KR20140006372A - Production of minor ginsenosides using novel ginsenoside glycosidase from sanguibacter keddieii - Google Patents

Abstract

The present invention relates to a production method of fusible minor saponin by converting PPT type or PPD type ginseng saponin using transformant culture, transformant having a vector including nucleic acid coding protein or novel ginsenoside glycosidase protein. More particularly, the method uses sanguibacterkeddieii novel ginsenoside glycosidase protein. PPT or PPT type ginseng saponin including the protein, transformant culture, and its culture as active components is converted into soluble ginseng saponin. The present invention relates to the transformant to which converted composition, novel ginsenoside glycosidase protein, nucleic acid coding the protein, vector including the nucleic acid, and vector are applied.

Description

Production method of minor ginsenosides using novel ginsenoside glycosidase derived from fresh ear bacterial cardioid {Sanguibacter keddieii}

The present invention uses a novel Ginsenoside glycosidase protein, a transformant into which a vector comprising the nucleic acid encoding the protein is introduced, or a PPD type or PPT type using a culture of the transformant. The present invention relates to a method for preparing soluble minor saponins by converting ginseng saponins of, specifically, Sanguibacter. soluble ginseng using a novel ginsenoside glycosidase protein derived from keddieii ), which is easily absorbed by the body in the form of PPD or PPT-type ginseng saponin containing the protein, transformant or culture thereof as an active ingredient. A composition for converting to saponin, a novel Ginsenoside glycosidase protein, a nucleic acid encoding the protein, a vector comprising the nucleic acid and a transformant into which the vector is introduced.

Saponin means a substance in which a non-sugar moiety is composed of a plurality of ring compounds in a glycoside widely present in the plant system. Since triterpene saponin, which is a saponin component contained in ginseng or red ginseng as a major physiologically active ingredient, has a chemical structure different from that of saponin found in other plants, in order to distinguish saponin from other plant saponins, ginseng ) Glycoside is called ginsenoside.

The ginsenosides are classified as protopanaxadiol-type (PPD type) ginsenoside, protopanaxatriol-type (PPT type) ginsenoside, and oleanolin acid type based on the structure of aglycone (Oleanolic acid type) and ginsenosides. These three groups are again composed of sugar moieties (aglycones) attached by glycosidic bonds at the 3-carbon, 6-carbon and 20-carbon positions of the ring of the compound structure Location and number. The basic skeleton of the oleanolic acid-based ginsenosides is 5-ring, which is the only ginsenoside Ro, and the aglycon is oleanolic acid. At present, more than 40 ginsenosides have been isolated, most of which are PPD-type ginsenosides. Ginsenosides of the PPD type include Rb1, Rb2, Rb3, Rc, Rd, F2, Zipenoside XVII (Gypenoside XVII, GypXVII), Zipenoside LXXV (Gypenoside LXXV, Gyp LXXV), Compound O (Compound O, CO) , Compound Mc1 (C-Mc1), Rg3 (S), Compound Y (Compound Y), Compound Mc (Compound Mc), Rg3, Rh2, Compound K (Coumpound K, CK) and PPD (protopanaxadiol) do. Ginsenosides of the PPT type include Re, Rg1, Rf, Rg2, Rh1 and protopanaxatirol (PPT).

In addition, it occupies more than 90% of the ginsenosides in the ginseng, which is major ginsenoside, but it has a very low absorption rate in vivo due to its large size near 1,000 daltons. Therefore, in order to increase the efficacy of ginsenoside, it is necessary to convert major ginsenosides into minor ginsenosides that are relatively well absorbed and have better efficacy. In other words, the major gin senoside is in In order to effectively exhibit physiological activity in vivo , a conversion process of deglycosylating glucose, arabinose, rhamnose, xylose, etc. constituting the sugar is required. Major ginsenosides include Rg1, Re, Rb1, Rb2, Rc and Rd, and minor ginsenosides (rare ginsenosides) that are soluble in vivo present in trace amounts include Rg3 (S), Rg3, Rg2 (S ), Rh1 (S), Rh2, Rh2 (S), F1, F2, PPD, Zipenoside XVII, Zipenoside LXXV and Compounds K, Y, O, Mc, Mc1 (compound K, Y, 0, Mc, Mc1) and the like.

Compared to major ginsenosides, minor ginsenosides with no sugars are in vivo ( in In vivo , it shows much better activity in terms of physiological efficacy. For example, ginsenoside Rg2 inhibits glucose production in the liver through phosphorylation of GSK-3-β (Glycogen synthase kinase-3 -β) by AMP-activated protein kinase (AMPK). It is believed to have a therapeutic effect (Yuan et al., Chem Biol Interact. 2012 5; 195 (1): 35-42). In addition, the ginsenosides Rh1 and Rg2 are known to protect the rheological function of erythrocytes by inhibiting the oxidation of the SH group of the band 3 protein (Yoon et al., 2012). In this respect, it has been noted that the ginsenosides Rh1 and Rg2 will provide therapeutic efficacy in various diseases such as cancer, inflammatory neurological diseases and diabetes. Ginsenoside F1 is also known to have anti-aging and antioxidant effects. Ginsenoside F1 has been shown to protect HaCaT keratinocytes from apoptosis induced by UV _B (Lee et al., 2003) and has been shown to inhibit platelet aggregation (Wang et al., 2008). However, despite this usefulness, the pharmacological activity of ginsenoside F1 was recently reported even though it was identified in 1976. This is because ginsenoside F1 is present in ginseng leaves in small amounts, making it difficult to obtain a sufficient amount to test the biological activity of ginsenoside F1.

Methods for producing such minor ginsenosides, which are present in trace amounts, have been proposed, such as chemical decomposition methods, enzymatic methods, and synthesis methods using glycosides. However, the above-mentioned methods 1) 2) the desired components are lost during the production process, 3) the use of a catalyst unsuitable for edible purposes, or 4) the yield is low and there is still a limit to mass production.

Among enzymatic methods, enzymes which can be used include β-glucosidase, α-L-arabinopyranosidase, α-L-arabinofuranosin L-arabinofuranosidase and? -L-rhamnosidase. There have been many studies on the biotransformation of major ginsenosides using such enzymes. However, these are also ineffective as a mass production method, and there is a problem that a large cost is incurred.

In addition, β-glucosidase, α-L-arabinopyranosidase, α-L-arabinofuranosidase, and α-L-arabino furanosidase Even if it belongs to (alpha) -L-rhamnosidase, not all have the activity which can convert a major ginsenoside into minor ginsenoside. For example, Arthrobacter < RTI ID = 0.0 > It has been confirmed that beta-glucosidase, which is known to be derived from chlorophenolicus A6, has no biosynthesis activity of ginsenoside. In addition, known enzymes, such as beta-glycosidase A, an enzyme known to be capable of converting to Rb1, were insignificant even in the bioconversion activity of ginsenosides. That is, the enzymes differ in substrate and final product depending on their origin.

Korean Patent No. 10-0329259 also discloses a method for producing ginsenoside Rh2 or Rh1 by digesting the saponin pulling group of PPD type or PPT type ginsenoside with saponin alpha-glucosidase. Said saponin alpha-glucosidase of the present invention converts ginsenoside Rg3 (S) to ginsenoside Rh2. Rh1 can also be prepared from ginsenoside Rg2 using beta-lambsocidase. However, as described in Example 3 of the above patent, the saponin alpha-glucosidase has disadvantages in that germ bacteria is added to a culture medium containing a pulse and ginseng powder, and cultured to remove the cells. Therefore, it shows a low yield, which is not effective as a mass production method, has a high production cost, and can disadvantageously lose desired components during the production process.

Accordingly, the present inventors have made diligent efforts to develop a method for easily and easily obtaining a large amount of minor ginsenosides in a minor form present in trace amounts in plants such as ginseng. Ginsenoside glycosidase gene having bioconversion activity from major strain ginsenoside to minor ginsenoside was obtained from ^T strain, and the ginsenoside glycosidase encoded by the gene was ginsenoside. The present invention has been completed by developing a method for biomass conversion of various minor ginsenosides including side F1.

One object of the present invention is to provide a novel ginsenoside glycosidase protein, a vector-introduced transformant containing the nucleic acid encoding the protein, or a PPD (protopanaxadiol) type or PPT (protopanaxatriol) type saponin to convert the saponin into a soluble saponin.

Another object of the present invention is to provide a novel ginsenoside glycosidase protein, a transformant into which a vector containing a nucleic acid encoding the protein is introduced, or a culture of the transformant as an active ingredient A saponin of PPD (protopanaxadiol) type or PPT (protopanaxatriol) type, which is easy to be absorbed into the body.

Another object of the present invention is to provide a novel ginsenoside glycosidase protein.

It is still another object of the present invention to provide a nucleic acid encoding the protein, a vector comprising the nucleic acid, and a transformant into which the vector is introduced.

As one embodiment for achieving the above object, the present invention provides a novel Ginsenoside glycosidase protein, a transformant introduced with a vector comprising the nucleic acid encoding the protein, or the transformation Provided is a method for producing soluble minor saponins by converting saponins of PPD (protopanaxadiol) type or PPT (protopanaxatriol) type using a culture of a sieve.

As used herein, the term "PPD (protopanaxadiol) type saponin" refers to a ginsenoside having two numbers of hydroxyl groups (-OH) attached to a non-glycone as a dammarane-based saponin, Examples thereof include Rb1, Rb2, Rb3, Rc, Rd, Ra3, Rg3, Rh2 (S), Rs1, Compound O (CO), Compound Mc1 (C-Mc1), Compound Mc (C-Mc), Compound Y (CY) , Compound K (CK), Gifenoside LXXV (Gyp LXXV) Gifenoside XVII (Gyp XVII), F2, PPD or Rs2. For the purposes of the present invention, saponins of the PPD type are Gyp XVII, Gyp LXXV, CK, ginsenoside F2, ginsenoside Rh2, PPD, CO, CY, C-Mc1 or C by the activity of the ginsenoside glycosidase. Includes all saponins that can be converted to -Mc. In the embodiment of the present invention, it was confirmed that ginsenoside Rb1 can be finally converted to Gyp XVII, Gyp XVII to Gyp LXXV, Gyp LXXV to CK, and finally ginsenoside Rb1 to CK. It was confirmed that ginsenoside Rd can be finally converted to CK by converting ginsenoside Rd to ginsenoside F2 and ginsenoside F2 to CK, and ginsenoside Rg3 (S) is ginsenoside Rh2 ( As S), it was confirmed that ginsenoside Rh2 (S) can be converted to PPD so that ginsenoside Rg3 (S) can be finally converted to PPD. Ginsenoside Rb2 is converted to CO, CO is converted to CY, it was confirmed that ginsenoside Rb2 can be finally converted to CY, ginsenoside Rc to C-Mc1, C-Mc1 to C-Mc The conversion confirmed that ginsenoside Rc could finally be converted to C-Mc.

Saponins of the PPD type are preferably ginsenoside Rb1, ginsenoside Rb2, ginsenoside Rd, ginsenoside Rc, GypXVII, GypLXXV, ginsenoside F2, ginsenoside Rh2, ginsenoside Rg3, CO or C-Mc1, but is not limited thereto.

As used herein, the term "PPT (protopanaxatriol) type saponin" refers to ginsenoside having three hydroxyl groups attached to the non-glycolic portion, and examples thereof include ginsenoside Re, ginsenoside Rg1, Ginsenoside Rf, ginsenoside F1, ginsenoside Rg2 (S), protopanaxatriol (PPT) or ginsenoside Rh1 (S). For the purposes of the present invention, the saponins of the PPT type include all saponins that can be converted to ginsenoside Rg2 (S) or ginsenoside F1 by the activity of the ginsenoside glycosidase. In the examples of the present invention, it is confirmed that ginsenoside Re or ginsenoside Rg1 may be converted to ginsenoside Rg2 (S) or ginsenoside F1 by the activity of the ginsenoside glycosidase of the present invention. It was. The saponin of the PPT type is preferably ginsenoside Re or ginsenoside Rg1, but is not limited thereto.

The saponins of the PPD type or the PPT type may use saponins in a separated and purified form, or ginsenosides contained in the powder or extract of ginseng or red ginseng. That is, the method of the present invention may be carried out by using powder or extract of ginseng or red ginseng containing saponin as a direct starting material. Ginseng used in the present invention, it is possible to use the various well-known ginseng, goryeosam (Panax ginseng ), P. quiquefolius , P. notoginseng , P. japonicus , P. trifolium , P. pseudoginseng and P. vietnamensis However, the present invention is not limited thereto. The structure of the saponin of the PPD type or PPT type is shown in FIG. 1.

As used herein, the term "soluble minor saponin" is produced by sequentially hydrolyzing glucose on the 3rd or 20th carbon of a major PPD type saponin, which is difficult to be absorbed in the body, or a PPT type saponin. It means a minor form of saponin that is relatively easy to absorb in the body, compared to major PPD or PPT type saponins, which are produced by sequentially hydrolyzing glucose on the 6th or 20th carbon. Do not. The major form of PPD type saponin includes Rb1, Rb2, Rb3, Rc or Rd, and the major form of PPT type saponin includes, but is not limited to, Re, Rg1 or Rf. In addition, the soluble saponins are zipenoside XVII, zipenoside LXXV, compound K (CK), ginsenoside F2, ginsenoside Rh2, protopanaxadiol, compound O (CO), compound Y (CY), compound Mc1 (C-Mc1), compound Mc (C-Mc), ginsenoside Rg3 (S), ginsenoside Rg2 (S) or ginsenoside F1 can be, but is not limited thereto.

In the present invention, the term "Gyp XVII" refers to two glucose (glc → glc) refers to the minor ginsenoside in the form present, and refers to the ginsenoside of the form that is easily absorbed in the body by removing saccharides as compared to Rb1. Gifenoside LXXV (Gyp LXXV) is a minor ginsenoside in the form of two glucoses linked to carbon 20 in the basic carbon skeleton of PPD-type saponins, and the saccharides are removed as compared to Rb1 or GypXVII. Ginsenosides in easy form.

The ginsenoside Rg3 refers to a minor ginsenoside in the form of two glucoses bonded to carbon 3 in the basic carbon skeleton of the saponin of the PPD type, and the sugars are removed in the body as compared to Rb1, Rd, and Rc. It refers to ginsenosides in an easily absorbable form, wherein the ginsenoside Rg3 includes Rg3 (S) and Rg3 (R). In addition, the ginsenoside F2 is a minor ginsenoside in the form of one glucose on the 3rd and 20th carbons in the basic carbon skeleton of the PPD-type saponin, and the saccharide is removed in the body compared to the ginsenoside Rd. Ginsenoside in easy form, Ginsenoside Rh2 is a minor ginsenoside in the form of one glucose on carbon 3 in the basic carbon skeleton of PPD-type saponin, the saccharide is removed compared to Rg3 and the like Ginsenoside in the form means, ginsenoside Rh2 includes Rh2 (S) and Rh2 (R), preferably Rh2 (S), but is not limited thereto.

As used herein, the term “compound O (CO)” refers to a form in which glucose is present on carbon 3 and glucose connected to arabinopyranosyl groups on carbon 20 in the basic carbon skeleton of saponin of the PPD type. Mean minor ginsenoside, the form is free of saccharides compared to ginsenoside Rb2. In addition, the compound Mc1 (C-Mc1) is a minor ginsenoside in a form in which the glucose is connected to carbon 3 and the arabinofuranosyl group is linked to carbon 20 in the basic carbon skeleton of the saponin of the PPD type. It is a form in which saccharides are removed as compared to ginsenoside Rc. Compound K (CK) refers to minor ginsenosides in which one glucose is present at carbon 20 in the basic carbon skeleton of PPD type saponin, and compound Y (CY) is 20 in the basic carbon skeleton of PPD type saponin. Mean ginsenoside in the form of glucose in which arabopyranose is linked to carbon number 1, and compound Mc (C-Mc) is a form in which glucose of carbon number 3 is removed from compound Mc 1. It is an easy form.

In the present invention, the term "ginsenoside Rg2" refers to the minor carbon of the form in which glucose (Glc (2 → 1) Rha) exists in the basic carbon skeleton of saponin of the PPT type and the rhamnopyranosyl group is linked to the 6th carbon Means senoside, and means ginsenoside in which saccharide is removed as compared with Re to facilitate absorption into the body. The ginsenoside Rg2 includes both Rg2 (S) and Rg2 (R), preferably Rg2 (S), but is not limited thereto.

In the present invention, the term "ginsenoside F1" is a minor ginsenoside in the form of one glucose linked to carbon 20 in the basic carbon skeleton of the PPT type saponin, which is easier to absorb in the body than Re or Rg1. It is present in very small amounts in ginseng leaves.

The minor saponins are the sugars have been removed or the like than ginsenoside Rb1, Rb2, Rc or Re in In vivo physiological activity is also much better, especially ginsenoside F1 is useful as a pharmaceutical active ingredient because it has anti-aging and antioxidant functions. However, in spite of such usefulness, the minor saponins are present in trace amounts in ginseng and need to be mass-produced, and an appropriate enzyme capable of converting the minor saponins, especially ginsenoside F1, should be identified. However, even if the enzyme belongs to the same glycosidase enzyme activity can exhibit a variety of enzyme activities, such as glucosidase, cellulase, there is a need to identify an appropriate enzyme having the activity of converting major saponin to the minor saponin have. Accordingly, the present inventors isolated and identified a novel ginsenoside glycosidase having such activity, and confirmed its function.

As used herein, the term "Ginesenoside glycosidase" refers to an enzyme that hydrolyzes the glucoside molecular bonds of the chain polysaccharides of the disaccharides or more. The degree and function of the activity of ginsenoside glycosidase varies by enzyme type. For the purposes of the present invention, ginseng saponins of the PPD type are designated as phenenoside XVII, zipenoside LXXV, compound K (CK), ginsenoside F2, ginsenoside Rh2 (S), protopanaxadiol (PPD), compound O (CO) , To compound Y (CY), compound Mc1 (C-Mc1), compound Mc (C-Mc) or ginsenoside Rg3 (S) to convert saponins of PPT type to ginsenoside F1 or Rg2 (S) The type of enzyme having activity is not particularly limited, but may refer to a ginsenoside glycosidase protein, which is preferably defined by the amino acid sequence set forth in SEQ ID NO: 1. The ginsenoside glycosidase preferably has an amino acid sequence having not less than 70%, preferably not less than 80%, more preferably not less than 90%, more preferably not less than 90% , Preferably at least 95%, and most preferably at least 98%, of the amino acid sequence shown in SEQ ID NO: 1. Also, as the sequence having such similarity, a protein variant having an amino acid sequence in which a part of the sequence is deleted, modified, substituted or added is also an amino acid sequence having the same or corresponding biological activity as that of the ginsenoside glycosidase, It is self-evident that it is included in the range.

The similarity is intended to indicate a similar degree to the amino acid sequence of a wild-type protein or a nucleic acid sequence encoding the wild-type protein, and includes a sequence having the same sequence as the amino acid sequence or the nucleic acid sequence of the present invention, . This similarity can be compared with the naked eye or using a comparison program that is easy to purchase.

The ginsenoside glycosidase is an enzyme derived from Sanguibacter keddieii KACC 14479 ^T , which may be mixed with BglSk in the present invention. The ginsenoside glycosidase has a beta-glucosidase activity, and can cleave β1 → 2, β1 → 4, and β1 → 6 bonds connecting two glucose or glucose-substituted molecules. Ginsenosides of the PPD or PPT type are phenenoside XVII, zipenoside LXXV, compound K (CK), ginsenoside F2, ginsenoside Rh2, protopanaxadiol (PPD), compound O (CO), compound It can be converted to Y (CY), compound Mc1 (C-Mc1), compound Mc (C-Mc), ginsenoside Rg3 (S), ginsenoside Rg2 (S) or ginsenoside F1. However, even an enzyme having a beta-glucosidase activity does not have an activity to convert major ginsenosides to minor ginsenosides, Whether or not it is genie should be clarified. The ginsenoside glycosidase of the present invention selectively cuts 3 or 20 carbon pulls of PPD type ginsenosides and selectively cuts 6 or 20 carbon pulls of PPT type ginsenosides such as minor There is no known use of ginsenosides, and in particular, no enzyme has been reported for converting ginsenosides Re to ginsenosides F1. In addition, the ginsenoside glycosidase of the present invention has an activity capable of bioconversion by using both ginsenosides of the PPD type or the PPT type as a substrate, and thus the production of the minor ginsenosides, in particular the ginsenoside F1. It can be usefully used in the production of.

The ginsenoside glycosidase has a selective hydrolytic ability to outer and inner glucose of carbon 3 or 20 of saponins of the PPD type. Therefore, the method for preparing the minor saponin by using the ginsenoside glycosidase of the present invention is to selectively hydrolyze glucose located on carbon 3 or 20 of the saponin of PPD type zipinoside XVII, zipenoside LXXV , CK, ginsenoside F2, ginsenoside Rh2, PPD, CO, CY, C-Mc1 or C-Mc may be included without limitation if the method for producing. Representatively, in one embodiment of the present invention, it was confirmed that the ginsenoside Rb1 was converted to ginsenoside GypXVII, the GypXVII was converted to CK to prepare CK, the ginsenoside Rb2 was converted into CO, and CO was converted into CY. It was confirmed that the CY was prepared, and that the ginsenoside Rc was converted to C-Mc1 and the C-Mc1 was converted to C-Mc, thereby confirming the preparation of C-Mc1. In addition, it was confirmed that ginsenoside Rd is converted to ginsenoside F2, ginsenoside F2 is converted to CK to prepare CK, and ginsenoside Rg3 (S) is converted to ginsenoside Rh2 (S). Cenoside Rh2 (S) is converted to PPD so that the ginsenoside glycosidase of the present invention can produce such minor ginsenosides by selective hydrolysis of glucose of carbon 3 or 20 of saponin of PPD type. It was confirmed that the presence (Figs. 4 to 5).

Specifically, the ginsenoside glycosidase, in the case of ginsenoside Rb1, has a selective hydrolysis ability on carbon 3, and thus, outer glucose of two glucose moieties located at carbon 3 Can be converted to GypXVII first by hydrolysis, and GypXVII can be converted to GypLXXV by hydrolysis of glucose located at carbon 3. In the case of GypLXXV, the outer glucose of the two glucose moieties at carbon 20 can be hydrolyzed and converted to C-K. These results show that the ginsenoside glycosidase of the present invention hydrolyzes sequentially from the outer glucose of carbon 3 to the inner glucose, and then has the hydrolysis ability on carbon 20.

In the case of ginsenoside Rb2, the outer glucose of the two glucose moieties located at carbon 3 can be hydrolyzed first to be converted to CO. In the case of CO, glucose at carbon 3 can be hydrolyzed to be converted to CY. . Ginsenoside Rc can be converted to C-Mc1 by removing the outer glucose located at carbon 3, C-Mc1 can be converted to C-Mc by removing the glucose located at carbon 3. Ginsenoside Rd can be converted to F2 by removing the outer glucose of the two glucose moieties located at carbon 3, and F2 can be converted to C-K by removing the glucose at carbon 3. Ginsenoside Rg3 (S) can be converted to Rh2 (S) by removing the outer glucose of the two glucose moieties of carbon 3, and Rh2 (S) is removed from the glucose of carbon 3 to PPD. Can be switched.

In addition, the ginsenoside glycosidase has a selective hydrolytic ability to glucose located on carbon 6 or 20 of the saponin of the PPT type (Figs. 4 and 6). The ginsenoside glycosidase, in the case of ginsenoside Re, has a selective hydrolysis ability on carbon 20 of ginsenoside Re and hydrolyzes one glucose moiety located at carbon 20. It can switch to side Rg2 (S). In addition, in the case of ginsenoside Re, it can be converted to ginsenoside F1 by removing the inner glucose in the form of linked rhamnose (rha) located at carbon 6. This conversion process indicates that ginsenoside F can be produced by hydrolyzing the inner glucose to produce ginsenoside F1 irrespective of the outer rhamnose moiety of carbon 6 of ginsenoside Re. It is not known to be converted by enzymes having beta-glucosidase activity. In the case of ginsenoside Rg1, glucose located at carbon 6 can be removed and converted to ginsenoside F1.

Thus, the process for preparing soluble minor saponins of the present invention is preferably a process of converting ginsenoside Rb1 to zipenoside XVII, a process of converting zipenoside XVII to zipenoside LXXV, and a compound K (from phenenoside LXXV). Conversion of CK), conversion of ginsenoside Rd to ginsenoside F2, conversion of ginsenoside F2 to compound K (CK), conversion of ginsenoside Rg3 (S) to ginsenoside Rh2 (S) Process, conversion of ginsenoside Rh2 (S) to ginsenoside PPD, conversion of ginsenoside Rb2 to compound O (CO), conversion of compound O (CO) to compound Y (CY), ginsenoside Conversion of Rc to compound Mc1 (C-Mc1), conversion of compound Mc1 (C-Mc1) to compound Mc (C-Mc), conversion of ginsenoside Re to ginsenoside Rg2, from ginsenoside Re Ginsenoside F1 and the process switches to a binary conversion include one or more processes selected from the group consisting of transition into ginsenoside F1 from ginsenoside Rg1, but is not limited thereto. The conversion activity of this ginsenoside glycosidase is shown in FIG. 7.

Method for producing a soluble minor saponin of the present invention is transformed into a vector containing a nucleic acid encoding the ginsenoside glycosidase protein or culture of the transformant and a saponin of PPD type or PPT type It may comprise the step of reacting.

In the present invention, the term "vector" refers to a nucleic acid construct comprising an essential control element operatively linked to the expression of a nucleic acid insert, which is an expression vector capable of expressing the desired protein in a suitable host cell.

In the present invention, the term "transformation" refers to a phenomenon in which DNA is introduced as a host and DNA can be cloned as a factor of chromosome or by integration of chromosome integration, thereby introducing an external DNA into cells to cause an artificial genetic change it means.

Any transformation method of the present invention can be used, and can be easily carried out according to a conventional method in the art.

The transformant into which the vector containing the nucleic acid encoding the ginsenoside glycosidase protein of the present invention, transformed by the above method, was converted to PPD type saponin to convert phenenoside XVII, zipenoside LXXV, and CK. , Ginsenoside F2, ginsenoside Rh2, PPD, CO, CY, C-Mc1 or C-Mc has the activity to convert, and also converts the saponin of the PPT type to ginsenoside Rg2 or F1 Has activity that can be converted. The transformant is preferably converted from ginsenoside Rb1 to zipenoside XVII, from zipenoside XVII to zipinoside LXXV, and from fenenoside LXXV to compound K (CK), a saponin of PPD type. Conversion activity, conversion activity of ginsenoside Rd to ginsenoside F2, conversion activity of ginsenoside F2 to compound K (CK), conversion activity of ginsenoside Rg3 to ginsenoside Rh2, ginsenoside Rh2 (S) To ginsenoside PPD, conversion of ginsenoside Rb2 to compound O (CO), conversion of compound O (CO) to compound Y (CY), ginsenoside Rc to compound Mc1 (C-Mc1) Conversion activity, compound Mc1 (C-Mc1) to compound Mc (C-Mc), ginsenoside Re to ginsenoside Rg2, ginsenoside Re to ginsenoside F1 Means the activity and transformed with at least one binary switching activity is selected from the group consisting of a conversion activity ginsenoside F1 binary conversion from ginsenoside Rg1 one body, it is not limited.

In the present invention, the host is not particularly limited as long as it is capable of expressing the nucleic acid of the present invention. Specific examples of hosts that can be used in the present invention include Escherichia (Escherichia) bacteria belonging to the genus such as Escherichia coli (E. coli); Bacteria of the genus Bacillus such as Bacillus subtilis ; Bacteria of the genus Pseudomonas such as Pseudomonas putida ; Yeasts such as Saccharomyces cerevisiae , Schizosaccharomyces pombe ; Animal cells and insect cells.

In addition, the minor saponin may be prepared by converting saponins of the PPD type or the PPT type using a culture obtained by culturing the transformant.

The minor saponin is as described above.

In the present invention, the term "culture product" can mean a product obtained by culturing the transformant according to a known microorganism culture method. The culture of the transformant into which the expression vector containing the nucleic acid encoding the ginsenoside glycosidase was introduced converts saponins of the PPD type to zipenoside XVII, zipenoside LXXV, CK, ginsenoside F2, It has the activity to convert ginsenosides Rh2, PPD, CO, CY, C-Mc1 or C-Mc, and has the activity to convert PPT type saponin to ginsenoside Rg2 or F1. Preferably, the conversion activity of zipenoside XVII from ginsenoside Rb1 which is a saponin of PPD type, the conversion activity of zipenoside XVII to zipenoside LXXV, the conversion activity of zipenoside LXXV to compound K (CK), ginsenoside Conversion activity from side Rd to ginsenoside F2, conversion activity from ginsenoside F2 to compound K (CK), conversion activity from ginsenoside Rg3 to ginsenoside Rh2, conversion activity from ginsenoside Rh2 to ginsenoside PPD , Conversion activity of ginsenoside Rb2 to compound O (CO), conversion activity of compound O (CO) to compound Y (CY), conversion activity of ginsenoside Rc to compound Mc1 (C-Mc1), compound Mc1 (C -Mc1) to Compound Mc (C-Mc), ginsenoside Re to ginsenoside Rg2, ginsenoside Re to ginsenoside F1 and ginsenosides It means ginsenoside F1 cultures having a switch with one or more active is selected from the group consisting of a transition from the active one Rg1, but are not limited to.

In an embodiment of the present invention Sanguibacter keddieii ) Ginsenoside glycosidase having the amino acid sequence set forth in SEQ ID NO: 1 from KACC 14479 ^T was isolated and purified, and was named BglSk (Example 2 and FIG. 2). The polynucleotide encoding BglSk comprises a 1857 bp polynucleotide and encodes a polypeptide consisting of 618 amino acids. In addition, BglSk has enzymatic activity of beta-glucosidase, which sequentially degrades glucose located at carbon 3 of Rb1, a PPD-type ginsenoside, converts it to GypLXXV via GypXVII, and converts glucose at carbon 20 to Decomposes and finally converts to CK, the glucose located on carbon 3 of ginsenoside Rb2 is sequentially decomposed and converted to CY via CO, and the glucose located on carbon 3 of ginsenoside Rc is sequentially decomposed Activity to convert to C-Mc via C-Mc1, the glucose located on carbon 3 of ginsenoside Rd sequentially to convert to CK via F2 and glucose located on carbon 3 of ginsenoside Rg3 It was confirmed that the sequential decomposition of the chromium on the 20th carbon of Re, which is a PPT-type ginsenoside of Re, which has the activity of converting to PPD via Rh2. Ginsenosides are decomposed to ginsenosides Rg2, or the inner glucose of carbon 6 is decomposed to F1, and the glucose located at carbon 6 of Rg1, a PPT type ginsenoside, is decomposed. Ginsenoside glucosidase of the present invention was selectively hydrolyzed to glucose located at carbon 3 or 20 of PPD type saponin and carbon 6 or 20 of PPT type saponin. It was confirmed that there was (Figs. 4 to 6).

In another embodiment, the present invention relates to a method for producing a recombinant vector comprising the above ginsenoside glycosidase protein, a vector containing a nucleic acid encoding the protein, or a culture of the transformant, A saponin of PPD (protopanaxadiol) type or PPT (protopanaxatriol) type, which is easy to be absorbed into the body.

The PPD type saponin, the PPT type saponin, the ginsenoside glycosidase protein, the minor saponin, the transformant or the culture thereof are as described above.

The ginsenoside glycosidase protein has a selective hydrolysis ability on carbon 3 or 20 of PPD-type saponin and carbon 6 or 20 of PPT-type saponin and thus may be usefully used to produce minor saponins. .

In another embodiment, the present invention provides a method for producing a protein comprising a ginsenoside glycosidase protein defined by the amino acid sequence of SEQ ID NO: 1, a nucleic acid encoding the protein, a vector comprising the nucleic acid, Thereby providing a transformant.

The ginsenoside glycosidase protein, the nucleic acid encoding the protein, the vector containing the nucleic acid, and the transformant into which the vector is introduced are as described above.

The nucleic acid encoding the ginsenoside glycosidase protein may preferably be a nucleic acid represented by SEQ ID NO: 2, but is not limited thereto. The nucleic acid encoding the ginsenoside glucosidase is not limited to the nucleic acid encoding the protein having the activity of ginsenoside glucosidase, but preferably the nucleic acid sequence of SEQ ID NO: 2, And more preferably 70% or more, preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, and most preferably 98% or more of the amino acid sequence of SEQ ID NO: Lt; RTI ID = 0.0 > a < / RTI > protein having activity. The similarity is as described above.

The ginsenoside glycosidase protein of the present invention can convert ginsenosides of PPD type or PPT type into minor soluble ginsenosides which are readily soluble in the body, And may be used at various temperatures and pHs as long as it is at least one selected from the group consisting of ZnCl ₂ , MnCl ₂ , CaCl ₂ , CoCl ₂ , MgCl ₂ , EDTA, NaCl, KCl, CuCl ₂ , SDS, DTT, and mercaptoethanol Metals and chemical agents may be used together, but are not limited thereto.

According to one embodiment of the present invention, the enzyme properties of the ginsenoside glycosidase was analyzed to show the optimum enzyme activity at 25 ℃, it was confirmed that the stability and activity of the enzyme is excellent at pH 8.0 (Fig. 3a and 3b).

The novel ginsenoside glycosidase of the present invention exhibits excellent activity of converting PPD or PPT type saponins into various minor ginsenosides, including Compound K and Ginsenoside F1, which are easily absorbed in the body. Although the pharmacological effect has been demonstrated, it can be used in the mass production and production of the minor form of ginsenoside, which is produced only in trace amounts in nature and has been limited in use.

Figure 1 shows the ginsenosides of the PPD type or PPT type.
Figure 2 shows the results of SDS-PAGE analysis of recombinant BglSk purified using GST-bind agarose resin.
M, protein molecular weight marker; Lane 1, precipitated portion of a crude extract of recombinant BL21 (DE3) cells in which the expression of BglSk was induced; Lane 2, the soluble portion of the crude extract of recombinant BL21 (DE3) cells in which expression of BglSk was induced; Lane 3, GST-BglSk purified by GST-binding agarose resin; Lane 4, recombinant BglSk treated with thrombin
3A is a graph showing stability and activity according to pH of recombinant BglSk, and FIG. 3B is a graph showing stability and activity according to temperature.
4 is saenggwi bakteo Kane dieyi KACC 14479 ^T by the strain-derived recombinant BglSk ginsenoside Rb1, Rb2, Rc, Rd, Gyp XVII, Rg3 (S), TLC (Thin-layer represents the bioconversion activity of Re and Rg1 chromatography results are shown. The reaction time is 1 hour and the developing solvent is: CHCl ₃ -CH ₃ OH-H ₂ O (65:35:10, v / v, lower phase). Lanes 1, 3, 5, 7, 9, 11, 13 and 15 represent standards, and lanes 2, 4, 6, 8, 10, 12, 14 and 16 represent reaction mixtures.
S is ginsenoside standard (ginsenoside mixture of PPD type); Lane 1, standard Rb1; Lane 2, reaction mixture of Rb1 and BglSk; lane 3, standard Rb2; Lane 4, a reaction mixture of Rb2 and BglSk; Lane 5, standard Rc; Lane 6, a reaction mixture of Rc and BglSk; Lane 7, standard Rd; Lane 8, a reaction mixture of Rd and BglSk; Lane 9, standard GypXVII; Lane 10, the reaction mixture of GypXVII and BglSk; Lane 11, standard Re; Lane 12, the reaction mixture of Re and BglSk; Lane 13, standard Rg1; Lane 14, Rg1 and BglSk Reaction mixtures; Lane 15, standard Rg 3 (S); Lane 16, a reaction mixture of Rg3 (S) and BglSk; CK, compound K. PPD, protopanaxadiol.
FIG. 5 shows a method of biotransforming HPLC of recombinant BglSk derived from a live ear bacter Cadiai KACC 14479 ^T strain, followed by PPD type ginsenosides Rb1, Rb2, Rc, Rd, Gyp XVII, and Rg3 (S). High performance liquid chromatography analysis results are shown.
(1) shows the ginsenoside standard curve. 1, Rb1; 2, Rc; 3, Rb 2; 4, Rd; 5, Gyp XVII; 6, C-Mc1; 7, CO; 8, F2; 9, Rg 3 (S) + Gyp LXXV; 10, Rg 3 (R); 11, C-Mc; 12, CY; 13, CK; 14, Rh 2 (S); 15, Rh 2 (R); 16, PPD
(2) is the reaction mixture of Rb1 and BglSk, (3) is the reaction mixture of Rb2 and BglSk (4) is the reaction mixture of Rc and BglSk, (5) is the reaction mixture of Rd and BglSk (6) is of GypXVII and BglSk The reaction mixture (7) shows the HPLC results of the reaction mixture of Rg 3 (S) and BglSk.
FIG. 6 shows the results of HPLC analysis of the bioconversion of PPT type ginsenosides Ginsenoside Re and Ginsenoside Rg1 by GST-BglSk. (1) shows the ginsenoside curve. 1, Rg1; 2, Re; 3, Rg 2 (S) + Rh 1 (S); 4, F1; 5, PPT
(2) is the reaction mixture of Re and BglSk, (3) is the reaction mixture of Rg1 and BglSk. HPLC results of the reaction mixture are shown.

Figure 7 shows ginsenosides Rb1, Rb2, Rc, Rd, GypXVII, Rg3 (S), Re and Rg1 by recombinant BglSk. It is a schematic diagram showing the bioconversion reaction pathway of.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  1: Experiment Method and Preparation

Example  1-1: Chemical Sanctions ( chemical ) Ready

Ginsenosides Rb1, Rc, Rb2, Rd, Rg3 (S), Rh2 (S), Rh2 (R), F2, Compound K, Protopanaxadiol (PPD), Rg1, Re, Rg2 (S), Rh1 (S), F1, protopanaxatriol (PPT) was purchased from Dalian Green Bio Co., Ltd. (Dalian, China) and contained fenenoside XVII, zipenoside LXXV, compound O (CO), compound Y (CY), compound Mc1 (C-Mc1) and compound Mc (C-Mc ₁ ) is An et al (Appl Environ Microbiol. 2010; 76: 5827-5836) and Wang et al (J. Biotechnol. 2011; 156; 125-133) were prepared for this experiment.

5-bromo-4-chloro-3-indolyl β-D-glucopyranoside (X-Glc), PNP-β-D-glucopyranoside (pNPGlc), PNP-β-D-galactopyranoside, PNP-β-D-fucopyranoside, PNP -N-acetyl-β-D-glucosaminide, PNP-β-L-arabinopyranoside, PNP-β-D-mannopyranoside, PNP-β-D-xylopyranoside, PNP-β-D-glucopyranoside, PNP-β-L-arabinofuranoside , PNP-β-L-arabinopyranoside, PNP-β-L-rhamnopyranoside, PNP-β-D-mannopyranoside, PNP-β-D-xylopyranoside, ONP-β-D-glucopyranoside, ONP-β-D-galactopyranoside, ONP -β-D-fucopyranoside and ONP-β-D-galactopyranoside were purchased from Sigma. All of these chemical agents are at least analytical reagent grade.

Example  1-2: host cell, expression vector and medium

In order to clone the ginsenoside glycosidase of the present invention, the fresh ear bacter Keddie KACC 14479 ^T strain was cultured in aerobic R2A agar (BD, USA) at 30 ℃. Escherichia coli BL21 ( Esherichia for gene replication and expression) coli , DE3 ) and pGEX 4T-1 plasmid (GE Healthcare, Waukesha, WI, USA) were inoculated in LB (Luria-Bertani) medium to which 100 mg / L Ampicillin was added to culture.

Example  1-3: TLC ( Thin - layer chromatography )analysis

TLC was performed using a 60F ₂₅₄ silica gel plate (Merck, Germany) using CHCl ₃ -CH ₃ OH-H ₂ O (65:35:10, vol / vol, lower phase) as solvent. Spots on TLC plates were developed with 10% (vol / vol) H ₂ SO ₄ and then heated at 110 ° C. for 5 minutes.

Example  1-4: HPLC ( High performance liquid chromatography ) analysis

HPLC analysis of ginsenosides was carried out using an HPLC system (Younglin Co. Ltd, Korea) equipped with four solvent pumps, an autoinjector, and a single wavelength UV detection ratio. Software was used.

Separation was performed using a Prodigy ODS (2) C18 column (5 uM, 150 × 4.6 mm id, Phenomenex, USA) and a guard column (Eclipse XDB C18, 5 uM, 12.5 × 4.6 mm id). Mobile phases used A (acetonitrile) and B (water). Concentration elution starts with 17% solvent A and 83% solvent B, starting with solvent A at 17 to 25% at 12 to 20 minutes, 25 to 32% at 20 to 30 minutes, 32 to 55% at 30 to 35 In minutes from 55 to 60% at 35 to 40 minutes at 60 to 80% at 40 to 45 minutes at 80 to 100% at 45 to 50 minutes at 100% at 50 to 54 minutes at 100 to 17% From 54 to 54.1 minutes, 17% to 54.1 to 64 minutes. Flow rate was 1.0 ml / min, absorption was measured at 203 nm, and injection volume was 25 μl.

Example  2: New Gin Senocide Of ginsenoside glycosidase  Produce

Example  2-1: New Gin Senocide Glycosidase  Production of recombinant expression vectors and transforming microorganisms containing

In the present invention, in order to prepare a novel ginsenoside glycosidase that can convert major ginsenosides to minor ginsenosides, a novel ginsenoside glycosidase (gincenoside) is first obtained from a live ear bacter Cadiai KACC 14479 ^T strain. glycosidase) was screened and named BglSk.

Specifically, the Saengbopter Kardiei KACC 14479 ^T strain was selected and its genomic DNA was extracted using a genomic DNA extraction kit (Solgent, Korea). Using the genomic DNA thereof as a template, polymerase chain reaction (PCR) was performed using the following forward primer (SEQ ID NO: 3) and reverse primer (SEQ ID NO: 4). The primer sequences are shown in Table 1 below.

primer Sequences (5 '-> 3') SEQ ID NO: Forward primer GGTTCCGCGT GGATCC CCACTCCCTGACCACCCTGACC SEQ ID NO: 3 Reverse primer GATGCGGCCG CTCGAG TCAGATGCTCAGCCCGTGCCCCAC SEQ ID NO: 4

The fragments amplified and separated and purified by the above reaction were inserted into the BamHI and XhoI restriction enzyme sites of the plasmid vector pGEX4T-1 (GE Healthcare, USA) into which glutathione S-transferase was inserted, using an EzCloning Kit (Enzynomics). The recombinant expression vector pGEX-bglSk ginsenoside glycosidase of the present invention was produced. The recombinant expression vector was transformed into E. coli BL21 (DE3) strain by a conventional transformation method.

Example  2-2: Gin Senocide Of ginsenoside glycosidase  Expression

In order to mass-produce the ginsenoside glycosidase of Example 2-1, the transformed strain was cultured at 37 ° C. until the absorbance at 600 nm was 0.6 in LB medium to which ampicillin was added. When the absorbance was 0.6, the final concentration of 0.1 mM IPTG (isopropyl-beta-D-thiogalactoside) was added to induce the expression of ginsenoside glycosidase.

When the strain was in a staionary phase by further incubating for 24 hours at 18 ° C., the culture medium of the strain was centrifuged at 13,000 rpm for 15 minutes at 4 ° C., and 50 mM sodium phosphate buffer (5 mM EDTA). And 1% Triton X-100 pH 7.0), and then the cell solution was disrupted with a sonicator. The cell lysate was again centrifuged at 4 ° C. for 15 minutes at 13,000 rpm, and then a crude cell extract containing ginsenoside glycosidase of the present invention was obtained. The GST-fused protein was separated and purified by GST-fused agarose resin (GST-bind agarose resin, resin, Elpis Co. Ltd., Daejeon, Korea). Separated purified ginsenoside glycosidase was analyzed by 10% SDS-PAGE and EZ-Gel staining solution (Daeillab Co. Ltd., Korea). In this case, the amino acid number of the ginsenoside glycosidase BglSk was 618, and the amino acid sequence of the BglSk was represented by SEQ ID NO: 1. Ginsenoside glucosidase of the present invention with GST tag removed using thrombin showed a molecular weight of 66.6 kDa (FIG. 2).

Example  3: Gin Senocide Glycosidase ( Bglsk Enzyme Characterization

To characterize the purified BglSk, An et al. It was measured by the method described in al (Appl Environ Microbiol 2010; 76: 5827-5836).

Substrate affinity of the enzyme (substrate preference) is chromotherapy transgenic o- nitrophenyl (ONP, o -nitrophenyl) and p- nitrophenyl (PNP, p -nitrophenyl) - was tested using the glycoside. Kineitc studies were performed with freshly purified enzyme using p- nitrophenyl-β-D-glucopyranoside and ginsenoside Rb1 within a concentration range of 2.0 mM within 0.1 mM. All analyzes were performed more than three times. Parameters ( K _m and V _max ) were determined by the enzyme kinetics program reported by Cleland (Methods in Enzymology, 1979; 63: 103-138).

Example  3-1: pH  Measure the effects of change

The effect of pH on the enzyme activity of the present invention was measured as follows. Substrate was used with 2.0 mM pNPGlc (p-nitrophenyl-β-D-glucopyranoside; Sigma) and pH was adjusted using the following buffer (50 mM): pH 2-10 range: KCl-HCl (pH 2) ), Glycine-HCl (pH 3), sodium acetate (pH 4 and 5), sodium phosphate (pH 6 and 7), Tris-HCl (pH 8 and 9) and glycine-sodium hydroxide (pH 10)

In addition, the effect of pH on enzyme stability was measured. After enzymatic incubation in each of the above-mentioned buffers at 4 ° C. for 24 hours, enzyme stability with pH variation was determined by analyzing o − or p-NPGlc in 50 mM potassium buffer. Residual activity was analyzed by standard analytical methods and the results are shown in FIG. 3A as the probability of activity obtained at the optimum pH.

As a result, ginsenoside glycosidase (BglSk) was excellent in the activity and stability of the enzyme at pH 8.0, but the enzyme activity decreased from pH 9.0. In addition, the enzyme activity was reduced by 70% at pH 6.0 (Fig. 3a).

Example  3-2: Measure the effect of temperature changes

The effect of temperature on the enzyme activity of the present invention was measured as follows. The temperature was adjusted to 4-90 ° C. and the temperature dependent activity in 50 mM potassium phosphate buffer was analyzed at optimal pH for 5 minutes using pNPGlc (p-nitrophenyl-β-D-glucopyranoside; Sigma) 2.0 mM.

In addition, a temperature stability analysis was performed by incubating enzyme equivalents in 50 mM potassium phosphate buffer for 30 minutes in the same temperature range. This was done by cooling the sample with ice for 10 minutes, then confirming the residual activity measured by standard analytical methods, and the results are shown in FIG. 3B.

As a result, BglSk showed the optimum temperature activity at 25 ° C, and the enzyme activity was reduced by 15% and 25% at 30 ° C and 37 ° C, respectively. In addition, thermal stability was not detected at 65 ° C. (FIG. 3B).

Example  3-3: Measuring the effects of metals and chemicals

BglSk was reacted at 37 ° C. for 30 minutes at 1 mM and 10 mM (final concentration) of MnCl ₂ , CaCl ₂ , CoCl ₂ , MgCl ₂ , EDTA, NaCl, KCl, CuCl ₂ , SDS, ZnCl ₂ , HgCl ₂ , dithiothreitol ( DTT) and β-mercaptoethanol, and activity was measured using pNPGlc (p-nitrophenyl--D-glucopyranoside; Sigma) as a substrate, and the result is a percentage of the activity obtained in the absence of the compound. It is shown in Table 2 below.

As a result of this activity BglSk Cu ^{+ 2,} Hg ^{2 +} and under the presence of Zn ^{+ 2,} but strongly inhibited, Na ⁺ and K ⁺ did not significantly increase the enzyme activity at low concentrations (Table 2).

Metal ions or reagents Relative activity ± SD ^a (%) 1 mM 10 mM NaCl 104.4 ± 1.21 82.8 ± 0.43 KCl 103.2 ± 1.90 83.0 ± 1.05 MgCl ₂ 84.5 ± 4.15 76.2 ± 0.75 MnCl ₂ 85.9 ± 2.37 61.9 ± 0.57 CoCl ₂ 84.2 ± 3.00 62.2 ± 0.50 ZnCl ₂ 52.2 ± 1.02 24.8 ± 0.53 CaCl ₂ 99.2 ± 2.63 62.2 ± 1.59 CuCl ₂ 1.5 ± 0.05 6.4 ± 1.25 HgCl ₂ 2.2 ± 0.07 2.1 ± 0.02 SDS 83.6 ± 1.75 63.9 ± 2.09 EDTA 97.7 ± 1.53 75.8 ± 0.87 β-Mercaptoethanol 86.0 ± 2.63 77.0 ± 1.22 DTT 99.3 ± 4.26 74.1 ± 2.03 Control 100 ± 1.28 100 ± 1.28

Example  3-4: Substrate Preference and Kinetic Analysis

One active unit, defined as the release of o-nitrophenol or p-nitrophenol per minute, for chromogenic ONP and PNP (p) to analyze substrate preferences. -nitrophenyl) substrate was incubated at 37 ° C. for 5 minutes in 50 mM sodium phosphate buffer.

The analyzed substrate (Sigma) is PNP-β-D-glucopyranoside (PNP-β-D-glucopyranoside), PNP-β-D-galactopyranoside (PNP-β-D-galactopyranoside), PNP- β-D-fucopyranoside (PNP-β-D-fucopyranoside), PNP-N-acetyl-β-D-glucoamide (PNP-N-acetyl-β-D-glucosaminide), PNP-β-L- Arabinopyranoside (PNP-β-L-arabinopyranoside), PNP-β-D-mannopyranoside (PNP-β-D-mannopyronoside), PNP-β-D-xylpyranoside (PNP-β -D-xylopyranoside), PNP-α-D-glucopyranoside (PNP-α-D-glucopyranoside), PNP-α-L-arabinofuranoside (PNP-α-L-arabinofuranoside), PNP-α -L-arabinopyranoside (PNP-α-L-arabinopyranoside), PNP-α-D-rhamnopyranoside (PNP-α-D-rhamnopyranoside), PNP-α-D-mannopyranoside (PNP -α-D-mannopyranoside), and PNP-α-D-xylopyranoside (PNP-α-D-xylopyranoside), and o-nitrophenol [ONP] -β-D-glucopyranoside (o- nitrophenol [ONP] -β-D-glucopyranoside), ONP-β-D-galactopyranoside (ONP-β-D-galacto pyranoside), ONP-β-D-fucopyranoside (ONP-β-D-fucopyranoside) and ONP-β-D-galactopyranoside (ONP-β-D-galactopyranoside).

As a result, BglSk hydrolyzed both PNP-β-D-glucopyranoside and ONP-β-D-glucopyranoside (Table 3).

Substrate Relative activity ± SD (%) pNP-α-D-glucopyranoside 0 pNP-α-D-mannopyranoside 0 pNP-α-D-xylopyranoside 0 pNP-α-L-arabinofuranoside 0 pNP-α-L-arabinopyranoside 0 pNP-α-L-rhamnopyranoside 0 pNP-β-D-fucopyranoside 0 pNP-β-D-galactopyranoside 0 pNP-β-D-glucopyranoside 100 ± 3.70 pNP-β-D-glucosaminide 0 pNP-β-D-mannopyranoside 0 pNP-β-D-xylopyranoside 0 pNP-β-L-arabinopyranoside 0 oNP-β-D-galactopyranoside 0 oNP-β-D-fucopyranoside 0 oNP-β-D-glucopyranoside 112 ± 4.52

Kinetic studies were performed with freshly purified enzyme using p -nitrophenyl-β-D-glucopyranoside and ginsenoside Rb1 as substrates. The absorbance of p-nitrophenol was monitored at 405 nm for 20 minutes at a temperature of 37 ° C. The results are shown by determining Km and Vmax using the Enzyme Kinetics Program reported by Cleland.

As a result, the Km and Vmax values for the hydrolysis of pNPGlc by GST-BglSk were 0.456 ± 0.009 mM or 30.2 ± 0.7 μmol * min ^-1 mg * protein ^{- 1} , respectively, and the Ginsenoside Rb1 by GST-BglSk Bioconversions had Km and Vmax values of 0.167 ± 0.003 mM or 4.1 ± 0.1 μmol * min ⁻¹ mg * protein ⁻¹ , respectively.

Example  4: New Gin Senocide Glycosidase Gin Senocide Conversion  Activity analysis

In order to analyze the ginsenoside bioconversion activity of the enzyme of BglSk of the present invention, TLC and HPLC were performed as follows.

Attached to carbon 3 (C-3) and 20 (C-20) sites of the PPD type ginsenoside of the ginsenoside glycosidase protein of the present invention and to carbons 6 and 20 of the PPT type ginsenoside Ginsenosides Rb1, Rb2, Rc, Rd, Re, Rg1, Rg3 (S) and Zipenoside XVII were used as substrates to analyze the specificity and selectivity of the enzymes for the prepared glucose.

The enzyme solution, present in a concentration of 0.1 mg / ml in 50 mM sodium phosphate buffer (pH 8.0), was equilibrated in 50 mM sodium phosphate buffer (pH 8.0) in which the eight substrates were present at a concentration of 0.1% (wt / vol). It reacted at 25 degreeC. The samples were collected at appropriate intervals. For TLC analysis, the reaction was terminated by adding an equal volume of aqueous-saturated butanol. The n-butanol fraction was evaporated to dryness and the residue was dissolved in CH ₃ OH and analyzed by thin layer chromatography (TLC), and the results are shown in FIG. 4. For HPLC analysis, an equal amount of methanol was added to terminate the reaction, centrifuged at 15,000 g for 10 minutes, and then the supernatant was used for sample analysis.

As a result of analysis by TLC, the ginsenoside glycosidase of the present invention hydrolyzed glucose of the outer and inner carbon of ginsenoside No. 3 carbon of the PPD type, and then sequentially C-20) showed bioconversion activity that hydrolyzes glucose attached to the outer region. Specifically, ginsenoside Rb1 was sequentially converted from zipenoside XVII to zipenoside LXXV, then to compound K (lanes 1 and 2), and ginsenoside Rb2 to ginsenoside CO , Again converted to ginsenoside CY (lanes 3 and 4), for ginsenoside Rc sequentially to C-Mc1 and then to C-Mc (lanes 5 and 6), If sequentially converted to ginsenoside F2, then to compound K (lanes 7 and 8), and for phenenoside XVII, to sequentially converted to phenenoside LXXV and then to compound K (lane 9 And 10), ginsenoside Rg3 (S) was sequentially converted to Rh2 (S) and then to PPD (lanes 15 and 16).

Ginsenoside glycosidase of the present invention also hydrolyzed glucose attached to the 6th carbon (C-6) or 20th carbon (C-20) site of PPT type ginsenosides. Specifically, in the case of ginsenoside Re, glucose attached to carbon site 20 was hydrolyzed and converted to ginsenoside Rg2 (S), and at the carbon site of ginsenoside Re, the outer rhamnose (rhanose, rha) Regardless of the moiety, the inner glucose was cut, and Glc (1 → 2) Rha was hydrolyzed and converted to ginsenoside F1 (lanes 11 and 12), and the sixth carbon (C-6) site for ginsenoside Rg1. The glucose attached to was hydrolyzed to show conversion to ginsenoside F1 (lanes 13 and 14). In particular, the ginsenoside glycosidase of the present invention converted almost all of ginsenosides Re to ginsenoside F1 (lanes 11 and 12), from which the ginsenoside glycosidase of the present invention is particularly ginsenoside F1. It can be usefully used for mass production.

As a result of HPLC analysis, ginsenoside Rb1 was sequentially converted to ginsenoside CK via zipenoside LXXV (Fig. 5 (2)), and ginsenoside Rb2 was sequentially passed through ginsenoside CO. To CY (FIG. 5 (3)), ginsenoside Rc was sequentially converted to ginsenoside C-Mc via ginsenoside C-Mc1 (FIG. 5 (4)), and Case was sequentially converted to compound K via ginsenoside F2 (FIG. 5 (5)), and for phenenoside XVII was converted sequentially to ginsenoside CK via zipenoside LXXV (FIG. 5 (6)). In the case of ginsenoside Rg3 (S) was sequentially converted to PPD through ginsenoside Rh2 (S) (Fig. 5 (7)). In the case of ginsenoside Re, which is a PPT type, ginsenoside Rg2 (S) or ginsenoside F1 was converted (FIG. 6 (2)), and ginsenoside Rg1 was converted to ginsenoside F1 ( 6 (3)).

These results suggest that the ginsenoside glycosidase of the present invention can easily convert major ginsenosides of the PPD or PPT type into minor ginsenosides that are easily soluble in the body. In particular, the ginsenoside glycosidase of the present invention indicates that it can be usefully used to produce ginsenoside F1 from ginsenoside Re.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> Korea Advanced Institute of Science and Technology <120> Production of minor ginsenosides using novel ginsenoside          glycosidase from Sanguibacter keddieii <130> PA120545KR <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 618 <212> PRT <213> Sanguibacter keddieii <400> 1 Val Pro Thr Pro Leu Thr Thr Leu Thr Ala Pro Asp Gly Thr Val Phe   1 5 10 15 Arg Asp Leu Asp Lys Asp Gly Val Met Ala Pro Phe Glu Asp Pro Arg              20 25 30 Glu Ser Val Glu Thr Arg Val Glu Asp Leu Leu Gly Arg Met Asn Leu          35 40 45 Glu Glu Lys Ala Gly Leu Met Phe Gln Thr Val Ile Glu Thr Ser Pro      50 55 60 Asp Gly Thr Leu Val Glu Gln Thr Gly Ala Ile Ser Lys Ser Pro Thr  65 70 75 80 Thr Val Val Val Gln Glu Lys Leu Leu Asn His Phe Asn Val His Val                  85 90 95 Leu Pro Glu Gly Arg Leu Ala Ala Arg Trp His Asn Asn Leu Gln Ala             100 105 110 Val Ala Glu Gln Thr Arg Leu Gly Ile Pro Val Thr Val Ser Thr Asp         115 120 125 Pro Arg His Ala Phe His Glu Asn Thr Gly Ala Ser Phe Ala Ala Gly     130 135 140 His Phe Ser Gln Trp Pro Asp Ser Leu Gly Leu Ala Ala Ile Gly Asp 145 150 155 160 Thr Glu Leu Val Arg Gln Phe Ala Asp Ala Ala Arg Gln Glu Tyr Leu                 165 170 175 Ser Val Gly Ile Arg Ala Ala Leu His Pro Cys Val Asp Leu Ala Thr             180 185 190 Glu Pro Arg Trp Ala Arg Gln Leu Asn Thr Phe Gly Glu Thr Ser Gln         195 200 205 Leu Val Ser Asp Phe Thr Ala Ala Tyr Leu Asp Gly Leu Gln Gly Pro     210 215 220 Gly Gly Ala Leu Ser Ala Glu Ser Val Ala Cys Thr Thr Lys His Phe 225 230 235 240 Pro Gly Gly Gly Pro Gln Lys Asp Gly Glu Asp Ala His Phe Pro Tyr                 245 250 255 Gly Arg Glu Gln Val Tyr Thr Gly Gly Thr Phe Glu Glu His Leu Ala             260 265 270 Pro Phe Lys Val Ala Leu Glu His Lys Thr Ala Ala Met Met Pro Tyr         275 280 285 Tyr Gly Met Pro Val Asp Leu Glu Ile Asp Gly Glu Lys Ile Glu Glu     290 295 300 Val Gly Phe Gly Tyr Asn Lys Gln Ile Val Thr Gly Leu Leu Arg Glu 305 310 315 320 Gln Met Gly Phe Asp Gly Val Val Val Asp Trp Glu Leu Val Asn                 325 330 335 Asp Asn Lys Val Ala Thr Gly Gln Val Leu Pro Ala Arg Ala Trp Gly             340 345 350 Val Glu His Leu Asp Ala Pro Gly Arg Met Glu Lys Ile Ile His Ala         355 360 365 Gly Cys Asp Gln Phe Gly Gly Glu Glu Cys Pro Asp Leu Leu Val Gln     370 375 380 Leu Val Arg Glu Gly Arg Val Thr Glu Asp Arg Ile Asp Ala Ser Val 385 390 395 400 Arg Arg Leu Leu Arg Val Lys Phe Glu Leu Gly Leu Phe Asp Asp Pro                 405 410 415 Tyr Val Asp Glu Asp Ala Ala Asp Glu Ile Val Gly Arg Ala Asp Leu             420 425 430 Val Ala Ala Gly Leu Ala Ala Gln Ser Arg Ser Val Thr Val Leu Lys         435 440 445 Asn Gly Asp Val Asp Gly Ser Pro Val Leu Pro Leu Thr Gly Ser Gln     450 455 460 Arg Val Tyr Val Val Gly Met Ser Asp Glu Asp Ala Ala Arg Leu Gly 465 470 475 480 Thr Val Val Thr Asp Pro Ala Asp Ala Asp Val Ala Val Val Arg Leu                 485 490 495 Pro Ala Pro Trp Glu His Arg Asp Ser Met Phe Leu Glu Ala Trp Phe             500 505 510 His Gln Gly Ser Leu Asp Phe Ser Ala Glu Thr Val Ala Gln Val Thr         515 520 525 Glu Leu Ala Ala Gln Val Pro Val Val Leu Asp Val Met Leu Asp Arg     530 535 540 Pro Ala Ile Leu Thr Pro Leu Val Asp Val Ala Thr Ala Ile Val Gly 545 550 555 560 Thr Tyr Gly Thr Ser Asp Pro Ala Leu Val Ala Ala Leu Thr Gly Glu                 565 570 575 Val Lys Pro Glu Gly Arg Leu Pro Phe Gln Leu Pro Arg Ser Met Glu             580 585 590 Ala Val Ala Ala Ser Arg Pro Asp Val Ala Ser Asp Thr Thr Asp Pro         595 600 605 Val Phe Pro Val Gly His Gly Leu Ser Ile     610 615 <210> 2 <211> 1857 <212> DNA <213> Sanguibacter keddieii <400> 2 gtgcccactc ccctgaccac cctgaccgcc cccgacggga ccgtcttccg cgatctcgac 60 aaggacggcg tcatggcgcc gttcgaggac ccccgcgaga gcgtcgagac ccgcgtcgag 120 gacctgctcg gacgcatgaa cctcgaggag aaggcgggtc tgatgttcca gaccgtcatc 180 gagacgagcc ccgacgggac ccttgtcgag cagaccggcg cgatcagcaa gtccccgacc 240 accgtcgtgg tccaggagaa gctgctcaac cacttcaacg tgcacgtgct gcccgagggc 300 cgcctcgccg cccgctggca caacaacctg caggccgtcg ccgagcagac ccgcctgggc 360 atccccgtga ccgtctcgac cgacccgcgg cacgccttcc acgagaacac cggggcgtcc 420 ttcgcggccg ggcacttctc gcagtggccc gactccctcg gcctcgccgc gatcggcgac 480 accgagctgg tccgccagtt cgccgacgcc gcccgccagg agtacctgtc cgtgggcatc 540 cgcgcggcgc tgcacccctg cgtcgacctc gcgaccgagc cccgctgggc ccgccagctc 600 aacaccttcg gtgagacgtc ccagctggtc agcgacttca ccgccgccta cctcgacggg 660 ctccagggcc ccggcggcgc gctgagcgcc gagtcggtcg cctgcaccac caagcacttc 720 cccggcggcg gcccgcagaa ggacggcgag gacgcgcact tcccctacgg ccgcgagcag 780 gtctacaccg gagggacctt cgaggagcac ctcgcgccct tcaaggtcgc cctcgagcac 840 aagaccgccg cgatgatgcc gtactacggc atgcccgtgg acctcgagat cgacggggag 900 aagatcgagg aggtcggctt cggctacaac aagcagatcg tcaccgggct gctccgcgag 960 cagatgggct tcgacggcgt ggtcgtcacc gactgggagc tcgtcaacga caacaaggtc 1020 gcgaccggac aggtgctgcc cgcccgcgcg tggggcgtcg agcacctcga cgcaccgggg 1080 cgcatggaga agatcatcca cgccggctgc gaccagttcg gcggcgagga gtgccccgac 1140 ctgctcgtcc agctcgtccg cgagggacgc gtcaccgagg accgcatcga cgcctccgtg 1200 cgccgcctgc tccgcgtgaa gttcgagctc gggctcttcg acgaccccta tgtcgacgag 1260 gacgcggccg acgagatcgt cgggcgcgcc gacctcgtcg ccgcgggcct cgccgcgcag 1320 agccgctcgg tcaccgtgct gaagaacggc gacgtcgacg gcagccccgt cctgccgctc 1380 accggcagcc agcgcgtgta cgtcgtcggc atgtccgacg aggacgccgc ccgcctcggg 1440 accgtcgtga ccgacccggc cgacgccgac gtcgccgtcg tgcgcctccc cgccccgtgg 1500 gagcaccgcg actcgatgtt cctcgaggcc tggttccacc aggggtcgct cgacttctcc 1560 gccgagaccg tcgcgcaggt caccgagctc gccgcgcagg tgcccgtcgt cctcgacgtc 1620 atgctcgacc gccccgcgat cctcacgccg ctcgtcgacg tcgcgaccgc gatcgtcggc 1680 acctacggga cgtccgaccc ggcgctcgtc gccgcgctga ccggcgaggt caagcctgag 1740 gggcgcctgc cgttccagct gccccgttcg atggaggctg tcgcggcgtc acgcccggat 1800 gtcgcgtccg acacgaccga cccggtgttc ccggtggggc acgggctgag catctga 1857 <210> 3 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 3 ggttccgcgt ggatccccac tccctgacca ccctgacc 38 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 4 gatgcggccg ctcgagtcag atgctcagcc cgtgccccac 40

Claims (10)

Using a ginsenoside glycosidase protein defined by the amino acid sequence set forth in SEQ ID NO: 1, a transformant into which a vector comprising the nucleic acid encoding the protein is introduced, or a culture of the transformant A method for producing soluble minor saponins by converting saponins of the protopanaxadiol (PPD) type or the protopanaxatriol (PPT) type.
The method according to claim 1, wherein the ginsenoside glycosidase protein has a selective hydrolysis of carbon 3 or carbon 20 of the saponin of the PPD type, selective hydrolysis of carbon 6 or 20 of the saponin of the PPT type Characterized in that it has a resolution.
The compound of claim 1, wherein the minor saponin is zipenoside XVII, zipenoside LXXV, compound K (CK), ginsenoside F2, ginsenoside Rh2, protopanaxadiol (PPD), compound O (CO), compound Y ( CY), compound Mc1 (C-Mc1), compound Mc (C-Mc), ginsenoside Rg2 and ginsenoside F1.
The method of claim 1, wherein the soluble minor saponin is prepared by the process of converting ginsenoside Rb1 to zipenoside XVII, from zipenoside XVII to zipenoside LXXV, and to compound K (CK) from zipenoside LXXV. To ginsenoside Rd to ginsenoside F2, to ginsenoside F2 to compound K (CK), to ginsenoside Rg3 to ginsenoside Rh2, to ginsenoside Rh2 Conversion of Cenoside PPD, Conversion of Ginsenoside Rb2 to Compound O (CO), Conversion of Compound O (CO) to Compound Y (CY), Conversion of Ginsenoside Rc to Compound Mc1 (C-Mc1) Process, conversion of compound Mc1 (C-Mc1) to compound Mc (C-Mc), conversion of ginsenoside Re to ginsenoside Rg2, conversion of ginsenoside Re to ginsenoside F1 and The method of Jin and comprising at least one conversion step selected from the group consisting of transition to ginsenoside F1 from ginsenoside Rg1.
Using a ginsenoside glycosidase protein defined by the amino acid sequence set forth in SEQ ID NO: 1, a transformant into which a vector comprising the nucleic acid encoding the protein is introduced, or a culture of the transformant A composition for converting a saponin of PPD (protopanaxadiol) type or PPT (protopanaxatriol) type into soluble minor saponin which is an easily absorbed form in the body.
6. The compound of claim 5, wherein the minor saponin is zipenoside XVII, zipenoside LXXV, compound K (CK), ginsenoside F2, ginsenoside Rh2, protopanaxadiol (PPD), compound O (CO), compound Y ( CY), compound Mc1 (C-Mc1), compound Mc (C-Mc), ginsenoside Rg2 and ginsenoside F1.
Ginsenoside glycosidase protein defined by the amino acid sequence set forth in SEQ ID NO: 1.
A nucleic acid encoding the protein of claim 7.
A vector comprising the nucleic acid of claim 8.
A transformant into which the vector of claim 9 is introduced.

Images