KR20140068635A - Single nucleotide polymorphism markers for identifying origin place of short-necked clams and method for identifying short-necked clams by using the same - Google Patents

Abstract

Provided in the present invention are single nucleotide polymorphism marker comprising a specific single nucleotide polymorphism (SNP) part identifying the origin place of a short-necked clam, primers of the markers, and a method for identifying the origin place of a short-necked clam using the same. The present invention has advantages of preventing illegal acts in markets, increasing benefits and health of domestic consumers, and preventing an ecosystem from being disturbed, by providing a measure which rapidly and precisely block the import, distribution and sales by disguising a Chinese short-necked clam as a Korean short-necked clam.

Description

[0001] The present invention relates to single nucleotide polymorphism markers for discriminating the origin of clams and for identifying clams using the same.

The present invention relates to single base polymorphic markers comprising a specific single nucleotide polymorphism (SNP) site capable of discriminating the origin of a clam, the primers for these markers and a method for determining the origin of clams using them.

More particularly, the present invention relates to single base polymorphic markers comprising specific SNP sites useful for determining the origin of clams and primers for these markers, and (a) amplifying a single base polymorphic marker and (b) The present invention relates to a method for discriminating the origin of clam, which comprises the step of analyzing the genotype of the SNP region of Korean clam, and the method of discriminating the origin of clam, It can be widely used to overcome.

The shellfish belongs to the Veneridae, and its scientific name is Ruditapes philippinarum , a small shellfish that lives in the Pacific coast from South Siberia to China. Clam is cultivated or harvested in East Asian countries including Korea, China and Japan and is widely used for food. In Korea, it mainly lives on the coastal waters of the west coast and the southern coast. Especially, it is one of the most important cultivars in the west coast tidal flats. However, the production of clams is decreasing due to the decrease of habitat due to coastal reclamation landfill and mass mortality.

     As a result, a variety of illegal activities are appearing, such as the importation of inexpensive Chinese clam shellfish seeds into the coastal areas of the country, or trickery of Chinese clam shellfish as domestic products. Therefore, through such illegal activities, some importers, distributors, and restaurants have also used the difference in price between domestic and Chinese to take unfair advantage from consumers.

In view of the above, the technical field to which the present invention belongs is to minimize the damage caused by the illegal acts as described above, and to minimize the ecological disturbance of the clam group which can appear due to the gene-flow through illegal spraying It is urgently necessary to provide technology to distinguish the origin of Korean clam and the origin of clam.

Therefore, the inventors of the present invention have conducted intensive studies to develop a method for discriminating the origin of clam, and as a result, found that a continuous nucleotide sequence (contig) and a single nucleotide polymorphism (SNP), which are useful for discriminating the origin of clams from an EST (Expressed Sequence Tag) ) Sites are selected and a pair of primers capable of amplifying a marker including all or part of the contiguous nucleotide sequence (contig) is prepared, and then (a) a single base polymorphic marker containing the SNP region And (b) analyzing the genotype of the SNP region of the marker. Thus, the present invention has been successfully accomplished by providing a method for effectively discriminating the origin of cloverleaf.

Korean Patent Publication No. 10-2004-0044740 (May 31, 2004) Korean Patent Publication No. 10-2011-0106172 (September 28, 2011) Korean Patent Publication No. 10-2011-0042734 (Apr. 27, 2011) Korean Patent Publication No. 10-2011-0077174 (July 7, 2011)

It is an object of the present invention to provide a method for determining single base polymorphism markers comprising a specific single nucleotide polymorphism (SNP) site capable of discriminating origin of clams, primers for these markers and origin of clams using them .

In order to achieve the above object, the present invention provides a polynucleotide encoding a single base polymorphism (hereinafter referred to as " polymorphism ") capable of discriminating the origin of clam, including all or part of each of the nucleotide sequences of SEQ ID NOS: Provide markers.

It is another object of the present invention to provide a method for determining the origin of clam along with (a) amplifying the single nucleotide polymorphism marker and (b) analyzing the genotype of the SNP region of the marker.

In addition, it is an object of the present invention to provide primer pairs capable of amplifying single base polymorphic markers each comprising the SNP region.

In order to accomplish the above object, the present invention provides single base polymorphism markers including a specific single nucleotide polymorphism (SNP) site capable of discriminating the origin of clams. Specifically, the present invention provides single base polymorphism markers capable of discriminating the origin of the clam, including all or part of contiguous nucleotide sequences contigs having the respective nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 11.

In addition, the present invention provides a pair of primers capable of amplifying the SNP marker. For reference, the SNP site described in the specification of the present invention is numbered based on the 5 'position of the forward primer sequence with respect to the SNP marker. This is because the lengths of contiguous sequences having the nucleotide sequences of SEQ ID NOS: 1 to 11 are too long to identify the SNP region based on the entire contiguous nucleotide sequence (contigs) For convenience, it is noted that the SNP site is numbered based on the 5 'position of the forward primer in each successive nucleotide sequence.

Specifically, the present invention provides a single base polymorphism marker comprising a single base polymorphism marker KRph 18421 of SEQ ID NO: 1, a single base polymorphism marker KRph 20768 of SEQ ID NO: 2, a single base polymorphism marker KRph 27135 of SEQ ID NO: 3, The nucleotide polymorphism marker KRph 29263, the single nucleotide polymorphism marker KRph 29658 of SEQ ID NO: 5, the single nucleotide polymorphism marker KRph 31762 of SEQ ID NO: 6, the single nucleotide polymorphism marker KRph 32035 of SEQ ID NO: 7, the single nucleotide polymorphism marker KRph 32296 of SEQ ID NO: At least one marker selected from the group consisting of the single base polymorphism marker KRph 37987 of SEQ ID NO: 9, the single base polymorphism marker KRph 41628 of SEQ ID NO: 10, and the single base polymorphism marker KRph 5948 of SEQ ID NO: 11 Reference).

As shown in FIGS. 2A to 2K, a forward primer and a reverse primer pair for each single nucleotide polymorphic marker capable of discriminating the origin of the clover of the present invention are indicated as underlined in square brackets and a single nucleotide polymorphism (SNP) Is indicated as red "N ".

The single nucleotide polymorphism marker of the present invention may further comprise a nucleotide sequence selected from the group consisting of nucleotides 139, 140, 152, 180, 182, 186, 194, 196 and 199 of SEQ ID NO: 1, nucleotide 147 of SEQ ID NO: The base of SEQ ID NO: 3, the base of SEQ ID NO: 4, the base of nucleotides 143, 190 and 205 of SEQ ID NO: 4, base 245 of SEQ ID NO: 5, base 184 of SEQ ID NO: 6, base 227 of SEQ ID NO: 7, At least one single nucleotide polymorphism (SNP) site selected from the group consisting of base # 207, base # 159 of SEQ ID NO: 9, base # 148 of SEQ ID NO: 10 and base # 164 of SEQ ID NO: 11.

Specifically, in the present invention, the single base polymorphism marker KRph 18421 of SEQ ID NO: 1 has SNP sites at one or more of positions 139, 140, 152, 180, 182, 186, 194, 196 or 199 Wherein the single base polymorphism marker KRph 20768 of SEQ ID NO: 2 comprises a SNP site at position 147, the single base polymorphism marker KRph 27135 of SEQ ID NO: 3 comprises a SNP site at position 144, The single nucleotide polymorphism marker KRph 29263 comprises at least one of the SNP sites at positions 143, 190 or 205, the single nucleotide polymorphism marker KRph 29658 of SEQ ID NO: 5 comprises the SNP site at position 245, The single nucleotide polymorphism marker KRph 31762 comprises the SNP site at position 184, the single nucleotide polymorphism marker KRph 32035 of SEQ ID NO: 7 comprises the SNP site at position 227, and the single base polymorphism marker KRph 32296 of SEQ ID NO: At position 207 Wherein the single base polymorphism marker KRph 37987 of SEQ ID NO: 9 comprises a SNP site at position 159, the single base polymorphism marker KRph 41628 of SEQ ID NO: 10 comprises a SNP site at position 148, 11 single nucleotide polymorphism marker KRph 5948 contains the SNP site at position 164.

In the present invention, the nucleotide sequence of the EST library constructed from mRNA, which is one of the most commonly used SNP digestion methods, was investigated, and SNP regions showing differences in the nucleotide sequences of Korean and Chinese clams were investigated and selected to determine the CLC main workbench version 5. 6. 1 Identification primers were made using software.

Next, gradient PCR was performed to obtain the appropriate Tm value using DNA samples extracted from Korean and Chinese clams. The DNA amplified by PCR at the appropriate Tm value was confirmed by direct sequencing method, and then the differences in the nucleotide sequences of Korean and Chinese clams were confirmed and analyzed. Finally, 21 SNP regions from 11 primer pairs Lt; RTI ID = 0.0 > polymorphism < / RTI >

The present invention also relates to a method for detecting a polymorphism in a polymorphic locus comprising the steps of: (a) amplifying a single base polymorphic marker of the invention as described above from a clam sample, and (b) Is provided.

The clam is located in the Ruditapes philippinarum ), its subspecies and variants, and may also include pecks from various origins, including Korean peaches and Chinese peaches.

The clitorical sample DNA necessary for the amplification of the marker can be obtained from various tissues or various processed products by various methods, and the DNA is used to determine the country of origin. Therefore, any method can be used if it is known to a person skilled in the art. Preferably, the clam samples include viscera, spleen, muscle, liver, and gill.

In addition, since amplification of the obtained DNA sample by PCR is intended to increase the number of specimens, the method of obtaining the amplification product is not particularly limited, and any method can be applied as long as a person skilled in the art is familiar with the method.

In the method of determining origin of the clitoris of the present invention, in the step (a), the single nucleotide polymorphism marker is subjected to a polymerase chain reaction using primers comprising the nucleotide sequences of SEQ ID NOS: 12 to 33 Amplified.

Specifically, the single base polymorphism marker KRph 18421 of SEQ ID NO: 1 comprises a pair of the forward primer of SEQ ID NO: 12 and the reverse primer of SEQ ID NO: 13, the single base polymorphism marker KRph 20768 of SEQ ID NO: 2 comprises the forward primer of SEQ ID NO: 15, the single base polymorphism marker KRph 27135 of SEQ ID NO: 3 is a pair of the forward primer of SEQ ID NO: 16 and the reverse primer of SEQ ID NO: 17, the single base polymorphism marker KRph 29263 of SEQ ID NO: 4 is a pair of reverse primers of SEQ ID NO: A single base polymorphism marker KRph 29658 of SEQ ID NO: 5 is a pair of a forward primer of SEQ ID NO: 20 and a reverse primer of SEQ ID NO: 21, a single base polymorphism marker KRph 31762 of SEQ ID NO: 6 is a sequence of SEQ ID NO: A forward primer of SEQ ID NO: 22 and a reverse primer of SEQ ID NO: 23, a single base polymorphism of SEQ ID NO: 7 KRph 32035 is a pair of a forward primer of SEQ ID NO: 24 and a reverse primer of SEQ ID NO: 25, a single base polymorphism marker KRph 32296 of SEQ ID NO: 8 is a pair of a forward primer of SEQ ID NO: 26 and a reverse primer of SEQ ID NO: The single base polymorphism marker KRph 37987 comprises a pair of a forward primer of SEQ ID NO: 28 and a reverse primer of SEQ ID NO: 29, a single base polymorphism marker KRph 41628 of SEQ ID NO: 10 comprises a forward primer of SEQ ID NO: 30 and a pair of reverse primers of SEQ ID NO: , And the single base polymorphism marker KRph 5948 of SEQ ID NO: 11 is amplified using a pair of the forward primer of SEQ ID NO: 32 and the reverse primer of SEQ ID NO:

In step (b) of the method of discriminating the origin of clams of the present invention, in step (b), the amino acid sequence of SEQ ID NO: 1, 139, 140, 152, 180, 182, 186, 194, 196 and 199 A base sequence of SEQ ID NO: 2; a base sequence of SEQ ID NO: 3; a base sequence of SEQ ID NO: 3; a base sequence of SEQ ID NO: 3; a base sequence of SEQ ID NO: At least one single base polymorphism selected from the group consisting of nucleotide number 227 in SEQ ID NO: 7, nucleotide number 207 in SEQ ID NO: 8, base 159 in SEQ ID NO: 9, base 148 in SEQ ID NO: 10, The genotype of the region is determined, and the genotype frequency is further analyzed as shown in Table 2.

The single nucleotide polymorphic markers including the SNP site of the present invention and the primers for them can be developed by various DNA chips or kits capable of discriminating the origin of clover by a conventional method.

As used herein, the term "polymorphism " means the occurrence of two or more alternative sequences or alleles within a genetically determined population, and a polymorphic marker or region is a locus in which divergence occurs. . Preferred markers are those having two or more alleles showing a frequency of occurrence of 1% or more, more preferably 10% or 20% or more, in the selected population.

The present invention makes it possible to quickly, accurately, and specifically discriminate the origin of clam, so that countermeasures can be taken promptly to prevent the clam from being made into a clam by the Chinese in the import, quarantine and distribution process. And to further protect the interests and health of domestic consumers.

In addition, the present invention makes it possible to precisely and specifically discriminate the origin of clams from a trace amount of specimens to devise countermeasures to quickly and accurately block imports, distribution and sales problems by trimming clams made in China into Korean clams, To protect domestic consumers' interests and health, and to prevent ecosystem disturbances.

1 is a graph showing the nucleotide sequences of Korean and Chinese clams from the SNP region of the single nucleotide polymorphism marker KRph 29263 (SEQ ID NO: 4) of the present invention by comparing them with SeqMan program.
FIGS. 2A to 2K are diagrams showing the nucleotide sequences of respective single base polymorphic markers capable of discriminating origin of the clover of the present invention, wherein the forward primer and the reverse primer pair for each marker are indicated as underlined in brackets Single nucleotide polymorphism (SNP) sites are marked as red "N ".

Hereinafter, the present invention will be described in more detail based on examples. It should be understood that the following embodiments of the present invention are only for embodying the present invention and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. The references cited in the present invention are incorporated herein by reference.

Example  1: Single nucleotide polymorphism for discrimination of clover origin Markers  Selection

In this Example, SNP regions showing differences in nucleotide sequence between Korean and Chinese clams were selected by examining the base sequence of EST library made from mRNA, which is one of the most commonly used SNP discovery methods, and primers containing these regions were prepared .

Specifically, total RNA was isolated from clams mixed with 5 different tissues (visceral, spleen, muscle, liver, gill), mRNA was isolated by pure separation, and cDNA library was constructed and 780,000 ESTs sequence information was obtained. Then, 46,405 Sequencing sequences (average 400 bp, consisting of two or more ESTs) were selected to detect 49,540 potential SNPs. In addition, from these 49,540 potential SNP sites, the CLC Main Workbench (version 5.6.1) was used to screen optimal SNP sites and prepare primers from them. Using the primers prepared above, 8 clusters and 24 clusters were tested, respectively, and finally 11 primers and 21 SNP regions were identified which can discriminate between Chinese and Korean clones. These primers were synthesized with reference to Genotech (Daejeon, Korea) (see Table 1).

SNP marker
SEQ ID NO: SNP marker
Name KRph SNP
Location (bp) primer
SEQ ID NO: Primers (5 ' - > 3 ') Amplification product
(bp) One 18421 139 12 F: ACAGGCGCTTACATTGGGT 476 140 13 R: CAACAGTAAAGCAAAATATACTGC 152 180 182 186 194 196 199 2 20768 147 14 F: TGATGCAAGTATGCATCGTAG 341 15 R: GTGATGCGCTGGTTCTTC 3 27135 144 16 F: CTAGAATCATCATCCGGTTTTAA 310 17 R: AACTTTGACGTCAACAAAACCG 4 29263 143 18 F: GTGTTAATGATGCCATTAAAATGG 338 190 19 R: CTGTTCTTTCAATATACTTTACTGG 205 5 29658 245 20 F: CCTTATTGCAGCAGATGAATG 305 21 R: ACAATAGCCTGAAAGTGTTTCTT 6 31762 184 22 F: GTTATTTGGAAGATAGACGTCC 326 23 R: ACATGGTATTGGAATAAATGCAG 7 32035 227 24 F: TTCACATTTGACCGAAAAAGTCA 439 25 R: TGCTACAGTATAGTATACATCGA 8 32296 207 26 F: ATTACTTTATAGTTAGCATTGACC 310 27 R: ACACAGTATAGAGCCTGGT 9 37987 159 28 F: GGGATCCTGGATAGGGTT 310 29 R: GTACAGCTAGCGATCGGA 10 41628 148 30 F: GTCTGTATATATTTACGCAATGC 340 31 R: ATACCTCGAATGTTCCTCGT 11 5948 164 32 F: ATCTCAATTATGAACACACTTGTG 375 33 R: GATCCTTCACACAAATTGTTCC

Example  2: Clam collecting and genome DNA  detach

In this example, clay samples from Korean (Gohung region in Jeollanamdo) and Chinese clam (Dalian region) were sampled to determine the origin of clam, 96 human tissues were fixed in 99.99% ethanol, Respectively. Add 0.2 g of each of the Korean and Chinese clove tissues to a sterile 1.5 mL E-tube, add 900 μL of lysis buffer and 5 μL of protease K (PK) And cultured in a 37 ° C incubator for 18 hours or more. In this procedure, a Mac extractor (MagExtractor-Genome-, Tianti Research Co., Ltd.) was used as a genomic DNA purification kit. The cultured tissue samples were separated using DNA MFX-6100 (TOYOBO), a DNA automation extractor in Japan, and used as a template.

Example  3: Polymerase chain reaction PCR )

Polymerase chain reaction (PCR) using DNA samples extracted from Korean and Chinese barnyardgrass as a template was carried out in the following procedure.

( 3-1) Determination of Tm value

Gradient PCR was performed using two DNA samples of Korean and Chinese clams in the temperature range of 48 to 62 ° C to obtain the appropriate Tm value. Specifically, the total volume of the PCR was adjusted to 10 μL, and anti-HsTag high-Plus (including T & T Rep., 10x PCR buffer, 10 mM dNTP, Taq polymerase) ) Was used to perform gradient PCR with the primers prepared from the EST library.

(3-2) PCR  Furtherance

The total volume was adjusted to 10 μL and PCR was performed with the following composition; 1 μL DNA template, 6.9 μL distilled water (DW), 0.4 μL each primer (10 pmol), 0.2 μL 10 mM dNTPs (2.5 mM each dNTPs), 1 μL 10 × PCR buffer solution and 0.1 μL Taq polymerase Unit / mL).

On the other hand, the volume composition of the total volume to 30 μL for sequencing was as follows; 3 μL of DNA template, 21.9 μL of distilled water, 1.2 μL of each primer (10 pmol), 0.6 μL of 10 mM dNTPs (2.5 mM each dNTPs), 3 μL of 10 × PCR buffer solution and 0.3 μL of Taq polymerase mL).

(3-3) PCR  Condition

PCR was carried out under the following conditions; The process was repeated 35 times at 95 ° C for 11 minutes, at 94 ° C for 1 minute, at 48-62 ° C for 1 minute, and at 72 ° C for 1 minute, maintained at 72 ° C for 5 minutes, at 4 ° C for 30 minutes, at 8 ° C.

(3-4) Analysis of results

Next, when the PCR amplification reaction is completed, add 2 μL of gel loading buffer (0.25% xylene cyanol FF, 40% sucrose, and 50 mL with distilled water) to 3 μL of the PCR amplification product and add 1 μL / And electrophoresed in an agarose gel containing ethidium bromide. The band of the PCR amplification product was then confirmed in an image analysis system (Bio-rad, Gel Doc 2000) with a transilluminator.

(3-5) Purification

The PCR amplification product obtained in the above procedure was purified using a protocol of QIAquick PCR purification kit (QIAGEN).

Example  4: Sequencing and analysis of results

(4-1) For nucleotide sequence determination PCR  Furtherance

PCR was performed with the following composition; Use a mixture of 1 μL purified DNA template, 4.9 μL distilled water, 1 μL Bigdye, 1.5 μL of 5x sequencing buffer, and 1.6 μL forward primer 1 pmol [BigDinterator Version 3.1 Circular Sequencing Kit (BigDye ^® Terminator v3.1 Cycle Sequencing kit, Applied Biosystems).

(4-2) For nucleotide sequence determination PCR  Condition

PCR was carried out under the following conditions; Repeat 25 cycles of 95 ° C for 10 seconds, 50 ° C for 5 seconds, and 60 ° C for 4 minutes and keep at 4 ° C.

(4-3) Purification for sequencing

To purify the PCR templates for sequencing, 27 μL of a mixture of 25 μL of 99.99% ethanol, 1 μL of 3 M sodium acetate, and 1 μL of 125 mM EDTA was mixed and dispensed at 2,250 rpm And centrifuged for 45 minutes. For washing, 35 μL of 70% ethanol was dispensed, centrifuged at 1,650 rpm for 15 minutes, and then dried naturally. 10 μL of Hi-Di ^™ formamide (Applied Biosystems, Warrington, UK) was dispensed into each naturally dried sample, transferred to a 96-well plate, and heated at 95 ° C. for 2 minutes to obtain a base sequence .

(4-4) Sequence determination ( ABI  3130) and analysis of the results

The nucleotide sequence in this embodiment is determined by using a 3130 xl genetic analyzer (Genetic Analyzer, Applied Biosystems, Inc.), and the result is analyzed by ^{SeqMan Pro (DNASTAR Lasergene ®, USA} ) and GENETYX (version 7.0.3) program SNP regions were searched. Genotype and haplotype of Korean and Chinese clams were compared and analyzed using GeneClass 2.0 (INRA-CBGP / CIRAD) and Mega 4 program.

As a result, FIG. 1 shows the nucleotide sequence of Korean and Chinese clams derived from consecutive nucleotide sequence 29263 (contigs 29263) of the present invention by the SeqMan program. In FIG. 1, the yellow part represents SNP sites. Here, it can be seen that the base of Chinese (CHN) is base T and the base of Korean (KOR) is base G. Therefore, it was possible to confirm the difference of SNP site base by the data analysis through sequence determination, and it was possible to discriminate origin of Chinese clam and Korean clam clam specifically from these SNP regions. Table 2 summarizes the nucleotide sequences of the 21 SNP regions present in the continuous nucleotide sequences analyzed in the present invention.

Specifically, Table 2 shows the positions of the 21 SNP regions present on the SNP markers of the 11 consecutive nucleotide sequences selected in the present invention, and the genotype and the frequency of the nucleotides appearing at the corresponding positions. As shown in Table 2, it can be seen that there is a clear difference in the genotype between the Chinese and Korean clams, and the Chinese and Korean clams are clearly distinguished from the genotype frequencies. For example, the SNP site of the SNP marker KRph 18421 of the present invention shows the frequency of T / T genotype to 0.98 in Korean clam, and the genotype of G / G in Chinese clam is 1.00 . Therefore, when carrying out the nucleotide sequence analysis according to the present invention, it was confirmed that the origin of the clam was clearly distinguished from the base T of Korean clam and base G of Chinese clam, and 11 clones of the SNP markers When the primer pairs were used together, the discrimination accuracy could be further improved.

Table 3 shows the discrimination power of Korean and Chinese clams using SNP marker regions of the present invention.

Table 3 above is the result of discrimination analyzed using the GeneClass 2.0 (INRA-CBGP / CIRAD) program. The discrimination power of Korean and Chinese clams was 97.4% and the average value was 95.83% in Korean and 95.76% in Chinese.

In summary, in the present invention, 49,540 SNP sites available as SNP markers were searched in 46,405 consecutive nucleotide sequences created from 780,000 EST library data of 5 tissues. On the basis of this, 108 primers containing the corresponding SNP region were prepared. 21 primers were firstly selected. After the second verification, finally, 11 consecutive nucleotide primers and 21 SNP regions Were selected (see Table 1). In the first screening, 8 strains of Korean and Chinese clams were compared with each other. In the second test, 24 strains were selected and further experiments were carried out.

In order to verify the discrimination ability of Korean and Chinese clams on the final 11 primers, 21 SNP sites were compared using one group of Korean and Chinese clams. As a result, the difference between Korean and Chinese clams on the SNP sites of the consecutive nucleotide sequences KRph 18421, KRph 27135, KRph 31762, KRph 32296, KRph 37987, KRph 41628 and KRph 5948 was relatively clear (SNP base of Korean and Chinese clams Frequency range of 0.60-1.00) (see Table 2).

GeneClass 2.0 was used to estimate the discriminatory power of Korean and Chinese clam clusters based on genotype data of clams analyzed. As a result of analysis using 21 candidate SNP marker regions, the probability of Korean clam became 95% or more and the probability of occurrence of Chinese clam was 95% or more in 97.4% SNP markers that discriminated the origin of clams were highly discriminating (see Table 3).

Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. It will be understood by those skilled in the art that modifications and variations may be made without departing from the spirit and scope of the invention, and that such modifications and variations are also contemplated by the present invention.

<110> Republic of Korea <120> Single nucleotide polymorphism markers for identifying origin          place of short-necked clams and method for identifying          short-necked clams by using the same <130> P12-0298KR <160> 33 <170> Kopatentin 1.71 <210> 1 <211> 600 <212> DNA <213> Contig 18421 (Ruditapes philippinarum) <400> 1 aacgacaagc atgtacttcc tatttccgaa ttgctctctg ctggcgctat tcacatccgt 60 gcgcccattt ttgttacgtg agagaatact gcaagaccac aggcgcttac attgggtatt 120 attatgcgaa tgggtgctta gtaggatgtg acccaggacc ctccaatcca atatgtccat 180 taaggaacaa ataaaatcat cagcactttc gtttctaaaa tgtgtctttt cataaanntt 240 aaattacaan tatggtgatg tgcaatttca gaacaaantn ctcncccaca tngnctnctt 300 aacactattt aatatactct atgaaacaga attaaaatgg agtttattta aatattttag 360 gaattgtata atatattcaa gtatgtttca atgattatta ttatgtattt ctttcaaaga 420 aattatatat tttctgataa tacacacgtt ttcatttgta aaatcacaaa ttttgactaa 480 tgtccatttt aactgttgtt tcaattattt tgtgaaaatt taatcatata agtatatcag 540 atgtcttttt gcagtatatt ttgctttact gttgaaattc atgatctttg gcttgacata 600                                                                          600 <210> 2 <211> 1280 <212> DNA <213> Contig20768 (Ruditapes philippinarum) <400> 2 gtagcaggca tgctagctgg agctatacaa catggtgtga caggtaaaga tggctggaaa 60 gtaaacctga gattaggtgg aagctttctc attatcgtag gcgtggccac ggcggtcctc 120 attatacttc acaaacttgg aaaaatcaat ttgaaagaac gagaaggtaa gcgatcatct 180 aacgagtata caaaaacaaa cgagaatacc gaaactaaga gtgagactaa aaatgaacct 240 gacgatgact taccaaaaga tattgatgag atatcaatga caattgaaag tggaaagttg 300 cattctgacg atacacgaac cgggaattac attagacgca aaagtccaga gagatcagat 360 agtcgatcag ctgaattccc aaacacagct atggttcagg cttctggtga aagtgataga 420 atggaacatg tccatgacat tccgtctggc ccaagacaac cgtcaaatgg aaggatgtat 480 ggtaacaacg aagaacatga aagtgacaga atgcaacaaa tttacggtat ggcgcctcga 540 aggcaatctt caacagaaat gatgaatgga aatgtagcgg atcaaatacg atttgatgca 600 agtatgcatc gtagttactc aaaccctggt tatataaacc aacctgagat gttaccagtc 660 catacataca atccgaacac acaggtactc tatgtaaatc aatttggtaa tccgatttat 720 caaggacaac atcctcagcn ttacgctggt agccaaatca tgcctcaaaa caattacttc 780 cctccaaatg gtccggcatt gcaggggaaa caggtccagg agaaaggcaa gcgcaagaaa 840 ggaaaagaca agaaacagaa aagtagcaaa tcagtgacag atatgagaca aacatttcct 900 aataacgatc cttacagaag aaccagcgca tcacaaaatt atgttgaaga acagataact 960 gatgctgata ctgttttgta ttaaactgtc ttgaataatt atgttcttat aatctgtaag 1020 ttatatcatt ttatttttta cagacattct tatagttctt taaaataaac atatattcat 1080 ttctatttac ctgtttttct ttgagtgcat accaacaagt tatagagcgt acaaacattc 1140 attttatact tgacctcgaa ggaaatctta atagttgttt ggtataaatt tattccattg 1200 tatttaaaaa gtctgtatat atgaatattc aataacagtt aaactaaacg aaaaatatag 1260 taaaaaaaaa ataaagttag 1280 <210> 3 <211> 333 <212> DNA <213> Contig27135 (Ruditapes philippinarum) <400> 3 agcatagctt tttttttaac tagaatcatc atccggtttt aatgacattg tattacagct 60 ataagctgtt agattaaaca ttagatcatt gttgccatgg aaacatgtcc ttgttacagg 120 aaccctgaat tttatattag actcatacct taatcatgga acncattttt tgtattcttc 180 attttcttgc tgaaaaacca acataatgga ctaaaggatc atttctgtgt aaattttcaa 240 ttctgtacag ggtgtgttaa gaactctgga ttttttttat atgagtgttt ttttttctat 300 ctccctccgg ttttgttgac gtcaaagtta tat 333 <210> 4 <211> 1187 <212> DNA <213> Contig29263 (Ruditapes philippinarum) <400> 4 tttccatgcg gttgtgctct tttgaattta aattgcctag catgatttga atagggtttc 60 attactattc cacaagcaaa aaagttaatt ttcaagatac gtttatattc tttaagcata 120 tgtgtcacgt accatttccg agccttcatg aattggatca actttcttca ctagccataa 180 tcgtatttag gttgcaaatt acaacgcgta aaggaatgcc taatttaatt aaaccgaatc 240 tatgccaatg atttcggtca gcgctggaca aacatcgaag tgttggtcaa ggttaatttc 300 agcaagcata attgagtata gctcaaatat cacaacacaa ttaagggcag caatagtgta 360 tatatgtgtt tgaaagtgcc agtgtgtgat gtacgtagca aagcagactc actttaagtg 420 aatgttgact ctgaacgctg attaagtaca tacaaggacc tatttcctct tccttttaac 480 gtcagctact attacggctc tttttgttgt tgacgatgtt aatgcgcatt gtgtattttg 540 catttgtatc agaactaatt aattgtgctt taaatgttgt gttaatgatg ccattaaaat 600 ggaattttaa gagcagacat gcacacttcg aagacacttt tgttcaaggt caaaaatctt 660 gaaattagac gtcaatctaa cagttcagca tttgaatgct aattcaagtc tcggacaatg 720 ngcgcatacg ttctcaacaa ttcttatctt ctataacacc tacacgtnta ttaaatttca 780 gtnacgtgat atcttgcaaa tgatatgtaa aaaggcagtg atagagccta tgagacttga 840 ctaaacaatc ggtctgttta tttatttctg tatgtgttta attgcacttt accagtaaag 900 tatattgaaa gaacagaatg cgctgccaaa attataaaat aatatattgt gttaaaatac 960 tcatatttta aatgctggtc attatttttg ataaaatgtt tgtattttat ttcaggagta 1020 tattctatgt cttaaaacat gtttattgtg ttgttaagtg aatttttaac aaatggttat 1080 atatgtacta agttgtgaac attcattccg tgacaaacta gatatatttc tatgacacct 1140 atacatgtag aaataaagag tatttctaca ctaaaaaaaa aaaaaaa 1187 <210> 5 <211> 1488 <212> DNA <213> Contig29658 (Ruditapes philippinarum) <400> 5 ctaatggaag acaaaatgtg tattctttca tttatagtgg agcagaatac acaataaaac 60 cttcctgatt tgaaaagaaa ttgttacctc atgtagaaac cgctgtattg aaagtgtgtt 120 agtattttat agaaagtaca cggtaaatta aaatttttcc gtcttaattt attattataa 180 tattatattg tattacttcc ctttaatatt tttttccttt tcctgtttgt tatttttgtt 240 atatttatga gtgatataat taaaaaagga atttagctca gcatattgtt tttacatgtg 300 tgtgtggtgt tagaaaatag tagttgtcgg attctagtgt ataaaatttc atatcaagaa 360 ttttaattac ccatttaact acatgatgac gacaggtcct tgtaaatttg taatcattaa 420 tcaattattc atcgttatct attgctatga attgttgacg aagaaatcgt agttgtaata 480 tattcatttc gagtatttaa atgaaaacca ttacgtattg taccatattg catcgtgtaa 540 actatttatt cctaaaaagt cgggaagttt tatttttatg tgaaacgttt tttttttgtc 600 tttgtaaata taaatataga caaagccctt attgcagcag atgaatgaac aatatgtgaa 660 cttgaggcgg tttaattttt tatctataat tttcgagaaa aatgtgcgat gacatgcttt 720 gtcagaagtt ctaaattcga cctaatgagt gcaagtcccc ccttcatttc agacaattta 780 atatccaatg taaaagaaag attagttttt ctttgtacca ttgtagttaa ccagtctgga 840 agaaggtacc ttaacattcc aaaaccatat ntaagcttat aaaagatgat tttttgctat 900 gtttggaaaa gaaacacttt caggctattg taaaaggttt aaagagttga gtctgtgaca 960 gcaaaaaaaa attagtgaca gaaaaaaaaa cgtttttaaa tggactgcaa atttacatta 1020 attgaacatt ttggatttta cgttgcagaa aaagattcag aagctaggca ttttatttct 1080 atttttgagc tgcccagata aatcatgtaa tgtgaaactg aaatttttta tttttttcaa 1140 aagcgacttc ccagttgtat aacaagaatt gtatctgaac atgcaagatt aagtttacct 1200 gtttgttaaa tgtgtctgtc cccctgtaag taaagctcca atggctgccc tctcacaaac 1260 atttatgcaa aaaaaaattt gtgtaagaat gccgttaaaa tgttgaaatt gattgaatga 1320 aaatttggtg ttgtatattt tgtcgttttt ttttccacaa ctagttgtac cattttttag 1380 ggcttagagc tcaaatgata tgaaaataca gaggtcagat gaaccttccg atgggaggcc 1440 atatttgatt cctgtatttg tagtttctat gtctaaaaat agtaacat 1488 <210> 6 <211> 422 <212> DNA <213> Contig31762 (Ruditapes philippinarum) <400> 6 gacggttgtg gttatttgga agatagacgt ccatcgtcta attgtgaccc atattcagtt 60 actgaagtta ttgtctatac cgcttgttta ggaaaataac tattgtttac ttatcacggc 120 gagcagtgca gatgttataa ttatagacac gctggacgtt aaagacacgc tggccaacag 180 tgaaaacaat tcantaatta tagaccagtt aaatttacat gtgacaacct gagaaaaaaa 240 tcaattcagg ggttttctaa attttaaaat ataaagtatt tttttatgaa atattcaaat 300 actatgaaaa tgtctgcatt tattccaata ccatgtagga ggcagctaaa aacattgttt 360 gattatttat attactaagt gatatagtta tgaaaaaagt cgctccaagt taattcaggt 420 ga 422 <210> 7 <211> 582 <212> DNA <213> Contig32035 (Ruditapes philippinarum) <400> 7 tattgaaatg taaattctta gatattttgt gatgctaata tgctattacc tctaaaagaa 60 aatacacaat atattttttt cttcttcaca tttgaccgaa aaagtcatca ttaatatgta 120 caatgtagca tgtttcaaac agctcaattt aggtttactg ttaaagaact tgcagaaggt 180 aatacagatc aaattataca caaatcttta actaacctag tcaactttgt tttatttcat 240 aaattgatat gttatgcata tattattgtg taagaaaatg tagtctgtta gaattgttta 300 tatgttataa nggaactatt ttaagaatat agtcaagtgc tcgcaaattt tgttcgaaac 360 taaattgtgt ttttaactga aggtctcaaa agttatacaa atgcttacag ttgcgaattc 420 aaaacttctt ctcaacaagg aaatccaaat ttattcaatg gtatttataa tgtaacattc 480 catacatgcc ataattatgt tcgatgtata ctatactgta gcacatgttg tgatttaaat 540 tgtgtaaata aataatatat aaacttgaaa aaaaaaaaaaaa 582 <210> 8 <211> 531 <212> DNA <213> Contig32296 (Ruditapes philippinarum) <400> 8 ccttgatgaa caaaaatact tgttcctttc catgaaaatg ttagttttgc aataaggaga 60 aaaattgtgg cattatttta aaattcattt cattcattaa aaaatcaata accatgtagt 120 tttatgtaat tactttatag ttagcattga cctaagattt attttgaaac ataatatttc 180 cccttggaaa gaaatatgaa tctactgcct aaaacagagt aaaaatgttt gtaatcatac 240 atttctatag aaaccaatag atttggatca atttttatat cattgtataa aaacttgttt 300 tttggttttt atatgcattg aagaattgtt tactnaaacc cttaacctgc tagaatcgga 360 agtggttgtc catgacaacc agtatagagc caggcaagct tgcacttccg tgcagtctga 420 ccaggctcta tactgtgtgg ggcttacttt cttaaaaatt ttatgtcgat ttttcaaaga 480 atgataattg atacttttaa aatggaagct ggacaaggcc atttaagata t 531 <210> 9 <211> 395 <212> DNA <213> Contig37987 (Ruditapes philippinarum) <400> 9 agatattatt acaagagagg gatcctggat agggttgatg gacgacgcct tgtgtacaag 60 tttggagtta actcgcatgg ttggaaataa attaaaccaa atgcattcaa gatctcccat 120 tgtatcacag ccagtcagcc ggtctaaagt gctgcatagg ccaaattgtc tcccatncct 180 acaaacaatt tattggaaaa acacaatacg aactctcttc taggccaaag tcctcaattt 240 aaaatctggt tgcaggccac taaaaggcaa agaaggcaaa tgagggacga agagtcgtga 300 cgtcattgta gtccgatcgc tagctgtaca cgtcagaaaa caattacatt tgacgtgatt 360 ttaaaaaaaa gtgcttcaaa cataaatttt catca 395 <210> 10 <211> 1364 <212> DNA <213> Contig41628 (Ruditapes philippinarum) <400> 10 ttataattct tacttcggct ggaactgtaa gttttgagaa attttaaaaa gcaaggttgt 60 agacttgata aattgaatat cataacgagt ataacattct aaatatgatt gtccaatcga 120 agctttgata gtctcgcact cgtgtcaact gtcctgaaca ggaagttcat aattttttta 180 tcgtctgtat atatttacgc aatgcattgt cttataatat tgcacatttc ccttggttta 240 tatatatagt atgggatcca agaatttttt gcaaagcttt tgattaaatg cgaaaagaaa 300 gcattgcaaa aatacttgac ctatattttn tatgtttata atactggaga tcggtactag 360 aatataactt ctgaaatatg tcacgtgtct tggcgtgcct atcgccttag caacctgcta 420 aaaattctgc tcttcttctt ccggttcttg agagcaagat taactacact tgagaaaact 480 tccgatacac cgtccattgt caacgaggaa cattcgaggt atgcgtcggc tccaatctct 540 tttgcaaaag cctcgccttc ttctagagtt acataactat caccagatga atgccggcgc 600 tttagtcgga cgtctgactg gcagccaatg agaataatag gctttttacg tttaacatgg 660 gactttgctt cctgtatcca gacgtccttg atattttgta aagaatcggc gtcattgacg 720 ctgtagcaga cgataatgac ctcactgtct cggtaactga acgctcgcac gtcttcataa 780 tcatgctgtc ctggtgagtc aaagatgctg accgtgtatt gttctccgtg cactgagact 840 gtaccagcat aattatcgaa tactgtagcg acataagcgt ctccgggagg ctgcttattg 900 acgaagccaa agctagagaa gttttccaac cattccatct cctatcacag tacaattaac 960 aactttctgg ctcatgaatt ttgtccttta tcattctttt agtaaatgtt tattatccct 1020 aaatcgaaga atacacacaaa acaatgacca caattatctt aacaatgagc aaatgcacaa 1080 ttctttgtcc aaattatttc gatctaaaag ttcatttcat ttcactgtgg agtgtatgct 1140 tttagtccac tcgctgttat tacgtcagct tctaaaattc acatttcaat tcaaattact 1200 ttctaattca aaatcggacc gtttgcaatt acttcttaac ccgtctagat ttcaatatta 1260 aatgtcattg tattcttcat taatagtcta gtcatacgat gtacaatgac gtctatttac 1320 tacggtatat taccacaacg gtaaacacta tcaacacata aaag 1364 <210> 11 <211> 1900 <212> DNA <213> Contig5948 (Ruditapes philippinarum) <400> 11 ttttttttt ttnttttttt ttnttttttt ttttttnttt tttttttttt nttttttttt 60 ttttttactt atttaaattt tttaaagtta aaacaacaat ttaacattta ctacaaaaac 120 tttaaaaaca aatatttcat cattattttt tactctattc ttaaacacaa aacaaatcat 180 actacataca tctaatacaa ttatgctgca aatatgaatt gaaattttta ttcacatgta 240 aaaatacaaa ggtataatac atgtatctca attatgaaca cacttgtggt aatacaatat 300 gtaaacatac aaacaaaatg tgtcatgtga acacaaaatg ctcaattaat gcaaataatt 360 gtctctttta tttgtggctg acaagcactc taaactacac aagagggaca tgatggcctt 420 cattgctnac ccgagattta ttgcaagagg tgactgaagg atgtaaagac aaggtttcca 480 ttcccacaga aaataaatct ttacacaatt tgaaataact ttatgaacaa tacaatctta 540 tgaggaactc ttaaagaaat caaatgttaa tgcatactta tttattttat ttatcttttc 600 ttaaaaagtt actgtttgag gaacaatttg tgtgaaggat cactgcagtg tatctttgta 660 gttacagaca cagtcataat aatgtatgtc aatgtttgta tcacttgtta accagtactg 720 ggtggggtag gtatcggtta gaggctatgt gttcctttag ataatctcca cctttctcct 780 ggtactctgc tcgggtaatc caaacattac caatacctga tgatgtgatc cactgccggg 840 caccaagcca tgcatccaaa cttggatcat ctgctgtgaa cacattaaat gttgatttga 900 agggtcgcat ttgtaacatc tcccgatcca ttctctgttt gaactgacca aaattagcac 960 agcctccagt caaaaataca tactgtgcta aggtctgttg tacatcttgt gtatattttt 1020 tgaacatgta gtctagagtt tcaacaattc ctgcttgctc agcaccaatc atagatggct 1080 ggaacaataa ctctggtacc ctgatacgtt ctacaccaat atgtaacctg tagtattcag 1140 ctatatcaaa ctccccggct tccttgtcca actctttcag gaattctgga tcatgttcct 1200 tgagcatagt ttctagttcc tctagctgta gctcctcggc ctctgaatca ctgtcactca 1260 tgttggggtt aatttcctta taaacatccc agtccctgtc atcttgtcca aaggtatctt 1320 ctttctttgt atttttagca agctgtgata taattctcat cctctgctgg gcagcatatg 1380 tttttctttt tgccatatct tgcttcttct gcttgcggtt gttacgtgtt tccaacagtt 1440 tttgtctttt ttgtctcact tcagacaacc aactctgaaa atcagtcagt cttttctttt 1500 caagttcttt ttctgcaatg agttcctttt gtcttttttc cctttgttga gcctgggctt 1560 tagcacgacc ttccttagct ttctgtagta tatattgacg tttcttcttc actagttgat 1620 ctggtgataa ttgatcatct ggtatatcta gtaggtcaaa cactgcttgc ttccgaggct 1680 caggttcctc gggtggcggt tctttaccat ctataacagc cttcaatctt tgtatactca 1740 ctgacaactt gtttatcagt acctgcagct cctcttcact ctctatattg ttctcactta 1800 atgcattatt atattcctca tcatcatcat cataatctgc tatcagctcc tgtaactgca 1860 tcaacctctt catttcctgc tcttcttctg ccaacctttc 1900 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> KRph 18421 forward primer <400> 12 acaggcgctt acattgggt 19 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> KRph 18421 reverse primer <400> 13 caacagtaaa gcaaaatata ctgc 24 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KRph 20768 forward primer <400> 14 tgatgcaagt atgcatcgta g 21 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> KRph 20768 reverse primer <400> 15 gtgatgcgct ggttcttc 18 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> KRph 27135 forward primer <400> 16 ctagaatcat catccggttt taa 23 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> KRph 27135 reverse primer <400> 17 aactttgacg tcaacaaaac cg 22 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> KRph 29263 forward primer <400> 18 gtgttaatga tgccattaaa atgg 24 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> KRph 29263 reverse primer <400> 19 ctgttctttc aatatacttt actgg 25 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KRph 29658 forward primer <400> 20 ccttattgca gcagatgaat g 21 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> KRph 29658 reverse primer <400> 21 acaatagcct gaaagtgttt ctt 23 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> KRph 31762 forward primer <400> 22 gttatttgga agatagacgt cc 22 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> KRph 31762 reverse primer <400> 23 acatggtatt ggaataaatg cag 23 <210> 24 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> KRph 32035 forward primer <400> 24 ttcacatttg accgaaaaag tca 23 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> KRph 32035 reverse primer <400> 25 tgctacagta tagtatacat cga 23 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> KRph 32296 forward primer <400> 26 attactttat agttagcatt gacc 24 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> KRph 32296 reverse primer <400> 27 acacagtata gagcctggt 19 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> KRph 37987 forward primer <400> 28 gggatcctgg atagggtt 18 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> KRph 37987 reverse primer <400> 29 gtacagctag cgatcgga 18 <210> 30 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> KRph 41628 forward primer <400> 30 gtctgtatat atttacgcaa tgc 23 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KRph 41628 reverse primer <400> 31 atacctcgaa tgttcctcgt 20 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> KRph 5948 forward primer <400> 32 atctcaatta tgaacacact tgtg 24 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> KRph 5948 reverse primer <400> 33 gatccttcac acaaattgtt cc 22

Claims (10)

A single nucleotide polymorphism marker capable of discriminating the origin of a clam, selected from the group consisting of SEQ ID NOS: 1 to 11 comprising a single nucleotide polymorphism (SNP) region. The method according to claim 1,
The SNP site comprises the nucleotides 139, 140, 152, 180, 182, 186, 194, 196 and 199 of SEQ ID NO: 1, base 147 of SEQ ID NO: 2, nucleotides 144 of SEQ ID NO: Base # 245 of SEQ ID NO: 5, base # 184 of SEQ ID NO: 6, base # 227 of SEQ ID NO: 7, base # 207 of SEQ ID NO: 8, Wherein the nucleotide polymorphism is at least one SNP site selected from the group consisting of nucleotide 159 of SEQ ID NO: 9, base 148 of SEQ ID NO: 10, and base 164 of SEQ ID NO: 11. The method according to claim 1,
A single base polymorphism marker KRph 18421 of SEQ ID NO: 1, a single base polymorphism marker KRph 20768 of SEQ ID NO: 2, a single base polymorphism marker KRph 27135 of SEQ ID NO: 3, a single base polymorphism marker KRph 29263 of SEQ ID NO: 4, Polymorphic marker KRph 29658, the single base polymorphism marker KRph 31762 of SEQ ID NO: 6, the single base polymorphism marker KRph 32035 of SEQ ID NO: 7, the single base polymorphism marker KRph 32296 of SEQ ID NO: 8, the single base polymorphism marker KRph 37987 of SEQ ID NO: A single base polymorphism marker KRph 41628 of SEQ ID NO: 10, and a single base polymorphism marker KRph 5948 of SEQ ID NO: 11. The method of claim 3,
The single base polymorphism marker KRph 18421 of SEQ ID NO: 1 comprises a SNP site in one or more of positions 139, 140, 152, 180, 182, 186, 194, 196 or 199, 2 single base polymorphism marker KRph 20768 comprises the SNP site at position 147, the single base polymorphism marker KRph 27135 of SEQ ID NO: 3 comprises the SNP site at position 144, and the single base polymorphism marker KRph 29263 of SEQ ID NO: 4 Comprises a SNP site at one or more of positions 143, 190 or 205, the single base polymorphism marker KRph 29658 of SEQ ID NO: 5 comprises a SNP site at position 245, the single base polymorphism marker KRph of SEQ ID NO: 6 31762 contains the SNP site at position 184, the single base polymorphism marker KRph 32035 of SEQ ID NO: 7 contains the SNP site at position 227, the single base polymorphism marker KRph 32296 of SEQ ID NO: 8 contains the SNP site at position 207 , And The single nucleotide polymorphism marker KRph 37987 of SEQ ID NO: 9 contains the SNP site at position 159, the single base polymorphism marker KRph 41628 of SEQ ID NO: 10 contains the SNP site at position 148, and the single base polymorphism marker of SEQ ID NO: 11 KRph 5948 comprises a SNP site at position 164. 5. The method according to any one of claims 1 to 4,
A single nucleotide polymorphism marker characterized by discriminating the origin of Korean clams and Chinese clams. (a) amplifying a single base polymorphic marker of claim 1 from a clitoris sample;
(b) analyzing the genotype of the single nucleotide polymorphic site of the marker. The method according to claim 6,
Wherein the single nucleotide polymorphism marker in the step (a) is amplified by performing a polymerase chain reaction using a pair of primers selected from primers comprising the nucleotide sequences of SEQ ID NOS: 12 to 33, Of origin. 8. The method of claim 7,
The single base polymorphism marker KRph 18421 of SEQ ID NO: 1 comprises a pair of the forward primer of SEQ ID NO: 12 and the reverse primer of SEQ ID NO: 13, the single base polymorphism marker KRph 20768 of SEQ ID NO: 2 comprises the forward primer of SEQ ID NO: 14 and the reverse primer of SEQ ID NO: A single base polymorphism marker KRph 27135 of SEQ ID NO: 3 is a pair of a forward primer of SEQ ID NO: 16 and a reverse primer of SEQ ID NO: 17, a single base polymorphism marker KRph 29263 of SEQ ID NO: 4 is a forward primer of SEQ ID NO: 18, The single base polymorphism marker KRph 29658 of SEQ ID NO: 5 is a pair of the reverse primer of SEQ ID NO: 20 and the reverse primer of SEQ ID NO: 21, the single base polymorphism marker KRph 31762 of SEQ ID NO: 6 is the pair of reverse primers of SEQ ID NO: A forward primer and a pair of reverse primers of SEQ ID NO: 23, a single base polymorphism marker of SEQ ID NO: 7 KRph 32035 The single primer polymorphism marker KRph 32296 of SEQ ID NO: 8 comprises a pair of a forward primer of SEQ ID NO: 26 and a pair of reverse primers of SEQ ID NO: 27, a single base polymorphism of SEQ ID NO: The marker primer KRph 37987 is a pair of a forward primer of SEQ ID NO: 28 and a reverse primer of SEQ ID NO: 29, a single base polymorphism marker KRph 41628 of SEQ ID NO: 10 is a pair of a forward primer of SEQ ID NO: 30 and a reverse primer of SEQ ID NO: 11 single nucleotide polymorphism marker KRph 5948 is amplified using a pair of the forward primer of SEQ ID NO: 32 and the reverse primer of SEQ ID NO: 33. The method according to claim 6,
In step (b), nucleotides 139, 140, 152, 180, 182, 186, 194, 196 and 199 of SEQ ID NO: 1, nucleotide 147 of SEQ ID NO: 2, A nucleotide sequence of SEQ ID NO: 18, a nucleotide sequence of SEQ ID NO: 18, a nucleotide sequence of SEQ ID NO: 18, a nucleotide sequence of SEQ ID NO: Characterized in that the genotype of at least one single base polymorphic site selected from the group consisting of base 159 of SEQ ID NO: 9, base 148 of SEQ ID NO: 10, and base 164 of SEQ ID NO: 11 is analyzed to determine the origin of clams Way. 10. The method according to any one of claims 6 to 9,
The method of claim 1, wherein the origin of the clam is from the Korean origin.

Images