KR20130135414A - Method for multiplex determination of copy number variation using modified mlpa - Google Patents

Abstract

The present invention relates to a multiple detection method of a copy number variation using the mobile phase difference by a cubical structure of a probe regardless of the length difference of the probe, and a kit for embodying the method. The multiple detection method of a copy number variation is obtained by changing conventional MLPA (multiplex ligation-dependent probe amplification) technology for analyzing the copy number based on the length difference of the probe.

Description

Method for multiplex determination of copy number variation using modified MLPA}

The present invention is a modification of the existing MLPA (Multiplex Ligation-dependent Probe Amplification) technique for analyzing the copy number depending on the difference in the length of the probe, depending on the mobile phase according to the three-dimensional structure of the probe regardless of the difference in the length of the probe A method for multiple detection of copy number polymorphisms and a kit for implementing the method.

Along with single nucleotide polymorphisms, termed single-nucleotide polymorphisms (SNPs), large-scale deletions or amplifications are known to be drivers of evolution and are associated with phenotypic mutations and human diseases. This structural variation is called copy-number variation (CNV) and numerous quantitative analytical techniques have been developed to detect it. Population genetics and disease-related studies, however, rely mostly on array-based genome screening and PCR-based efficacy analysis.

Recently, techniques such as array comparative genomic hybridization (array-CGH) and SNP array analysis, which are hybridization based copy number detection means, have been used for CNV analysis of the entire genome. However, the analytical technique has a problem of non-specific hybridization with respect to some CNVs, thereby failing to detect CNV reliably. Therefore, CNV detection by hybridization-based technical means needs to be validated by quantitative genetic analysis. Recently, next generation sequencing (NGS) technology has been proposed as a new method for quantitative sequencing and CNV detection, but using this technique to detect copy number differences is more relative than that required by conventional sequencing. As a result, many coverage areas are required, and verification of their accuracy is still required. Thus, as in the case of CNV determined by hybridization-based analytical tools, CNV determined by NGS-based should also be accompanied by validation by more critical methods such as real-time quantitative polymerase chain reaction (qPCR). Therefore, at this stage, large-scale CNV genome research based on NGS cannot be a realistic choice.

Recently, genome qPCR has been widely used to identify CNVs detected throughout the genome. However, the sensitivity of qPCR assays is not sufficient to accurately differentiate copy number differences, so even if these assays have a wide measurement range, it is difficult to accurately detect small fold changes (eg, 1.5 times). Thus, qPCR is limited in reliably distinguishing between single copy number differences between individuals. In addition, qPCR is not a suitable means for multiplex analysis. When qPCR is used to assess CNV of multiple genomic regions, up to four targets can be measured simultaneously using carefully designed primers and probes, but each target is often amplified preferentially, which in many cases is reliable. Designing a qPCR multiplex analysis is difficult.

Multiplex Ligation-dependent Probe Amplification (MLPA) is known as a reliable and effective way to identify copy number variation. This method connects two adjacent annealed and sequence-tagged probes with a heat resistant DNA ligase and amplifies with a universal primer complementary to the sequence tag. The multiplexing ability of MLPA is useful for various DNA copy number analyzes, including CNV detection. However, MLPA is to analyze the copy number based on the length of the linking product, which limits the application of the technique. In particular, MLPA contains a sequence called a stuffer that has a unique length for each ligation product but does not participate in ligation reactions or PCR amplification, because of the long stuffer sequence between probes or between target DNA and probes. There is a problem that internal folding and nonspecific hybridization may occur. In addition, because smaller amplicons are generally more resistant to PCR inhibitors and are more efficiently amplified than larger amplicons, the difference in length between probes can affect the efficiency of the probe amplification step.

Another drawback of this method is the time consuming process of manufacturing the probe. Specifically, the cloning step is necessary to prepare MLPA probes because of the length limitation of oligonucleotide synthesis. Stern et al. Proposed a solution to this problem by using a fully synthesized probe set (Stern et al. Biotechniques 37: 399-405, 2004), but due to the limitation of separation resolution, the technique has multiplexing power. There is less than half of the existing MLPA. Other teams have attempted to improve Stern et al. Using two to three primer sets labeled differently (Harteveld et al. J Med Genet 42: 922-931, 2005; White et al. Hum Mutat 24: 86). -92, 2004), still based on the same length-based differentiation principle as existing MLPAs. Recently, Zeng et al. Proposed a technique that does not depend on length using a microarray format (Zeng et al. Hum Mutat 29: 190-197, 2008). Instead of using stuffer sequences, the team used a barcoding system, where each probe contained its own sequence and its complementary sequence was immobilized on a microarray. This technique has greatly increased the multi-detection capability of MLPA, but this array-based technique is problematic in that the surrounding signal is strong and the false positive rate due to nonspecific hybridization is high.

The inventors have attempted to develop a reliable and easy to use multiple CNV detection method. To this end, the existing MLPA technology for analyzing the copy number depending on the difference in the length of the probe was modified to develop a new method for determining the DNA copy number regardless of the difference in the length of the probe. Modified MLPA method provided by the present invention is a method of analyzing the copy number according to the mobile phase difference according to the three-dimensional structure of the probe, regardless of the difference in the length of the probe even if it does not contain a stuffer sequence or a stuffer sequence It is possible to analyze the copy number and to simultaneously detect CNV in multiple genomic regions. The inventors have designed probes targeting various chromosomal regions by applying the modified MLPA method of the present invention and compared the efficiency with the existing MLPA method for X-chromosome copy polymorphism samples, and further, multiple CNV analysis targeting various autosomal bodies. As a result of applying the present invention to the present invention, it was confirmed that the present invention can simultaneously detect CNV in multiple genomic regions with sufficient accuracy.

One object of the present invention is to provide a method for multiplexing the copy number polymorphism according to the difference in mobile phase according to the three-dimensional structure of the probe irrespective of the length of the probe.

Another object of the present invention is to provide a kit for use in the multiple detection method of the copy number polymorphism.

In one aspect, the present invention is directed to a method for multiplexing copy number polymorphism according to differences in mobile phase along the conformation of a probe regardless of the difference in length of the probe.

As used herein, the term "copy-number variation" (CNV) refers to a structural variation in which a particular DNA site on the genome is deleted or duplicated, resulting in a different copy number compared to a reference genome. CNV accounts for about 13% of the human genome and is known to contain more than 2,000 genes. CNV causes various genetic diseases by impairing gene function or exerting a dose effect by quantitative variation of genes. For example, Duchenne / Becker type muscular dystrophy, type 1 neurofibromatosis, nodular sclerosis, Sothos syndrome, CHARGE syndrome, Felizus-Mertzsbach disease, Alzheimer's, autism, psoriasis, Crohn's disease, Parkinson's disease, etc. Known as CNVs of oncogenes and tumor suppressor genes in cancer tissues are also known.

The present invention is a modification of the existing MLPA technology for detecting CNV, characterized in that multiple copy polymorphism detection according to the mobile phase difference according to the three-dimensional structure of the probe irrespective of the probe length difference.

Existing MLPA technology developed by MRC-Holland, the Netherlands, hybridizes a pair of probes side by side with a target nucleic acid, connects these hybridized probes, and then amplifies the probe linkage to confirm the presence of CNV in the target nucleic acid. to be. In particular, existing MLPA techniques use multiple pairs of probes to simultaneously detect CNV in multiple genomic regions, using a SALSA vector derived from M13 bacteriophage, a stuffer of 130-480 bp for each probe. Create different lengths by including the. A stuffer is a sequence that has a unique length for each probe linkage but does not participate in linkage reactions or PCR amplification.The presence of a stuffer makes it possible to make dozens of probes into one experimental group. Having an exon, it is possible to produce a test group that can identify the gene CNV of all exons for most genes.

Specifically, looking at the probe used in the existing MLPA technology, the first probe has a stuffer for varying the length of the probe linkage product, a hybridization sequence portion capable of hybridizing with the target nucleic acid, and a universal amplification probe probe at a time It consists of a primer recognition sequence. The second probe consists of a target hybridization sequence (usually with one base difference) and a universal primer recognition sequence adjacent to the hybridization site of the first probe, so that if these two probes successfully hybridize to the target nucleic acid, the 3 'end And the 5 'end face to face. Treatment of the heat-resistant nucleic acid ligase produces a probe linkage product, and amplification of only a successfully hybridized probe linkage product is performed by PCR using a universal primer labeled with fluorescent material. Probe linkages corresponding to each target sequence form fragments of different sizes with fluorescent materials, and each of the formed fragments is subjected to a genetic analyzer (ABI-Prism of Appliedbiosystems; CEQ of Beckmann; Megabase of Amersham, etc.). They are separated by size (by length) and multiple detection of copy number polymorphism with fluorescence of the products by size.

As such, the conventional MLPA essentially includes a stuffer and detects CNV depending on the length of the stuffer, but due to the length of the stuffer sequence, internal folding and nonspecific hybridization between the probes or between the target DNA and the probes are prevented. Occurs, the amplification efficiency of the probe linkage is lowered, and there is a disadvantage in that the preparation of the probe takes a long time.

Accordingly, the present invention is to overcome the disadvantages of the existing MLPA associated with the stuffer, multiple detection of the copy number polymorphism according to the mobile phase difference according to the three-dimensional structure of the probe irrespective of the difference in the length of the probe.

First, in the present invention, even if the stuffer is not included or the stuffer is included, a probe having the same or similar total length is used. Accordingly, the amplicons of the probe linkage products used in the conventional MLPA are 148 to 481 nt and have different lengths, whereas the amplicons of the present invention are smaller than 90 to 114 nt, more preferably 109 to 112 nt. And have similar lengths. As such, the probe linkage product of the present invention produces amplicons of similar length, and thus cannot be separated based on the length of the product.

In the present invention, in order to multi-analyze CNV from probe linkage products having similar lengths, the probe amplicons are denatured by heat to have a single-stranded polymorphism. Separate each amplicon. Another feature of the present invention is the separation at high resolution using a polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) triblock copolymer solution during electrophoresis, and peaks the number of copies in multiple target regions. Quantification by analysis enables multiple CNV detection.

Thus, in a preferred embodiment, the present invention

(a) contacting the sample nucleic acid and the reference nucleic acid with at least two probe sets, respectively,

Each probe set is

A first probe comprising a target hybridization sequence complementary to a first site of a target nucleic acid and a universal primer recognition sequence linked to the 5 'end of the target hybridization sequence and non-complementary to the target nucleic acid, and

A second probe comprising a target hybridization sequence complementary to said first site of said target nucleic acid and a universal primer recognition sequence linked to the 3 'end of said target hybridization sequence and non-complementary to said target nucleic acid,

Each probe set has a different target hybridization site in the target nucleic acid,

The first probe or the second probe does not include a stuffer sequence between the target hybridization sequence and the universal primer recognition sequence or comprises a stuffer sequence of the same or similar length regardless of the target hybridization sequence;

(b) incubating the sample nucleic acid and the standard nucleic acid with each of the at least two probe sets to hybridize the target site of each nucleic acid with the target hybridization sequence in the probe;

(c) linking the first probe and the second probe hybridized with the target nucleic acid to produce a probe linkage product;

(d) PCR amplifying probe linkage products using universal primers;

(e) denaturing each probe linkage product to induce single stranded structural polymorphism;

(f) unmodified capillary electrophoresis for each probe linkage product; And

(g) comparing the peak areas in the sample nucleic acid and the standard nucleic acid,

A multiple detection method for copy number polymorphism.

Since the CNV multiple detection method of the present invention is easily illustrated in FIG. 1, it may be referred to.

Hereinafter, the CNV multiplex detection method of the present invention will be described in more detail.

Step (a) is a step of contacting a sample nucleic acid and a reference nucleic acid with two or more probe sets, respectively, wherein the two probes constituting each probe set have a target hybridization base sequence and a universal primer recognition sequence as with a conventional MLPA probe. Including but not including the stuffer sequence or the same or similar lengths.

“Sample nucleic acid” refers to a nucleic acid isolated from a subject to be detected for the presence or absence of CNV, and may be a nucleic acid isolated from whole blood, serum, plasma, saliva, urine, sputum, lymph, or cells of the sample. "Standard nucleic acid" refers to a nucleic acid of a normal genome in which chromosomal duplications, deletions, substitutions, and the like are not shown. In order to confirm the exact concentration of the target gene in the sample nucleic acid, a comparison with the normal control is required. Therefore, as an internal control, a probe set is separately processed for the standard nucleic acid, and the analysis of the normal genes is also performed.

In addition, the present invention is a combination of two or more probe sets, preferably 10 or more probe sets, more preferably about 20 to 40 probe sets to target CNV of multiple genomic regions simultaneously. It can be used simultaneously in the reactor.

Step (b) is a step of hybridizing the sample nucleic acid and the standard nucleic acid with the probe, respectively, by applying heat to each nucleic acid (for example, 95 ° C. or higher), separating the single nucleic acid, and incubating at a lower temperature. The target hybridization sequence is complementarily bound to the target site in the sample nucleic acid or standard nucleic acid. At this time, the first probe and the second probe recognize adjacent target sites, for example, hybridize with one base difference so that the 3 'end and the 5' end of each probe face each other.

Step (c) is a step of connecting the first probe and the second probe hybridized with the target nucleic acid to generate a probe linkage product, wherein the probe linkage product is 90 to 114 nt in length, preferably 109 to 112 nt in length. It can be a range.

Linking of the first and second probes may be performed by treating the heat-resistant nucleic acid ligase and incubating at about 50 to 60 ° C.

Step (d) is PCR amplification of probe linkage products using universal primers. Since each probe has forward and reverse universal primer recognition sequences, it is possible to amplify all probe linkage products at once using universal primers. .

Step (e) is a step of denaturing the probe linkages to induce a single stranded polymorphism, wherein the addition of strong alkaline chemical reagents such as methyl mercury hydroxide, formamide, sodium hydroxide or urea or by thermal denaturation leads to a single stranded polymorphism. Although derived, the scope of the present invention is not limited thereto. It is preferably denatured by addition and heating of formamide and immediately cooled (eg, left in an ice bath) to induce single stranded structural polymorphism. When the single-stranded polymorphism is induced, probe amplicons with different target hybridization sequences form unique stereostructures. Since the difference in movement speed during electrophoresis varies according to the shape of the particles, the mobile phase according to the three-dimensional structure CNV detection according to the difference becomes possible.

Step (f) is an unmodified capillary electrophoresis of the probe linkages in which the single stranded polymorphism is induced, wherein the polyethylene oxide-polypropyleneoxide-polyethyleneoxide (PEO-PPO-PEO) triblock copolymer is included. It is particularly preferable for high resolution separation to use a filling gel.

Step (g) is a step of comparing the peak areas in the sample nucleic acid and the standard nucleic acid, and can detect multiple copies polymorphism by performing peak analysis through a Genetic Analyzer.

In a specific embodiment of the present invention, genomic DNA is extracted from five cell lines known to vary in X-chromosome copy number (1-5) and then modified MLPA of the present invention results in all target-specific peaks being reliably isolated. It could be confirmed. In addition, the copy number determination using the modified MLPA of the present invention was more accurate than the existing MLPA, and the coefficient of variation of the measured copy number was significantly lower. In addition, the measurement of CNV in the autosomal between two HapMap individuals by applying the present invention confirmed that all peaks for the CNV target show the expected copy number change. These results support that the present invention overcomes the limitations of existing MLPAs due to the difficulty of producing long probes and probes and is a novel technique showing excellent multi-performance.

Thus, the present invention can be used to multiplex diagnose and screen chromosomal abnormalities due to duplication and deletion, such as trisomy, monosomy, and sex chromosomal abnormalities. The method also diagnoses genetic diseases due to the deletion of small chromosomes such as duchenne / Becker-type muscular dystrophy and detects small changes to the chromosomes of genetic predispositions caused by various causes such as mental retardation, Alzheimer's disease, and diabetes. It is useful to pay. It can also be used to analyze changes in the number of copies of oncogenes and tumor suppressor genes in cancer tissues or more than the overall number of chromosomes.

As another aspect, the present invention

A first probe comprising a target hybridization sequence complementary to a first site of a target nucleic acid and a universal primer recognition sequence linked to the 5 'end of the target hybridization sequence and non-complementary to the target nucleic acid, and

A probe set comprising a target hybridization sequence complementary to a second site adjacent said first site of a target nucleic acid and a second probe linked to the 3 'end of said target hybridization sequence and comprising a universal primer recognition sequence that is non-complementary to the target nucleic acid; 2 or more included

Each of the at least two probe sets is different from the target hybridization site in the target nucleic acid,

Wherein either the first probe or the second probe does not include a stuffer sequence between the target hybridization sequence and the universal primer recognition sequence, or comprises a stuffer sequence of the same length regardless of the target hybridization sequence,

A kit for multiple detection of copy number polymorphism of a target nucleic acid.

The kit of the present invention comprises a set of probes designed to hybridize with a target nucleic acid in a sample nucleic acid and a standard nucleic acid, and in addition, means for heat-resistant nucleic acid enzymes, probe amplification means, single stranded structure polymorphism and capillary electrophoresis for probe linkage. It may include, and may be a kit designed to detect CNV compared to a standard nucleic acid.

In one embodiment, the probe set used in the multiple detection method and kit of copy number polymorphism of the present invention is a probe set for multiple detection of copy number polymorphism on the X chromosome,

A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 1 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 2 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 3 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 4 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 5 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 6 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 7 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 8 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 9 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 10 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 11 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 12 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 13 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 14 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 15 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 16 and a universal primer recognition sequence of SEQ ID NO: 42 Set, and

A first probe comprising a target hybridization sequence of SEQ ID NO: 17 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 18 and a universal primer recognition sequence of SEQ ID NO: 42 Two or more probe sets selected from the group consisting of sets.

In another embodiment, the probe set used in the multiple detection method and kit of copy number polymorphism of the present invention is a probe set for multiple detection of copy number polymorphism on an autosomal polymorphism.

A first probe comprising a target hybridization sequence of SEQ ID NO: 21 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 22 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 23 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 24 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 25 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 26 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 27 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 28 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 29 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 30 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 31 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 32 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 33 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 34 and a universal primer recognition sequence of SEQ ID NO: 42 set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 35 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 36 and a universal primer recognition sequence of SEQ ID NO: 42 Set, and

A first probe comprising a target hybridization sequence of SEQ ID NO: 37 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 38 and a universal primer recognition sequence of SEQ ID NO: 42 Two or more probe sets selected from the group consisting of sets.

The modified MLPA technology of the present invention overcomes the limitations of existing MLPAs due to the difficulty of preparing long length probes and probes, and is a new technique showing excellent multi-performance.

1 is a schematic of the principle of the modified MLPA method of the present invention.
FIG. 2 performs a capillary electrophoresis analysis single assay after hybridization of the probe and the target nucleic acid, coupling of the first and second probes, and PCR amplification using nine probe sets that do not include a stuffer (A ), Single-strand structural polymorphism and capillary electrophoresis analyzes show the separation of assay products (B).
Figure 3 is a target in MLPA electrophoresis according to each method in order to compare the accuracy and reliability of X chromosome copy number (1X, 2X, 3X, 4X, 5X) measurement by the conventional MLPA method and modified MLPA technology of the present invention Peak analysis results (A, B) and relative copy number measurement results (C, D) are shown.
Figure 4 (A) shows the relationship between the amplicon size and the coefficient of variation (coefficient of variation, CV) measured in the existing MLPA, (B) is amplicon size and measured copy number in the modified MLPA of the present invention It is related to the coefficient of variation of.
5 shows the relationship between MLPA product length and coefficient of variation (CV). 1X, 2X, 3X, 4X, 5X represent the copy number of the X chromosome, respectively, and plotted the CV of 47 probes with a 130-481 bp length range.
Figure 6 shows the results of the measurement of autosomal CNV using a modified MLPA of the present invention. (A) shows all peaks for autosomal CNV targets, and (B) shows a comparison of the relative copy number determined by the modified MLPA and genomic qPCR of the present invention.
7 shows copy number profiles of 9 CNVs on the positive control region and autosomal.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1. Cell Lines and Genomes DNA  extraction

GM10851, GM15510, GM04626, GM01416, and GM06061 cell lines, each with X chromosome 1-5 copies, were purchased from Coriell Institute for Medical Research (Camden, NJ, USA) and cultured according to the manufacturer's instructions. Each DNA sample was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. Quantitative and qualitative analysis of genomic DNA samples was performed using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA).

Example  2. MLPA Probe  And qPCR Primer  Produce

The MLPA probe was designed to consist of a universal primer recognition site and a target hybridization sequence and not include a stuffer sequence. A total of 20 probe sets were designed in the same way (Table 1 and Table 2), 9 of which were previously designed and were designed with SALSA MLPA Kit P106 MRX (MRC-Holland, Amsterdam, The Netherlands) (Madrigal et al. Genet Med 9: 117-122, 2007), were X-chromosome probes having the same target hybridization sequence as included in (Chem. Target hybridization sequences of the other probes were designed according to the synthetic probe design protocol recommended by MRC-Holland ( http://www.mlpa.com ). The probe was designed without considering the length variation of the amplification products, and the length range of 90 ~ 114 nt.

Amplification Label Cytoband Hybridization Sequence of Probe 1 (Left) Length Hybridization Sequence of Probe 2 (Right) X
Chromosome copy ACSL4 Xq22.3 GACACACCGATTCATGAATGTCTGCTTCT (SEQ ID NO: 1) 109 (148) GCTGCCCAATTGGCCAGGGTTATGGACTGACAGAATCA (SEQ ID NO: 2) SLC6A8 Xq28 TGGAGATCTTCCGCCATGAAGACTGTGCCAA (SEQ ID NO: 3) 110 (208) TGCCAGCCTGGCCAACCTCACCTGTGACCAGCTTGCT (SEQ ID NO: 4) AFF2-1 Xq28 CTTCCTGGCCTACTCCTCTCACTTCCATG (SEQ ID NO: 5) 109 (241) CATACTGCTGGACACTCTGAGCAGAGCACCTTTTCCAT (SEQ ID NO: 6) AFF2-2 Xq28 GACAGGAACACTCCATCCCCAGTGTCTCTCA (SEQ ID NO: 7) 111 (261) ACAACGTCTCCCCCATCAACGCAATGGGGAACTGTAAC (SEQ ID NO: 8) IL1RAPL1 Xp21.3 CCTTTAAGAGCTGGAAGATGAAAGCTC (SEQ ID NO: 9) 112 (328) CGATTCCACACTTGATTCTCTTATACGCTACTTTTACTCAGAG (SEQ ID NO: 10) AFF2-3 Xq28 CCAGCCCCTAGGAAAGAACCAAGACCT (SEQ ID NO: 11) 109 (337) AACATCCCTTTGGCTCCCGAGAAGAAGAAGTACAGAGGGC (SEQ ID NO: 12) AGTR2 Xq23 CGTCCCAGCGTCTGAGAGAACGAG (SEQ ID NO: 13) 109 (355) TAAGCACAGAATTCAAAGCATTCTGCAGCCTGAATTTTGAAGG (SEQ ID NO: 14) PAK3-1 Xq22.3 CGAGGATGAATAGTAACAACCGGGATTCTTCA (SEQ ID NO: 15) 109 (385) GCACTCAACCACAGCTCCAAACCACTTCCCATGGC (SEQ ID NO: 16) PAK3-2 Xq22.3 CGCGGCTGCTGTTCTTAATTGCTTCC (SEQ ID NO: 17) 109 (481) TTTGCAGCGATAATCAGAGGAGTCAGGCTGGAGAGAGGCTT (SEQ ID NO: 18) standard
(standard) RNaseP 14q11.2 CCATTGAACTCACTTCGCTGGCCGTGA (SEQ ID NO: 19) 94 GTCTGTTCCAAGCTCCGGCAAAGGA (SEQ ID NO: 20)

Amplification Label Cytoband Hybridization Sequence of Probe 1 (Left) Length Hybridization Sequence of Probe 2 (Right) Autosomal L-1 2q22.3 CCATCTCTTTGGTAGTAAGTGGCATATAGGCAAATC (SEQ ID NO: 21) 114 CATCTAAGCAAACTCCATCTTCATTAGTGTTGCGGT (SEQ ID NO: 22) L-2 10q21.1 GGACATGATATAAACTCAGAGCAGGACTGC (SEQ ID NO: 23) 101 TTAGCCCCAATCACTAGATTGGTCATCAC (SEQ ID NO: 24) G-1 4p15.1 CTCCACCAGAGTGCATTTGAGCA (SEQ ID NO: 25) 91 GCCTGCTAACCTTTTGGATATCCCAG (SEQ ID NO: 26) G-2 22q11.22 CCAGGAACAGGGGGTATTTGAGCAT (SEQ ID NO: 27) 102 CTCTGAGCTGCAGCCTGAGGACGAGGCTATGTATT (SEQ ID NO: 28) G-3 22q11.22 CCAGATCAGCTCAGGAGTGAGGCCATAACAC (SEQ ID NO: 29) 106 AACCTACAGTGACGATGTCAACCCAGATGATGG (SEQ ID NO: 30) G-4 6q14.1 CTCCCTGTGGAATGTGAACAATCTAGC (SEQ ID NO: 31) 97 ATAGGTTTCTGAAGGGAACCTGGCGCTA (SEQ ID NO: 32) NC-1 13q32.1 CGAGTATGCAAAAGATCTCTTCCAGCAGCGCTAC (SEQ ID NO: 33) 102 CACCACACCAAGCAGCTAGAGCACCA (SEQ ID NO 34) NC-2 1q42.2 CCAGAGAGCAGAGGAAACAGAAGAGG (SEQ ID NO: 35) 95 CAACCAAGAGACCACTCTGGTTTTCAC (SEQ ID NO: 36) NC-3 11q22.3 CTGAGCTGAAAGCTGAAAACTAAGGAAGAGCCAATC (SEQ ID NO: 37) 108 TTGGGAGAACCAAGCAAAGGATGTGGGTAG (SEQ ID NO: 38) CTRL Xq22.3 CCTGAAGAGCTATCTACCAGTGCCGTTGACAT (SEQ ID NO: 39) 104 CCAAGCCACAGAATTCTTTTCCTCACTTCG (SEQ ID NO: 40)

* In Table 1 and Table 2, the 5 'end of probe 1 is tagged with the same primer recognition sequence as the forward universal primer sequence (5'-GGG TTC CCT AAG GGT TGG A-3', SEQ ID NO: 41)

* In Table 1 and Table 2, the 3 'end of probe 2 is tagged with a primer recognition sequence (5'-TCT AGA TTG GAT CTT GCT GGC AC-3', SEQ ID NO: 42) that is reverse complementary to the reverse universal primer sequence.

* 'Length' in Tables 1 and 2 means the total length including the target hybridization sequence and the primer recognition sequence

* The lengths in parentheses in Tables 1 and 2 refer to the total length when the stuffer sequence is included.

* Table 1 used RNaseP as an intrinsic control for both X chromosome and autosomal copy number measurements.

* CTRL in Table 2 was used as a positive control for the number of X chromosome copies

Primers for qPCR identification were designed using PrimerQuest ( http://www.idtdna.com/Scitools/Applications/Primerquest ) (Table 3). Specificity of the primers was confirmed using the UCSC database ( http://genome.ucsc.edu/ ), and no repeat sequence was detected in the amplicon. All probes and primers were synthesized by Genotech (Daejeon, Korea).

Label Cytoband Forward Reverse L-1 2q22.3 TGAGTCTCTGGGCCTGGTTCATTT
(SEQ ID NO: 43) TCCTTGCACTCTGCCAGCTTATCT
(SEQ ID NO: 44) L-2 10q21.1 GTTCTTGCCCAGGTCCATATAA
(SEQ ID NO: 45) AAATGGCAAACTGGACAGAAGT
(SEQ ID NO: 46) G-1 4p15.1 GCATTGCTCCACCAGAGTGCATTT
(SEQ ID NO: 47) TGGGCTCCTCTTACTCAATTGCCA
(SEQ ID NO 48) G-2 22q11.22 AGCCTGAGGACGAGGCTATGTATT
(SEQ ID NO: 49) TGGGTTCCATTTCTTCCTCCCACT
(SEQ ID NO: 50) G-3 22q11.22 AGTGGGAGGAAGAAATGGAACCCA
(SEQ ID NO: 51) TTTACAGCAACACTGCAGGACCAG
(SEQ ID NO: 52) G-4 6q14.1 TTTCTGAAGGGAACCTGGCGCTAT
(SEQ ID NO: 53) AGTGTGGTCATGCAAGGCTCCTAT
(SEQ ID NO: 54) NC-1 13q32.1 CGCTACCACCACACCAAGCAG
(SEQ ID NO: 55) CCACCTGGCTGTTGTAGTCCTC
(SEQ ID NO: 56) NC-2 1q42.2 ACAGAAGAGGCAACCAAGAGACCA
(SEQ ID NO: 57) TGGCTTCAACAGTGGCACAACATC
(SEQ ID NO: 58) NC-3 11q22.3 ACGCTGACAAGGTTCCTCCTTTGT
(SEQ ID NO: 59) TCAGCTTTCAGCTCAGTGTCACCT
(SEQ ID NO: 60) CTRL Xq22.3 TCTACCAGTGCCGTTGACATCCAA
(SEQ ID NO: 61) AACTGGTGAGGCAGGCTAGTTCAT
(SEQ ID NO: 62)

Example  3. MLPA

MLPA was performed according to the instructions provided by MRC-Holland. All buffers and enzymes were purchased from MRC-Holland. In brief, 5 μL of genomic DNA (40-60 ng / μL) was initially denatured at 98 ° C. for 5 min, followed by addition of 1.5 μL probe set (2 fmol each / μL for synthetic probes) and 1.5 μL MLPA buffer. . 95 that mixture? The mixture was hybridized by incubating at 60 ° C for 16 hours after incubation for 1 minute at. After hybridization, 3 μL of each ligase buffer A and B, 25 μL of nuclease-free water, and 1 μL of Ligase-65 were added at 54 ° C. and incubated at 54 ° C. for 15 minutes. Connected. After thermal inactivation at 98 ° C. for 5 minutes, 10 μL of ligation reaction solution was mixed with 30 μL of diluted SALSA PCR buffer and heated to 60 ° C., followed by 0.5 μL of SALSA polymerase and 2 μL of SALSA enzyme dilution. Buffer, 2 μL of SALSA primer, and 5.5 μL of nuclease free purified water. Immediately after addition of all PCR reagents, PCR was performed under the following conditions: 30 cycles at 95 ° C., 30 seconds at 60 ° C., and 60 seconds at 72 ° C., followed by final elongation at 72 ° C. for 20 minutes. All reactions were repeated three times, followed by capillary electrophoresis alone, or single stranded structure polymorphism and capillary electrophoresis.

Example  4. Single Strand Structural Polymorphism and Capillary Electrophoresis

Capillary electrophoresis was performed using the ABI 3130XL Genetic Analyzer (36-cm capillary array and POP7 polymer; Applied Biosystems, Foster City, CA, USA) using a protocol provided by MRC-Holland ( http://www.mlpa.com ). Followed. 0.7 μL of the PCR reaction aliquot was mixed with 9 μL of Hi-Di formamide and 0.3 μL of GeneScan 500 ROX Size Standard (Applied Biosystems), incubated at 80 ° C. for 2 minutes, and then cooled on ice. Samples were injected into capillaries and applied for 15 seconds at a voltage of 1.6 kV, followed by electrophoresis at 10 kV electrophoresis voltage and 60 ° C.

Single-stranded structure polymorphism and capillary electrophoresis analysis showed slight modifications to our previous reports (Shin et al. Electrophoresis 31: 2405-2410, 2010; Shin et al. J Sep Sci 33: 1639-1643, 2010). Addition was carried out. 0.7 μL of 50-fold diluted PCR reaction samples were mixed with 9 μL of Hi-Di formamide and 0.3 μL of GeneScan 500 ROX Size Standard (Applied Biosystems). The sample mixture was denatured at 95 ° C. for 5 minutes and then cooled on ice for 2 minutes. Non-denaturing electrophoresis was performed using an ABI 3130XL Genetic Analyzer using a 50 cm capillary array (Applied Biosystems) and 15 wt% Pluronic F108 (Product No. 542342; Sigma-Aldrich, St. Louis, MO, USA) solution. (Applied Biosystems). A polymer solution comprising a polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) triblock copolymer was prepared, samples were injected into a capillary and applied for 5 seconds at a voltage of 15 kV, followed by electrophoresis of 15 kV. Electrophoresis at voltage and 35 ° C.

In both methods, peak areas were calculated using GeneMapper software (Applied Biosystems). For normalization, all signals were divided by the signals of the control probes and the normalized signals obtained from the DNA samples were compared. In the assay according to the existing MLPA, one of three denatured control probes was selected for standardization. In the assay according to the invention a probe targeting RNaseP was added for standardization.

Example  5. Real time qPCR  analysis

Genomic qPCR was performed using the Mx3000P qPCR system (Stratagene, La Jolla, CA, USA). A primer set targeting RNaseP was used as a diploid control (Cat. No. 4316844; Applied Biosystems). PCR efficiency of all primers was determined experimentally and all primers were found to be suitable for reliable copy number quantification. The PCR reaction included 1 × Maxima SYBR Green qPCR Master Mix (Fermentas, Eugene, OR, USA), 10 ng of DNA sample, and 10 pmol of primer, with a total volume of 10 μL. qPCR was performed under the following conditions: initial denaturation at 95 ° C. for 30 seconds, followed by 40 cycles with conditions of 5 seconds at 95 ° C., 10 seconds at 60 ° C., and 20 seconds at 72 ° C. Relative DNA copy number was determined by ΔΔCT method (Yim et al. Hum Mol Genet 19: 1001-1008). All experiments were performed three times.

Experiment result

1. Principle of the Invention

In order to establish a reliable multiple CNV detection technique while minimizing the shortcomings associated with the long stuffer in the probe, we have modified the MLPA technique, which analyzes the copy number depending on the length difference of the probe, to copy DNA regardless of the length of the probe. We have developed a new method for determining numbers. The principle of the invention is illustrated in FIG. 1. First, a probe connecting product including a primer recognition site was formed at both ends by hybridizing probes having similar total lengths with template DNA even if they did not include a stuffer or a stuffer, and connected the first and second probes. Second, the probe linkage product was amplified using a universal primer tagged with fluorescent material. Unlike conventional MLPA, the probe of the present invention produces amplicons of similar length, and thus cannot be separated based on the length of the product. Third, the amplified product was thermally denatured and single stranded structural polymorphism and non-denatured capillary electrophoresis analysis were performed. In electrophoresis, instead of conventional separation medium (eg, POP-CAP; Applied Biosystems), a polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) triblock copolymer solution was used for high resolution separation. Finally, DNA copy numbers in multiple target regions were quantified by peak analysis.

2. Existing MLPA  Modifications of the Invention Compared to the Law MLPA  Validation of the system

In order to confirm that the modified MLPA technique of the present invention reliably distinguishes between single copy differences, we have applied the technique to genomic DNA ranging from five cell lines to X chromosome copy numbers (1-5 copies). Out of 47 probes targeting the X chromosome, we previously used nine stuffer-free probes with the same target hybridization sequence as previously designed and included in the SALSA MLPA Kit P106 MRX (MRC-Holland, Amsterdam, The Netherlands). Compared with MLPA technology. While the nine stuffer-containing probe amplicons used in conventional MLPA are nucleotides (148) to 148-481, the length of the nine stuffer-free probe amplicons of the present invention is smaller and similar to each other than that of the conventional method. (109-112 nt). Detailed information on the stuffer-free probes used in the present invention is summarized in Tables 1 and 2.

In order to confirm that the electrophoretic mobility of each stuffer-free probe amplicon is unique, we used a stuffer-free probe to hybridize the probe to the target nucleic acid, the first and second probes. Ligation, and PCR amplification were performed and the assay products were separated by a single analysis of capillary electrophoresis analysis, or by single stranded structure polymorphism and capillary electrophoresis analysis. Capillary Electrophoresis Analysis In a single reaction, each of the nine probes produced an amplification product of the expected size. Thus, multiple reaction products were not separated using conventional capillary electrophoresis settings (FIG. 2A). However, all nine targets could be distinguished by high resolution single stranded structure polymorphism and capillary electrophoresis analysis for the same PCR product (FIG. 2B). Characteristic shifts were reproducible in single stranded polymorphism and capillary electrophoresis analysis even when randomly distributed fragments of similar length with different sequences were on electropherograms.

Next, in order to confirm the accuracy and reliability of the copy number measurement by the modified MLPA technique of the present invention which does not depend on the probe length, the present inventors compared and analyzed with the existing MLPA method. In MLPA electrophoresis, the expected number of target peaks (47 target peaks, 4 control peaks, and 2 Y chromosome specific peaks on the X chromosome) showed their exact size, and the peak height was the number of X copies ( n = 1-5)) (FIG. 3A). In the electrophoresis of the modified MLPA technique of the present invention, all 10 target peaks (9 X chromosome targets and reference peaks) were clearly separated and the peak area also increased dose dependently (FIG. 3B). Relative copy numbers were calculated from the peak areas of nine probes sharing the same target hybridization sequence. To this end, a GM15510 cell line with X chromosome 2 copies was used as a calibrator. Autosomal control peaks and RNaseP peaks were used as endogenous controls. After copy number calculation, linear regression analysis was performed to evaluate the accuracy of the copy number measurement. Both assay techniques showed consistently good results, but the modified MLPA technique of the present invention without Stuffer showed better results than conventional MLPA (FIGS. 3C and D). In addition, the mean R squared values for the nine targets were similar between the conventional MLPA (0.98) and the modified MLPA (0.99) of the present invention, but the slope value (0.94 ± 0.08) of the modified MLPA of the present invention was similar to the existing MLPA. Significantly higher than (0.76 ± 0.08). In addition, there was less standard error in the modified MLPAs of the present invention, indicating that the present invention is more effective in distinguishing single copy number differences compared to existing MLPAs.

3. Amplicon  Size-dependence increases the effectiveness of copy number determination.

The inventors examined whether the difference in probe length affects the probe amplification stability and ultimately examined the reliability of the copy number measurement by measuring the coefficient of variation (CV) of the measured copy number ( 4). Regardless of the number of X chromosome copies, the mean CV of the copy number measured by the conventional MLPA method was significantly higher than the CV of the modified MLPA of the present invention (25.7% ± 7.4% vs. 5.5% ± 4.0%, P = 1.79 x 10 ^-18 ). In the existing MLPA method, the CV of nine targets increased with increasing probe length (FIG. 4A). Conversely, in the modified MLPA technique of the present invention, the CVs of all nine targets with short amplicons (109-112 bp) of similar size were all low (FIG. 4B). This trend was further confirmed in all 47 existing MLPA probes on the X chromosome (FIG. 5). For example, the smallest probe (AGTR2) was 130 nt in length and the average CV for its five cell lines was 17%, whereas the longest probe (PAK3) was 481 nt in length and its average CV was 37%.

4. Multiple Autosomal CNV  Variation of the invention to detection MLPA  Application of the technology

To determine whether the modified MLPA of the present invention can detect CNV on autosomal bodies, we used Agilent 2X244K whole-genome CNV analysis to examine the Caucasian HapMap samples GM10851 (male, reference) and GM15510 (female, test). CNV of the liver was measured. We randomly selected nine autosomal regions: six regions comprising CNV (two copies lost CNV, L-1 and -2; four copies added CNV, G-1, -2 , -3 and -4) and three genomic regions without CNV (NC-1, -2 and -3) (Figure 6). Copy number profiles of nine autosomal targets are shown in FIG. 7. Probe on X-chromosome (Xp22.3) was included as a positive control for detecting a known 1 copy difference between GM10851 (male) and GM15510 (female), and RNaseP probe was included as an endogenous control. Detailed information on the MLPA probes used in the present invention is summarized in Tables 1 and 2. All peaks for autosomal CNV targets show expected copy number changes based on values obtained in CNV array analysis (FIG. 6A). For example, the homozygous loss of GM15510 (L-1) did not show an individual peak, and the heterozygous loss region (L-2) was lower in GM15510 compared to GM10851. Peaks were shown. CNV array analysis showed similar signal intensities in genomic regions without CNV. As a result of adjusting the magnification of the peak signal to the signal of the intrinsic control, all targets were accurately detected by the modified MLPA assay of the present invention (FIG. 6B). We performed a singleplex qPCR analysis on the same target and compared the results with those by the modified MLPA assay of the present invention. The results showed that all of the modified MLPAs of the present invention matched, supporting the reliability and suitability of the modified MLPA technology of the present invention for determining copy number.

<110> CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Method for multiplex determination of copy number variation using          modified MLPA <130> DPP20121478KR <160> 62 <170> Kopatentin 1.71 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-1 <400> 1 gacacaccga ttcatgaatg tctgcttct 29 <210> 2 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-2 <400> 2 gctgcccaat tggccagggt tatggactga cagaatca 38 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-1 <400> 3 tggagatctt ccgccatgaa gactgtgcca a 31 <210> 4 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-2 <400> 4 tgccagcctg gccaacctca cctgtgacca gcttgct 37 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-1 <400> 5 cttcctggcc tactcctctc acttccatg 29 <210> 6 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-2 <400> 6 catactgctg gacactctga gcagagcacc ttttccat 38 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-1 <400> 7 gacaggaaca ctccatcccc agtgtctctc a 31 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-2 <400> 8 acaacgtctc ccccatcaac gcaatgggga actgtaac 38 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Xp21.3 probe-1 <400> 9 cctttaagag ctggaagatg aaagctc 27 <210> 10 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Xp21.3 probe-2 <400> 10 cgattccaca cttgattctc ttatacgcta cttttactca gag 43 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-1 <400> 11 ccagccccta ggaaagaacc aagacct 27 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-2 <400> 12 aacatccctt tggctcccga gaagaagaag tacagagggc 40 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Xq23 probe-1 <400> 13 cgtcccagcg tctgagagaa cgag 24 <210> 14 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Xq23 probe-2 <400> 14 taagcacaga attcaaagca ttctgcagcc tgaattttga agg 43 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-1 <400> 15 cgaggatgaa tagtaacaac cgggattctt ca 32 <210> 16 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-2 <400> 16 gcactcaacc acagctccaa accacttccc atggc 35 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-1 <400> 17 cgcggctgct gttcttaatt gcttcc 26 <210> 18 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-2 <400> 18 tttgcagcga taatcagagg agtcaggctg gagagaggct t 41 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <220> 14q11.2 probe-1 <400> 19 ccattgaact cacttcgctg gccgtga 27 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 14q11.2 probe-2 <400> 20 gtctgttcca agctccggca aagga 25 <210> 21 <211> 36 <212> DNA <213> Artificial Sequence <220> 2q22.3 probe-1 <400> 21 ccatctcttt ggtagtaagt ggcatatagg caaatc 36 <210> 22 <211> 36 <212> DNA <213> Artificial Sequence <220> 2q22.3 probe-2 <400> 22 catctaagca aactccatct tcattagtgt tgcggt 36 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> 10q21.1 probe-1 <400> 23 ggacatgata taaactcaga gcaggactgc 30 <210> 24 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> 10q21.1 probe-2 <400> 24 ttagccccaa tcactagatt ggtcatcac 29 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 4p15.1 probe-1 <400> 25 ctccaccaga gtgcatttga gca 23 <210> 26 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 4p15.1 probe-2 <400> 26 gcctgctaac cttttggata tcccag 26 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> 22q11.22 probe-1 <400> 27 ccaggaacag ggggtatttg agcat 25 <210> 28 <211> 35 <212> DNA <213> Artificial Sequence <220> 22q11.22 probe-2 <400> 28 ctctgagctg cagcctgagg acgaggctat gtatt 35 <210> 29 <211> 31 <212> DNA <213> Artificial Sequence <220> 22q11.22 probe-1 <400> 29 ccagatcagc tcaggagtga ggccataaca c 31 <210> 30 <211> 33 <212> DNA <213> Artificial Sequence <220> 22q11.22 probe-2 <400> 30 aacctacagt gacgatgtca acccagatga tgg 33 <210> 31 <211> 27 <212> DNA <213> Artificial Sequence <220> 6q14.1 probe-1 <400> 31 ctccctgtgg aatgtgaaca atctagc 27 <210> 32 <211> 28 <212> DNA <213> Artificial Sequence <220> 6q14.1 probe-2 <400> 32 ataggtttct gaagggaacc tggcgcta 28 <210> 33 <211> 34 <212> DNA <213> Artificial Sequence <220> 13q32.1 probe-1 <400> 33 cgagtatgca aaagatctct tccagcagcg ctac 34 <210> 34 <211> 26 <212> DNA <213> Artificial Sequence <220> 13q32.1 probe-2 <400> 34 caccacacca agcagctaga gcacca 26 <210> 35 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 1q42.2 probe-1 <400> 35 ccagagagca gaggaaacag aagagg 26 <210> 36 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 1q42.2 probe-2 <400> 36 caaccaagag accactctgg ttttcac 27 <210> 37 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 11q22.3 probe-1 <400> 37 ctgagctgaa agctgaaaac taaggaagag ccaatc 36 <210> 38 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 11q22.3 probe-2 <400> 38 ttgggagaac caagcaaagg atgtgggtag 30 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-1 <400> 39 cctgaagagc tatctaccag tgccgttgac at 32 <210> 40 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-2 <400> 40 ccaagccaca gaattctttt cctcacttcg 30 <210> 41 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> universal primer recognition sequence <400> 41 gggttcccta agggttgga 19 <210> 42 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> universal primer recognition sequence <400> 42 tctagattgg atcttgctgg cac 23 <210> 43 <211> 24 <212> DNA <213> Artificial Sequence <220> 2q22.3 probe-1 <400> 43 tgagtctctg ggcctggttc attt 24 <210> 44 <211> 24 <212> DNA <213> Artificial Sequence <220> 2q22.3 probe-2 <400> 44 tccttgcact ctgccagctt atct 24 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> 10q21.1 probe-1 <400> 45 gttcttgccc aggtccatat aa 22 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 10q21.1 probe-2 <400> 46 aaatggcaaa ctggacagaa gt 22 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 4p15.1 probe-1 <400> 47 gcattgctcc accagagtgc attt 24 <210> 48 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 4p15.1 probe-2 <400> 48 tgggctcctc ttactcaatt gcca 24 <210> 49 <211> 24 <212> DNA <213> Artificial Sequence <220> 22q11.22 probe-1 <400> 49 agcctgagga cgaggctatg tatt 24 <210> 50 <211> 24 <212> DNA <213> Artificial Sequence <220> 22q11.22 probe-2 <400> 50 tgggttccat ttcttcctcc cact 24 <210> 51 <211> 24 <212> DNA <213> Artificial Sequence <220> 22q11.22 probe-1 <400> 51 agtgggagga agaaatggaa ccca 24 <210> 52 <211> 24 <212> DNA <213> Artificial Sequence <220> 22q11.22 probe-2 <400> 52 tttacagcaa cactgcagga ccag 24 <210> 53 <211> 24 <212> DNA <213> Artificial Sequence <220> 6q14.1 probe-1 <400> 53 tttctgaagg gaacctggcg ctat 24 <210> 54 <211> 24 <212> DNA <213> Artificial Sequence <220> 6q14.1 probe-2 <400> 54 agtgtggtca tgcaaggctc ctat 24 <210> 55 <211> 21 <212> DNA <213> Artificial Sequence <220> 13q32.1 probe-1 <400> 55 cgctaccacc acaccaagca g 21 <210> 56 <211> 22 <212> DNA <213> Artificial Sequence <220> 13q32.1 probe-2 <400> 56 ccacctggct gttgtagtcc tc 22 <210> 57 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 1q42.2 probe-1 <400> 57 acagaagagg caaccaagag acca 24 <210> 58 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 1q42.2 probe-2 <400> 58 tggcttcaac agtggcacaa catc 24 <210> 59 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 11q22.3 probe-1 <400> 59 acgctgacaa ggttcctcct ttgt 24 <210> 60 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 11q22.3 probe-2 <400> 60 tcagctttca gctcagtgtc acct 24 <210> 61 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-1 <400> 61 tctaccagtg ccgttgacat ccaa 24 <210> 62 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-2 <400> 62 aactggtgag gcaggctagt tcat 24

Claims (13)

(a) contacting the sample nucleic acid and the reference nucleic acid with at least two probe sets, respectively,
Each probe set is
A first probe comprising a target hybridization sequence complementary to a first site of a target nucleic acid and a universal primer recognition sequence linked to the 5 'end of the target hybridization sequence and non-complementary to the target nucleic acid, and
A second probe comprising a target hybridization sequence complementary to said first site of said target nucleic acid and a universal primer recognition sequence linked to the 3 'end of said target hybridization sequence and non-complementary to said target nucleic acid,
Each probe set has a different target hybridization site in the target nucleic acid,
The first probe or the second probe does not include a stuffer sequence between the target hybridization sequence and the universal primer recognition sequence or comprises a stuffer sequence of the same or similar length regardless of the target hybridization sequence;
(b) incubating the sample nucleic acid and the standard nucleic acid with each of the at least two probe sets to hybridize the target site of each nucleic acid with the target hybridization sequence in the probe;
(c) linking the first probe and the second probe hybridized with the target nucleic acid to produce a probe linkage product;
(d) PCR amplifying probe linkage products using universal primers;
(e) denaturing each probe linkage product to induce single stranded structural polymorphism;
(f) unmodified capillary electrophoresis for each probe linkage product; And
(g) comparing the peak areas in the sample nucleic acid and the standard nucleic acid,
Multiple detection method of copy number variation.
The method of claim 1, wherein the method analyzes the copy number according to the difference in mobile phase along the single strand conformation of the amplified probe linkages.
The method of claim 1, wherein the probe linkage product is in the range of 90 to 114 nt in length.
The method of claim 3, wherein the probe linkage product is in the range of 109 to 112 nt in length.
The method of claim 1, wherein 20 to 40 probe sets are treated in one reactor.
The method of claim 1, wherein step (c) is to process the heat resistant nucleic acid ligase to produce a probe linkage product.
The method of claim 1, wherein step (e) denaturates each probe linkage product by addition and heating of formamide to induce a single stranded structural polymorphism.
The method according to claim 1, wherein the capillary electrophoresis in step (f) uses a filling gel comprising polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) triblock copolymer.
The method of claim 1, wherein the probe set is
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 1 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 2 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 3 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 4 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 5 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 6 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 7 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 8 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 9 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 10 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 11 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 12 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 13 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 14 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 15 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 16 and a universal primer recognition sequence of SEQ ID NO: 42 Set, and
A first probe comprising a target hybridization sequence of SEQ ID NO: 17 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 18 and a universal primer recognition sequence of SEQ ID NO: 42 Selected from the group consisting of
Two or more probe sets,
Multiple detection method of copy number polymorphism on X chromosome.
The method of claim 1, wherein the probe set is
A first probe comprising a target hybridization sequence of SEQ ID NO: 21 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 22 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 23 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 24 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 25 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 26 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 27 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 28 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 29 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 30 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 31 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 32 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 33 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 34 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 35 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 36 and a universal primer recognition sequence of SEQ ID NO: 42 Set, and
A first probe comprising a target hybridization sequence of SEQ ID NO: 37 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 38 and a universal primer recognition sequence of SEQ ID NO: 42 At least two probe sets selected from the group consisting of
Multiple detection method of copy number polymorphism on autosomal.
A first probe comprising a target hybridization sequence complementary to a first site of a target nucleic acid and a universal primer recognition sequence linked to the 5 'end of the target hybridization sequence and non-complementary to the target nucleic acid, and
A probe set comprising a target hybridization sequence complementary to a second site adjacent said first site of a target nucleic acid and a second probe linked to the 3 'end of said target hybridization sequence and comprising a universal primer recognition sequence that is non-complementary to the target nucleic acid; 2 or more included
Each of the at least two probe sets is different from the target hybridization site in the target nucleic acid,
Wherein the first probe or the second probe does not include a stuffer sequence between the target hybridization sequence and the universal primer recognition sequence or comprises a stuffer sequence of the same or similar length regardless of the target hybridization sequence,
Kit for multiple detection of copy number polymorphism of target nucleic acid.
The method of claim 1, wherein the probe set is
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 1 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 2 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 3 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 4 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 5 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 6 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 7 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 8 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 9 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 10 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 11 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 12 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 13 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 14 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 15 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 16 and a universal primer recognition sequence of SEQ ID NO: 42 Set, and
A first probe comprising a target hybridization sequence of SEQ ID NO: 17 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 18 and a universal primer recognition sequence of SEQ ID NO: 42 Selected from the group consisting of
Two or more probe sets,
Kit for multiple detection of copy number polymorphism on X chromosome.
The method of claim 1, wherein the probe set is
A first probe comprising a target hybridization sequence of SEQ ID NO: 21 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 22 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 23 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 24 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 25 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 26 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 27 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 28 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 29 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 30 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A primer comprising a first probe comprising a target hybridization sequence of SEQ ID NO: 31 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 32 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 33 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 34 and a universal primer recognition sequence of SEQ ID NO: 42 set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 35 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 36 and a universal primer recognition sequence of SEQ ID NO: 42 Set, and
A first probe comprising a target hybridization sequence of SEQ ID NO: 37 and a universal primer recognition sequence of SEQ ID NO: 41, and a primer comprising a second probe comprising a target hybridization sequence of SEQ ID NO: 38 and a universal primer recognition sequence of SEQ ID NO: 42 At least two probe sets selected from the group consisting of
Kit for multiple detection of copy number polymorphism on autosomal.

Images