KR20140057786A - Transgenic silkworms producing red fluorescent cocoons - Google Patents

Abstract

The present invention relates to a transgenic silkworm that produces red fluorescent silk. More specifically, a recombinant expression vector which includes a gene construct in which a marker gene regulatory promoter, a marker gene, a silkworm-derived fibroin promoter, and an anemone-derived red fluorescent gene are operatively linked and a silkworm is transformed by the recombinant expression vector so that a transgenic silkworm that produces red fluorescent silk can be produced. The red fluorescent silk that the transgenic silkworm produces represents thin natural red color even in natural light so that a separated coloring process is not needed and the silk is environment-friendly and economical. When a light beam of a particular wavelength is irradiated, the silk represents bright red fluorescent color in the darkness so as to be usefully used as material for high value clothes and fashion or wallpaper compared with general silk.

Description

TRANSGENIC SILKWORMS PRODUCING RED FLUORESCENT COCOONS PRODUCING RED FLUORESCENT SILK

The present invention relates to a transformed silk producing a red fluorescent silk and a method of producing a red fluorescent silk using the transformed silkworm.

The silkworm belongs to the taxonomic insecta, lepidoptera, Bombyxidae, Bombyx, and moth species. The silkworm is a complete transformational insect, which develops larvae hatching from eggs, becomes a pupa, becomes an adult (moth), gives birth to an egg, and finishes its life. The life of the silkworm is relatively short, on average 60 days, and it has an advantage as an experimental animal. Eggs that have been scattered are colored when left untreated, and hatched and hatch without coloring until the following spring. The number of hatchings per year is determined by the amount of dormant hormone produced in the ganglion below the esophagus by each gene action. In silkworm eggs, fertilized nuclei divide several times to form cleavage nuclei, surrounded by protoplasts around the nuclei, and they migrate toward the edges of eggs. For example, after 12 hours of spawning, ants silkworms form a syncytial blastoderm, and 20 hours later, it is possible to carry out pickling, one of the artificial incubation methods. At 30 hours after spawning, it becomes full yolk cells and hatches into ants silkworm after about 10 days.

Various studies have been conducted to produce silkworm transgenic silkworms due to their industrial value as well as research use. The development of transgenic silkworms was carried out by the Japanese Tamura et al. Transgenic transgenic vectors were constructed using the piggyBac gene derived from ni and microinjection into transgenic silkworm cultivars was succeeded in producing transgenic silkworms for the first time. Recently, transgenic silkworms producing various biopharmaceuticals have been reported. On the other hand, it has been reported that the transfection vector is injected into the silkworm eggs by the microinjection method used by Tamura et al. In 2000, and the injection efficiency can be improved by injecting the microinjection position in the middle part between the main part and the posterior part of the embryo have. In addition, the silkworm varieties used in the transgenic cultivation are the hybrids of sleeping 125 and sleeping 140. The silkworm eggs are larger than the normal species, and they can be raised by artificial feed during the year. do. Therefore, the selected silkworm transgenic can be stored for a long period of time.

Silkworms produce a silk protein composed of heavy-chain fibroin, light-chain fibroin, and P25 protein. Raw protein expression, especially fibroin, produces a strongly expressed protein in the posterior silk gland of the fifth instar larva, producing a phytoene protein that is approximately 20% or more of the total body weight. It is expected that clarifying the powerful and tissue-specific expression control mechanism of fibroin can provide important clues to gene expression control research, and this regulatory mechanism can be used for the mass production of useful substances in eukaryotes.

Using the specificity of amino acid sequences with large molecular weights, the study of fibroin genes was first carried out by Suzuki and Brown from the posterior silk glands at the end of the fifth instar in 1972, followed by the isolation of mRNA from the genomic DNA of silkworms in 1976 Gene was cloned. Later, the H chain and the L chain in the silkworm, and the H chain in the knuckle were cloned, and the structure and the control of the mutation were actively studied.

The H chain of the silkworm consists of two exons with a length of 16 to 17 kb, and the L chain consists of 7 exons with a length of 13472 bp. The transcription of fibroin H chain gene is activated at 25 stages of embryogenesis and repeatedly switch on and off at the posterior silk line at the larval stage. Transcriptional regulation studies using the nuclear run-on assay revealed that the transcription was localized in the first half of the posterior silk gland of the fifth instar larva. At this time, it was found that L chain was transcribed as H chain. The fibroin gene has been shown to undergo no structural changes such as gene amplification or methylation during cell differentiation, which means that the expression of the fibroin gene is largely regulated by transcription.

A transgenic animal is an animal in which an exogenous gene has been inserted into the genome of a host and a part of its trait has changed, and the foreign gene at that time is called a transgene. In the mid 1970's, we started to import foreign genes by using recombinant viruses in somatic cells or germ cells. In 1980, Gordon produced super-mice by microinjection.

Techniques for introducing a foreign gene include calcium phosphate, electroporation, DEAE-dextran, liposome, microinjection, and bombardment. Among these methods, the DEAE-dextran method and the electroporation method allow the cells to enter the cytoplasm directly through the open hole of the DNA, which may damage the DNA. The method using liposomes is widely used as a method of directly transferring DNA into a cell by fusing the DNA with a liposome, an artificial lipid vesicle, into the cell membrane. The microinjection method is a method of directly injecting DNA with a micro needle to such an extent that it does not damage the eggs by using a micro manipulator in the first embryo transfer embryo. Outpatient gene transfer technology at the practical stage will have infinite benefits to human beings if introduced foreign genes are related to growth rate control, tolerance in extreme environments, gene therapy.

In Korea, sleeping business was the best agricultural product exported $ 500 million per year in the 70s (the world's fifth largest country), but the domestic sleeping business has been affected by rapid growth of wages, labor shortage, , The price of Chinese cocoons dropped sharply due to the increase in imports of cocoons, and there was almost no production of silkworm cocoons in Korea. Therefore, it is required to develop high value-added transgenic silkworms for the expansion of the domestic silkworm industry and the epoch-making income of the silkworm farmers.

As related prior arts, Korean Patent No. 10-0267742 (filed on July 07, 2000, entitled "Fluorescent silkworms using recombinant baculovirus inserted with green fluorescent protein gene and preparation method thereof") and Korea Patent No. 10 -0323550 (registered on Jan. 24, 2002, titled: Transgenic silkworm transfection method and transgenic silkworm).

It is an object of the present invention to provide a novel silkworm-like silkworm which is characterized in that a mutation gene codon optimized to optimize silkworm mutants of anemone- (PFibH), and producing the transformed silkworm transformed silkworm transformed with silkworm silkworm transformed with the recombinant expression vector.

Another object of the present invention is to provide a method for mass-producing red fluorescent silks using the transgenic silkworm according to the present invention.

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not intended to limit the invention to the particular embodiments that are described. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not restrictive of the invention, There will be.

In order to achieve the above object, the present invention provides a recombinant expression vector comprising a marker gene-regulated promoter, a marker gene, a silkworm-derived fibroin promoter, and a gene construct operably linked to an anemone-derived red fluorescent gene Lt; / RTI >

The red fluorescent gene is an mKate2co gene, which mutates mKate2 gene through codon optimization. Especially, the mKate2co gene is composed of the nucleotide sequence of SEQ ID NO: 1.

The marker gene-regulated promoter is a 3xP3 promoter.

The marker gene is an EGFP (green fluorescent protein) gene.

The gene construct is characterized in that it has the structure of FIG.

And the expression vector is a piggyBac vector.

The present invention provides a transgenic silk producing a red fluorescent silk produced by transforming the recombinant expression vector according to the present invention into silkworm (Bombyx mori) or silkworm eggs.

In addition,

1) preparing the recombinant expression vector according to the present invention;

2) transforming the recombinant expression vector of step 1) into silkworm eggs to produce transformed silkworm eggs; And

3) hatching the transformed silkworm in step 2) to produce a transformed silkworm. The present invention also provides a method for producing a transformed silkworm producing red silkworm comprising the step of:

The transformation of step 2) is characterized by using microinjection.

In step 3), a method of confirming the expression of the above-mentioned marker gene in a transformed silkworm after i) introducing a marker gene into an expression vector or ii) a method of confirming the expression of a red fluorescent gene in a transformed silkworm The method comprising the step of selecting a transgenic silkworm.

In addition,

1) preparing the recombinant expression vector according to the present invention;

2) transforming the recombinant expression vector of step 1) into silkworm or silkworm to produce a transformed silkworm; And

3) culturing the transformed silkworm of step 2) to obtain silk, and a method of mass-producing the red fluorescent silk.

The red fluorescent silk produced by the transgenic silkworms of the present invention exhibits a pale natural red color even in natural light, so that it is environmentally friendly and very economical since no additional dyeing is required. In addition, the red fluorescent silk exhibits red fluorescence speckled in the dark when light of a specific wavelength is shot, so that it can be applied to materials such as high-end fashion garments and wallpaper having a much higher added value than general silk. In particular, the silkworm farmers can contribute to the income increase by breeding the transgenic silk producing the red fluorescent silk which can be used as the material of the high quality fashion clothes differentiated from the general silkworms currently being raised.

Fig. 1 is a diagram showing the structure of a transition vector (p3xP3-EGFP-pFigH-mKate2co).
Fig. 2 shows fluorescence of EGFP of G2-transgenic silkworm.
A shows that fluorescence appears in the eye and nervous system of the F1 7th embryo in the case of eggs. At this time, the arrow indicates the eye and the nervous system.
B shows that fluorescence appears in the eye of the F1 lizard in the larval case. At this time, the arrow marks the eye.
C shows that in the case of the pupa, fluorescence appears in the eye. At this time, the arrow marks the eye.
D shows fluorescence in the eyes in the case of an adult. At this time, the arrow marks the eye.
Fig. 3 shows mKate2co fluorescence in the silkgland on the third day of the fifth instar of the F2-transformed silkworm.
A shows the silk lines observed under bright field conditions.
B shows the silk lines observed under red fluorescence system conditions.
Fig. 4 is a figure showing mKate2co fluorescence in the cocoon of a transgenic silkworm.
A shows a pair of cocoon cocoons observed under bright field conditions.
B shows a pair of cocoon cocoons observed under red fluorescence system conditions.

Hereinafter, the present invention will be described in detail.

The present invention provides a recombinant expression vector comprising a marker gene-regulated promoter, a marker gene, a silkworm-derived fibroin promoter, and a gene construct operably linked to an anemone-derived red fluorescent gene.

In the recombinant expression vector, the red fluorescent gene is preferably mKate2co gene that mutates mKate2 gene through codon optimization, but is not limited thereto. The mKate2co gene is preferably composed of the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto. The mKate2co gene may also include one or two or more bases inserted, deleted or substituted in the nucleotide sequence.

In the recombinant expression vector, the fibroin promoter is preferably a silkworm-derived fibroin H promoter (pFibH).

In the recombinant expression vector, the marker gene-regulated promoter is preferably a 3xP3 promoter, but not limited thereto, and any promoter capable of expressing the marker gene can be used.

In the recombinant expression vector, all of the genes that express the fluorescent protein can be used as the marker gene, and it is more preferable to use EGFP (green fluorescent protein) gene, but the present invention is not limited thereto.

In one embodiment of the present invention, a fluorescent protein (EGFP) was used as a marker gene for the selection of transformants, and a 3xP3 promoter specifically expressed in the eye and nervous system was used to regulate the expression of the marker gene.

In the recombinant expression vector, the gene construct preferably has a construct comprising the structure of FIG. 1, but is not limited thereto.

In the recombinant expression vector, the expression vector into which the gene construct is introduced is preferably a piggyBac vector, but is not limited thereto.

The present invention also provides a transformed silkworm producing a red fluorescent silk prepared by transforming the recombinant expression vector according to the present invention into silkworm (Bombyx mori) or silkworm eggs.

Long repeated sequences of the fibroin H-chain form a crystal structure by hydrophobic interaction. Two factors are necessary to form such a structure. First, the N-terminal and C-terminal of the H-chain should have a signal sequence to secrete the fibroin molecule into the silk. Second, the 20th cysteine residue of the H-chain C-terminal and 172 The cysteine residue must form a disulfide bond. Therefore, in the present invention, a silkworm transformant expressing a red fluorescent protein gene as a recombinant protein in the fibroin H-chain was constructed based on such a system.

In addition,

1) preparing the recombinant expression vector according to the present invention;

2) transforming the recombinant expression vector of step 1) into silkworm eggs to produce transformed silkworm eggs; And

3) hatching the transformed silkworm in step 2) to produce a transformed silkworm. The present invention also provides a method for producing a transformed silkworm producing red silkworm comprising the step of:

In the above method, the transformation in step 2) is preferably performed using microinjection, but not limited thereto, and all known transformation methods can be used.

In the method, in the step 3), the step of selecting a transgenic silkworm may be further included by one of the following methods.

i) a method of inserting a marker gene into an expression vector and then confirming the expression of the marker gene in the transformed silkworm; or,

ii) a method for confirming expression of a red fluorescent protein gene in a transgenic silkworm.

In one embodiment of the present invention, silkworm eggs were transformed with the recombinant expression vector using a known microinjection method, and some of them were hatched with larvae, and some adult moths were mated with each other to generate F1 generations Of silkworm eggs were obtained. Then, the transgenic plants were selected by observing the expression of the marker gene in the eye or nerve tissue in the early embryo, larva, pupa, or adult after spawning of the F1 generations. Then, finally, only these were crossed to obtain F2 generation transformants (see Table 1 and Fig. 2).

In one embodiment of the present invention, the obtained F2 generation transformant was dissected and the rear silk gland was observed with a fluorescence microscope to confirm the production of red fluorescent silk. As a result, the expression of red fluorescence was observed in the posterior silk gland, And the expression of red fluorescence was also observed in the middle silk gland producing sericin (see FIGS. 3 and 4).

In addition,

1) preparing the recombinant expression vector according to the present invention;

2) transforming the recombinant expression vector of step 1) into silkworm or silkworm to produce a transformed silkworm; And

3) culturing the transformed silkworm of step 2) to obtain silk, and a method of mass-producing the red fluorescent silk.

Hereinafter, the present invention will be described in detail by the following examples.

However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

< Example  1> Construction of transformation vector for transformation

In order to produce transgenic silkworms expressing red fluorescent protein in silkworm silk, fibroin promoter and mKate2co gene were introduced into piggyBac vector.

First, to obtain the fibroin promoter, the fragment containing the 1,124 bp promoter sequence and the intron (972 bp) of the fibroin H gene (nt 61, 312 - 63, 870 nt) at the 1,430 bp N-terminus contained genomic DNA isolated from silkworm (PFibHN-F: 5'-GGCGCGCCGTGCGTGATCAGGAAAAAT-3 '(SEQ ID NO: 2) (27 mer)) and pFibHN-R: 5'-TGCACCGACTGCAGCACTAGTGCTGAA-3' , And cloned into pGEM-T Easy Vector System (Promega, Madison Wis.). The completed plasmid was named 'pGEMT-pFibH-NTD'.

Fragments containing the 300 bp 3 'region of the 180 bp 3' end of the H-chain gene ORF and the fibroin H gene (nt 79,021 - 80,009 of AF226688) (SEQ ID NO: 4) (27 mer) and pFibHC-F: 5'-TATAGTATTCTTAGTTGAGAAGGCATA-3 '(SEQ ID NO: 5) (27 mer)) and pGEM-T Easy Vector System (Promega, USA). The completed plasmid was named 'pGEMT-CTD'.

Then, fragments were prepared by restriction enzyme treatment of 'pGEMT-pFibH-NTD' with Asc I and BamH I and 'pGEMT-CTD' with Sal I and Fse I, respectively. These fragments were cloned together into a restriction enzyme treated pBluescriptII SK (-) vector (Stratagene, CA) with Apa I and Not I, and named as pFibHNC-null.

mKate2co gene (ATGGTGAGCGAGCTTATAAAGGAGAATATGCATATGAAACTTTACATGGAAGGCACCGTGAACAACCACCACTTCAAATGCACATCTGAAGGTGAAGGTAAACCGTACGAAGGCACTCAAACTATGAGAATCAAGGCGGTTGAAGGCGGCCCTTTGCCTTTCGCCTTCGACATTTTGGCTACCTCGTTTATGTACGGTAGCAAAACTTTCATCAACCACACGCAGGGTATTCCCGATTTTTTTAAGCAGTCCTTCCCGGAAGGCTTCACATGGGAGAGGGTCACGACATATGAGGACGGGGGCGTCTTAACCGCTACGCAAGACACCTCTCTCCAAGACGGATGCTTGATCTATAATGTCAAGATCCGTGGTGTGAATTTTCCATCCAACGGTCCAGTAATGCAGAAAAAGACACTCGGCTGGGAGGCCTCAACAGAGACTCTGTACCCGGCTGACGGAGGCCTGGAAGGACGCGCAGATATGGCACTGAAACTCGTAGGCGGAGGACATCTGATATGTAACTTGAAGACTACGTACAGATCAAAGAAGCCAGCTAAAAATTTAAAGATGCCCGGAGTTTACTATGTTGATCGCCGGCTAGAAAGAATTAAGGAAGCCGATAAGGAGACCTATGTCGAACAGCATGAGGTTGCCGTGGCGCGTTACTGTGATCTACCTAGTAAATTAGGGCACCGA) no termination codon is a codon optimized gene for mKate2 (ATGGTGAGCGAGCTGATTAAGGAGAACATGCACATGAAGCTGTACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATCAAGGCGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGGCAGCAAAACCTTCATCAA In CCACACCCAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCCGAGGGCTTCACATGGGAGAGAGTCACCACATACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGGAGGCCTCCACCGAGACCCTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAGCCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAACTTGAAGACCACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTCTACTATGTGGACAGAAGACTGGAAAGAATCAAGGAGGCCGACAAAGAGACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAGATGA) by a codon mutation (codon optimization) was produced using the gene synthesis process that allows the optimization expressed in silkworm (done in Bioneer), was cloned into the pGEM-T easy vector (Promega Co.). The plasmid was restriction enzyme treated with Not I and Bbvc I, and the isolated fragment was cloned into 'pFibHNC-nul' which was restriction enzyme treated with Not I and Bbvc I. The completed plasmid was named &quot; pFibHNC-mKate2co &quot;.

Finally, 'pFibHNC-mKate2co' was restriction enzyme treated with Asc I and Fse I and the isolated fragment was cloned into 'pG-3xP3-EGFP' which was restriction enzyme treated with Asc I and Fse I. At this time, the EGFP gene was used as a marker gene for selecting the transformant, and the 3xP3 promoter was used as a regulatory promoter of the EGFP gene. The completed plasmid was named 'pG-3xP3-EGFP-pFibH-mKate2co' (Fig. 1).

< Example  2> Preparation and selection of silkworm transformants

<2-1> Preparation and breeding of silkworm

The silkworm (125 x 140) was used for the transgenic silkworm (Bombyx mori, using silkworms from the National Academy of Agricultural Science, National Institute of Agricultural Science and Technology) and standard feeding standards (temperature, 24 ℃ - 27 ℃; Relative humidity, 70% - 90%). The silkworm eggs used for transformation were used only within 4 hours after spawning.

<2-2> Production of silkworm transformant

The production of silkworm transformants was carried out with reference to the microinjection method used by Tamura et al. In 2000 (Tamura T, Thibert C, Royer C, Kanda T, Abraham E, Kamba M, Komoto N, Thomas JL, Mauchamp B, Chavancy G, Shirk P, Fraser M, Prudhomme JC, Couble P (2000) Germline transformation of the silkworm Bombyx mori L. using a piggyBac transposon-derived vector. Nat Biotechnol 18, 81-84.

Specifically, the concentration ratio of the transition vector 'pG-3xP3-EGFP-pFibH-mKate2co' prepared in Example 1 and the helper plasmid pHA3PIG was 1: 1 (200 ng / And diluted to a concentration of 0.2 μg / μl in a buffer solution for microinjection (5 mM KCl, 0.5 mM Phosphate buffer, pH 7.0). The microinjection of the silkworm early blastocyst was injected into the middle part of the middle between the main and posterior parts of the embryo. The procedure was as follows. First, a small hole is drilled in the railing of the silkworm with a tungsten needle, the tip of the microcapillary containing the DNA solution is inserted into the hole, and the DNA solution is injected into the egg using the air pressure of the microinjector Respectively. At this time, the amount of DNA solution injected into each embryo was 10-15 nl, and the hole in the railing was blocked with a cyanocrylate adhesive. A total of 1020 silkworm eggs were microinjected. After microinjection, silkworm eggs were placed in a moistened patridish and protected until incubated at 25 ° C.

<2-3> Screening of silkworm transformants

Selection of silkworm transformants was performed by fluorescence microscopy. Specifically, the silkworms were selected for each generation and period by using a LEICA MZ16FA microscope (Leica, USA) and a Microscope MZ FLIII Flourescence Filter EGFP fluorescence filter (Leica, USA). According to the previously reported documents, the 3xP3 promoter is known to act in the eyes and nervous tissues of the silkworm early stage, larvae and pupae, and adult eyes, and thus the transformants were selected based on these characteristics.

As a result, 60 larvae hatch. Twenty adult moths were mated with each other to obtain silkworm eggs of the F1 generation. The eggs were observed under fluorescent microscope for selection of transformants. In addition, green fluorescence was observed in the eyes and nerve tissues of the silkworms from the third day after spawning, and a total of 14 transformants (Broods) were selected (Table 1). In addition, the larvae, pupae, and adults with green-fluorescent eyes were selected in the selected agar (Fig. 2). Finally, the transformants of the F2 generation were selected by crossing only these genes.

Transformation ratio of Construct DNA to Geomorphology embryo Injected embryo A hatched embryo G0 brood EGFP positive
G1 Agu 1,020 grains 60 grains 20 grains 14 grains

It was used as a host species. Vector plasmid p3xP3-EGFP-pFibH-mKate2co (200 ng / ul) and helper plasmid (200 ng / ul) were used for injection.

<2-4> Red fluorescence Silk  Selection

For the selection of red fluorescent cocoons, LEICA Z6 APO microscope from Leica (USA) and Filtersystem 530 LED from Leica (USA) were used. Generally, the process of silk formation is the formation of fibroin in the rear silk gland of the silkworm, sericin coating on the middle silk gland, and all of the silk glands are eluted through the silk gland from the silk gland. Therefore, in order to confirm the expression of red fluorescent protein in fibroin, the 5th and 3rd day silkworms of F2 generation were dissected and the rear silkworms were confirmed by fluorescence microscope.

As a result, the expression of red fluorescence could be observed in the posterior silk gland, which is an organ for producing fibroin, and the expression of red fluorescence could also be observed in the middle silk gland producing sericin (FIG. 3). In addition, it was confirmed that mKate2co recombinant protein was expressed normally in fibroin by observing red fluorescence in the F2 generation cocoon (Fig. 4).

As such, the red fluorescent silk produced by the transitional silk exhibits a pale natural red color even in natural light, so that it is environmentally friendly and very economical, since no additional dyeing is required. In addition, the red fluorescent silk exhibits red fluorescence speckled in the dark when light of a specific wavelength is shot, so that it can be applied to materials such as high-end fashion garments and wallpaper having a much higher added value than general silk. In particular, the silkworm farmers can contribute to the income increase by breeding the transgenic silk producing the red fluorescent silk which can be used as the material of the high quality fashion clothes differentiated from the general silkworms currently being raised.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. You can implement the examples. The scope of the present invention is defined by the appended claims, and all differences within the scope of the claims are to be construed as being included in the present invention.

Claims (12)

A recombinant expression vector comprising a marker gene-regulated promoter, a marker gene, a silkworm-derived fibroin promoter, and a gene construct operably linked to an anemone-derived red fluorescent gene.
2. The recombinant expression vector according to claim 1, wherein the red fluorescent gene is mKate2co gene which mutates mKate2 gene through codon optimization.
3. The recombinant expression vector according to claim 2, wherein the mKate2co gene comprises the nucleotide sequence of SEQ ID NO: 1.
2. The recombinant expression vector according to claim 1, wherein the marker gene-regulated promoter is a 3xP3 promoter.
The recombinant expression vector according to claim 1, wherein the marker gene is an EGFP (green fluorescent protein) gene.
2. The recombinant expression vector according to claim 1, wherein the gene construct comprises the structure of FIG.
2. The recombinant expression vector according to claim 1, wherein the expression vector is a piggyBac vector.
A transformed silkworm producing a red fluorescent silk, which is produced by transforming the recombinant expression vector of any one of claims 1 to 7 into silkworm (Bombyx mori) or silkworm.
1) preparing a recombinant expression vector according to any one of claims 1 to 7;
2) transforming the recombinant expression vector of step 1) into silkworm eggs to produce transformed silkworm eggs; And
3) hatching the transformed silkworm in step 2) to produce a transformed silkworm, wherein the transformed silkworm is produced.
[Claim 11] The method according to claim 9, wherein the transformation in step 2) is performed using microinjection.
[Claim 11] The method according to claim 9, further comprising the step of selecting the transgenic silkworm by one of the following methods in the step 3):
i) a method of inserting a marker gene into an expression vector and then confirming the expression of the marker gene in the transformed silkworm; or
ii) a method for confirming the expression of a red fluorescent gene in a transgenic silkworm.
1) preparing a recombinant expression vector according to any one of claims 1 to 7;
2) transforming the recombinant expression vector of step 1) into silkworm or silkworm to produce a transformed silkworm; And
3) culturing the silkworm transformed in step 2) to obtain silk.

Images