. Statistically, it was found that the decreasing width average of the mixed solution showed a significantly higher synergistic effect than the average of the sum of the individual solution decreasing widths ( P <0.05).

주관적 만족도를 조사한 결과, 2 주 경과 후 혼합 용액을 도포한 얼굴 면에 대한 환자의 주관적 만족도는 8.3 점 (10점 만점)으로 EGCG 단독 도포 면의 5.2점, 글리콜산 단독 도포 면의 4.3 점보다 유의하게 높음을 확인하였다 (P < 0.05).
The subjective satisfaction rate of EGCG alone was 5.2 and that of glycolic acid alone was 4.3 points, which was 8.3 points (out of 10 points) for the face applied with mixed solution after 2 weeks. ( P <0.05), respectively.

실시예 9: EGCG 및 살리실산 혼합 조성물에 의한 상승효과Example 9: Synergistic effect of EGCG and salicylic acid mixed composition

실험 방법은 실시예 8의 기재된 바와 같다. 결과는 도 10에 기재되어 있으며, 비염증성 및 비염증성 여드름에 모두 효과가 있었으며, EGCG와 살리실산의 혼합에 의한 상승효과가 나타났다. The experimental method is as described in Example 8. The results are shown in FIG. 10, and both non-inflammatory and non-inflammatory acne were effective and synergistic effects were obtained by mixing EGCG with salicylic acid.

구체적으로 비염증성 여드름의 경우 EGCG 를 바른 얼굴 면에서 비염증성 여드름이 평균 23.4 % 가 감소하였고, 살리실산 용액을 바른 얼굴 면에서는 평균 25.2 % 가 감소하였다. EGCG 와 살리실산 혼합 용액을 바른 얼굴 면에서는 평균 59.8 % 가 감소하였다. 통계적으로 혼합 용액의 감소 폭 평균이 개별 용액 감소 폭의 합에 대한 평균 보다 유의하게 더 높은 상승 효과를 보이는 것을 확인하였다 (P < 0.05).Specifically, in non - inflammatory acne, non - inflammatory acne decreased by 23.4% on the face with EGCG and average 25.2% on the face with salicylic acid solution. The mean EGCG and salicylic acid solution decreased 59.8% on the face. Statistically, it was found that the decreasing width average of the mixed solution showed a significantly higher synergistic effect than the average of the sum of the individual solution decreasing widths ( P <0.05).

염증성 여드름의 경우에도, EGCG 를 바른 얼굴 면에서 비염증성 여드름이 평균 33.2 % 가 감소하였고, 살리실산 용액을 바른 얼굴 면에서는 평균 26.6 % 가 감소하였다. EGCG 와 글리콜산 혼합 용액을 바른 얼굴 면에서는 평균 68.6 % 가 감소하였다. 통계적으로 혼합 용액의 감소 폭 평균이 개별 용액 감소 폭의 합에 대한 평균 보다 유의하게 더 높은 상승 효과를 보이는 것을 확인하였다 (P < 0.05).In the case of inflammatory acne, on average, non-inflammatory acne decreased by 33.2% on the face with EGCG and average 26.6% on the face with salicylic acid solution. EGCG and glycolic acid mixed solution decreased in average 68.6% on the face. Statistically, it was found that the decreasing width average of the mixed solution showed a significantly higher synergistic effect than the average of the sum of the individual solution decreasing widths ( P <0.05).

주관적 만족도를 조사한 결과, 2 주 경과 후 혼합 용액을 도포한 얼굴 면에 대한 환자의 주관적 만족도는 9.1 점 (10점 만점)으로 EGCG 단독 도포 면의 5.2점, 살리실산 단독 도포 면의 4.9 점보다 유의하게 높음을 확인하였다 (P < 0.05).
As a result of the subjective satisfaction test, the subjective satisfaction rate of the facial surface applied with the mixed solution after 2 weeks was 9.1 (out of 10 points), which was significantly higher than that of EGCG alone and 4.9 of salicylic acid alone ( P < 0.05).

통계처리Statistical processing

실험결과는 최소 5회 반복 실험하여 평균값을 나타내었다. 통계분석은 Student's t-test (SYSTAT program, SigmaPlot version 9, Systat Software)를 사용하였다. Student's t-test의 P 값이 <0.05 경우에 차이가 유의성이 있는 것으로 간주된다.
Experimental results were repeated at least 5 times. Statistical analysis was performed using Student's t-test (SYSTAT program, SigmaPlot version 9, Systat Software). The difference is considered significant if the Student's t-test P- value is <0.05.

본 발명의 실시예에서 사용된 세포배양, 정량 역전사 PCR, 웨스턴 블랏 및 박층 크로마토그래피는 다음과 같은 방법으로 수행되었다.
Cell culture, quantitative reverse transcription PCR, Western blot and thin layer chromatography used in the examples of the present invention were carried out as follows.

세포배양Cell culture

Thibutot et al. (J Am Acad Dermatol 57: 791-9, 2007)에 기재된 바와 같이 SEB-1 불멸세포(immortalized cell)는 SV40 라지 T 항원으로 2차 피지선세포에 형질감염(transfection)시켜 만들었다. SEB-1 세포는 5 % CO₂, 37 ℃ 인큐베이터에서 5.5 mM glucose/Ham's F-12 3:1 (Invitrogen), fetal bovine serum 2.5 % (HyClone, Logan, UT), adenine 1.8 X 10^-4M (Sigma, USA), hydrocortisone 0.4 μgml^-1(Sigma), 인슐린 10 ngml^-1(Sigma), epidermal growth factor 3 ngml^-1 (Austral Biologicals, USA), 및 콜레라 톡신 1.2 X 10^-10M를 포함하는 DMEM (Invitrogen)에서 배양하였다.Thibutot et al. SEB-1 immortalized cells were prepared by transfection of secondary sebaceous cells with SV40 large T antigen as described in J Am Acad Dermatol 57: 791-9, 2007. SEB-1 cells were treated with 5% CO ₂ , 5.5 mM glucose / Ham's F-12 3: 1 (Invitrogen), fetal bovine serum 2.5% (HyClone, Logan, UT), adenine 1.8 X 10 ^-4 M DMEM containing Sigma, USA), 0.4 μgml ^-1 hydrocortisone (Sigma), insulin, ^{10 ngml -1 (Sigma), epidermal} growth factor 3 ngml -1 (Austral Biologicals, USA), and 1.2 X 10 ^-10 M cholera toxin (Invitrogen).

인간 케라틴 세포 HaCaT는 5 % CO₂, 37 ℃ 인큐베이터에서 5% fetal bovine serum, 20mM L-glutamine, 1mM sodium pyruvate 및 antibiotic/antimycotic solution (10 Uml^-1 penicillin, 10 μgml^-1 streptomycin, 및 0.25 μgml^-1 amphoterin)을 포함하는 DMEM (Invitrogen)에서 배양하였다.
HaCaT cells are human keratin 5% CO _2, at 37 ℃ incubator 5% fetal bovine serum, 20mM L -glutamine, 1mM sodium pyruvate , and ^{antibiotic / antimycotic solution (10 Uml -1} penicillin, 10 μgml -1 streptomycin, and 0.25 μgml ^{- 1} amphoterin) in DMEM (Invitrogen).

정량 역전사 PCRQuantitative Reverse Transcription PCR

EGCG를 SEB-1 세포에 각 해당 도면에 기재된 농도별로 처리하고 24 시간 후 총 RNA를 Trizol (Biorad, USA)를 이용하여 추출하였다. 이어 RevertAid^TMFirst-Strand cDNA Synthesis kit (Fermentas)을 사용하여 cDNA를 합성하였고, 1μg의 cDNA를 주형으로 하여 SYBR Green/ROX q-PCR kit (Fermentas)를 사용하여 실시간 PCR을 수행하였다. SREBP-1a, ADD/SREBP-1c, SREBP-2, FAS, ACC 그리고 GAPDH의 각 프라이머 서열을 다음과 같고, 방향은 5'->3' 이다: SREBP-1a (Forward): GCTGCTGACCGACATCGAA, (Reverse) : TCAAATAGGCCAGGGAAGTCA; ADD/SREBP-1c (F) : GGAGCCATGGATTGCACTTTC, (R) : ATCTTCAATGGAGTGGGTGCAG; SREBP-2(F) : AACGGTCATTCACCCAGGTC, (R) : GGCTGAAGAATAGGAGTTGCC; FAS (F) : CCGAGGAACTCCCCTCAT, (R) : GCCAGCGTCTTCCACACT; ACC (F) : CCACTTGGCTGAGCGATT, (R) : CCAGGTCCTCCAGCAGAA; 및 GAPDH (F) : CAAGGTCATCCATGACAACTTTG, (R) : GTCCACCACCCTGTTGCTGTAG. SYBR Green을 이용한 정량 PCR의 조건은 변성 95℃, 15 초; 어닐링, 30 초; 신장, 72 초의 주기로 40주기를 수행하였다. EGCG was treated with SEB-1 cells at the concentrations indicated in the respective figures, and total RNA was extracted with Trizol (Biorad, USA) after 24 hours. CDNA was synthesized using RevertAid ^™ First-Strand cDNA synthesis kit (Fermentas) and real-time PCR was performed using SYBR Green / ROX q-PCR kit (Fermentas) with 1 μg of cDNA as a template. SREBP-1a (Forward): GCTGCTGACCGACATCGAA, (Reverse) Each primer sequence of SREBP-1a, ADD / SREBP-1c, SREBP-2, FAS, ACC and GAPDH is as follows, : TCAAATAGGCCAGGGAAGTCA; ADD / SREBP-1c (F): GGAGCCATGGATTGCACTTTC, (R): ATCTTCAATGGAGTGGGTGCAG; SREBP-2 (F): AACGGTCATTCACCCAGGTC, (R): GGCTGAAGAATAGGAGTTGCC; FAS (F): CCGAGGAACTCCCCTCAT, (R): GCCAGCGTCTTCCACACT; ACC (F): CCACTTGGCTGAGCGATT, (R): CCAGGTCCTCCAGCAGAA; And GAPDH (F): CAAGGTCATCCATGACAACTTTG, (R): GTCCACCACCCTGTTGCTGTAG. The conditions for quantitative PCR using SYBR Green were denaturation at 95 ° C for 15 seconds; Annealing, 30 seconds; Kidney, and 72 cycles.

IL-1α (assay ID number Hs 00174092), IL-1β (assay ID number Hs 01555410), TNF-α (assay ID number Hs 00174128), IL-8 (assay ID number Hs 99999034) 그리고 GAPDH (assay ID number Hs 00266705)는 TaqMan probe (TaqMan　Applied Biosystems, USA)를 이용하였다. TaqMan probe를 사용한 경우의 PCR 조건은 변성 95℃, 15 초; 어닐링/신장 60℃, 1 분간의 주기로 40주기를 수행하였다.
IL-8 (assay ID number Hs 99999034) and GAPDH (assay ID number Hs 01995410), IL-1? (Assay ID number Hs 00174092) (TaqMan Applied Biosystems, USA) was used. The PCR conditions for the TaqMan probe were denaturation at 95 ° C for 15 seconds; 40 cycles were performed at a cycle of annealing / elongation at 60 DEG C for 1 minute.

웨스턴 블랏 분석Western blot analysis

단백질은 세포 용해(lysis) 버퍼(Cell Signaling Technology, Beverly, MA)를 이용하여 추출하였다. 융해물(lysate)에 포함된 단백질의 양은 BCA 단백질 정량(Pierce, Rockford, IL)을 이용하여 결정하였다. 동일한 양의 단백질은 10% SDS-PAGE에 로딩하여 PVDF(Polyvinylidene difluoride) 막에 트랜스퍼하여 하기와 같이 각 단백질의 1차 항체를 붙이고, anti-rabbit IgG 및 anti-mouse IgG를 2차 항체로 하여 1차 항체를 탐지하였다. 블랏은 WESTSAVE Up (LabFrontier, Seoul, South Korea)을 이용하여 현상하였으며, 필름에 노출시켰다. 필름의 블랏을 분석하여 밀도 프로그램(densitometric program, TINA; Raytest Isotopenmebgerate, Straubenhardt, Germany)으로 정량화하였다. Proteins were extracted using cell lysis buffer (Cell Signaling Technology, Beverly, Mass.). The amount of protein contained in the lysate was determined using BCA protein quantification (Pierce, Rockford, Ill.). The same amount of protein was loaded on a 10% SDS-PAGE and transferred to PVDF (polyvinylidene difluoride) membrane. Primary antibodies of each protein were attached as follows, and anti-rabbit IgG and anti-mouse IgG were used as secondary antibodies The secondary antibody was detected. The blot was developed using WESTSAVE Up (LabFrontier, Seoul, South Korea) and exposed to film. The blots of the film were analyzed and quantified with a density program (TINA; Raytest Isotopenmebgerate, Straubenhardt, Germany).

사용된 1차 항체는 다음과 같다: cleaved caspase-3 (Asp175) (5A1) rabbit antibody, cyclin D1 (DCS6) mouse antibody, Bax rabbit antibody, BCL-2 mouse antibody, Akt rabbit antibody, Phospho-Akt (Thr308) rabbit antibody, Phospho-PI3K p85(Tyr 458)/p55 (Tyr199) rabbit antibody, Phospho-IRS-1 (Ser307) rabbit antibody, Phospho-ACC (Ser79) rabbit antibody, Phospho-AMPKa (Thr172) rabbit antibody, AMPKa rabbit antibody, Phospho-c-Jun (Ser63) rabbit antibody, Phospho-IkB (Ser32/36) mouse antibody (Cell Signaling Technology), b-actin mouse antibody, Lamin A, NF-kB p65 mouse antibody, SREBP-1 rabbit antibody (Santa Cruz Biotechnology, Santa Cruz, CA), Phospho-IGF 1 receptor rabbit antibody (Abcam, Cambridge, UK), MMP-2 mouse antibody, MMP-9 mouse antibody, and IL-1α mouse antibody (R&D Systems, Minneapolis, MN)
The primary antibodies used were: cleaved caspase-3 (Asp175) (5Al) rabbit antibody, cyclin D1 (DCS6) mouse antibody, Bax rabbit antibody, BCL-2 mouse antibody, Akt rabbit antibody, Phospho-Akt ) rabbit antibody, Phospho-PI3K p85 (Tyr 458) / p55 (Tyr199) rabbit antibody, Phospho-IRS-1 (Ser307) rabbit antibody, Phospho-ACC (Ser79) rabbit antibody, Phospho-AMPKa (Ser32 / 36) mouse antibody, b-actin mouse antibody, Lamin A, NF-kB p65 mouse antibody, and SREBP-1 rabbit 1 mouse antibody (R & D Systems, Minneapolis, MN), MMP-2 mouse antibody, and MMP-9 mouse antibody (Santa Cruz Biotechnology, Santa Cruz, Calif.), Phospho-IGF 1 receptor rabbit antibody , MN)

박층 크로마토그래피Thin layer chromatography

SEB-1 세포는 35 mm 접시에서 80 % 컨플루언시가 되도록 배양하였고 컨트롤 또는 각각 다른 농도의 EGCG를 24시간 동안 처리하였다. 모든 실시예에서 세포는 데이터로 정규화하였다. 세포를 1μCi ¹⁴C-acetate를 포함하는 DMEM 용액에서 현탁시키고 37 ℃에서 2시간 동안 배양하였다. 에텔 에테르 및 비방사성 담체 지질로 2번 추출하였다. 시료는 소량의 에틸 아세테이트에 용해시켜 20cm 실리카겔 박층 크로마토그래피(Merck, Darmstadt, Germany) 플레이트에 찍고, 19.5cm까지의 앞부분은 핵산으로 이어서 벤젠으로, 그리고 마지막 11cm는 헥산:에틸에테르:빙초산(69.5:30:1.5)으로 전개시켰다. 지질 스팟은 방사선을 액체 신틸레이션 카운터로 정량화하였다. 각 실험은 최소 5번 반복하였다.
SEB-1 cells were cultured in 80% confluency in 35 mm dishes and treated with control or different concentrations of EGCG for 24 hours. In all of the examples, the cells were normalized with data. The cells were suspended in DMEM solution containing 1 μCi ¹⁴ C-acetate and cultured at 37 ° C. for 2 hours. Ethereal and non-radioactive carrier lipids. The sample was dissolved in a small amount of ethyl acetate and applied to a 20 cm silica gel thin layer chromatography (Merck, Darmstadt, Germany) plate, the front portion to 19.5 cm was washed with benzene followed by benzene and the last 11 cm with hexane: ethyl ether: 30: 1.5). The lipid spot quantified radiation as a liquid scintillation counter. Each experiment was repeated at least 5 times.

이상의 실험 결과에서 알 수 있는 바와 같이, 본원의 모낭각화 이상을 예방 또는 치료하기 위한 조성물은 박테리아에 대한 내성을 유발하지 않으면서도 효과적으로 이러한 목적을 필요로 하는 다양한 응용분야에 폭 넓게 사용될 수 있다.
As can be seen from the above experimental results, the composition for preventing or treating follicular keratinization disorder of the present invention can be widely used for various applications requiring such a purpose effectively without inducing resistance to bacteria.

상기와 같이 본원의 실시예에 대하여 상세하게 설명하였지만 본 발명의 권리범위는 이에 한정되는 것은 아니고, 다음의 청구범위에서 정의하고 있는 본원의 기본 개념을 이용한 당업자에 의한 다양한 변형 또는 개량된 것 또한 본원의 권리범위에 속하는 것이다.While the present invention has been described in connection with what is presently considered to be practical exemplary embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Of the right.

Claims

A pharmaceutical composition for preventing or treating follicular keratosis comprising catechin or a derivative thereof.

The method according to claim 1,
The catechin or its derivative may be selected from the group consisting of epigallocatechin gallate (EGCG), gallocatechin gallate (GCG), epigallocatechin (EGC), epicatechin 3-gallate (ECG), gallocatechin (GC), cathechin 3-gallate wherein the composition is at least one selected from the group consisting of catechin, kaempferol, formononetin, quercetin, or ellagic acid. .

The method according to claim 1,
Wherein the catechin or a derivative thereof is epigallocatechin gallate (EGCG).

The method according to claim 1,
Wherein the composition further comprises a skin exfoliation agent.

5. The method of claim 4,
Wherein the skin resurfacing agent is at least one of Alpha-Hydroxy Acid (BHA) or Beta-Hydroxy Acid (BHA).

The method according to claim 1 or 4,
Wherein the catechin or a derivative thereof is contained in an amount of 0.1 to 30% (w / v), and the peeling agent is contained in an amount of 1 to 70% (w / v).

4. The method according to any one of claims 1 to 3,
Wherein the catechin or a derivative thereof regulates AMPK-SREBP-1 cell signaling.

4. The method according to any one of claims 1 to 3,
Wherein said catechin or a derivative thereof inhibits IGF-1 / PI3K / Akt cell signaling.

4. The method according to any one of claims 1 to 3,
Wherein said catechin or a derivative thereof inhibits NF-kB and AP-I cell signaling.

4. The method according to any one of claims 1 to 3,
Wherein said catechin or a derivative thereof reduces IL-1 alpha in keratinocytes.

The method according to claim 1 or 4,
Wherein said follicular keratinization abnormality causes injection, pore keratosis, facial nerve follicular red sclerosis or inflammatory or non-inflammatory acne.

12. The method of claim 11,
Wherein said inflammation is caused by Propionibacterium acnes, Staphylococcus aureus, or Staphylococcus epidermidis, wherein said inflammation is caused by prophylactic or therapeutic A pharmaceutical composition.

A cosmetic composition for improving or alleviating follicular keratin comprising catechin or a derivative thereof.

14. The method of claim 13,
The catechin or its derivative may be selected from the group consisting of epigallocatechin gallate (EGCG), gallocatechin gallate (GCG), epigallocatechin (EGC), epicatechin 3-gallate (ECG), gallocatechin (GC), cathechin 3-gallate wherein the composition is at least one selected from the group consisting of catechin, kaempferol, formononetin, quercetin, or ellagic acid. .

15. The method of claim 14,
Wherein the composition further comprises a skin exfoliation agent.

16. The method of claim 15,
Wherein the skin cleanser is at least one of Alpha-Hydroxy Acid (BHA) or Beta-Hydroxy Acid (BHA).

The method according to claim 13 or 14,
Wherein the composition is provided as a cleanser, a soap, a shampoo, a lotion, a cream, or a pack for improving or alleviating the follicular keratinization.

16. The method according to claim 13 or 15,
Wherein the catechin or a derivative thereof is contained in an amount of 0.1 to 30% (w / v), and the peeling agent is contained in an amount of 1 to 10% (w / v).