KR20140046688A

KR20140046688A - Melting curve analysis using pna probe comprising reporter and quencher, method and kit for analyzing nucleotide polymorphism using melting curve analysis

Info

Publication number: KR20140046688A
Application number: KR1020120112365A
Authority: KR
Inventors: 조군호; 김성기; 박희경; 박창식; 김세련; 김용태; 김수남
Original assignee: 주식회사 파나진
Priority date: 2012-10-10
Filing date: 2012-10-10
Publication date: 2014-04-21
Also published as: KR102018317B1

Abstract

The present invention includes a PNA probe for detecting nucleotide polymorphism of a target gene, a fusion curve analysis method for detecting a nucleotide polymorphism of a target gene using the same, a nucleotide polymorphism analysis method of a target gene including the fusion curve analysis method and a PNA probe It relates to a kit for detecting the base polymorphism of the target gene. The PNA probe according to the present invention may comprise a negative charge. The modified PNA probe according to the present invention includes a molecule having a negative charge, and thus has a high recognition ability and binding ability with a target DNA, and is rapidly dissociated by heat so that it is relatively easy to analyze even in a heterozygous sample in which two melting curve graphs appear. In addition, two or more single nucleotide sequence mutations adjacent to each other can be analyzed simultaneously.

Description

Melting curve analysis method using a PNA probe combined with a reporter and quencher, nucleotide polymorphism analysis method by fusion curve analysis and nucleotide polymorphism analysis kit. {Melting curve analysis using PNA probe comprising reporter and quencher, Method and Kit for analyzing Nucleotide Polymorphism using melting curve analysis}

The present invention provides a melting curve analysis method using a modified PNA probe, a reporter and a quencher coupled PNA probe for detecting the base polymorphism of the target gene, a method for analyzing the base polymorphism of the target gene using the same, and a target including a PNA probe. The present invention relates to a kit for detecting a base polymorphism of a gene.

Single Nucleotide Polymorphism (SNP) is a genetic variation in which one nucleotide sequence is substituted in a DNA nucleotide sequence, and brings about individual differences such as the cause of a disease or a response to a therapeutic agent. Attention is focused on the detection and identification of single nucleotide sequence mutations, as well as the development of new drugs.

Various detection methods using real-time PCR technology have been used for the rapid detection of single nucleotide sequence mutations. Typically, there is a method using an DNA intercalating fluorescent material, a method using a DNA probe, or a method using a PNA probe.

Single nucleotide sequence analysis using DNA intercalating fluorophores can distinguish base changes in PCR amplicons by saturation concentration of DNA intercalating fluorophores without further manipulation of the product after PCR reaction. Can be. However, there are limitations in using DNA intercalating fluorescent material, and only one single sequence variation can be analyzed at a time, and the disadvantage of using a program for analyzing the melting curve is [Kirk M. Ririe, et al., ANALYTICAL BIOCHEMISTRY 245, 154160, 1997; U. Hladnik et al., Clin Exp Med 2, 105108, 2002]

DNA probes used for melting curve analysis include MGB Taqman probe, Molecular Beacon (MB) and Binary probe. While these methods have the advantage of distinguishing single nucleotide sequences, the short length of the DNA probe is about 20 to 40 mer, so that the single nucleotide sequences that are adjacent to each other are difficult to detect in one reaction. Hidefumi Sasaki et a., Clin Cancer Res 11, 2924-2929, 2005; Manna Zhang et al., HEPATOLOGY, 36, 3, 2002]

The melting curve analysis method using the conventional PNA probe can bind to target DNA faster and stronger than DNA probe, and the short binding probe can be used due to the strong binding, so that the detection of single nucleotide sequence adjacent to each other is possible. Has

Chen, C. Y., et al., Clin. Chem. 50, 481-489, 2004 M Beau-Faller et al., British Journal of Cancer 100, 985 992, 2009

It is an object of the present invention to provide a PNA probe for detecting base polymorphism of a target gene. Particularly preferably, the PNA probe has a negative charge introduced therein.

Another object of the present invention is to provide a melting curve analysis method for detecting the base polymorphism of the target gene using the PNA probe and a base polymorphism analysis method including the same.

Another object of the present invention to provide a kit for detecting polymorphism of the target gene containing the PNA probe.

In order to achieve the object of the present invention, the present invention provides a PNA probe combined with a reporter and a quencher for detecting nucleotide polymorphism of the target gene.

The PNA probe preferably includes a negatively charged molecule, but is not limited thereto. The negatively charged molecule may be at least one selected from the group of all acids of phosphoric acid, carboxylic acid, sulfonic acid, nitric acid, and boric acid.

In addition, the negatively charged molecules may be bound to the N, C, or alpha, beta, and gamma positions of the PNA backbone of the PNA probe, and at least one negatively charged molecule may be continuously and intermittently bound to the base of the probe.

In order to achieve the object of the present invention provides a melting curve analysis method using a PNA probe combined with a reporter and a quencher.

The PNA probe used in the melting curve analysis method preferably includes negatively charged molecules, but is not limited thereto. The use of PNA probes with negative charges increases the melting curve resolution, making it easier to analyze heterozygous samples.

The PNA probe comprising the negatively charged molecule according to the present invention may comprise one or more negatively charged molecules selected from the group of all acids of the phosphoric acid, carboxylic acid, sulfonic acid, nitric acid, boric acid series. The negatively charged molecule can be bound to the N, C, or alpha, beta, gamma positions of the PNA backbone of the PNA probe, and at least one negatively charged molecule can bind to the base of the probe continuously and intermittently.

In addition, the PNA probe may include a fluorescent material. The fluorescent material may be a reporter and a quencher, and may be an intercalating fluorescent material.

In order to achieve another object of the present invention, there is provided a method for analyzing base polymorphism of a target gene using a PNA probe containing a negatively charged molecule.

The base polymorphism analysis method of the target gene can be used to analyze the melting curve.

PNA can be used as a probe of real-time PCR technology that detects single nucleotide sequence mutations because it has better thermal and biological stability than DNA and the ability to recognize and bind to target DNA. However, since the real-time PCR method uses a fluorescent material to detect the target DNA in the sample, there is a problem that a probe having two different wavelengths of a fluorescent material is required to detect a single base mutation at one position. This acts as a big limitation in performing multiplex detection. In order to solve this problem, the present invention can be solved through the melting curve analysis of the fluorescent probe. However, when the melting curve analysis is performed using an unmodified PNA probe, the result of the analysis of the heterozygote sample is not clear because the half curve at half maximum of the graph is wide. Accordingly, the present inventors were able to clarify the analysis of the melting curve by rapidly dissociating the PNA probe and the target DNA as the temperature was increased by binding the amino acid having a negative charge to the basic skeleton of the PNA probe. A schematic diagram of this is shown in FIG. 1.

The PNA probe according to the present invention can be applied to various molecular diagnostic techniques, such as the following examples, due to the narrow half width at half maximum of the melting curve graph. For example, if the polymorphism occurs at codons at multiple positions within a short sequence, the resolution curve is high. Therefore, whether the polymorphism occurred at one position or at two or several positions, one PNA probe was used. Can be detected. In addition, since the resolution of the melting curve is high, the melting curves are distinguished from each other according to the bases at the positions where the base diversity occurs. As a result, the base sequences can be easily determined without a separate analysis such as sequencing analysis.

The melting curve analysis method for detecting the base polymorphism using the PNA probe according to the present invention is capable of multiple detection of the base polymorphism as the resolution of the melting curve increases, and even if a single nucleotide sequence exists adjacent to each other. To be able.

In addition, similar effects can be obtained when not only PNA probes having a negatively charged amino acid according to the present invention but also bases that form incomplete complementary binding (mis-match) are introduced at positions other than the single nucleotide sequence position of the target DNA.

For another object of the present invention, the present invention comprises the steps of separating the target DNA from the sample sample;

Hybridizing the target DNA with the PNA probe to which the reporter and quencher is bound;

Melting the hybridized product while changing temperature to obtain a melting curve; And

It provides a method for analyzing the polymorphism of the target DNA comprising the step of analyzing the obtained melting curve.

Preferably, the PNA probe used in the nucleotide polymorphism analysis method and the melting curve analysis method of the target gene includes a negative charge. The PNA probe comprising a negative charge may comprise one or more negatively charged molecules selected from the group of all acids of the phosphoric acid, carboxylic acid, sulfonic acid, nitric acid, boric acid series. The negatively charged molecule can be bound to the N-terminal, C-terminal, or alpha, beta, gamma positions of the PNA backbone, and at least one negatively charged molecule can bind to each base of the PNA probe continuously and intermittently.

In addition, the PNA probe used in the nucleotide polymorphism analysis method and the melting curve analysis method according to the present invention may include a fluorescent material. The probe may combine a reporter and a fluorescent material of a quencher capable of quenching the reporter fluorescence at both ends, and may include an intercalating fluorescent material. The reporter may be one or more selected from the group consisting of FAM (6-carboxyfluorescein), Texas red, JOE, TAMRA, CY5, CY3, the quencher is TAMRA (6-carboxytetramethyl-rhodamine). BHQ1, BHQ2 or Dabysyl Preferred but not limited to use. The intercalating fluorescent materials include acridine homodimer and derivatives thereof, acridine orange and derivatives thereof, 7-aminoactinomycin D (7-AAD) and Derivatives thereof, Actinomycin D and derivatives thereof, ACMA (9-amino-6-chloro-2-methoxyacridine) and derivatives thereof, DAPI and derivatives thereof, dihydroethidium (Dihydroethidium) and its derivatives, Ethidium bromide and its derivatives, Ethidium homodimer-1 (EthD-1) and its derivatives, Ethidium homodimer-2 (EthD-2) and its derivatives, ethidium Ethidium monoazide and its derivatives, Hexidium iodide and its derivatives, bisbenzimide (Hoechst 33258) and its derivatives, Hoechst 33342 and its derivatives, arc Hoechst 345 80) and derivatives thereof, hydroxystilbamidine and derivatives thereof, LDS 751 and derivatives thereof, Propidium Iodide (PI) and derivatives thereof, Cy-dyes ) Derivatives.

The PNA probe coupled to the negatively charged molecule used in the method for analyzing the base polymorphism of the target gene may include a reporter and a quencher. The PNA probe including the negatively charged molecule, the reporter, and the quencher hybridizes with the target DNA, and then generates a fluorescent signal. As the temperature increases, the PNA probe rapidly melts with the target DNA at the proper melting temperature of the probe due to the negative charge effect, thereby quenching the fluorescent signal. The negative charge-containing PNA probe increases dissociation with the target DNA faster than the negative charge-free PNA probe, thereby increasing the resolution of the melting curve. The base polymorphism of the target DNA can be analyzed through a high resolution melting curve analysis obtained from the fluorescent signal according to the temperature change.

In addition, the PNA probe coupled to the negatively charged molecule used in the method for analyzing the base polymorphism of the target gene may include an intercalating fluorescent material. The probe combined with the negatively charged molecule and the intercalating fluorophore hybridizes with the target DNA to generate a fluorescence signal. It is possible to analyze target polymorphism of target DNA through high resolution melting curve analysis.

In addition, the method for analyzing the base polymorphism of the target gene according to the present invention may include analyzing the melting curve obtained by using the fluorescence signal detection without intercalating fluorescent material directly attached to the probe.

For still another object of the present invention, a kit for nucleotide polymorphism analysis of a target gene using a melting curve analysis method of a PNA probe with a reporter and a quencher is provided. The kit preferably includes a PNA probe to which a reporter and a quencher are coupled, and more preferably, the PNA probe includes a negative charge, but is not limited thereto.

The base polymorphism analysis kit may be used to analyze base polymorphism of multiple target DNA or single target DNA.

The PNA probe according to the present invention has high recognition ability and binding ability with a target DNA by binding an amino acid having a negative charge to a basic skeleton, and can be rapidly dissociated by heat. Therefore, the base polymorphism analysis method using the PNA probe including the negative charge of the present invention is relatively easy to analyze even in heterozygotes in which two melting curve graphs appear, and can simultaneously analyze two or more adjacent single nucleotide sequences. Has an advantage. Here, the ease of melting curve analysis is not limited only to the heterozygous sample, but also applicable to homozygous samples.

1 is a schematic diagram and a melting curve graph of a PNA probe bound to a target DNA.
(a) Using a PNA probe that combines amino acids with negative charges.
(b) using an unmodified PNA probe.
Figure 2 shows a melting curve graph of the PNA probe by binding to heterozygous samples with a single nucleotide sequence variation.
(a) When using a sample in which a unmodified PNA probe and a DNA oligomer of SEQ ID NOs: 10 and 11 in Table 2 were mixed 1: 1.
(b) When a sample in which a gamma glutamic acid-coupled PNA probe and a DNA oligomer of SEQ ID NOs: 10 and 11 in Table 2 were mixed in a 1: 1 ratio was used.
(c) When a sample in which the unmodified PNA probe and the DNA oligomers of SEQ ID NOs: 10 and 12 of Table 2 were mixed in a 1: 1 ratio was used.
(d) When a sample in which a gamma glutamic acid-bound PNA probe and a DNA oligomer of SEQ ID NOs: 10 and 12 in Table 2 were mixed in a 1: 1 ratio was used.
(e) When using a sample in which the unmodified PNA probe and the DNA oligomers of SEQ ID NOs: 10 and 13 in Table 2 were mixed 1: 1.
(f) When a sample in which a gamma glutamic acid-coupled PNA probe and a DNA oligomer of SEQ ID NOs: 10 and 13 in Table 2 were mixed in a 1: 1 ratio was used.
Figure 3 shows a melting curve graph of the PNA probe by binding to a heterozygous sample having a single nucleotide sequence variation.
(a) For PNA probes that do not bind gamma glutamic acid.
(b) For a PNA probe where two gamma glutamic acids bind with two bases in between.
(c) For PNA probes in which two gamma glutamic acids are bound in series without intervening bases.
(d) For PNA probes where two gamma glutamic acids bind with one base in between.
4 shows that three PNA probes bound with gamma glutamic acid perform multiple detection. The black line is the melting curve by the PNA probe of SEQ ID NO: 2, the blue line is the melting curve of the PNA probe of SEQ ID NO. 7, the red curve is the melting curve of the PNA probe of SEQ ID NO.
(a) When tested with homozygous samples consisting of three PNA probes bound to gamma glutamic acid and a target DNA oligomer complementary to each probe.
(b) Experiments with homozygous samples consisting of three PNA probes bound to gamma glutamic acid, and a target DNA oligomer with incomplete complementary binding to each probe with a single nucleotide sequence.
(c) Experiments with heterozygous samples in which three PNA probes bound with gamma glutamic acid, each probe, and the target DNA oligomer used in (a) and (b) above were mixed at a 1: 1 ratio.
FIG. 5 shows that three PNA probes bound with gamma glutamic acid perform multiple detection when a single nucleotide sequence is located adjacent to each other. FIG. The black line is the melting curve by the PNA probe of SEQ ID NO: 2, the blue line is the melting curve of the PNA probe of SEQ ID NO. 7, the red curve is the melting curve of the PNA probe of SEQ ID NO.
(a) Using three PNA probes bound with gamma glutamic acid and the DNA oligomer of SEQ ID NO: 19 in Table 2.
(b) using three PNA probes bound with gamma glutamic acid and the DNA oligomer of SEQ ID NO: 20 in Table 2.
(c) When a mixture of three PNA probes bound with gamma glutamic acid and a DNA oligomer of SEQ ID NOs: 19 and 20 in Table 2 was used in a 1: 1 mixture.
6 is a graph showing a melting curve of the PNA probe by binding to various heterozygous samples having a single nucleotide sequence variation.
(a) When a sample in which the PNA probe of SEQ ID NO: 9 in Table 1 is mixed with DNA oligomers of SEQ ID NO: 21 and 22 in Table 2 is used 1: 1
(b) a sample in which the PNA probe of SEQ ID NO: 9 of Table 1 and the DNA oligomer of SEQ ID NOs: 25 and 26 of Table 2 were mixed 1: 1
(c) When a sample in which the PNA probe of SEQ ID NO: 9 in Table 1 and the DNA oligomers of SEQ ID NO: 21 and 23 in Table 2 is 1: 1 mixed is used
(d) When a sample in which the PNA probe of SEQ ID NO: 9 in Table 1 and the DNA oligomers of SEQ ID NO: 25 and 27 in Table 2 are mixed 1: 1 is used
(e) When using a sample in which the PNA probe of SEQ ID NO: 9 of Table 1 and the DNA oligomer of SEQ ID NO: 21, 24 of Table 2 were mixed 1: 1
(f) When a sample in which the PNA probe of SEQ ID NO.

Hereinafter, the present invention will be described in more detail with reference to Examples. The following examples are intended to illustrate the present invention in more detail, it is clear that the scope of the present invention is not limited to the embodiments.

[ Example 1] used in the melting curve analysis experiment PNA Probe And target DNA Oligomer Synthesis and Melting Curve Analysis Method

PNA probes as shown in Table 1 were synthesized and used for the melting curve analysis of the present invention.

Sequence of PNA probe used in the present invention SEQ ID NO: name Sequence (N '-> C') Sequence length One 861-F71 Dabcyl-CAAACAGCTGGG-OK-ROX 12 2 861-glu2-71-65 Dabcyl-CAAAC A GC T GGG-OK-ROX 12 3 858-F-78 Dabcyl-TTGGGCGGGCC-OK-ROX 11 4 858-glu2-70 Dabcyl-TTGGGCG G GC C -OK-ROX 11 5 858-glu270 Dabcyl-TTGGGCGG GC C-OK-ROX 11 6 858-glu-270 Dabcyl-TTGGGCG G G C C-OK-ROX 11 7 18-2-3 Dabcyl-TAGTTG G GA T GTAC-OK-FAM 14 8 K13_melt Dabcyl-ACGCCACC A GC T CC-OK-HEX 14 9 K Dabcyl-GAGCTTGGTGGCG-OK-FAM 13

In Table 1, O is a linker, bold letters, and underlined letters indicate γ-glutamic acid-PNA monomer (monomer), and K means lysine.

PNA probes were synthesized by solid phase synthesis from PNA monomers protected with benzothiazolesulfonyl groups and functionalized resins according to the method described in Korean Patent No. 464,261 [Lee et al ., Org. Lett., 2007, 9, 3291-3293]. In addition to this method, it is also possible to synthesize PNA using known synthesis of 9-fluorenylmethoxycarbonyl (9-fluorenylmethloxycarbonyl) or t-Boc (t-butoxycarbonyl) [Kim L. et al., J. Org . Chem. 59, 5767-5773, 1994; Stephen A. et al., Tetrahedron, 51, 6179-6194, 1995). Reporter and quencher materials were labeled with PNA probes according to methods well known in the art.

The target DNA oligomers that bind to the PNA probes were synthesized and used by Bioneer (Korea) as shown in Table 2.

Sequence of DNA oligomer used in the present invention SEQ ID NO: name Sequences (5 '-> 3') Sequence length 10 58T-61T CGCACCCAGCTGTTTGGCCTGCCCAAAATC 30 11 58T-61A CGCACCCAGCAGTTTGGCCTGCCCAAAATC 30 12 58T-61G CGCACCCAGCGGTTTGGCCTGCCCAAAATC 30 13 58C-61C CGCACCCAGCCGTTTGGCCTGCCCAAAATC 30 14 58A-61C CGCACCCAGCCGTTTGGCCAGCCCAAAATC 30 15 Tm-13-04 CATGTACGTCCCAACTACATG 21 16 Tm-13-01 CATGTACGTCACAACTACATG 21 17 2120758-G (W) AAGGTTGGAGATGGTGGCGTAGGCTA 26 18 2120758-C AAGGTTGGAGATGCTGGCGTAGGCTA 26 19 3Target_W CACCCAGCTGTTTGGAAGCATGGTACGCCACTAAGCTCCAAGGAATCGGTTGGAGATGGTGGCGTAGGCTA 71 20 3Target_M CACCCAGCAGTTTGGAAGCATGGTACGCCAGTAAGCTCCAAGGAATCGGTTGGAGATGCTGGCGTAGGCTA 71 21 K (D) CATGCGCCACCAAGCTCCATG 21 22 K (D) -0A CATGCGCCACTAAGCTCCATG 21 23 K (D) -0C CATGCGCCACGAAGCTCCATG 21 24 K (D) -0T CATGCGCCACAAAGCTCCATG 21 25 K (D) -0A CATGCGCCACTAAGCTCCATG 21 26 K (D) -1A CATGCGCCAATAAGCTCCATG 21 27 K (D) -2A CATGCGCCAGTAAGCTCCATG 21 28 K (D) -3A CATGCGCCATTAAGCTCCATG 21

1.25 uM of PNA probes listed in Table 1 above, 0.25 uM of DNA oligomers listed in Table 2, and PCR amplification solution (Engineics, Korea) were mixed and mixed with a real-time PCR machine (Real-time PCR machine, CFX96 ^™ Real-time PCR). System, Biorad, USA) for 5 minutes at 95 ℃, lowered to 40 ℃ at a rate of 0.1 ℃ per second and then maintained for 5 minutes, and then increased by 0.5 ℃ from 40 ℃ to 95 ℃ by fluorescence Dissolution curve analysis was performed.

[ Example 2] gamma glutamate Combined PNA The probe Used Single Base Sequence Variation Melting curve analysis of heterozygous samples

In order to compare the difference in the melting curve between the PNA probe to which the gamma glutamic acid is bound and the unmodified PNA probe, the PNA probes of SEQ ID NOS: 1 and 2 of Table 1 were selected from SEQ ID NO: 10 and Tables 11 to 12 to 13 of Table 2. And the oligomer mixed in a 1: 1 ratio with each of the experiments using the method of Example 1 above to analyze the melting curve.

The results are shown in Fig. When gamma glutamic acid-coupled PNA probes were used, the dissociation of the target DNA with the temperature increase due to the negative charge effect rapidly increased the resolution of the melting curve in the heterozygous sample having a single nucleotide sequence variation.

[ Example 3] PNA In the probe Combined Depending on the position of gamma glutamic acid Single Base Sequence Variation Melting curve analysis of heterozygous samples

In order to compare the difference in the melting curve according to the position of gamma glutamic acid bound to the PNA probe, the PNA probes of SEQ ID NOs: 3, 4, 5, and 6 of Table 1 were used as DNA oligomers of SEQ ID NOs: 13 and 14 of Table 2, respectively. Melting curves were analyzed by using the method of Example 1 and the samples mixed in proportion. The results are shown in Fig.

When the PNA probe with gamma glutamic acid bound to two bases was used, the two melting curves were most clearly separated from the heterozygous sample having a single nucleotide sequence variation.

[ Example 4] gamma glutamate Combined Three different PNA The probe using PNA Probes and three different homozygous samples or Single nucleotide sequence mutation Melting curve analysis on heterojunction samples

It was confirmed whether Example 2 above could be applied to multiple detection. A combination of the PNA probe of SEQ ID NO: 2 of Table 1 with a target oligomer obtained by mixing SEQ ID NOS: 10 to 11 or Table 2 in a 1: 1 ratio, and the PNA probe of SEQ ID NO: 7 of Table 1 of SEQ ID NO: 15 of Table 2 To a combination of the target oligomer with a mixture of 1 to 16 or two in a 1: 1 ratio, and a PNA probe of SEQ ID NO: 8 of Table 1 with a target oligomer of SEQ ID NO: 17 to 18 or two of Table 2 in a 1: 1 ratio The combination of was experimented using the method of Example 1 above to analyze the melting curve.

The results are shown in Fig. It was confirmed that multiple detections were also possible using a PNA probe bound to gamma glutamic acid.

[ Example 5] gamma glutamic acid Combined Three different PNA The probe Using three different Single Base Sequence Variation Melting curve analysis in heterojunction samples adjacent to each other

It was confirmed whether the multiple detection capability confirmed in Example 4 was possible even when single nucleotide sequence mutations exist adjacent to each other. The PNA probes of SEQ ID NOs: 2, 7, and 8 of Table 1 were experimented with the target oligomers of SEQ ID NOs: 19 to 20 or Table 2 in a 1: 1 ratio, using the method of Example 1, to obtain a melting curve. Analyzed. The results are shown in Fig. Using PNA probes with gamma glutamic acid, multiple detection was possible even when single nucleotide sequence mutations existed adjacent to each other.

[Example 6] target DNA Introducing bases that form incomplete complementary bonds at positions other than those of PNA The probe Used Single Base Sequence Variation Melting curve analysis on heterozygous samples

In order to confirm the effect of the PNA probe having introduced a base that forms an incomplete complementary binding to a position other than the single nucleotide sequence position of the target DNA, the PNA probe of SEQ ID NO. To a target oligomer mixed at 1: 1 ratio with one of 24 to 24, and a target oligomer mixed at 1: 1 ratio with one of SEQ ID NO: 25 and one of SEQ ID NOs 26 to 27 to 28, respectively, using the method of Example 1 Experiment was performed to analyze the melting curve.

The results are shown in Fig. The PNA probe, which has introduced a base that forms incomplete complementary binding at a position other than the single nucleotide sequence position of the target DNA, also confirmed that two fusion curves were clearly separated from the heterozygous sample having the single nucleotide sequence.

The PNA fluorescent probe developed in the present invention can be used not only for the fusion curve analysis method clearly defined in the examples, but also for all methods capable of analyzing target DNA using a fluorescent probe, for example, a real-time PCR method. It is obvious to those skilled in the art that the present invention is only an example, but is not limited thereto and may be used in all other possible ways.

<110> Panagene Inc. <120> Melting curve analysis using PNA probe comprising reporter and quencher, Method and Kit for analyzing Nucleotide Polymorphism using melting curve analysis <130> P1209113125 <160> 28 <170> Kopatentin 2.0 <210> 1 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> pna probe (861-F71) <400> 1 caaacagctg gg 12 <210> 2 <211> 12 <212> DNA <213> Artificial Sequence <220> P223 probe (861-glu2-71-65) <400> 2 caaacagctg gg 12 <210> 3 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> pna probe (858-F-78) <400> 3 ttgggcgggc c 11 <210> 4 <211> 11 <212> DNA <213> Artificial Sequence <220> P223 probe 858-glu2-70 <400> 4 ttgggcgggc c 11 <210> 5 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> pna probe (858-glu270) <400> 5 ttgggcgggc c 11 <210> 6 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> pna probe (858-glu-270) <400> 6 ttgggcgggc c 11 <210> 7 <211> 14 <212> DNA <213> Artificial Sequence <220> P223 probe (18-2-3) <400> 7 tagttgggat gtac 14 <210> 8 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> pna probe (K13_melt) <400> 8 acgccaccag ctcc 14 <210> 9 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> pna probe (K) <400> 9 gagcttggtg gcg 13 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> DNA oligomer (58T-61T) <400> 10 cgcacccagc tgtttggcct gcccaaaatc 30 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> DNA oligomer (58T-61A) <400> 11 cgcacccagc agtttggcct gcccaaaatc 30 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> DNA oligomer (58T-61G) <400> 12 cgcacccagc ggtttggcct gcccaaaatc 30 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> DNA oligomers (58C-61C) <400> 13 cgcacccagc cgtttggcct gcccaaaatc 30 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> DNA oligomers (58A-61C) <400> 14 cgcacccagc cgtttggcca gcccaaaatc 30 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA oligomer (Tm-13-04) <400> 15 catgtacgtc ccaactacat g 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA oligomer (Tm-13-01) <400> 16 catgtacgtc acaactacat g 21 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> DNA oligomer (2120758-G (W)) <400> 17 aaggttggag atggtggcgt aggcta 26 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <220> DNA oligomer (2120758-C) <400> 18 aaggttggag atgctggcgt aggcta 26 <210> 19 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> DNA oligomer (3 Target_W) <400> 19 cacccagctg tttggaagca tggtacgcca ctaagctcca aggaatcggt tggagatggt 60 ggcgtaggct a 71 <210> 20 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> DNA oligomer (3 Target_M) <400> 20 cacccagcag tttggaagca tggtacgcca gtaagctcca aggaatcggt tggagatgct 60 ggcgtaggct a 71 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> DNA oligomer (K (D)) <400> 21 catgcgccac caagctccat g 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> DNA oligomer (K (D) -0A) <400> 22 catgcgccac taagctccat g 21 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> DNA oligomer (K (D) -0C) <400> 23 catgcgccac gaagctccat g 21 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> DNA oligomer (K (D) -0T) <400> 24 catgcgccac aaagctccat g 21 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> DNA oligomer (K (D) -0A) <400> 25 catgcgccac taagctccat g 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> DNA oligomer (K (D) -1A) <400> 26 catgcgccaa taagctccat g 21 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> DNA oligomer (K (D) -2A) <400> 27 catgcgccag taagctccat g 21 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> DNA oligomer (K (D) -3A) <400> 28 catgcgccat taagctccat g 21

Claims

Melting curve analysis method for the detection of the base polymorphism of the target gene using a PNA probe with a reporter and quencher.

The melting curve analysis method of claim 1, wherein the PNA probe comprises a negatively charged molecule.

3. The melting curve analysis method of claim 1 or 2, wherein the PNA probe comprises an intercalating fluorescent substance.

The melting curve analysis method according to claim 1 or 2, comprising an intercalating fluorescent substance which does not directly bind to the probe.

The method of claim 2, wherein the negatively charged molecule is at least one selected from the group consisting of phosphoric acid, carboxylic acid, sulfonic acid, nitric acid and boric acid.

The melting curve analysis method of claim 2, wherein the negatively charged molecules are bonded to the alpha, beta, and gamma positions of the N-terminal, C-terminal, or PNA backbone, and at least one negatively charged molecule is continuously or intermittently bound.

Separating the target DNA from the sample sample;
Hybridizing the target DNA with the PNA probe to which the reporter and quencher is bound;
Melting the hybridized product while changing temperature to obtain a melting curve; And
A base polymorphism analysis method of target DNA comprising the step of analyzing the obtained melting curve.

8. The method of claim 7, wherein the PNA probe comprises a negatively charged molecule.

Kit for nucleotide polymorphism analysis of a target gene using a melting curve analysis method of the PNA probe with the reporter and quencher.

10. The kit of claim 9, wherein the kit is for nucleotide polymorphism analysis of multiple target DNA or single target DNA.

The kit of claim 9 or 10, wherein said PNA probe comprises a negatively charged molecule.