KR20140083129A - Recombinant foot and mouth disease viruses using the vaccine strain, O manisa strain for protection of ME-SA topotype of O serotyp - Google Patents
Recombinant foot and mouth disease viruses using the vaccine strain, O manisa strain for protection of ME-SA topotype of O serotyp Download PDFInfo
- Publication number
- KR20140083129A KR20140083129A KR1020120152084A KR20120152084A KR20140083129A KR 20140083129 A KR20140083129 A KR 20140083129A KR 1020120152084 A KR1020120152084 A KR 1020120152084A KR 20120152084 A KR20120152084 A KR 20120152084A KR 20140083129 A KR20140083129 A KR 20140083129A
- Authority
- KR
- South Korea
- Prior art keywords
- region
- manisa
- foot
- mouth disease
- gene
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/125—Picornaviridae, e.g. calicivirus
- A61K39/135—Foot- and mouth-disease virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/32011—Picornaviridae
- C12N2770/32111—Aphthovirus, e.g. footandmouth disease virus
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S930/00—Peptide or protein sequence
- Y10S930/01—Peptide or protein sequence
- Y10S930/22—Viral peptide or viral protein
- Y10S930/222—Foot and mouth disease related
Abstract
Description
본 발명은 구제역 바이러스 O Manisa를 이용한 재조합 구제역 백신 바이러스에 관한 것으로서 보다 상세하게는 구제역 바이러스 O Manisa의 전체 유전자를 클로닝한 후 일부 유전자를 결실(deletion)시켜 얻은 구제역 바이러스 O Manisa를 이용한 재조합 구제역 백신 바이러스에 관한 것이다.
The present invention relates to a recombinant foot-and-mouth disease vaccine virus using O Manisa. More specifically, the present invention relates to a recombinant foot-and-mouth disease vaccine virus O Manisa obtained by cloning a whole gene of FM virus O Manisa and deletion of some genes .
구제역(Foot and mouth disease; FMD)은 발굽이 둘로 갈라진 동물에 감염되는 바이러스 수포성 질병으로 빠른 복제와 빠른 전파력이 특징이다. 이 질병은 그 경제적 중요성으로 인하여 세계동물보건기구(OIE)에 의하여 중요한 동물질병으로 분류되어 있으며, 축산물의 국가간 교역에 있어 가장 중요한 요소로 작용하고 있다. Foot and mouth disease (FMD) is a virus-borne disease that infects animals with split hoofs and is characterized by rapid replication and rapid spreading. Due to its economic importance, this disease is classified as an important animal disease by the World Animal Health Organization (OIE), and it is the most important factor in the trade of livestock products between countries.
구제역 병원체는 단일 가닥의 양극성 RNA 바이러스로 피코나비리데(Piconaviridae)과, 아프소바이러스(Aphthovirus)속에 속하며 7개의 다른 혈청형(A형, O형, C형, Asia1형, SAT1형, SAT2형, SAT3형)으로 분류되고 있다.The foot-and-mouth disease pathogen is a single-stranded bipolar RNA virus that belongs to the genus Piconaviridae and Aphthovirus and has seven different serotypes (A, O, C, Asia1, SAT1, SAT2 , SAT3 type).
구제역 바이러스(Foot and mouth disease virus)는 대부분 병원성이 있는 원인체이다. 그러나 여러번의 계대 등 여러 연구자들의 시도에서도 병원성이 유지되기 때문에 현재까지 구제역바이러스에 대한 병원성이 줄어든 약독화 백신으로 사용되는 것은 국제적으로는 금기시된 일이다. 구제역에 대해 약독화 바이러스를 사용하는 것은 병원성의 회복에 대한 문제점을 안고 있으며 또한 생독백신을 사용하면 야외 감염된 구제역 바이러스와 구분이 안되는 단점이 있어 구제역 발생시 효과적으로 접종하여 방역하는 체계를 구축하기 어렵다. Foot and mouth disease viruses are mostly pathogenic. However, it is internationally forbidden to be used as an attenuated vaccine, which has so far been reduced in pathogenicity to foot-and-mouth disease virus, since the pathogenicity is maintained even in the attempts of various researchers such as multiple passages. The use of attenuated virus against foot-and-mouth disease has a problem of restoration of pathogenicity. Also, it is difficult to distinguish it from outbreaks of foot-and-mouth disease virus using live monsoon vaccine.
본 발명의 발명자는 상기의 문제점을 해결하기 위하여 연구하던 중 이미 O형 구제역 바이러스의 여러 야외바이러스에 대한 광범위하게 면역이 가능한 백신주로 알려진 O manisa 구제역 바이러스 유전자 전체 게놈을 플라스미드에 클로닝한 후 상기 O manisa 구제역 바이러스의 유전자 중에서 3A 부위 일부 및 3B 부위 일부 중에서 선택된 어느 하나 이상의 부위를 결실시켜 병원성이 없는 새로운 바이러스 백신을 얻을 수 있음을 알게 되어 본 발명을 완성하였다. The inventors of the present invention have been studying to solve the above problems. The inventors of the present invention have already cloned O manisa foot-and-mouth disease virus genome entirely known as a vaccine capable of widely immunizing against various outdoor viruses of O type foot- It is possible to obtain a novel virus vaccine having no pathogenicity by deleting one or more sites selected from the 3A region and the 3B region of the foot-and-mouth disease virus gene. Thus, the present invention has been completed.
구제역 바이러스 O manisa 주는 세계적으로 널리 쓰이는 O형의 표준 백신주이다. 그러나 이 백신은 동물에 병원성이 있어 백신주로 사용할 경우 백신 청정국에서는 사용하기 어렵다. 따라서 청정국에서도 안심하고 사용이 가능한 백신주의 개발은 절실하므로 O Manisa 바이러스에 대한 전체 유전자를 클로닝하고 이 바이러스를 유전자 조작하여 일부 유전자(3A 부위 및 3B 부위 중에서 선택된 어느 하나 이상의 유전자 부위)를 제거하여 돼지 및 반추수의 일종인 유산양에서 병원성이 없는 구제역 백신 바이러스를 얻고, 향후 이 백신 바이러스를 기초로 안전한 구제역 백신을 제작할 수 있다.Foot-and-mouth disease virus O manisa is the world's most widely used type of vaccine. However, this vaccine is pathogenic to animals, so it is difficult to use it in vaccine cleansing countries when used as a vaccine. Therefore, it is urgent to develop a vaccine that can be safely used in a clean country. Therefore, the whole gene for O Manisa virus is cloned and the virus is genetically manipulated to remove some genes (at least one gene region selected from 3A region and 3B region) And a foot-and-mouth disease vaccine virus in a lactic acid which is a kind of rumen, and can prepare a safe foot-and-mouth vaccine based on this vaccine virus in the future.
한편 본 발명과 관련된 선행기술로서 본 발명의 발명자가 발명자로 참여한 한국공개특허 제2011-0135532호에 구제역 방어를 위한 3개의 서로 다른 siRNA(small interference RNA)를 발현하는 바이러스 벡터 및 이를 포함하는 구제역 바이러스 백신에 관한 것으로, 보다 상세하게는 구제역의 유전자 중 가장 안정적인 부위인 2B와 3C 부분에서 효과가 입증된 3개의 siRNA 염기 서열을 선정하고, 이를 아데노바이러스에 삽입하여 발현되도록 제조한 바이러스 벡터 및 이를 포함하는 구제역 바이러스 백신을 나타내고 있다.As a prior art related to the present invention, Korean Patent Publication No. 2011-0135532, in which the inventor of the present invention has participated as an inventor, describes a virus vector expressing three different siRNA (small interference RNA) for foot-and-mouth disease defense and a foot-and- The present invention relates to a vaccine, and more particularly, to a viral vector prepared by selecting three siRNA nucleotide sequences proven to be effective in 2B and 3C regions, which are the most stable regions of foot-and-mouth disease genes, Which is a foot-and-mouth disease virus vaccine.
그러나 본 발명과 상기 선행기술은 발명의 기술적 특징이 서로 달라 양 발명은 발명이 구성이 서로 다른 발명이다.
However, the present invention and the prior art are different from each other in technical characteristics of the invention, and both inventions are inventions having different compositions.
한 종류의 구제역 백신을 개발하는 일은 사독백신일지라도 적절한 조건과 바이러스의 선정 등 여러 과정을 거쳐야 하므로 수년간의 연구를 집약해야 이뤄질 수 있다. 백신이 개발된다 하더라도 이 바이러스의 병원성은 유지되고 있으며, 바이러스를 대량 배양할 경우 상당히 엄격한 시설 내에서 바이러스 유출이 되지 않도록 각별히 주의하여야 한다. 이러한 절차 등은 구제역 백신을 제시간에 생산을 어렵게 하고 있으며 필요한 시점에 동물에 공급하는 것은 어려울 수 있다. The development of one type of foot-and-mouth disease vaccine can be accomplished through years of research, even if it is a Sadoc vaccine, because it must go through several processes, including appropriate conditions and virus selection. Even if a vaccine is developed, the virulence of the virus is maintained and caution should be exercised to prevent virus outbreaks in very rigid facilities when large quantities of virus are cultured. These procedures make it difficult to produce foot-and mouth disease vaccines on time and it may be difficult to supply them to animals at the time they are needed.
본 발명은 구제역 바이러스일지라도 동물에 비병원성으로 위와 같은 엄격한 시설을 갖추지 않아도 되며, 구제역 예방용 백신을 제작하기 위한 기본 벡터로 이용하여 발현 항원부위를 교체할 수 있게 바이러스 백신을 제공하고자 한다.
The present invention provides a viral vaccine that can replace the expressed antigen site by using as a basic vector for the preparation of a vaccine for preventing foot-and-mouth disease, even if it is a foot-and-mouth disease virus.
본 발명은 새로운 병원성이 없고 감별이 가능한 마커바이러스 제작을 위하여 구제역 바이러스 O Manisa의 유전자 일부를 조작, 바람직하게는 구제역 바이러스 O Manisa의 유전자 중에서 3A 부위 일부 및 3B 부위 일부 중에서 선택된 어느 하나 이상의 유전자 부위를 결실시켜 동물의 병원성 부위로 알려져 있는 3A에 대해 일부 삭제되어도 증식에 영향을 주지 않는 부위와 구제역바이러스의 복제를 위해 필요한 단백질 시발체로 작동되는 3B가 정상적으로는 3개로 반복하여 구성되어 있지만 2개만 나오도록 교체하여 병원성의 약화시킨 구제역 바이러스 O Manisa를 이용한 재조합 구제역 백신 바이러스를 제공하고자 한다.
The present invention relates to a method for producing a novel pathogenicity-free and distinguishable marker virus, which comprises manipulating a gene part of foot-and-mouth disease virus O Manisa, preferably at least one gene region selected from the 3A region and the 3B region among O- 3B, which is known to be a pathogenic part of the animal, is partly deleted but does not affect the proliferation and 3B, which acts as a protein primer required for the replication of foot-and-mouth disease virus, is normally composed of 3 repeats. And to provide recombinant foot-and mouth disease vaccine virus using O Manisa, a disease caused by weakened virulence.
본 발명에 의해 제공한 구제역 바이러스 O Manisa를 이용한 재조합 구제역 백신 바이러스는 구제역 바이러스 O Manisa의 유전자 일부를 조작하여 병원성이 없거나 또는 약화시킴으로써 소독제 실험 또는 항바이러스 실험 등 실험실내에서 다루기에 병원성 바이러스 보다 더욱 안전한 장점을 지니고 있다. 또한 이 백신 바이러스를 이용하여 O형(ME-SA 지역형) 구제역의 치료 및/또는 예방에 사용할 수 있는 구제역 백신 제작에 기여할 수 있다.
The recombinant foot-and-mouth disease vaccine virus using the foot-and-mouth disease virus O Manisa provided by the present invention is not pathogenic by manipulating a part of the foot-and-mouth disease virus O Manisa, and is more safe than pathogenic virus in disinfectant experiments or anti- . The vaccine virus can also be used to contribute to the production of foot-and-mouth disease vaccines which can be used for the treatment and / or prevention of O-type (ME-SA type) foot-and-mouth disease.
도 1은 구제역 바이러스 O형 Manisa에 대한 재조합 구제역바이러스의 게놈 모식도이다[O-Manisa(전체 유전자 모식도), O-Manisa-3Ad(전체 유전자에서 3A 부위 결실 모식도), O-Manisa-3B2d(전체 유전자에서 3B2 부위 조작 모식도), O-Manisa-3AB2d (전체 유전자에서 3A, 3B2 부위 조작 모식도)].
도 2는 O1 manisa 주의 전체유전자를 클로닝한 플라스미드(pO-Manisa)의 모식도이다.
도 3은 플라스미드(pO-Manisa)를 기초로 3A 부위 일부가 결실된 플라스미드(pO-Manisa-3Ad)의 모식도이다[파란색으로 표시된 유전자 부위가 변화된 서열이 포함된 부분이다.]
도 4는 플라스미드(pO-Manisa)를 기초로 3B2 부위 일부가 조작된 플라스미드(pO-Manisa-3B2d)의 모식도이다[파란색으로 표시된 유전자 부위가 변화된 서열이 포함된 부분이다.].
도 5는 플라스미드(pO-Manisa-3Ad)를 기초로 3A 및 3B2 부위 일부가 조작된 플라스미드(pO-Manisa-3AB2d)의 모식도이다[파란색으로 표시된 유전자 부위가 변화된 서열이 포함된 부분이다.].
도 6은 해당 플라스미드를 이용하여 세포에 유전자를 삽입하여 형질도입으로 제작된 구제역 바이러스가 회복되어 세포에서의 변성효과를 보이는 사진이다[(가)는 BHK21 정상 대조세포, (나)는 O-Manisa-3Ad, (다)는 O-Manisa-3B2d (라) 는 O-Manisa-3AB2d 바이러스가 세포에서 변성효과가 확인된 결과이다.].
도 7은 제작된 바이러스에서 발현된 단백질이 간이항원킷트로 양성반응이 확인된 사진이다[회복된 바이러스 배양 상층액 25㎕ 를 간이항원킷트 (PBM Co. Ltd.)로 구제역에 대한 구조단백질(SP)에 대한 양성반응을 확인할 수 있다. (가)는 O-Manisa-3Ad, (나)는 O-Manisa-3B2d (다) 는 O-Manisa-3AB2d이다.]
도 8은 구제역바이러스 유전자 3A 부위에서 삭제된 유전자 서열을 나타낸 것이다[이 유전자 서열을 기초로 O-manisa-3Ad, O-manisa-3AB2에서 3A부위를 이와 같이 결실하였다.]
도 9는 구제역바이러스 유전자 3B2 부위에서 조작된 유전자 서열을 나타낸 것이다[이 유전자서열을 기초로 O-manisa-3B2d, O-manisa-3AB2에서 3B2d 부위를 이와 같이 결실하였다.].
도 10은 전체 유전자가 삽입된 O manisa바이러스를 접종한 후의 체온의 변화를 관찰한 그림이다[구제역의 특이 증상인 체온 상승 효과는 보이지 않았다.].
도 11은 O-Mansia를 돼지에 접종하여 증상이 관찰되지 않음을 확인하였다[(가)는 O-manisa를 접종하였으며, (나)는 대조로 국내에서 2010년 발생된 구제역바이러스 O-AD-2010를 접종하여 병원성이 확인된 것이다.].FIG. 1 is a genomic diagram of recombinant FMDV virus against OV type Manisa (O-Manisa, O-Manisa-3Ad, O-Manisa-3B2d, 3B2 region manipulation scheme), O-Manisa-3AB2d (3A, 3B2 region manipulation in all genes)].
Fig. 2 is a schematic diagram of a plasmid (pO-Manisa) cloning the entire gene of O1 manisa.
3 is a schematic diagram of a plasmid (pO-Manisa-3Ad) in which a part of the 3A region has been deleted based on a plasmid (pO-Manisa)
Fig. 4 is a schematic diagram of a plasmid (pO-Manisa-3B2d) in which a part of the 3B2 region was manipulated based on a plasmid (pO-Manisa)
5 is a schematic diagram of a plasmid (pO-Manisa-3AB2d) in which a part of the 3A and 3B2 regions have been manipulated based on the plasmid (pO-Manisa-3Ad).
FIG. 6 is a photograph showing the transformation effect of a foot-and-mouth disease virus produced by transfection by inserting a gene into a cell using the plasmid. [(A) BHK21 normal control cell, (b) O- Manisa -3Ad, (c) O-Manisa-3B2d (d) is the result of the O-Manisa-3AB2d virus showing the denaturation effect in the cells.
Fig. 7 is a photograph showing that the protein expressed in the prepared virus was positive by using a simple antigen kit (25 μl of the recovered virus culture supernatant was transferred to PBM Co. Ltd., a structural protein for foot-and-mouth disease (SP ) Can be confirmed. (A) is O-Manisa-3Ad, (B) is O-Manisa-3B2d (C) is O-Manisa-3AB2d.)
Figure 8 shows the gene sequence deleted from the foot-and-
Figure 9 shows the gene sequence engineered at the foot-and-mouth virus gene 3B2 region. (This deletion of the 3B2d region in O-manisa-3B2d and O-manisa-3AB2 based on this gene sequence.
FIG. 10 is a graph showing a change in body temperature after inoculation with the whole gene-inserted O manisa virus (no specific temperature increase effect of foot-and-mouth disease was observed).
11 shows that no symptoms were observed by inoculating O-Mansia into pigs [(a) was inoculated with O-manisa and (b) was inoculated with O-AD-2010 And the pathogenicity was confirmed by inoculation.
본 발명은 구제역 바이러스 O Manisa를 이용한 재조합 구제역 백신 바이러스.를 나타낸다.The present invention shows a recombinant foot-and mouth disease vaccine virus using foot-and-mouth disease virus O Manisa.
본 발명은 구제역 O형 백신주 Manisa의 전체 유전자가 삽입된 플라스미드에서 일부 유전자 부위를 결실(deletion) 또는 치환(substitution)시켜 얻은 플라스미드를 포함하는 구제역 바이러스 O Manisa를 이용한 재조합 구제역 백신 바이러스를 나타낸다.The present invention relates to a recombinant foot-and-mouth disease vaccine virus using a foot-and-mouth disease virus O Manisa comprising a plasmid obtained by deletion or substitution of a part of a gene in a plasmid into which a whole gene of a foot-and-mouth disease type O vaccine Manisa has been inserted.
상기에서 재조합 구제역 백신 바이러스는 구제역 O형 백신주 Manisa의 전체 유전자 부위 중에서 3A 부위 일부를 결실시켜 얻은 플라즈미드(pO-manisa-3Ad)를 포함할 수 있다.The recombinant foot-and-mouth disease vaccine virus may include a plasmid (pO-manisa-3Ad) obtained by deletion of a part of the 3A region in the whole gene region of the foot-and-mouth type O type vaccine strain Manisa.
상기의 유전자 3A 부위 중에서 결실 부위는 277∼306bp일 수 있다.The deletion site in the
상기에서 재조합 구제역 백신 바이러스는 구제역 O형 백신주 Manisa의 전체 유전자 부위 중에서 3B1 부위, 3B2 부위 및 3B3 부위로 구성된 3B 부위를 치환 또는 결실시키되 이때 3B1 부위 일부를 치환시키고, 3B2 부위 일부를 결실시켜 얻은 플라즈미드(pO-manisa-3B2d)를 포함할 수 있다.The recombinant foot-and-mouth disease vaccine virus is a plasmid obtained by substituting or deleting 3B1 part consisting of 3B1 part, 3B2 part and 3B3 part in the entire genetic part of foot-and-mouth disease type O vaccine Manisa and replacing part of 3B1 part and deleting part of 3B2 part (pO-manisa-3B2d).
상기의 유전자 3B1 부위 중에서 치환 부위는 22∼36bp이고, 유전자 3B2 부위 중에서 결실 부위는 37∼105bp일 수 있다.Among the 3B1 regions of the gene, the substitution region is 22 to 36 bp, and the deletion region of the gene 3B2 region may be 37 to 105 bp.
상기에서 재조합 구제역 백신 바이러스는 구제역 O형 백신주 Manisa의 전체 유전자 부위 중에서 3A 부위 일부의 결실과 3B2 부위 일부의 치환 또는 결실시켜 얻은 플라즈미드(pO-manisa-3AB2d)를 포함할 수 있다.The recombinant foot-and-mouth disease vaccine virus may include a plasmid (pO-manisa-3AB2d) obtained by deletion of part of the 3A region and substitution or deletion of part of the 3B2 region in the whole gene region of the foot-and-mouth disease type O vaccine strain Manisa.
상기의 유전자 3A 부위 중에서 결실 부위는 277∼306bp이고, 유전자 3B2 부위 중에서 치환 부위는 22∼36bp, 결실 부위는 37∼105bp일 수 있다.
Among the
본 발명은 구제역 바이러스 O Manisa를 이용한 재조합 구제역 백신 바이러스의 제조방법을 나타낸다.The present invention shows a method for producing recombinant foot-and mouth disease vaccine virus using foot-and-mouth disease virus O Manisa.
본 발명은 (1)구제역 O형 백신주 Manisa의 전체 유전자를 플라스미드에 삽입하는 단계; (2)상기의 플라스미드의 구제역 O형 백신주 Manisa의 전체 유전자 중에서 일부 유전자 부위를 결실(deletion) 또는 치환(substitution)시키는 단계; (3)상기 (2)단계에서 얻은 일부 유전전가 결실 또는 치환된 플라스미드를 세포에 주입하여 증식시키는 단계를 포함하는 구제역 바이러스 O Manisa를 이용한 재조합 구제역 백신 바이러스의 제조방법을 나타낸다.(1) inserting a whole gene of a foot-and-mouth-type O-type vaccine strain Manisa into a plasmid; (2) deletion or substitution of some genes in the whole genes of the foot-and-mouth disease type O vaccine strain Manisa of the plasmid; (3) a step of infecting cells by injecting some of the hereditary transference-deficient or substituted plasmids obtained in the step (2) and propagating the transformed viruses; and (3) a method for producing recombinant foot-and-mouth disease vaccine virus using the foot-and-mouth disease virus O Manisa.
상기에서 구제역 O형 백신주 Manisa의 전체 유전자를 플라스미드에 삽입은 통상적으로 유전자를 플라스미드에 삽입하는 방법을 이용할 수 있으면 족하므로 이에 대한 자세한 내용은 생략하기로 한다.
The insertion of the entire gene of the foot-and-mouth disease type O vaccine Manisa into the plasmid can be performed by inserting the gene into a plasmid. Therefore, detailed description thereof will be omitted.
상기에서 재조합 구제역 백신 바이러스는 구제역 O형 백신주 Manisa의 전체 유전자 부위 중에서 3A 부위 일부를 결실시켜 얻은 플라즈미드(pO-manisa-3Ad)를 포함할 수 있다.The recombinant foot-and-mouth disease vaccine virus may include a plasmid (pO-manisa-3Ad) obtained by deletion of a part of the 3A region in the whole gene region of the foot-and-mouth type O type vaccine strain Manisa.
상기의 유전자 3A 부위 중에서 결실 부위는 277∼306bp일 수 있다.The deletion site in the
상기의 유전자 3A 부위의 결실은 서열번호 2의 포워드 프라이머(Forwarf Primer) 및 서열번호 3의 리버스 프라이머(Reverse Primer)를 이용한 PCR에 의해 실시할 수 있다.Deletion of the
상기에서 재조합 구제역 백신 바이러스는 구제역 O형 백신주 Manisa의 전체 유전자 부위 중에서 3B1 부위, 3B2 부위 및 3B3 부위로 구성된 3B 부위 중 3B1 부위 일부를 치환시키고, 3B2 부위 일부를 결실시켜 얻은 플라즈미드(pO-manisa-3B2d)를 포함할 수 있다.The recombinant foot-and-mouth disease vaccine virus was constructed by replacing part of the 3B1 part of the 3B part consisting of the 3B1 part, 3B2 part and 3B3 part in the entire genetic part of the foot-and-mouth disease type O vaccine Manisa and deleting a part of the 3B2 part (pO- 3B2d).
상기의 유전자 3B1 부위, 3B2 부위 및 3B3 부위로 구성된 3B 부위 중 3B1 부위 의 치환 부위는 22∼36bp이고, 유전자 3B2 부위의 결실 부위는 37∼105bp일 수 있다.Among the 3B regions consisting of the 3B1, 3B2, and 3B3 regions, the 3B1 region has a substitution region of 22 to 36 bp, and the gene 3B2 region has a deletion region of 37 to 105 bp.
상기의 유전자 3B 부위의 치환 또는 결실은 서열번호 4의 포워드 프라이머(Forwarf Primer) 및 서열번호 5의 리버스 프라이머(Reverse Primer)를 이용한 PCR에 의해 실시할 수 있다.The substitution or deletion of the 3B region of the gene can be carried out by PCR using a forward primer of SEQ ID NO: 4 and a reverse primer of SEQ ID NO: 5.
상기에서 재조합 구제역 백신 바이러스는 구제역 O형 백신주 Manisa의 전체 유전자 부위 중에서 3A 부위 일부의 결실과 3B1 부위, 3B2 부위 및 3B3 부위로 구성된 3B 부위 중 3B1 부위 일부의 치환 또는 3B2 부위 일부를 결실시켜 얻은 플라즈미드(pO-manisa-3AB2d)를 포함할 수 있다.In this case, the recombinant foot-and-mouth disease vaccine virus is a plasmid obtained by deletion of part of the 3A region of the whole gene region of the foot-and-mouth disease type O vaccinia Manisa and deletion of part of the 3B1 site or part of the 3B2 site among the 3B region composed of the 3B1 region, 3B2 region and 3B3 region (pO-manisa-3AB2d).
상기의 유전자 3A 부위 중에서 결실 부위는 277∼306bp이고, 3B1 부위, 3B2 부위 및 3B3 부위로 구성된 3B 부위 중 유전자 3B1 부위의 치환 부위는 22∼36bp, 3B2 부위의 결실 부위는 37∼105bp일 수 있다.Among the 3A regions of the
상기의 3A 부위 일부의 결실과 3B 부위 일부의 치환 또는 결실은 서열번호 6의 포워드 프라이머(Forwarf Primer) 및 서열번호 7의 리버스 프라이머(Reverse Primer)를 이용한 PCR에 의해 실시할 수 있다.
The deletion of a part of the 3A region and the substitution or deletion of a part of the 3B region can be carried out by PCR using a forward primer of SEQ ID NO: 6 and a reverse primer of SEQ ID NO: 7.
상기 (2)단계에서 얻은 일부 유전전가 결실 또는 치환된 플라스미드를 세포에 주입하는 3단계에서의 세포는 염소 태아 혀 세포(ZZ-R) 및 어린 햄스터 신장 세포(BHK21) 중에서 선택된 어느 하나 이상을 사용할 수 있다.
The cells in step 3 of injecting the cells with some of the hereditary transference-deficient or substituted plasmids obtained in the step (2) may use at least one selected from the group consisting of fetal zoospore (ZZ-R) and young hamster kidney cells (BHK21) .
이하 본 발명의 내용을 실험예를 통하여 구체적으로 설명한다. 그러나, 하기의 실험예는 본 발명을 보다 상세하게 설명하기 위한 것으로 본 발명의 권리범위가 이들에 의해 한정되는 것은 아니다.
Hereinafter, the content of the present invention will be described in detail through experimental examples. However, the following experimental examples are intended to illustrate the present invention in more detail, and the scope of the present invention is not limited thereto.
<실험예><Experimental Example>
1. 실험방법1. Experimental Method
구제역 O Manisa 바이러스 전체 유전자(Genbank AY593823.1)를 PCR에 의하여 증폭하고 플라스미드(pBluescript SK II)에 O_Manisa 유전자를 삽입하였다(pO-Manisa). The whole genome of the foot-and-mouth disease O Manisa virus (Genbank AY593823.1) was amplified by PCR and the O_Manisa gene was inserted into a plasmid (pBluescript SK II) (pO-Manisa).
일반적으로 cDNA 합성시 사용되는 Random primers 를 이용하여 O Manisa 바이러스에 대한 cDNA 작성후 이것을 이용하여 O Manisa 바이러스 유전자정보를 기초로 증폭이 가능한 특이 프라이머들(Genbank AY593823.1를 기초로 5' 및 3' 유전자의 각 20 mers씩에 해당)를 작성하여 PCR을 실시하였으며, PCR를 위한 조건은 5X buffer (FINNZYMES, 10㎕), 10mM dNTPs (1㎕), Phusion enzyme (2U/㎕, 0.5㎕), 멸균증류수 (35.5㎕)의 용량으로 98℃ 30초 후 98℃ 10초, 65℃ 30초, 72℃ 2분 30초간 25cycle, 최종 72℃ 10분으로 반응을 실시하였다.Generally, Random primers used for cDNA synthesis were used to generate cDNA for O Manisa virus, and specific primers that can be amplified based on O Manisa virus gene information (5 'and 3' based on Genbank AY593823.1, The PCR conditions were as follows: 5X buffer (FINNZYMES, 10μl), 10mM dNTPs (1μl), Phusion enzyme (2μl, 0.5μl), sterilization The reaction was carried out at 98 ° C for 30 seconds, followed by 25 cycles at 98 ° C for 10 seconds, 65 ° C for 30 seconds, 72 ° C for 2 minutes and 30 seconds, and finally at 72 ° C for 10 minutes in the capacity of distilled water (35.5 μl).
상기 O Manisa 유전자가 삽입된 플라스미드를 기초로 O Manisa 바이러스 전체 유전자 중에서 3A 부위 일부와, 3B 부위 일부와, 3A 부위 일부 및 3B 부위 일부를 치환 및/또는 결실이 되도록 조작하였고 그 방법은 다음과 같다.Based on the plasmid into which the O Manisa gene has been inserted, part of the 3A region, part of the 3B region, part of the 3A region and part of the 3B region were manipulated to be substituted and / or deleted in the entire O Manisa virus gene, .
플라스미드(pO-Manisa)를 기초로 하여 TOYOBO mutation kit를 이용하여 조작하였다. Based on the plasmid (pO-Manisa), the TOYOBO mutation kit was used.
유전자의 3A 부위 조작을 위한 PCR은 플라스미드(30ng/㎕, 1㎕), 서열번호 2의 포워드 프라이머(Forward Primer, GACAAGACTCTTGACGAGGCGGAAA, 10pmole/㎕, 1㎕) 및 서열번호 3의 리버스 프라이머(Reverse Primer, GTCATTCACTGCATCGTCCACCATC, 10pmole/㎕, 1㎕)를 이용하였다. PCR was performed using the plasmid (30 ng /,, 1)), the forward primer (GACAAGACTCTTGACGAGGCGGAAA, 10 pmole / ㎕, 1 의) of SEQ ID NO: 2 and the reverse primer (Reverse Primer, GTCATTCACTGCATCGTCCACCATC , 10 pmole / μl, 1 μl) was used.
유전자의 3B 부위 조작을 위한 PCR은 플라스미드(30ng/㎕, 1㎕), 서열번호 4의 포워드 프라이머(TTGAAAGTGAGAGCAAGAGCCCCGG, 10pmole/㎕, 1㎕) 및 서열번호 5의 리버스 프라이머(TGCCACTGGTTTCTTAAGTGGTCCGGCGTAGGGCC, 10pmole/㎕, 1㎕)를 사용하였다. PCR was carried out using a plasmid (30 ng /,, 1)), a forward primer (TTGAAAGTGAGAGCAAGAGCCCCGG, 10 pmole / 쨉 l, 1 의) of SEQ ID NO: 4 and a reverse primer (TGCCACTGGTTTCTTAAGTGGTCCGGCGTAGGGCC, 10 pmole / Mu] l) was used.
유전자의 3A 부위 및 3B 부위 조작을 위한 PCR은 플라스미드 (O1m 3Ad)를 기초로 하여 TOYOBO mutation kit를 이용하여 조작하였다. 플라스미드(30ng/㎕, 1㎕), 서열번호 6의 포워드 프라이머(TTGAAAGTGAGAGCAAGAGCCCCGG, 10pmole/㎕, 1㎕) 및 서열번호 7의 리버스 프라이머(TGCCACTGGTTTCTTAAGTGGTCCGGCGTAGGGCC, 10pmole/㎕, 1㎕)를 합성하여 사용하였다. PCR for the 3A and 3B regions of the gene was performed using TOYOBO mutation kit based on the plasmid (O1m3Ad). (TTGAAAGTGAGAGCAAGAGCCCCGG, 10 pmole / l, 1 쨉 l) of SEQ ID NO: 6 and a reverse primer (TGCCACTGGTTTCTTAAGTGGTCCGGCGTAGGGCC, 10 pmole / 쨉 l, 1 쨉 l) of SEQ ID NO: 7 were synthesized and used.
상기에서 PCR를 위한 조건은 5X buffer (FINNZYMES, 10㎕), 10mM dNTPs (1㎕), Phusion enzyme (2U/㎕, 0.5㎕), 멸균증류수 (35.5㎕)의 용량으로 98℃ 30초 후 98℃ 10초, 65℃ 30초, 72℃ 2분 30초간 25cycle, 최종 72℃ 10분으로 반응을 실시하였다. 그 후 자가 결찰반응(Self ligation, TOYOBO mutation kit)을 수행하였다. 그 방법은 PCR 산물을 제한효소 DpnI(10unit/㎕, 2㎕)로 37℃, 1시간 처리 후 Ligation high 5㎕, T4 polynucleotide kinase 1㎕, 멸균증류수 7㎕로 조합하여 16℃, 3시간 반응하였다. 그후 플라스미드를 추출한 뒤 FspI 제한효소로 처리하면 Ligation이 잘 된 플라스미드는 3개의 band로 확인할 수 있다. The conditions for the PCR were 98 ° C for 30 seconds at 98 ° C and then 98 ° C for 5 minutes at 98 ° C in 5X buffer (FINNZYMES, 10 μl), 10 mM dNTPs (1 μl), Phusion enzyme (2 U / μl, 0.5 μl) and sterilized distilled
최종적으로 염기서열 분석을 실시하여 3A 부위의 서열이 결실(deletion)된 플라스미드(pO-Manisa-3Ad), 3B 부위의 서열이 결실(deletion) 및 치환(substitution)된 플라스미드(pO-Manisa-3B2d) 및 3A 부위의 서열이 결실되고, 3B 부위의 서열이 결실 및 치환된 플라스미드(pO-Manisa-3AB2d)를 확인하였다. (PO-Manisa-3B2d), a deletion and substitution sequence of the 3B region (pO-Manisa-3B2d), and a plasmid And a plasmid (pO-Manisa-3AB2d) in which the sequence at the 3A site was deleted and the sequence at the 3B site was deleted and substituted was identified.
그리고 바이러스 회복은 확보된 플라스미드(O1m 3Ad, 3B2d, 3AB2d)를 제한효소로 반응시킨 뒤 BHKT7-9 세포(T7 RNA polymerase가 발현되는 세포주)에서 바이러스를 확보한 후 ZZ-R(염소 태아 혀) 세포 및 BHK21(어린 햄스터 신장) 세포에서 증식시키고, BHK21 세포 및 IBRS-2(돼지 신장) 세포에서 세포 변성 효과를 확인하였다.After recovering the virus from the BHKT7-9 cells (T7 RNA polymerase-expressing cell line), ZZ-R (goat fetal tongue) cells were incubated with the plasmids (O1m3Ad, 3B2d, 3AB2d) And BHK21 (young hamster kidney) cells, and the cytopathic effect was confirmed in BHK21 cells and IBRS-2 (pig kidney) cells.
제작된 구제역 바이러스는 foot-pad 및 목 근육에 2ml (> 5.0 logTCID50/ml) 으로 접종하고 10일 이상 관찰하였다.
The foot-pad and neck muscles were inoculated with 2 ml (> 5.0 log TCID50 / ml) and observed for more than 10 days.
2. 결과2. Results
도 1은 구제역 바이러스 O형 Manisa에 대한 재조합 구제역바이러스의 게놈 모식도를 표현하고 있다. 도 1에서 O-Manisa은 구제역 바이러스 O형 Manisa 전체 유전자 모식도를 나타내고 있으며, O-Manisa-3Ad는 구제역 바이러스 O형 Manisa 전체 유전자에서 3A 부위 결실 모식도이고, O-Manisa-3B2d는 구제역 바이러스 O형 Manisa 전체 유전자에서 3B2 부위 조작 모식도이고, O-Manisa-3AB2d는 구제역 바이러스 O형 Manisa 전체 유전자에서 3A, 3B2 부위 조작 모식도이다.
Figure 1 depicts the genomic schema of recombinant FMD virus against the foot-and-mouth disease virus type O Manisa. In Fig. 1, O-Manisa shows the whole genome of the foot-and-mouth disease virus O-type Manisa, O-Manisa-3Ad is the pattern of 3A deletion in the whole genotype of foot-and-mouth disease virus O type Manisa, 3B2 region is a schematic diagram of the whole gene, and O-Manisa-3AB2d is a schematic diagram of the 3A, 3B2 region manipulation in the whole genome of the foot-and-mouth disease virus O type Manisa.
도 2는 구제역 바이러스 O manisa 주의 전체 유전자를 클로닝한 플라스미드(pO-Manisa)의 모식도이다.
Fig. 2 is a schematic diagram of a plasmid (pO-Manisa) in which the whole gene of foot-and-mouth disease virus O manisa is cloned.
도 3은 구제역 바이러스 O manisa 주의 전체 유전자를 클로닝한 플라스미드(pO-Manisa)를 기초로 3A 부위 일부가 결실된 플라스미드(pO-Manisa-3Ad)의 모식도이고, 파란색으로 표시된 유전자 부위가 변화된 서열이 포함된 부분이다.
FIG. 3 is a schematic diagram of a plasmid (pO-Manisa-3Ad) in which a part of the 3A region is deleted based on a plasmid (pO-Manisa) in which the whole gene of foot-and-mouth disease virus O manisa is cloned. .
도 4는 구제역 바이러스 O manisa 주의 전체 유전자를 클로닝한 플라스미드(pO-Manisa)를 기초로 3B2 부위 일부가 조작된 플라스미드(pO-Manisa-3B2d)의 모식도이고 파란색으로 표시된 유전자 부위가 변화된 서열이 포함된 부분이다.
FIG. 4 is a schematic diagram of a plasmid (pO-Manisa-3B2d) in which a part of the 3B2 region was manipulated based on a plasmid (pO-Manisa) in which the entire gene of foot-and-mouth disease virus O manisa was cloned, Section.
도 5는 구제역 바이러스 O manisa 주의 전체 유전자를 클로닝한 플라스미드(pO-Manisa-3Ad)를 기초로 3A 및 3B2 부위 일부가 조작된 플라스미드(pO-Manisa-3AB2d)의 모식도이고 파란색으로 표시된 유전자 부위가 변화된 서열이 포함된 부분이다.
FIG. 5 is a schematic diagram of a plasmid (pO-Manisa-3AB2d) in which a part of the 3A and 3B2 regions were manipulated based on a plasmid (pO-Manisa-3Ad) cloned from the whole genus of foot-and-mouth disease virus O manisa. This is the part containing the sequence.
도 6은 해당 플라스미드를 이용하여 BHK21 세포에 유전자를 삽입하여 형질도입으로 제작된 구제역 바이러스가 회복되어 BHK21 세포에서의 변성효과를 나타낸 것이다. 도 6에서 (가)는 BHK21 정상 대조 세포를 나타낸 것이고, (나)는 BHK21 세포에 3A 부위 일부가 결실된 플라스미드(pO-Manisa-3Ad)를 포함하는 백신 바이러스 주입 후 변성을 나타낸 것이고, (다)는 BHK21 세포에 3B 부위 일부가 치환 또는 결실된 플라스미드(pO-Manisa-3B2d)를 포함하는 백신 바이러스 주입 후 변성을 나타낸 것이고, (라) 는 BHK21 세포에 3A 부위 일부가 결실되고, 3B 부위 일부가 치환 또는 결실된 플라스미드(pO-Manisa-3AB2d)를 포함하는 백신 바이러스 주입 후 변성을 나타낸 것이다.
FIG. 6 shows gene deletion effect in BHK21 cells by recovering foot-and-mouth disease virus produced by transfection by inserting a gene into BHK21 cells using the plasmid. 6 shows (a) normal BHK21 control cells, and (b) shows denaturation after injection of a vaccine virus containing a plasmid (pO-Manisa-3Ad) in which part of the 3A region was deleted in BHK21 cells ) Showed denaturation after the injection of a vaccine virus containing a plasmid (pO-Manisa-3B2d) in which a part of the 3B region was substituted or deleted in the BHK21 cell, (d) part of the 3A region was deleted in the BHK21 cell, (PO-Manisa-3AB2d) in which the plasmid was replaced or deleted.
도 7은 상기에서 제조한 3종의 백신 바이러스에서 발현된 단백질이 간이항원키트로 구제역 양성반응이 확인된 사진이다. 회복된 바이러스 배양 상층액 25㎕를 간이항원키트(PBM Co. Ltd.)로 구제역에 대한 구조 단백질(SP)에 대한 양성반응을 확인할 수 있다. (가)는 3A 부위 일부가 결실된 플라스미드(pO-Manisa-3Ad)를 포함하는 백신 바이러스에 대한 구제역 양성반응을 나타낸 간이항원키트이고, (나)는 3B 부위 일부가 치환 또는 결실된 플라스미드(pO-Manisa-3B2d)를 포함하는 백신 바이러스에 대한 구제역 양성반응을 나타낸 간이항원키트이고, (다)는 3A 부위 일부가 결실되고, 3B 부위 일부가 치환 또는 결실된 플라스미드(pO-Manisa-3AB2d)를 포함하는 백신 바이러스 에 대한 구제역 양성반응을 나타낸 간이항원키트를 나타낸 것이다.
FIG. 7 is a photograph showing that the proteins expressed in the three kinds of vaccine viruses prepared above were positive for foot-and-mouth disease with a liver antigen kit. 25 μl of the recovered viral culture supernatant can be confirmed with a positive antigen kit (PBM Co. Ltd.) for a positive response to the structural protein (SP) against foot-and-mouth disease. (B) is a plasmid (pO-Manisa-3Ad) in which part of the 3B region has been deleted or replaced, and -Manisa-3B2d), (c) a plasmid (pO-Manisa-3AB2d) in which part of the 3A region was deleted and part of the 3B region was substituted or deleted, , Which shows a foot-and-mouth disease positive reaction against a vaccine virus containing the virus.
도 8은 구제역 바이러스 유전자 3A 부위에서 삭제된 유전자 서열을 보고주고 있다. 이 유전자 서열을 기초로 O-manisa-3Ad, O-manisa-3AB2에서 3A부위를 이와 같이 결실하였다.
Figure 8 shows the gene sequence deleted in the foot-and-
도 9는 구제역바이러스 유전자 3B2 부위에서 조작된 유전자 서열을 보고주고 있다. 이 유전자서열을 기초로 O-manisa-3B2d, O-manisa-3AB2에서 3B2d 부위를 이와 같이 결실하였다.
Figure 9 shows the gene sequence engineered at the foot-and-mouth virus gene 3B2 region. Based on this gene sequence, the 3B2d region was deleted in O-manisa-3B2d and O-manisa-3AB2.
표 1은 백신주의 표준으로 삼고 있는 O manisa 바이러스(소 유래주)를 조작한 여러 O manisa 바이러스 유래주를 소와 같은 반추수인 유산양에서 바이러스의 병원성 및 공격접종을 실시하여 병원성이 보이지 않는 것을 확인한 것이다.Table 1 shows the pathogenicity and attack inoculation of viral pathogens in ruminants, such as cattle, which are derived from various O manisa viruses, which have been engineered with O manisa virus (cattle-derived strain) will be.
(wild type)O-Manisa
(wild type)
*상기 표 1에서 Z는 ZZ-R(염소 태아 혀) 세포를 나타내고, B는 BHK21(어린 햄스터 신장) 세포를 나타내며, 이때 숫자는 계대수를 나타낸다.
In Table 1, Z represents ZZ-R (fetal tongue) cells and B represents BHK21 (young hamster kidney) cells, where the numbers represent the number of passages.
도 10은 구제역 O manisa 바이러스 전체 유전자를 포함하는 플라스미드(O-Manisa)를 포함하는 백신 바이러스, 구제역 O manisa 바이러스 전체 유전자 중에서 3A 부위 일부가 결실된 플라스미드(pO-Manisa-3Ad)를 포함하는 백신 바이러스, 구제역 O manisa 바이러스 전체 유전자 중에서 3B 부위 일부가 치환 또는 결실된 플라스미드(pO-Manisa-3B2d)를 포함하는 백신 바이러스, 구제역 O manisa 바이러스 전체 유전자 중에서 3A 부위 일부가 결실되고, 3B 부위 일부가 치환 또는 결실된 플라스미드(pO-Manisa-3AB2d)를 포함하는 백신 바이러스를 각각 발굽부위(foot pad)에 피내로 0.1ml을 접종한 후 체온의 변화를 관찰 것으로서, 모든 실험군에서 구제역의 특이 증상인 체온 상승은 보이지 않았다.
Fig. 10 is a diagram showing a vaccine virus containing a plasmid (O-Manisa) containing the entire gene of foot-and-mouth disease O manisa virus, a vaccine virus (pO-Manisa-3Ad) containing a plasmid (PO-Manisa-3B2d) in which part of the 3B region has been substituted or deleted in the whole genome of the foot-and-mouth disease O manisa virus, part of the 3A region is deleted and part of the 3B region is substituted or deleted The vaccine virus containing the deleted plasmid (pO-Manisa-3AB2d) was inoculated 0.1ml into each of the foot pads, and the change of body temperature was observed. In all experimental groups, I did not see it.
도 11은 돼지에 구제역 O manisa 바이러스 전체 유전자를 갖는 백신 바이러스 및 국내에서 2010년 발생된 구제역바이러스 O-AD-2010를 대조군으로 접종한 것을 나타낸 사진으로, 도 11에서 (가)는 돼지에 구제역 O manisa 바이러스 전체 유전자를 포함하는 백신 바이러스를 접종한 것으로 병원성을 나타내지 않았으며, (나)는 돼지에 국내에서 2010년 발생된 구제역바이러스 O-AD-2010를 접종한 것으로 병원성을 나타내었다.
FIG. 11 is a photograph showing that a vaccine virus having a whole foot-and-mouth disease virus O manisa virus and a foot-and-mouth disease virus O-AD-2010 generated in Korea in 2010 were inoculated into pigs. In FIG. 11, (a) (b) was vaccinated with the foot-and-mouth disease virus O-AD-2010, which occurred in Korea in 2010, and showed pathogenicity.
한편, 구제역 바이러스 O manisa 주를 전체 클로닝한 플라스미드(pO-Manisa)에 대한 유전자 염기서열을 서열번호 1에 나타내었다.
On the other hand, the gene sequence for the plasmid (pO-Manisa) in which the foot-and-mouth disease virus O manisa strain was fully cloned is shown in SEQ ID NO: 1.
상술한 바와 같이 본 발명의 바람직한 실시예 및 시험예를 참조하여 설명하였지만 본 발명의 기술 분야에서 통상의 지식을 가진 통상의 기술자라면 하기의 특허청구범위에 기재된 본 발명의 사상 및 영역으로부터 벗어나지 않는 범위 내에서 본 발명을 다양하게 수정 및 변경시킬 수 있음을 이해할 수 있을 것이다.
Although the present invention has been described and illustrated in detail, it should be understood by those skilled in the art that various changes and modifications may be made without departing from the scope of the present invention as defined by the appended claims. It will be understood that various modifications and changes may be made in the present invention.
본 발명에 의해 제공한 구제역 바이러스 O Manisa를 이용한 재조합 구제역 백신 바이러스는 구제역 바이러스 O Manisa의 유전자 일부를 조작하여 병원성이 없거나 또는 약화시킴으로써 소독제 실험 또는 항바이러스 실험 등 실험실내에서 다루기에 병원성 바이러스 보다 더욱 안전한 장점을 지니고 있다. 또한 이 백신 바이러스를 이용하여 O형(ME-SA 지역형) 구제역의 치료 및/또는 예방에 사용할 수 있는 구제역 백신 제작에 사용될 수 있어 구제역에 예민한 돼지, 소, 염소, 양 등의 축산 농가 및 축산 관련 산업발전에 기여할 수 있으므로 산업상 이용가능성이 있다.The recombinant foot-and-mouth disease vaccine virus using the foot-and-mouth disease virus O Manisa provided by the present invention is not pathogenic by manipulating a part of the foot-and-mouth disease virus O Manisa, and is more safe than pathogenic virus in disinfectant experiments or anti- . In addition, the vaccine virus can be used for the production of foot-and-mouth disease vaccines which can be used for the treatment and / or prevention of foot-and-mouth disease (Type ME-SA) foot-and-mouth disease using the vaccine virus, It can contribute to the development of related industries, and thus there is possibility of industrial use.
<110> REPUBLIC OF KOREA (Management : Ministry for Food, Agriculture, Forestry and Fisheries.Animal, Plant and Fisheries Quarantine and Inspection Agency (QIA) ) <120> Recombinant foot and mouth disease viruses using the vaccine strain, O manisa strain for protection of ME-SA topotype of O serotyp <130> 9039 <160> 7 <170> KopatentIn 2.0 <210> 1 <211> 11097 <212> DNA <213> gene for O manisa of pO-Manisa <400> 1 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120 gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc 180 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc 240 ctaatcaagt tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag 300 cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa 360 agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac 420 cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg 480 caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg 540 gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg 600 taaaacgacg gccagtgagc atatgtaata cgactcacta tagggttgaa agggggcgct 660 agggtctcac ccctagcatg ccaacgacag ctcctacgtc gcactccaca ctaacgtttg 720 tgtgcgcgcg ggaaccgatg gacttttgtt cacccaccta cagttggact cacggcaccg 780 cgtggccatt ttagctgggt tgtgcggacg aacactgctt gcgcatctcg cgtgaccggt 840 tagtactctt accactatcc gcctacttgg tcgttagcgc tgtcctgggc actcttgttg 900 ggggctgttc aacgctctac ggtctcccct gcgtaacaga ctacggtgtt ggggccgctt 960 cgtgcgagcc gatcgcttgg tgtgcctcgg ctgtcgcccg aagcccgcct ttcacccccc 1020 cccccccccc ccccctaggt tttaccgtcg ttcccgacgt taatggggaa acaaccacaa 1080 gcttaacacc gtcttgcccg acgtaaaagg gctgcaacca aaaagcttgt gccgcctttc 1140 ccggcgttaa tgggaggtaa ccacaagaca aaccttcacc cggaagtaaa acggcaactt 1200 cacacagttt tgcccgtttt cgtgagaaat gggccgtcaa cgcacgaaac gcgccgtcgc 1260 ttgaggagga cttgtacaaa cacgatctat gcaggtttcc acaactgaca caaaccgtgc 1320 aacttgaaac cccgcctggt ctttccaggt ctagaggggc gacattttgt actgtgcttg 1380 actccacgct cggtccacta gcgagtgtta gtagtagcac tgttgcttcg tagcggagca 1440 tgatggccgt gggagcttcc ccttggtaac aaggacccac ggggccaaaa gccacgtcct 1500 accggaccca tcatgtgtgc aaacccagca cggcaacttt actgcgaaaa ccactttaag 1560 gtgacactga tactggtact caatcactgg tgacaggcta aggatgccct tcaggtaccc 1620 cgaggtaaca cgcgacactc gggatctgag aaggggactg gggcttcttt aaaagtgccc 1680 agtttaaaaa gcttctatgc ctgaataggc gaccggaggc cggcgccttt tcactgtttt 1740 actactgttt tcatgaatac aactgactgt ttcaccgccc tgttacacgc tctcagagag 1800 atcaaaacac tgtttctttt acggacacaa ggaaagatgg aattcacact ttacaacggt 1860 gagaagaaaa ccttctactc cagacccaac aaccacgaca actgctggct taacaccatt 1920 ctccagttgt tcaggtatgt tgatgagcct ttctttgact gggtctacga ctcgcctgaa 1980 aacctcactc ttgaggcaat caaacagttg gaagagacaa ccggtcttga gctgcacgag 2040 ggtggaccac ccgctctcgt catctggaac atcaaacact tgcttcacac cggaatcggc 2100 actgcctcac gccctagcga ggtgtgtatg gtggacggaa cggacatgtg tttagctgat 2160 tttcatgctg gcattttcct gaaaggacag gaacatgctg tgttcgcctg tgtcacctcc 2220 aacgggtggt acgcgattga tgacgaggac ttttaccctt ggacaccgga cccgtccgac 2280 gttctggtgt ttgtcccgta cgatcaagaa ccgcttaacg gagagtggaa aacaaaggtc 2340 cagaaaaggc tcaagggagc cgggcaatcc agcccggcaa ccgggtcaca gaaccaatca 2400 ggcaacactg ggagcatcat caacaattac tacatgcagc agtaccaaaa ctccatggac 2460 acacaacttg gtgacaacgc tacaagcgga ggctcaaacg aggggtccac ggacacaacc 2520 tccacccaca caaccaacac tcagaacaac gactggttct cgaagctggc cagttccgct 2580 ttcagcggtc ttttcggcgc tcttctcgcc gacaagaaaa ccgaggagac cactcttctc 2640 gaggaccgca tcctcactac tcgtaacgga cacaccacct cgacaaccca gtcgagcgtt 2700 ggagtcacgt acgggtatgc aacagctgag gatttcgtga gcgggccaaa cacctctggt 2760 ctcgagacca gggttgccca ggcagagcgg ttctttaaaa cccacctgtt cgactgggtc 2820 accagtgacc cattcggacg gtgccacctg ctggaacttc caactgacca caaaggtgtc 2880 tacggcagcc tgaccgactc gtatgcttat atgaggaacg gctgggatgt tgaagtcact 2940 gcagtgggaa accagttcaa tggaggatgc ctgttggtgg ccatggtgcc agaactttgc 3000 tccatacaga agagggagct gtaccagctc acgctctttc ctcaccagtt catcaaccct 3060 cggacgaaca tgacagcaca catcactgtg ccctttgttg gcgtcaaccg ttatgaccag 3120 tacaaggtac acaaaccttg gaccctcgtg gttatggttg tagcccccct gactgtcaac 3180 agtgaaggtg ccccgcaaat caaggtgtat gccaacatcg cacctaccaa cgtacacgtc 3240 gcgggtgagt tcccttccaa agaggggatc ttccctgtgg cttgcagcga tggttatggc 3300 ggtctggtga ccactgaccc gaaaacggct gaccccgctt acgggaaagt gtttaacccc 3360 ccccgcaaca tgttgccggg gcggttcacc aattttcttg acgtggctga ggcgtgcccc 3420 acgtttctcc acttcgaggg tgacgtgcca tacgtgacca cgaagacgga ttcagacagg 3480 gtgctcgctc agttcgactt gtctttggca gcaaagcaca tgtcgaacac cttccttgca 3540 ggtctcgccc agtactacac acagtacagc ggcaccatca acctgcactt catgttcaca 3600 gggcctactg acgcgaaggc gcgttacatg attgcgtatg ctcctcctgg catggaacca 3660 cctaaaacgc cagaggcggc tgcccactgc attcatgctg aatgggacac agggttgaac 3720 tcaaaattca cattttcaat cccttacctt tcggcggctg attacgctta cacagcgtct 3780 gacactgctg agaccacaaa tgtacaggga tgggtttgcc tgtttcaaat aacacacggg 3840 aaagctgacg gcgacgcact ggtcgttttg gctagcgccg gaaaggactt tgagctgcgc 3900 ctgccggtgg atgctcgcac acagactacc tccgcgggcg agtcagctga ccccgtgacc 3960 gccaccgttg agaattacgg tggcgagaca caggtccaga ggcgccaaca cacggacgtc 4020 tcatttatat tagacagatt tgtgacagtg acaccaaaag accaaattaa tgtattggac 4080 ctgatgcaaa cccctgctca cactttggtg ggagcactcc ttcgtactgc cacttactat 4140 ttcgctgact tagaggtggc agtgaagcac aagggaaacc tcacctgggt cccgaacggg 4200 gcgcctgaag cggcgttgga caacaccacc aacccaacag cttaccacaa ggcaccactc 4260 acccgacttg cactgcctta cacggcgcca caccgcgtgt tggctactgt ttacaacggg 4320 aactgcaagt atggtgacgg cacggtggcc aatgtgagag gtgacctgca agtgttggcc 4380 cagaaggcgg cgagagcgct gcctacctcc ttcaactacg gtgccattaa agctactcgg 4440 gtgactgaac tgctttaccg catgaagagg gctgagacat actgcccccg gcctcttttg 4500 gccattcacc cggaccaggc tagacacaag cagaagattg tggcaccggt ggaacagctt 4560 ctaaattttg acctgctcaa attggcggga gatgtggagt ccaaccctgg gcccttcttc 4620 ttctccgacg tcaggtcaaa tttctcaaaa ctggtagaaa ccatcaatca gatgcaggag 4680 gacatgtcaa caaaacacgg gcctgacttt aaccggttgg tgtccgcatt tgaggaattg 4740 gccactggag tgaaggctat cagggccggt ctcgacgagg ccaaaccctg gtacaaactc 4800 atcaagctcc tgagccgctt gtcgtgcatg gccgctgtag cagcacggtc aaaggaccca 4860 gtccttgtgg ccatcatgct ggctgacacc ggtcttgaga ttctggacag cacctttgtc 4920 gtgaagaaga tctccgactc gctctccagt ctctttcacg tgccggcccc cgtcttcagt 4980 ttcggagccc cgattctgtt ggccgggttg gtcaaagtcg cctcgagttt cttccggtcc 5040 acacccgaag accttgagag agcagaaaaa cagctcaaag cacgtgacat taacgacata 5100 ttcgccattc tcaagaacgg cgagtggctg gtcaagctga tccttgccat ccgcgactgg 5160 atcaaagcgt ggatcgcctc agaagaaaag tttgtcacca tgacggactt ggtgcctggt 5220 atccttgaaa agcagcggga tctcaacgac ccgagtaagt acaaggaagc caaggagtgg 5280 ctcgacaacg cgcgccaggc gtgtttgaag agcgggaacg ttcacattgc caatttgtgc 5340 aaagtggtcg ccccggcacc cagcaagtcg agacccgaac ccgtggtcgt ttgcctccgc 5400 ggcaaatccg gccaggggaa gagtttcctt gcgaacgtgc tcgcgcaagc aatctccacc 5460 cacttcaccg gcagaactga ttcggtttgg tactgcccgc ctgaccctga ccacttcgac 5520 ggttacaacc agcagaccgt tgtcgtgatg gacgatttgg gccagaaccc cgatggcaag 5580 gacttcaagt acttcgccca gatggtttcg accacggggt tcatcccgcc catggcctcg 5640 cttgaggaca aaggcaagcc tttcaacagc aaagtcatca ttgctaccac caacctgtac 5700 tcgggtttca ccccgagaac aatggtgtgt cctgacgcgc tgaaccggag gttccacttt 5760 gacatcgacg tgagtgccaa ggacgggtac aaagttaaca acaaattgga cataatcaaa 5820 gctcttgaag acacccacac caacccagtg gcgatgttcc aatacgactg tgcccttcta 5880 aacggtatgg cagttgaaat gaagagaatg caacaggata tgttcaagcc tcaaccaccc 5940 ctccagaacg tgtaccaact cgttcacgag gtgattgaac gggtcgagct ccacgagaag 6000 gtgtcgagcc acccgatttt caaacagata tcaattcctt cccaaaagtc tgtgttgtac 6060 ttcctcattg agaaaggcca acacgaagca gcaattgaat tctttgaggg aatggtgcat 6120 gactccatca aggaagagct ccggcccctc atccaacaga cctcatttgt gaaacgcgct 6180 tttaagcgcc tgaaggaaaa ctttgagact gttgccctgt gtttgactct tttggcaaac 6240 atagtgatca tgatccgcga gactcgcaag agacaacaga tggtggacga tgcagtgaat 6300 gactacattg agaaggcaaa catcaccaca gatgacaaga ctcttgacga ggcggaaaag 6360 aaccctctag agaccagcgg tgccagcact attggtttca gagagagaac tctcccgggg 6420 cacaaggcga gcgatgacgt gagctccgag cccgccaaac ccgtggagga ccgaccacaa 6480 gctgaagggc cctacgccgg accacttgag cgtcagaaac ctctgagagt gaaaaccaag 6540 ttgccacaac aggagggacc ctacgctggc ccgatggata gacagaaacc gttgaaagtg 6600 agagcaagag ccccggtcgt gaaggaggga ccctacgagg gaccggtgaa gaagcctgtc 6660 gctttgaaag tgaaagccaa gaacttgatt gtcactgaga gtggtgcccc accgaccgac 6720 ttgcagaaga tggtcatggg caacactaag cctgttgagc tcatcctcga cgggaagacg 6780 gtagccatct gctgtgctac cggagtgttt ggcactgcct acctcgtacc tcgtcacctc 6840 ttcgcggaga agtacgacaa gataatgttg gacggtagag ccatgacaga cagtgactac 6900 agagtgtttg agtttgagat taaagtaaaa ggacaggaca tgctctcaga cgctgcactc 6960 atggtgcttc accgtgggaa ccgcgtgaga gacatcacga aacattttcg tgacacagca 7020 agaatgaaga aaggcacccc cgttgtcggt gtgatcaaca acgccgacgt tgggagactg 7080 attttctctg gagaggccct tacctacaaa gacattgtag tgtgcatgga tggagacacc 7140 atgccgggcc tgtttgccta cagagccgcc accaaggctg gttactgcgg gggagccgtt 7200 ctcgccaagg acggagccga cacattcatc gttggcaccc actccgcagg tggtaacgga 7260 gttggatact gctcgtgcgt gtccaggtcc atgctcctga aaatgaaggc acacattgac 7320 cctgaaccac accacgaggg gttgattgtt gataccagag atgtggaaga gcgcgtgcat 7380 gtcatgcgta aaaccaagct tgcacccacc gtggcacacg gtgtgtttaa ccctgaattt 7440 ggtcccgctg ccttgtccaa caaggacccg cggctgaacg aaggggttgt cctcgatgaa 7500 gtcatcttct ccaaacacaa gggagacacg aaaatgtctg aggaggacaa agcgctgttc 7560 cgccgctgcg ctgccgacta cgcgtcgcac ttgcacagcg tgctggggac ggcaaatgcc 7620 ccattgagca tctatgaggc catcaaaggc gtcgacgggc tcgatgccat ggagccggac 7680 accgcgcccg gcctcccctg ggccctccag gggaaacgcc gtggtgcgtt gattgacttc 7740 gagaacggca cggtcggacc cgaagtcgag gctgccctaa agctcatgga gaaaagagag 7800 tacaaatttg cttgccagac cttcctgaaa gacgagattc gtccgatgga aaaagtacgt 7860 gctggcaaga ctcgcattgt cgacgttttg cccgtggaac acattcttta caccaggatg 7920 atgattggca gattctgtgc tcaaatgcac acaaacaatg gaccgcagat tggctcagcg 7980 gtcggttgca atcctgatgt tgattggcaa agatttggca cacattttgc tcagtacaga 8040 aacgtgtggg atgtggacta ttcggccttt gatgctaacc actgcagtga cgcaatgaac 8100 atcatgtttg aggaggtatt tcgcacagac ttcggtttcc acccaaatgc tgagtggatt 8160 ctgaagactc ttgtgaacac ggagcacgcc tatgagaaca aacgtatcac tgttgagggc 8220 gggatgccgt ctggctgttc cgcgacaagc atcatcaaca caattttgaa caacatttat 8280 gtgctctacg ctcttcgtag acactatgag ggagttgagc tggacaccta caccatgatc 8340 tcctacggag atgacatcgt ggttgcaagt gactacgatc tggattttga ggctctcaaa 8400 ccccacttca aatctcttgg tcaaaccatc actccagctg acaaaagcga caaaggtttt 8460 gttcttggtc actccattac cgatgtcact ttcctcaaaa gacacttcca catggactat 8520 ggaactgggt tttacaaacc tgtgatggcc tcaaagaccc tcgaggccat tctctccttt 8580 gcacgccgtg ggaccataca ggagaagttg atctccgtgg caggactcgc cgtccactca 8640 ggacctgacg agtaccggcg tctctttgag cccttccagg gtctcttcga gattccaagc 8700 tacagatcac tttacctgcg ttgggtgaac gccgtgtgcg gtgacgcata atccctcaga 8760 tgtcacaatt ggcagaaaga ctctgaggcg agcgacgccg taggagtgaa aagcccgaaa 8820 gggcttttcc cgcttcctat tccaaaaaaa aaaaaaaaaa actagttcta gagcggccgc 8880 caccgcggtg gagctccagc ttttgttccc tttagtgagg gttaattgcg cgcttggcgt 8940 aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca 9000 tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat 9060 taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt 9120 aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct 9180 cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 9240 aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa 9300 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 9360 tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga 9420 caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc 9480 cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt 9540 ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct 9600 gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 9660 agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta 9720 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct 9780 acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 9840 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 9900 gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta 9960 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 10020 caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 10080 gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 10140 cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta 10200 cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 10260 caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg 10320 gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa 10380 gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt 10440 cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta 10500 catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 10560 gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta 10620 ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct 10680 gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg 10740 cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac 10800 tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact 10860 gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa 10920 atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt 10980 ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat 11040 gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccac 11097 <210> 2 <211> 25 <212> DNA <213> Forward Primer <400> 2 gacaagactc ttgacgaggc ggaaa 25 <210> 3 <211> 25 <212> DNA <213> Reverse Primer <400> 3 gtcattcact gcatcgtcca ccatc 25 <210> 4 <211> 25 <212> DNA <213> Forward Primer <400> 4 ttgaaagtga gagcaagagc cccgg 25 <210> 5 <211> 35 <212> DNA <213> Reverse Primer <400> 5 tgccactggt ttcttaagtg gtccggcgta gggcc 35 <210> 6 <211> 25 <212> DNA <213> Forward Primer <400> 6 ttgaaagtga gagcaagagc cccgg 25 <210> 7 <211> 35 <212> DNA <213> Reverse Primer <400> 7 tgccactggt ttcttaagtg gtccggcgta gggcc 35 <110> REPUBLIC OF KOREA (Management: Ministry for Food, Agriculture, Forestry and Fisheries.Animal, Plant and Fisheries Quarantine and Inspection Agency (QIA)) <120> Recombinant foot and mouth disease viruses using the vaccine strain, O manisa strain for protection of ME-SA topotype of O serotype <130> 9039 <160> 7 <170> Kopatentin 2.0 <210> 1 <211> 11097 <212> DNA <213> gene for O manisa of pO-Manisa <400> 1 ctaaattgta agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc 60 attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga 120 gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc 180 caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc 240 ctaatcaagt tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag 300 cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa 360 agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac 420 cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg 480 caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg 540 gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg 600 taaaacgacg gccagtgagc atatgtaata cgactcacta tagggttgaa agggggcgct 660 agggtctcac ccctagcatg ccaacgacag ctcctacgtc gcactccaca ctaacgtttg 720 tgtgcgcgcg ggaaccgatg gacttttgtt cacccaccta cagttggact cacggcaccg 780 cgtggccatt ttagctgggt tgtgcggacg aacactgctt gcgcatctcg cgtgaccggt 840 tagtactctt accactatcc gcctacttgg tcgttagcgc tgtcctgggc actcttgttg 900 ggggctgttc aacgctctac ggtctcccct gcgtaacaga ctacggtgtt ggggccgctt 960 cgtgcgagcc gatcgcttgg tgtgcctcgg ctgtcgcccg aagcccgcct ttcacccccc 1020 cccccccccc ccccctaggt tttaccgtcg ttcccgacgt taatggggaa acaaccacaa 1080 gcttaacacc gtcttgcccg acgtaaaagg gctgcaacca aaaagcttgt gccgcctttc 1140 ccggcgttaa tgggaggtaa ccacaagaca aaccttcacc cggaagtaaa acggcaactt 1200 cacacagttt tgcccgtttt cgtgagaaat gggccgtcaa cgcacgaaac gcgccgtcgc 1260 ttgaggagga cttgtacaaa cacgatctat gcaggtttcc acaactgaca caaaccgtgc 1320 aacttgaaac cccgcctggt ctttccaggt ctagaggggc gacattttgt actgtgcttg 1380 actccacgct cggtccacta gcgagtgtta gtagtagcac tgttgcttcg tagcggagca 1440 tgatggccgt gggagcttcc ccttggtaac aaggacccac ggggccaaaa gccacgtcct 1500 accggaccca tcatgtgtgc aaacccagca cggcaacttt actgcgaaaa ccactttaag 1560 gtgacactga tactggtact caatcactgg tgacaggcta aggatgccct tcaggtaccc 1620 cgaggtaaca cgcgacactc gggatctgag aaggggactg gggcttcttt aaaagtgccc 1680 agtttaaaaa gcttctatgc ctgaataggc gaccggaggc cggcgccttt tcactgtttt 1740 actactgttt tcatgaatac aactgactgt ttcaccgccc tgttacacgc tctcagagag 1800 atcaaaacac tgtttctttt acggacacaa ggaaagatgg aattcacact ttacaacggt 1860 gagaagaaaa ccttctactc cagacccaac aaccacgaca actgctggct taacaccatt 1920 ctccagttgt tcaggtatgt tgatgagcct ttctttgact gggtctacga ctcgcctgaa 1980 aacctcactc ttgaggcaat caaacagttg gaagagacaa ccggtcttga gctgcacgag 2040 ggtggaccac ccgctctcgt catctggaac atcaaacact tgcttcacac cggaatcggc 2100 actgcctcac gccctagcga ggtgtgtatg gtggacggaa cggacatgtg tttagctgat 2160 tttcatgctg gcattttcct gaaaggacag gaacatgctg tgttcgcctg tgtcacctcc 2220 aacgggtggt acgcgattga tgacgaggac ttttaccctt ggacaccgga cccgtccgac 2280 gttctggtgt ttgtcccgta cgatcaagaa ccgcttaacg gagagtggaa aacaaaggtc 2340 cagaaaaggc tcaagggagc cgggcaatcc agcccggcaa ccgggtcaca gaaccaatca 2400 ggcaacactg ggagcatcat caacaattac tacatgcagc agtaccaaaa ctccatggac 2460 acacaacttg gtgacaacgc tacaagcgga ggctcaaacg aggggtccac ggacacaacc 2520 tccacccaca caaccaacac tcagaacaac gactggttct cgaagctggc cagttccgct 2580 ttcagcggtc ttttcggcgc tcttctcgcc gacaagaaaa ccgaggagac cactcttctc 2640 gaggaccgca tcctcactac tcgtaacgga cacaccacct cgacaaccca gtcgagcgtt 2700 ggagtcacgt acgggtatgc aacagctgag gatttcgtga gcgggccaaa cacctctggt 2760 ctcgagacca gggttgccca ggcagagcgg ttctttaaaa cccacctgtt cgactgggtc 2820 accagtgacc cattcggacg gtgccacctg ctggaacttc caactgacca caaaggtgtc 2880 tacggcagcc tgaccgactc gtatgcttat atgaggaacg gctgggatgt tgaagtcact 2940 gcagtgggaa accagttcaa tggaggatgc ctgttggtgg ccatggtgcc agaactttgc 3000 tccatacaga agagggagct gtaccagctc acgctctttc ctcaccagtt catcaaccct 3060 cggacgaaca tgacagcaca catcactgtg ccctttgttg gcgtcaaccg ttatgaccag 3120 tacaaggtac acaaaccttg gaccctcgtg gttatggttg tagcccccct gactgtcaac 3180 agtgaaggtg ccccgcaaat caaggtgtat gccaacatcg cacctaccaa cgtacacgtc 3240 gcgggtgagt tcccttccaa agaggggatc ttccctgtgg cttgcagcga tggttatggc 3300 ggtctggtga ccactgaccc gaaaacggct gaccccgctt acgggaaagt gtttaacccc 3360 ccccgcaaca tgttgccggg gcggttcacc aattttcttg acgtggctga ggcgtgcccc 3420 acgtttctcc acttcgaggg tgacgtgcca tacgtgacca cgaagacgga ttcagacagg 3480 gtgctcgctc agttcgactt gtctttggca gcaaagcaca tgtcgaacac cttccttgca 3540 ggtctcgccc agtactacac acagtacagc ggcaccatca acctgcactt catgttcaca 3600 gggcctactg acgcgaaggc gcgttacatg attgcgtatg ctcctcctgg catggaacca 3660 cctaaaacgc cagaggcggc tgcccactgc attcatgctg aatgggacac agggttgaac 3720 tcaaaattca cattttcaat cccttacctt tcggcggctg attacgctta cacagcgtct 3780 gacactgctg agaccacaaa tgtacaggga tgggtttgcc tgtttcaaat aacacacggg 3840 aaagctgacg gcgacgcact ggtcgttttg gctagcgccg gaaaggactt tgagctgcgc 3900 ctgccggtgg atgctcgcac acagactacc tccgcgggcg agtcagctga ccccgtgacc 3960 gccaccgttg agaattacgg tggcgagaca caggtccaga ggcgccaaca cacggacgtc 4020 tcatttatat tagacagatt tgtgacagtg acaccaaaag accaaattaa tgtattggac 4080 ctgatgcaaa cccctgctca cactttggtg ggagcactcc ttcgtactgc cacttactat 4140 ttcgctgact tagaggtggc agtgaagcac aagggaaacc tcacctgggt cccgaacggg 4200 gcgcctgaag cggcgttgga caacaccacc aacccaacy cttaccacaa ggcaccactc 4260 acccgacttg cactgcctta cacggcgcca caccgcgtgt tggctactgt ttacaacggg 4320 aactgcaagt atggtgacgg cacggtggcc aatgtgagag gtgacctgca agtgttggcc 4380 cagaaggcgg cgagagcgct gcctacctcc ttcaactacg gtgccattaa agctactcgg 4440 gtgactgaac tgctttaccg catgaagagg gctgagacat actgcccccg gcctcttttg 4500 gccattcacc cggaccaggc tagacacaag cagaagattg tggcaccggt ggaacagctt 4560 ctaaattttg acctgctcaa attggcggga gatgtggagt ccaaccctgg gcccttcttc 4620 ttctccgacg tcaggtcaaa tttctcaaaa ctggtagaaa ccatcaatca gatgcaggag 4680 gacatgtcaa caaaacacgg gcctgacttt aaccggttgg tgtccgcatt tgaggaattg 4740 gccactggag tgaaggctat cagggccggt ctcgacgagg ccaaaccctg gtacaaactc 4800 atcaagctcc tgagccgctt gtcgtgcatg gccgctgtag cagcacggtc aaaggaccca 4860 gtccttgtgg ccatcatgct ggctgacacc ggtcttgaga ttctggacag cacctttgtc 4920 gtgaagaaga tctccgactc gctctccagt ctctttcacg tgccggcccc cgtcttcagt 4980 ttcggagccc cgattctgtt ggccgggttg gtcaaagtcg cctcgagttt cttccggtcc 5040 acacccgaag accttgagag agcagaaaaa cagctcaaag cacgtgacat taacgacata 5100 ttcgccattc tcaagaacgg cgagtggctg gtcaagctga tccttgccat ccgcgactgg 5160 atcaaagcgt ggatcgcctc agaagaaaag tttgtcacca tgacggactt ggtgcctggt 5220 atccttgaaa agcagcggga tctcaacgac ccgagtaagt acaaggaagc caaggagtgg 5280 ctcgacaacg cgcgccaggc gtgtttgaag agcgggaacg ttcacattgc caatttgtgc 5340 aaagtggtcg ccccggcacc cagcaagtcg agacccgaac ccgtggtcgt ttgcctccgc 5400 ggcaaatccg gccaggggaa gagtttcctt gcgaacgtgc tcgcgcaagc aatctccacc 5460 cacttcaccg gcagaactga ttcggtttgg tactgcccgc ctgaccctga ccacttcgac 5520 ggttacaacc agcagaccgt tgtcgtgatg gacgatttgg gccagaaccc cgatggcaag 5580 gacttcaagt acttcgccca gatggtttcg accacggggt tcatcccgcc catggcctcg 5640 cttgaggaca aaggcaagcc tttcaacagc aaagtcatca ttgctaccac caacctgtac 5700 tcgggtttca ccccgagaac aatggtgtgt cctgacgcgc tgaaccggag gttccacttt 5760 gacatcgacg tgagtgccaa ggacgggtac aaagttaaca acaaattgga cataatcaaa 5820 gctcttgaag acacccacac caacccagtg gcgatgttcc aatacgactg tgcccttcta 5880 aacggtatgg cagttgaaat gaagagaatg caacaggata tgttcaagcc tcaaccaccc 5940 ctccagaacg tgtaccaact cgttcacgag gtgattgaac gggtcgagct ccacgagaag 6000 gtgtcgagcc acccgatttt caaacagata tcaattcctt cccaaaagtc tgtgttgtac 6060 ttcctcattg agaaaggcca acacgaagca gcaattgaat tctttgaggg aatggtgcat 6120 gactccatca aggaagagct ccggcccctc atccaacaga cctcatttgt gaaacgcgct 6180 tttaagcgcc tgaaggaaaa ctttgagact gttgccctgt gtttgactct tttggcaaac 6240 atagtgatca tgatccgcga gactcgcaag agacaacaga tggtggacga tgcagtgaat 6300 gactacattg agaaggcaaa catcaccaca gatgacaaga ctcttgacga ggcggaaaag 6360 aaccctctag agaccagcgg tgccagcact attggtttca gagagagaac tctcccgggg 6420 cacaaggcga gcgatgacgt gagctccgag cccgccaaac ccgtggagga ccgaccacaa 6480 gctgaagggc cctacgccgg accacttgag cgtcagaaac ctctgagagt gaaaaccaag 6540 ttgccacaac aggagggacc ctacgctggc ccgatggata gacagaaacc gttgaaagtg 6600 agagcaagag ccccggtcgt gaaggaggga ccctacgagg gaccggtgaa gaagcctgtc 6660 gctttgaaag tgaaagccaa gaacttgatt gtcactgaga gtggtgcccc accgaccgac 6720 ttgcagaaga tggtcatggg caacactaag cctgttgagc tcatcctcga cgggaagacg 6780 gtagccatct gctgtgctac cggagtgttt ggcactgcct acctcgtacc tcgtcacctc 6840 ttcgcggaga agtacgacaa gataatgttg gacggtagag ccatgacaga cagtgactac 6900 agagtgtttg agtttgagat taaagtaaaa ggacaggaca tgctctcaga cgctgcactc 6960 atggtgcttc accgtgggaa ccgcgtgaga gacatcacga aacattttcg tgacacagca 7020 agaatgaaga aaggcacccc cgttgtcggt gtgatcaaca acgccgacgt tgggagactg 7080 attttctctg gagaggccct tacctacaaa gacattgtag tgtgcatgga tggagacacc 7140 atgccgggcc tgtttgccta cagagccgcc accaaggctg gttactgcgg gggagccgtt 7200 ctcgccaagg acggagccga cacattcatc gttggcaccc actccgcagg tggtaacgga 7260 gttggatact gctcgtgcgt gtccaggtcc atgctcctga aaatgaaggc acacattgac 7320 cctgaaccac accacgaggg gttgattgtt gataccagag atgtggaaga gcgcgtgcat 7380 gtcatgcgta aaaccaagct tgcacccacc gtggcacacg gtgtgtttaa ccctgaattt 7440 ggtcccgctg ccttgtccaa caaggacccg cggctgaacg aaggggttgt cctcgatgaa 7500 gtcatcttct ccaaacacaa gggagacacg aaaatgtctg aggaggacaa agcgctgttc 7560 cgccgctgcg ctgccgacta cgcgtcgcac ttgcacagcg tgctggggac ggcaaatgcc 7620 ccattgagca tctatgaggc catcaaaggc gtcgacgggc tcgatgccat ggagccggac 7680 accgcgcccg gcctcccctg ggccctccag gggaaacgcc gtggtgcgtt gattgacttc 7740 ggaacggca cggtcggacc cgaagtcgag gctgccctaa agctcatgga gaaaagagag 7800 tacaaatttg cttgccagac cttcctgaaa gacgagattc gtccgatgga aaaagtacgt 7860 gctggcaaga ctcgcattgt cgacgttttg cccgtggaac acattcttta caccaggatg 7920 atgattggca gattctgtgc tcaaatgcac acaaacaatg gaccgcagat tggctcagcg 7980 gtcggttgca atcctgatgt tgattggcaa agatttggca cacattttgc tcagtacaga 8040 aacgtgtggg atgtggacta ttcggccttt gatgctaacc actgcagtga cgcaatgaac 8100 atcatgtttg aggaggtatt tcgcacagac ttcggtttcc acccaaatgc tgagtggatt 8160 ctgaagactc ttgtgaacac ggagcacgcc tatgagaaca aacgtatcac tgttgagggc 8220 gggatgccgt ctggctgttc cgcgacaagc atcatcaaca caattttgaa caacatttat 8280 gtgctctacg ctcttcgtag acactatgag ggagttgagc tggacaccta caccatgatc 8340 tcctacggag atgacatcgt ggttgcaagt gactacgatc tggattttga ggctctcaaa 8400 ccccacttca aatctcttgg tcaaaccatc actccagctg acaaaagcga caaaggtttt 8460 gtctctggtc actccattac cgatgtcact ttcctcaaaa gacacttcca catggactat 8520 ggaactgggt tttacaaacc tgtgatggcc tcaaagaccc tcgaggccat tctctccttt 8580 gcacgccgtg ggaccataca ggagaagttg atctccgtgg caggactcgc cgtccactca 8640 ggacctgacg agtaccggcg tctctttgag cccttccagg gtctcttcga gattccaagc 8700 tacagatcac tttacctgcg ttgggtgaac gccgtgtgcg gtgacgcata atccctcaga 8760 tgtcacaatt ggcagaaaga ctctgaggcg agcgacgccg taggagtgaa aagcccgaaa 8820 gggcttttcc cgcttcctat tccaaaaaaa aaaaaaaaaa actagttcta gagcggccgc 8880 caccgcggtg gagctccagc ttttgttccc tttagtgagg gttaattgcg cgcttggcgt 8940 aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca 9000 tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat 9060 taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt 9120 aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct 9180 cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 9240 aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa 9300 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 9360 tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga 9420 caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc 9480 cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt 9540 ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct 9600 gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 9660 agtccaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta 9720 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct 9780 acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 9840 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 9900 gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta 9960 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 10020 caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 10080 gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 10140 cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta 10200 cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 10260 caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg 10320 gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa 10380 gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt 10440 cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta 10500 catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 10560 gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta 10620 ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct 10680 gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg 10740 cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac 10800 tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact 10860 gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa 10920 atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt 10980 ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat 11040 gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccac 11097 <210> 2 <211> 25 <212> DNA <213> Forward Primer <400> 2 gacaagactc ttgacgaggc ggaaa 25 <210> 3 <211> 25 <212> DNA <213> Reverse Primer <400> 3 gtcattcact gcatcgtcca ccatc 25 <210> 4 <211> 25 <212> DNA <213> Forward Primer <400> 4 ttgaaagtga gagcaagagc cccgg 25 <210> 5 <211> 35 <212> DNA <213> Reverse Primer <400> 5 tgccactggt ttcttaagtg gtccggcgta gggcc 35 <210> 6 <211> 25 <212> DNA <213> Forward Primer <400> 6 ttgaaagtga gagcaagagc cccgg 25 <210> 7 <211> 35 <212> DNA <213> Reverse Primer <400> 7 tgccactggt ttcttaagtg gtccggcgta gggcc 35
Claims (18)
구제역 O형 백신주 Manisa의 전체 유전자 부위 중에서 3A 부위 일부를 결실시켜 얻은 플라즈미드(pO-manisa-3Ad)를 포함하는 것을 특징으로 하는 구제역 백신 바이러스.The method according to claim 1,
(PO-manisa-3Ad) obtained by deletion of part of the 3A region in the entire gene region of the foot-and-mouth disease type O vaccine strain Manisa.
유전자 3A 부위 중에서 결실 부위는 277∼306bp 부위인 것을 특징으로 하는 구제역 백신 바이러스.3. The method of claim 2,
Wherein the deletion site in the gene 3A region is a 277 to 306 bp region.
구제역 O형 백신주 Manisa의 전체 유전자 부위 중에서 3B1 부위, 3B2 부위 및 3B3 부위로 구성된 3B 부위에서 3B1 부위 일부를 치환시키고, 3B 부위 일부를 결실시켜 얻은 플라즈미드(pO-manisa-3B2d)를 포함하는 것을 특징으로 하는 구제역 백신 바이러스.The method according to claim 1,
(PO-manisa-3B2d) obtained by replacing part of the 3B1 part in the 3B part consisting of the 3B1 part, 3B2 part and 3B3 part and deletion of part of the 3B part in the entire genetic part of foot-and-mouth disease type O vaccine Manisa Foot-and-mouth disease vaccine virus.
유전자 3B1 부위 중에서 치환 부위는 22∼36bp 부위이고, 유전자 3B2 부위 중에서 결실 부위는 37∼105bp인 것을 특징으로 하는 구제역 백신 바이러스.5. The method of claim 4,
Wherein the substitution site in the 3B1 region of the gene is 22 to 36 bp, and the deletion site in the 3B2 region of the gene is 37 to 105 bp.
구제역 O형 백신주 Manisa의 전체 유전자 부위 중에서 3A 부위 일부의 결실과 3B1 부위, 3B2 부위 및 3B3 부위로 구성된 3B 부위 중에서 3B1 부위 일부를 치환 또는 3B2 부위 일부를 결실시켜 얻은 플라즈미드(pO-manisa-3AB2d)로부터 작성된 구제역 백신 바이러스.The method according to claim 1,
(PO-manisa-3AB2d) obtained by deletion of part of the 3A region and deletion of part of the 3B1 region or deletion of part of the 3B2 region from the 3B region composed of the 3B1 region, 3B2 region and 3B3 region in the whole gene region of foot-and-mouth disease type O vaccine strain Manisa Foot-and-mouth disease virus.
유전자 3A 부위 중에서 결실 부위는 277∼306bp이고, 유전자 3B1 부위 중에서 치환 부위는 22∼36bp, 3B2 부위 중에서 결실 부위는 37∼105bp인 것을 특징으로 하는 구제역 백신 바이러스.The method according to claim 6,
Wherein the deleted region of the gene 3A region is 277 to 306 bp, the substitution region of the gene 3B1 region is 22 to 36 bp, and the deletion region of the 3B2 region is 37 to 105 bp.
(2)상기의 플라스미드의 구제역 O형 백신주 Manisa의 전체 유전자 중에서 일부 유전자 부위를 결실(deletion) 또는 치환(substitution)시키는 단계;
(3)상기 (2)단계에서 얻은 일부 유전자가 결실 또는 치환된 플라스미드를 세포에 주입하여 증식시키는 단계를 포함하는 것을 특징으로 하는 구제역 바이러스 O Manisa를 이용한 재조합 구제역 백신 바이러스의 제조방법.(1) inserting a whole gene of foot-and-mouth disease type O vaccine strain Manisa into a plasmid;
(2) deletion or substitution of some genes in the whole genes of the foot-and-mouth disease type O vaccine strain Manisa of the plasmid;
(3) a step of infecting the cells with a plasmid in which some of the genes obtained in the step (2) are deleted or substituted for propagation; and a step of propagating the recombinant foot-pupil vaccine virus using O Manisa.
플라스미드의 구제역 O형 백신주 Manisa의 전체 유전자 중에서 3A 부위를 결실시키는 것을 특징으로 하는 재조합 구제역 백신 바이러스의 제조방법.9. The method of claim 8,
A method for producing recombinant foot-and mouth disease vaccine virus characterized by deletion of the 3A region in the entire genes of the foot-and-mouth disease type O vaccine strain Manisa of the plasmid.
유전자 3A 부위 중에서 결실 부위는 277∼306bp인 것을 특징으로 하는 구제역 백신 바이러스의 제조방법.10. The method of claim 9,
Wherein the deleted region of the gene 3A region is 277 to 306 bp.
유전자 3A 부위의 결실은 서열번호 2의 포워드 프라이머(Forwarf Primer) 및 서열번호 3의 리버스 프라이머(Reverse Primer)를 이용한 PCR에 의해 실시하는 하는 것을 특징으로 하는 구제역 백신 바이러스의 제조방법.10. The method of claim 9,
Wherein the deletion of the gene 3A region is carried out by PCR using a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 3.
플라스미드의 구제역 O형 백신주 Manisa의 전체 유전자 중에서 3B1 부위, 3B2 부위 및 3B3 부위로 구성된 3B 부위 중 3B1 부위 일부를 치환 또는 3B2 부위 일부를 결실시키는 것을 특징으로 하는 구제역 백신 바이러스의 제조방법.9. The method of claim 8,
Wherein part of the 3B1 part of the 3B part consisting of the 3B1 part, 3B2 part and 3B3 part is substituted or part of the 3B2 part is deleted in the whole genes of the foot-and-mouth disease type O vaccine strain Manisa of the plasmid.
유전자 3B1 부위 중에서 치환 부위는 22∼36bp, 3B2 부위 일부 중에서 결실 부위는 37∼105bp인 것을 특징으로 하는 구제역 백신 바이러스의 제조방법.13. The method of claim 12,
Wherein the substitution site in the 3B1 region of the gene is 22 to 36 bp, and the deletion site in the 3B2 region is 37 to 105 bp.
유전자 3B 부위의 치환 또는 결실은 서열번호 4의 포워드 프라이머(Forwarf Primer) 및 서열번호 5의 리버스 프라이머(Reverse Primer)를 이용한 PCR에 의해 실시하는 하는 것을 특징으로 하는 구제역 백신 바이러스의 제조방법.13. The method of claim 12,
Wherein substitution or deletion of the 3B region of the gene is carried out by PCR using a forward primer of SEQ ID NO: 4 and a reverse primer of SEQ ID NO: 5.
구제역 O형 백신주 Manisa의 전체 유전자 부위 중에서 3A 부위 일부와 3B1 부위, 3B2 부위 및 3B3 부위로 구성된 3B 부위 중 3B1 부위 일부를 치환 또는 3B2 부위 일부를 결실시키는 것을 특징으로 하는 구제역 백신 바이러스의 제조방법.9. The method of claim 8,
Wherein part of the 3A region and part of the 3B1 region of the 3B region consisting of the 3B1 region, 3B2 region and 3B3 region are substituted or part of the 3B2 region is deleted in the whole genetic region of the foot-and-mouth disease type O vaccinia Manisa.
유전자 3A 부위 중에서 결실 부위는 277∼306bp이고, 유전자 3B1 부위 일부 중에서 치환 부위는 22∼36bp, 3B2 부위 일부의 결실 부위는 37∼105bp인 것을 특징으로 하는 구제역 백신 바이러스.16. The method of claim 15,
Wherein the deletion region of the gene 3A region is 277 to 306 bp, the substitution region of the gene 3B1 region is 22 to 36 bp, and the deletion region of the 3B2 region is 37 to 105 bp.
3A 부위 일부의 결실과 3B 부위 일부의 치환 또는 결실은 서열번호 6의 포워드 프라이머(Forwarf Primer) 및 서열번호 7의 리버스 프라이머(Reverse Primer)를 이용한 PCR에 의해 실시하는 하는 것을 특징으로 하는 구제역 백신 바이러스의 제조방법.16. The method of claim 15,
Deletion of a part of the 3A region and substitution or deletion of a part of the 3B region are carried out by PCR using a forward primer of SEQ ID NO: 6 and a reverse primer of SEQ ID NO: 7. ≪ / RTI >
세포는 염소 태아 혀 세포(ZZ-R) 및 어린 햄스터 신장 세포(BHK21) 중에서 선택된 어느 하나 이상인 것을 특징으로 하는 구제역 백신 바이러스의 제조방법.9. The method of claim 8,
Wherein the cell is at least one selected from the group consisting of a fetal tongue cell (ZZ-R) and a young hamster kidney cell (BHK21).
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020120152084A KR101535555B1 (en) | 2012-12-24 | 2012-12-24 | Recombinant foot and mouth disease viruses using the vaccine strain, O manisa strain for protection of ME-SA topotype of O serotyp |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020120152084A KR101535555B1 (en) | 2012-12-24 | 2012-12-24 | Recombinant foot and mouth disease viruses using the vaccine strain, O manisa strain for protection of ME-SA topotype of O serotyp |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20140083129A true KR20140083129A (en) | 2014-07-04 |
KR101535555B1 KR101535555B1 (en) | 2015-07-10 |
Family
ID=51733607
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020120152084A KR101535555B1 (en) | 2012-12-24 | 2012-12-24 | Recombinant foot and mouth disease viruses using the vaccine strain, O manisa strain for protection of ME-SA topotype of O serotyp |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101535555B1 (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20200134637A (en) * | 2019-05-23 | 2020-12-02 | 대한민국(농림축산식품부 농림축산검역본부장) | Recombinant viruses expressing the foot-and-mouth disease type A protective antigen which inserted long term immunity enhancing gene, and a vaccine composition comprising the same |
KR20210012696A (en) | 2019-07-26 | 2021-02-03 | 대한민국(농림축산식품부 농림축산검역본부장) | Suspension Cell Culture Adapted Vaccine Strain Derived from Foot-and-mouth disease virus of O/ME-SA/Ind-2001 Lineage and the Viral Vaccine Composition Containing the Same |
KR20210012695A (en) | 2019-07-26 | 2021-02-03 | 대한민국(농림축산식품부 농림축산검역본부장) | Suspension Cell Culture Adapted Vaccine Strain Derived from Foot-and-mouth disease virus of A/ASIA/Sea-97 Lineage and the Viral Vaccine Composition Containing the Same |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101891602B1 (en) * | 2017-03-24 | 2018-09-28 | 대한민국 | Recombinant foot-and-mouth disease virus expressing protective antigen of type O, SEA and ME-SA topotype |
KR101891607B1 (en) * | 2017-03-24 | 2018-08-24 | 대한민국 | Recombinant foot-and-mouth disease virus expressing stable and differential protective antigen of Asian isolates and standard strains |
KR101891603B1 (en) | 2017-03-24 | 2018-08-24 | 대한민국 | Recombinant foot-and-mouth disease virus expressing protective antigen of type A, Korean and standard strains |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5824316A (en) * | 1996-05-24 | 1998-10-20 | The United States Of America As Represented By The Secretary Of Agriculture | Leader-proteinase deleted foot-and-mouth disease viruses and their use as vaccines |
KR100536848B1 (en) * | 2004-02-19 | 2005-12-19 | 대한민국 | Kit for Diagnosis of Foot-and-Mouth Disease Containing Peptide of 2C and 3B Nonstructural Protein of Foot-and-Mouth Disease Virus |
WO2006063445A1 (en) * | 2004-12-14 | 2006-06-22 | Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Health | Recombinant foot and mouth disease vaccine |
WO2011054011A2 (en) * | 2009-11-02 | 2011-05-05 | The Trustees Of The University Of Pennsylvania | Foot and mouth disease virus (fmdv) consensus proteins, coding sequences therefor and vaccines made therefrom |
-
2012
- 2012-12-24 KR KR1020120152084A patent/KR101535555B1/en active IP Right Grant
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20200134637A (en) * | 2019-05-23 | 2020-12-02 | 대한민국(농림축산식품부 농림축산검역본부장) | Recombinant viruses expressing the foot-and-mouth disease type A protective antigen which inserted long term immunity enhancing gene, and a vaccine composition comprising the same |
KR20210012696A (en) | 2019-07-26 | 2021-02-03 | 대한민국(농림축산식품부 농림축산검역본부장) | Suspension Cell Culture Adapted Vaccine Strain Derived from Foot-and-mouth disease virus of O/ME-SA/Ind-2001 Lineage and the Viral Vaccine Composition Containing the Same |
KR20210012695A (en) | 2019-07-26 | 2021-02-03 | 대한민국(농림축산식품부 농림축산검역본부장) | Suspension Cell Culture Adapted Vaccine Strain Derived from Foot-and-mouth disease virus of A/ASIA/Sea-97 Lineage and the Viral Vaccine Composition Containing the Same |
KR20210055667A (en) | 2019-07-26 | 2021-05-17 | 대한민국(농림축산식품부 농림축산검역본부장) | Suspension Cell Culture Adapted Vaccine Strain Derived from Foot-and-mouth disease virus of A/ASIA/Sea-97 Lineage and Method of Preparing the Same |
KR20210055668A (en) | 2019-07-26 | 2021-05-17 | 대한민국(농림축산식품부 농림축산검역본부장) | Suspension Cell Culture Adapted Vaccine Strain Derived from Foot-and-mouth disease virus of O/ME-SA/Ind-2001 Lineage and Method of Preparing the Same |
Also Published As
Publication number | Publication date |
---|---|
KR101535555B1 (en) | 2015-07-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109021111B (en) | Gene base editor | |
KR101535555B1 (en) | Recombinant foot and mouth disease viruses using the vaccine strain, O manisa strain for protection of ME-SA topotype of O serotyp | |
CN107686848A (en) | The stable of transposons collaboration CRISPR/Cas9 systems knocks out single plasmid vector and its application | |
US20240117335A1 (en) | Fusion proteins for base editing | |
CN110079551A (en) | A kind of circular rna expression vector and its construction method and application | |
CN109735480A (en) | A kind of recombined bacillus subtilis synthesizing the new tetrose of lactoyl-N- and its construction method and application | |
CN111607614A (en) | Construction method and application of CD45-DTR transgenic mouse for regulating and eliminating immune cells by diphtheria toxin | |
CN111149730B (en) | Method for rapidly cultivating homozygous individuals of pluripotent stem cell fluorescence-labeled zebra fish | |
CN115044614B (en) | Modified vector of AAV-8 serotype for gene targeting and expression, construction method and application thereof | |
KR101578441B1 (en) | Foot-and-mouth disease virus expressing P1-protective antigen of O-PanAsia-2 strain and the manufacturing methods | |
CN100366747C (en) | Interference RNA miniplasmid of hypoxia induction factor | |
KR102009268B1 (en) | Recombinant foot-and-mouth disease virus expressing protective antigen of type C3 Resende | |
CN113789348B (en) | Mouse animal model with APEX2 gene knock-in, construction method and application thereof | |
CN110257403B (en) | Infectious laryngotracheitis virus gB gene expression, recombinant fowlpox virus thereof, construction method and application | |
KR101578425B1 (en) | Foot-and-mouth disease virus expressing P1-protective antigen of SAT1-WZ topotype and the manufacturing methods | |
CN110042117B (en) | Construction method and application of Toxoplasma gondii alpha amylase gene knock-out strain | |
KR101891607B1 (en) | Recombinant foot-and-mouth disease virus expressing stable and differential protective antigen of Asian isolates and standard strains | |
CN111110707A (en) | Application of recombinant oncolytic virus in preparation of medicine for treating digestive tract tumor | |
KR101546810B1 (en) | Foot-and-mouth disease recombinant virus expressing P1-protective antigen of O serotype-SEA topotype, and the viral vaccine comprising the same | |
CN101517076B (en) | Genetic remodeling in bifidobacterium | |
CN103952407A (en) | GAL1 promoter relieving glucose inhibiting effect and application thereof | |
KR102623115B1 (en) | Novel foot-and-mouth disease Asia1 recombinant virus and foot-and-mouth disease vaccine composition comprising the same | |
CN113880957A (en) | Streptolysin O fusion protein | |
KR101898214B1 (en) | A recombinant vector comprising MYH1 gene and use thereof | |
CN112410344B (en) | CpG-ODN with specific immunostimulation effect on PRRSV and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E90F | Notification of reason for final refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |