KR101513276B1 - Method for multiplex determination of copy number variation using modified MLPA - Google Patents

Abstract

The present invention is a modification of the existing MLPA (Multiplex Ligation-dependent Probe Amplification) technique for analyzing the number of copies depending on the difference in length of probes. A method for multiplex detection of copy number polymorphism, and a kit for implementing the method.

Description

Methods for Multiplexing Copyrights Polymorphism Using Modified MLPA [

The present invention is a modification of the existing MLPA (Multiplex Ligation-dependent Probe Amplification) technique for analyzing the number of copies depending on the difference in length of probes. A method for multiplex detection of copy number polymorphism, and a kit for implementing the method.

Along with single-nucleotide polymorphisms (SNPs), large-scale deletions or amplifications have been implicated in evolution and are associated with phenotypic variation and human disease. This structural variation is called copy-number variation (CNV), and many quantitative analysis techniques have been developed to detect it. However, population genetics and disease studies mostly rely on array-based genome screening and PCR-based validity analysis.

In recent years, techniques such as array comparative genomic hybridization (array-CGH) and SNP array analysis have been used for CNV analysis of the genome as a whole based on hybridization-based copy number detection. However, the above analytical technique has a problem that CNV can not be reliably detected due to nonspecific hybridization to some CNVs. Therefore, CNV detection by hybridization-based technical means needs to be validated by quantitative genetic analysis. Recently, next generation sequencing (NGS) technology has been proposed as a new method for quantitative sequencing and CNV detection, but the detection of copy number difference using this technique is more relative than required in conventional sequence analysis Which requires a large coverage area, and verification of its accuracy is still required. Thus, as with CNV determined by hybridization-based analysis tools, CNV determined by NGS-based should also be accompanied by more validated validation methods such as real-time quantitative polymerase chain reaction (qPCR). Therefore, NGS-based large-scale CNV genome research can not be a realistic option at this stage.

Recently, genomic qPCR has been widely used for genome-wide detection of CNV. However, the sensitivity of qPCR analysis is not sufficient to accurately discriminate copy number differences, so even if these assays have a wide measurement range, it is difficult to accurately detect small multiples (e.g., 1.5 times). Therefore, qPCR has a limitation in reliably discriminating a single copy number difference between individuals. In addition, qPCR is not a suitable means for multiple assays. When qPCR is used to assess CNV in multiple genomic regions, it is possible to simultaneously measure up to four targets using elaborately designed primers and probes, but since each target is often amplified preferentially, Designing a qPCR multiplex analysis is a difficult task.

Multiplex Ligation-dependent Probe Amplification (MLPA) is known to be a reliable and effective method of identifying variation in copy number. This method involves linking two adjacent annealed, sequence-tagged probes with a thermostable DNA linker and amplifying with a universal primer complementary to the sequence tag. MLPA's multiplexing capability is useful for analyzing various DNA copies including CNV detection. However, the MLPA analyzes the number of copies based on the length of the link product, which limits the application of the technique. In particular, MLPA contains a sequence called stuffer, which has a specific length for each of the linked products but does not participate in the coupling reaction or PCR amplification. Due to the long stuffer sequence, There is a problem that internal folding and nonspecific hybridization may occur. Also, because small amplicons are generally more resistant to PCR inhibitors and amplified more efficiently than larger amplicons, differences in length between probes can affect the efficiency of the probe amplification step.

The disadvantage of this method is that the probe manufacturing process is time consuming. Specifically, a cloning step is required because of the length restriction of oligonucleotide synthesis in order to produce MLPA probes. Stern et al. Proposed a method for solving this problem using a fully synthesized probe set (Stern et al., Biotechniques 37: 399-405, 2004) There is less than half of the existing MLPA. Other researchers have attempted to improve the technique of Stern et al. Using two or three sets of differentially labeled primers (Harteveld et al. J Med Genet 42: 922-931, 2005; White et al. -92, 2004), and is still based on a length-based differentiation principle like the existing MLPA. Recently, Zeng et al. Proposed a technique that does not depend on length using microarray format (Zeng et al. Hum Mutat 29: 190-197, 2008). Instead of using stuffer sequences, the researchers used a bar coding system, where each probe used contained a unique sequence and its complementary sequence was fixed in the microarray. These techniques greatly increase the MLPA's multiple detection capability, but these array-based techniques have a problem of high perimeter signals and high false positives due to nonspecific hybridization.

The present inventors have sought to develop a reliable and easy to use multi-CNV detection method. To do this, we developed a new analysis method that can determine the number of copies of DNA regardless of the length difference of probes by modifying the MLPA technique which analyzes the number of copies depending on the length difference of the probe. The modified MLPA method provided by the present invention is a method of analyzing the copy number according to the difference in the moving phase depending on the steric structure of the probe. Even if the probe does not include the stapler sequence or includes the stuffer sequence, It is a technology capable of analyzing the number of copies and simultaneously detecting CNV in the multiple genome region. The present inventors designed probes targeting various chromosome regions by applying the modified MLPA method of the present invention and compared the MLPA method with the efficiency of X-chromosome copy polymorphism samples. Furthermore, the present inventors performed multi-CNV analysis The inventors of the present invention have confirmed that CNV can be detected simultaneously in multiple genomic regions with sufficient accuracy and have completed the present invention.

It is an object of the present invention to provide a method for multiplexing a copy number polymorphism according to a difference in a moving phase depending on a steric structure of a probe irrespective of a difference in length of the probe.

It is another object of the present invention to provide a kit for use in the multiple detection method of the copy number polymorphism.

In one aspect, the present invention relates to a method for multiplexing a copy number polymorphism according to a difference in a moving phase according to a steric structure of a probe regardless of a difference in length of the probe.

The term "copy-number variation (CNV)" in the present invention refers to a structural variation in which a specific DNA region on a genome is deleted or duplicated and thereby shows a different copy number compared to a reference genome. CNV accounts for about 13% of the human genome and is known to contain more than 2,000 genes. CNV causes a variety of genetic diseases by disrupting the function of a gene or by a dosage effect caused by a quantitative variation of a gene. For example, Duchene / Becker type muscular dystrophy, type 1 neurofibromatosis, tuberous sclerosis, Sotts syndrome, CHARGE syndrome, Peligius-Merzbacher disease, Alzheimer's disease, autism, psoriasis, Crohn's disease, Parkinson's disease, . In addition, CNV of oncogene and tumor suppressor gene in cancer tissue is also known.

The present invention is a modification of the existing MLPA technology for detecting CNV, and it is characterized in that the copy number polymorphism is detected in multiple according to the difference in the moving phase depending on the three-dimensional structure of the probe irrespective of the length difference of the probe.

Conventional MLPA technology developed by MRC-Holland in the Netherlands is a method of hybridizing a pair of probes side by side with a target nucleic acid, connecting these hybridized probes, amplifying the probe-linked product and confirming the presence of CNV of the target nucleic acid to be. In particular, conventional MLPA technology uses multiple pairs of probes to simultaneously detect CNV in multiple genomic regions. Using a SALSA vector derived from an M13 bacteriophage, a stuffer ranging from 130 to 480 bp per probe, And the length of the inserter is different. Stuffer refers to a sequence that has a specific length for each probe-linked product but does not participate in the binding reaction or PCR amplification. The presence of the stuffer makes it possible to construct dozens of probes as one experiment group, It is possible to construct an experimental group that has exon and can confirm the CNV of all exons for most of the genes.

Specifically, the probes used in the conventional MLPA technology include a stuffer that changes the length of the probe-linked product, a hybridization sequence portion that can hybridize with the target nucleic acid, and a universal probe capable of amplifying the probe- Primer recognition sequence. The second probe is composed of a target hybridization sequence and a universal primer recognition sequence adjacent (mainly one base difference) to the hybridization site of the first probe, so that when the two probes are successfully hybridized to the target nucleic acid, And the 5 'end face each other. Treatment of the heat-resistant nucleic acid ligase generates a probe-linked product, and PCR is performed using a fluorescent-labeled universal primer, whereby only the hybridized probe-linked product is amplified. The probe-linked products corresponding to the respective target base sequences form fragments of different sizes with the fluorescent material. Each of the fragments thus formed is analyzed using a genetic analyzer (ABI-Prism of Applied Biosystems; CEQ of Beckmann, Megabase of Amersham, etc.) (By length), and multiplex polymorphism of fluorescence pathway polymorphism of product by size is detected.

Thus, the conventional MLPA essentially includes a stuffer and is characterized in that CNV is detected depending on the length of the stuffer. However, because of the long stuffer sequence, internal folding and non-specific hybridization between probes or between target DNA and probe The amplification efficiency of the probe-linked product is lowered, and it takes a long time to manufacture the probe.

Accordingly, the present invention overcomes the disadvantages of conventional MLPA related to stuffer, and detects copy polymorphism according to the difference in moving phase depending on the three-dimensional structure of the probe irrespective of the length difference of probes.

First, in the present invention, probes of the same or similar total length are used even if they do not include a stuffer or include a stuffer. Accordingly, the amplicon of the probe-linked product used in the conventional MLPA has 148 to 481 nt and has different lengths, whereas the amplicon of the present invention has a length of 90 to 114 nt, more preferably 109 to 112 nt And have similar lengths. Thus, the probe-linked product of the present invention produces amplicons of similar length, and thus can not be separated based on the length of the product.

In the present invention, in order to multiplex the CNVs from probe-linked products having similar lengths, probe amplicons are denatured by heat or the like to have single-stranded structure polymorphism, followed by non-denaturing capillary electrophoresis according to a unique three-dimensional structure Separate each ampicon. (PEO-PPO-PEO) triblock copolymer solution at high resolution during electrophoresis, and the number of copies in the multi-target region is set at the peak By quantification by analysis, multiple CNV detection becomes possible.

Thus, in a preferred embodiment,

(a) contacting a sample nucleic acid and a reference nucleic acid with a set of two or more probes, respectively,

Each of the probe sets

A first probe comprising a target hybridization sequence complementary to the first portion of the target nucleic acid and a universal primer recognition sequence that is connected to the 5 'end of the target hybridization sequence and is non-complementary to the target nucleic acid, and

A second probe comprising a target hybridization sequence complementary to a second site adjacent to the first site of the target nucleic acid and a universal primer recognition sequence connected to the 3 'end of the target hybridization sequence and non-conforming to the target nucleic acid,

Wherein each probe set has a different target hybridization site in the target nucleic acid,

Wherein the first probe or the second probe comprises a stuffer sequence between the target hybridization sequence and the universal primer recognition sequence or a stuffer sequence of the same or similar length regardless of the target hybridization sequence;

(b) incubating the sample nucleic acid and the standard nucleic acid with each of the at least two probe sets to hybridize the target portion of each nucleic acid with the target hybridization sequence in the probe;

(c) linking a first probe hybridized with the target nucleic acid and a second probe to produce a probe-linked product;

(d) PCR amplifying the probe-linked products using a universal primer;

(e) denaturing each probe-linked product to induce single-stranded polymorphism;

(f) non-denaturing capillary electrophoresis for each probe-linked product; And

(g) comparing the peak area in the sample nucleic acid and the standard nucleic acid.

And a method for multiple detection of copy number polymorphism.

The CNV multiplex detection method of the present invention is shown in FIG.

Hereinafter, the CNV multiplex detection method of the present invention will be described in more detail.

Step (a) is a step of bringing the sample nucleic acid and the reference nucleic acid into contact with two or more sets of probes, wherein the two probes constituting each probe set are hybridized with the target hybridization base sequence and the universal primer recognition sequence as in the conventional MLPA probe But may include the same or similar length even if it does not include the stuffer sequence or includes the stuffer sequence.

The "nucleic acid sample" refers to a nucleic acid isolated from a sample to be tested for the presence or absence of CNV, and may be a nucleic acid isolated from whole blood, serum, plasma, saliva, urine, sputum, lymphatic fluid, "Standard nucleic acid" refers to a nucleic acid of a normal genome in which chromosomal duplication, deletion, substitution, and the like are not observed. In order to confirm the exact concentration of the target gene in the sample nucleic acid, comparison with the normal control group is necessary. Therefore, the probe is set separately for the standard nucleic acid as an internal control, and the normal genes are also analyzed.

In order to simultaneously detect CNVs in a multiple genome region, the present invention is characterized in that two or more probe sets, preferably 10 or more probe sets, more preferably 20 to 40 probe sets, which target different regions, Can be used simultaneously in the reactor.

Step (b) is a step of hybridizing a sample nucleic acid and a standard nucleic acid with a probe. Each nucleic acid is separated into a single strand by applying heat (for example, 95 ° C or more) and incubated at a low temperature. The target hybridization sequence complementarily binds to the target site in the sample nucleic acid or the standard nucleic acid. At this time, the first probe and the second probe recognize adjacent target sites, for example, hybridize with one base difference, so that the 3 'end and the 5' end of each probe face each other.

Step (c) is a step of connecting a first probe hybridized with a target nucleic acid and a second probe to produce a probe-linked product, wherein the probe-linked product has a length of 90 to 114 nt, preferably 109 to 112 nt Lt; / RTI >

The connection of the first and second probes can be performed by treating the heat-resistant nucleic acid connecting enzyme and incubating at about 50 to 60 ° C.

Step (d) is a step of PCR amplifying the probe-linked products using a universal primer, and each probe has forward and reverse universal primer recognition sequences, so that all probe-linked products can be amplified at once using a universal primer .

Step (e) is a step of denaturing the probe-linked products to induce single-stranded structural polymorphism by adding strong alkaline chemical reagents such as methylmercury hydroxide, formamide, sodium hydroxide or urea, or by heat denaturation to single strand structural polymorphism However, the scope of the present invention is not limited thereto. Can be denatured by addition of formamide, preferably by heating, and immediately cooled (e. G., Left in an ice bath) to induce single-stranded structural polymorphism. When the single-stranded polymorphism is induced, probe am- plicones having different target hybridization sequences form different inherent stereostructures. Thus, since the difference in the traveling speed during electrophoresis varies depending on the shape of the particles, CNV detection due to the difference becomes possible.

(F) is a step of non-denaturing capillary electrophoresis of the probe-linked products from which the single-stranded polymorphism is induced, wherein the polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) triblock copolymer Lt; RTI ID = 0.0 > high-resolution < / RTI > separation.

Step (g) is a step of comparing the peak area in the sample nucleic acid and the standard nucleic acid. The peak number of the copy number polymorphism can be detected by performing a peak analysis through a genetic analyzer or the like.

In a specific example of the present invention, after extracting genomic DNA from five cell lines known to have various numbers of X-chromosome copies (1-5), the modified MLPA of the present invention was applied to find that all target- . In addition, the copy number determination using the modified MLPA of the present invention was more accurate than the conventional MLPA, and the coefficient of variation of the measured copy numbers was significantly lower. In addition, by applying the present invention, it was confirmed that all the peaks for the CNV target show the expected number of copies as a result of measuring the CNV in the autosomes between the two HapMap individuals. These results support the fact that the present invention overcomes the limitations of the existing MLPA due to the difficulty of manufacturing long probes and probes and is a new technology showing excellent multiple performance.

Therefore, the present invention can be used for multiplex diagnosis and screening of chromosomal anomalies due to duplication and deletion such as trisomy, monosomy, and sex chromosome abnormality. This method also recognizes small changes in the chromosomes of genetic diseases caused by deletion of small chromosomes such as Duchenne / Becker type muscular dystrophy and genetic diseases caused by various causes such as mental retardation, Alzheimer's disease and diabetes. It is useful to pay. It can also be used to analyze the number of copies of cancer genes (oncogene) and tumor suppressor genes in cancer tissues, or the number of chromosomes over the whole.

In another aspect,

A first probe comprising a target hybridization sequence complementary to the first portion of the target nucleic acid and a universal primer recognition sequence that is connected to the 5 'end of the target hybridization sequence and is non-complementary to the target nucleic acid, and

A probe set comprising a target hybridization sequence complementary to a second site adjacent to the first site of the target nucleic acid and a second probe site linked to the 3 'end of the target hybridization sequence and comprising a universal primer recognition sequence that is non- 2 or more,

Wherein each of the two or more probe sets has a target hybridization site in the target nucleic acid,

Wherein the first probe or the second probe comprises a stuffer sequence of the same length regardless of the target hybridization sequence or not including a stuffer sequence between the target hybridization sequence and the universal primer recognition sequence.

To a kit for multiple detection of the copy number polymorphism of a target nucleic acid.

The kit of the present invention comprises a set of probes designed to hybridize with a target region in a sample nucleic acid and a standard nucleic acid, and further comprises a heat-resistant nucleic acid enzyme for probe connection, probe amplification means, single strand structure polymorphism, and means for capillary electrophoresis And may be a kit designed to detect CNV as compared to a standard nucleic acid.

In one embodiment, the multiple detection method of the copy number polymorphism of the present invention and the probe set used in the kit are set of probes for multiplexing the copy number polymorphism on the X chromosome,

A first probe comprising a target hybridization sequence of SEQ ID NO: 1 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 2 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 3 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 4 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 5 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 6 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 7 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 8 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 9 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 10 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 11 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 12 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 13 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 14 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 15 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 16 and a universal primer recognition sequence of SEQ ID NO: Set, and

A first probe comprising a target hybridization sequence of SEQ ID NO: 17 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 18 and a universal primer recognition sequence of SEQ ID NO: Or a set of two or more probes selected from the group consisting of a set of probes.

As yet another embodiment, the multiple detection method of the copy number polymorphism of the present invention and the probe set used in the kit are set of probes for multiplexing the copy number polymorphism on the autosomal body,

A first probe comprising a target hybridization sequence of SEQ ID NO: 21 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 22 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 23 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 24 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 25 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 26 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 27 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 28 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 29 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 30 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 31 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 32 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 33 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 34 and a universal primer recognition sequence of SEQ ID NO: set,

A first probe comprising a target hybridization sequence of SEQ ID NO: 35 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 36 and a universal primer recognition sequence of SEQ ID NO: Set, and

A first probe comprising a target hybridization sequence of SEQ ID NO: 37 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 38 and a universal primer recognition sequence of SEQ ID NO: Or a set of two or more probes selected from the group consisting of a set of probes.

The modified MLPA technique of the present invention is a new technology that overcomes the limitations of the existing MLPA due to the difficulty of manufacturing long probes and probes and shows excellent multi-performance.

1 schematically illustrates the principle of the modified MLPA method of the present invention.
FIG. 2 is a graph showing the results of hybridization of probe and target nucleic acid, connection of first and second probes, and PCR amplification using 9 probe sets without stuffer, and then performing a single analysis of capillary electrophoresis analysis (A ), Single strand structural polymorphism and capillary electrophoresis analysis (B).
FIG. 3 is a graph showing the relationship between the accuracy and reliability of the X-chromosome copy number (1X, 2X, 3X, 4X, 5X) measurement by the MLPA method of the present invention and the modified MLPA technique of the present invention by MLPA electrophoresis Peak analysis results (A, B), and relative copy number measurement results (C, D).
FIG. 4A shows the relationship between the amplicon size and the measured coefficient of variation (CV) in conventional MLPA. FIG. 4B shows the relationship between the amplicon size and the measured copy number And the coefficient of variation of
Figure 5 shows the relationship between the MLPA product length and the coefficient of variation (CV). 1X, 2X, 3X, 4X, and 5X represent the number of copies of the X chromosome, respectively, and the CVs of 47 probes having a length of 130-481 bp were plotted.
6 shows the result of measurement of autosomal CNV using the modified MLPA of the present invention. (A) shows all the peaks for the autosomal CNV target, and (B) shows the comparison of the relative copy number determined by the modified MLPA and genomic qPCR of the present invention.
Figure 7 shows the copy number profile of 9 CNV on the positive control region and the autosomal region.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1. Cell line and genome DNA  extraction

GM10851, GM15510, GM04626, GM01416, and GM06061 cell lines, each having 1 to 5 copies of the X chromosome, were purchased from Coriell Institute for Medical Research (Camden, NJ, USA) and cultured according to the manufacturer's instructions. Each DNA sample was extracted using DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. Quantitative and qualitative analysis of genomic DNA samples was performed using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA).

Example  2. MLPA Probe  And qPCR Primer  Produce

The MLPA probes are designed to include a universal primer recognition site and a target hybridization sequence, but not a stuffer sequence. A total of 20 probe sets were designed in the same manner (Table 1 and Table 2), nine of which were previously designed and tested using the SALSA MLPA Kit P106 MRX (MRC-Holland, Amsterdam, The Netherlands) (Madrigal et al. Genet Med 9: 117-122, 2007). ≪ / RTI > The target hybridization sequence of the other probes was designed according to the synthetic probe design protocol recommended by MRC-Holland ( http://www.mlpa.com ). The probes were designed without considering the length variation of the amplification products and were in the range of 90 to 114 nt.

Amplification Label Cytoband Hybridization sequence of probe 1 (left) Length Hybridization sequence of probe 2 (right) X
Chromosome copy ACSL4 Xq22.3 GACACACCGATTCATGAATGTCTGCTTCT (SEQ ID NO: 1) 109 (148) GCTGCCCAATTGGCCAGGGTTATGGACTGACAGAATCA (SEQ ID NO: 2) SLC6A8 Xq28 TGGAGATCTTCCGCCATGAAGACTGTGCCAA (SEQ ID NO: 3) 110 (208) TGCCAGCCTGGCCAACCTCACCTGTGACCAGCTTGCT (SEQ ID NO: 4) AFF2-1 Xq28 CTTCCTGGCCTACTCCTCTCACTTCCATG (SEQ ID NO: 5) 109 (241) CATACTGCTGGACACTCTGAGCAGAGCACCTTTTCCAT (SEQ ID NO: 6) AFF2-2 Xq28 GACAGGAACACTCCATCCCCAGTGTCTCTCA (SEQ ID NO: 7) 111 (261) ACAACGTCTCCCCCATCAACGCAATGGGGAACTGTAAC (SEQ ID NO: 8) IL1RAPL1 Xp21.3 CCTTTAAGAGCTGGAAGATGAAAGCTC (SEQ ID NO: 9) 112 (328) CGATTCCACACTTGATTCTCTTATACGCTACTTTTACTCAGAG (SEQ ID NO: 10) AFF2-3 Xq28 CCAGCCCCTAGGAAAGAACCAAGACCT (SEQ ID NO: 11) 109 (337) AACATCCCTTTGGCTCCCGAGAAGAAGAAGTACAGAGGGC (SEQ ID NO: 12) AGTR2 Xq23 CGTCCCAGCGTCTGAGAGAACGAG (SEQ ID NO: 13) 109 (355) TAAGCACAGAATTCAAAGCATTCTGCAGCCTGAATTTTGAAGG (SEQ ID NO: 14) PAK3-1 Xq22.3 CGAGGATGAATAGTAACAACCGGGATTCTTCA (SEQ ID NO: 15) 109 (385) GCACTCAACCACAGCTCCAAACCACTTCCCATGGC (SEQ ID NO: 16) PAK3-2 Xq22.3 CGCGGCTGCTGTTCTTAATTGCTTCC (SEQ ID NO: 17) 109 (481) TTTGCAGCGATAATCAGAGGAGTCAGGCTGGAGAGAGGCTT (SEQ ID NO: 18) standard
(standard) RNaseP 14q11.2 CCATTGAACTCACTTCGCTGGCCGTGA (SEQ ID NO: 19) 94 GTCTGTTCCAAGCTCCGGCAAAGGA (SEQ ID NO: 20)

Amplification Label Cytoband Hybridization sequence of probe 1 (left) Length Hybridization sequence of probe 2 (right) Autosomal L-1 2q22.3 CCATCTCTTTGGTAGTAAGTGGCATATAGGCAAATC (SEQ ID NO: 21) 114 CATCTAAGCAAACTCCATCTTCATTAGTGTTGCGGT (SEQ ID NO: 22) L-2 10q21.1 GGACATGATATAAACTCAGAGCAGGACTGC (SEQ ID NO: 23) 101 TTAGCCCCAATCACTAGATTGGTCATCAC (SEQ ID NO: 24) G-1 4p15.1 CTCCACCAGAGTGCATTTGAGCA (SEQ ID NO: 25) 91 GCCTGCTAACCTTTTGGATATCCCAG (SEQ ID NO: 26) G-2 22q11.22 CCAGGAACAGGGGGTATTTGAGCAT (SEQ ID NO: 27) 102 CTCTGAGCTGCAGCCTGAGGACGAGGCTATGTATT (SEQ ID NO: 28) G-3 22q11.22 CCAGATCAGCTCAGGAGTGAGGCCATAACAC (SEQ ID NO: 29) 106 AACCTACAGTGACGATGTCAACCCAGATGATGG (SEQ ID NO: 30) G-4 6q14.1 CTCCCTGTGGAATGTGAACAATCTAGC (SEQ ID NO: 31) 97 ATAGGTTTCTGAAGGGAACCTGGCGCTA (SEQ ID NO: 32) NC-1 13q32.1 CGAGTATGCAAAAGATCTCTTCCAGCAGCGCTAC (SEQ ID NO: 33) 102 CACCACACCAAGCAGCTAGAGCACCA (SEQ ID NO: 34) NC-2 1q42.2 CCAGAGAGCAGAGGAAACAGAAGAGG (SEQ ID NO: 35) 95 CAACCAAGAGACCACTCTGGTTTTCAC (SEQ ID NO: 36) NC-3 11q22.3 CTGAGCTGAAAGCTGAAAACTAAGGAAGAGCCAATC (SEQ ID NO: 37) 108 TTGGGAGAACCAAGCAAAGGATGTGGGTAG (SEQ ID NO: 38) CTRL Xq22.3 CCTGAAGAGCTATCTACCAGTGCCGTTGACAT (SEQ ID NO: 39) 104 CCAAGCCACAGAATTCTTTTCCTCACTTCG (SEQ ID NO: 40)

* In Table 1 and Table 2, the primer recognition sequence (5'-GGG TTC CCT AAG GGT TGG A-3 ', SEQ ID NO: 41) is tagged at the 5' end of the probe 1 with the forward universal primer sequence

* In Table 1 and Table 2, the 3 'end of probe 2 is tagged with a primer recognition sequence (5'-TCT AGA TTG GAT CTT GCT GGC AC-3', SEQ ID NO: 42) which is reverse complementary to the reverse universal primer sequence

* In Table 1 and Table 2, "length" means the total length including the target hybridization sequence and the primer recognition sequence.

* In Table 1 and Table 2, the length in parentheses refers to the total length when including the stuffer sequence.

* In Table 1, RNaseP was used as an intrinsic control for both X chromosome and autosomal copy number measurements

In Table 2, CTRL was used as a positive control for the number of X chromosome copies

Primers for qPCR identification were designed using PrimerQuest ( http://www.idtdna.com/Scitools/Applications/Primerquest ) (Table 3). The specificity of the primers was confirmed using the UCSC database ( http://genome.ucsc.edu/ ), and no repeat sequences were detected in the amplicon. All probes and primers were synthesized in Genotech (Daejeon, Korea).

Label Cytoband Forward Reverse L-1 2q22.3 TGAGTCTCTGGGCCTGGTTCATTT
(SEQ ID NO: 43) TCCTTGCACTCTGCCAGCTTATCT
(SEQ ID NO: 44) L-2 10q21.1 GTTCTTGCCCAGGTCCATATAA
(SEQ ID NO: 45) AAATGGCAAACTGGACAGAAGT
(SEQ ID NO: 46) G-1 4p15.1 GCATTGCTCCACCAGAGTGCATTT
(SEQ ID NO: 47) TGGGCTCCTCTTACTCAATTGCCA
(SEQ ID NO: 48) G-2 22q11.22 AGCCTGAGGACGAGGCTATGTATT
(SEQ ID NO: 49) TGGGTTCCATTTCTTCCTCCCACT
(SEQ ID NO: 50) G-3 22q11.22 AGTGGGAGGAAGAAATGGAACCCA
(SEQ ID NO: 51) TTTACAGCAACACTGCAGGACCAG
(SEQ ID NO: 52) G-4 6q14.1 TTTCTGAAGGGAACCTGGCGCTAT
(SEQ ID NO: 53) AGTGTGGTCATGCAAGGCTCCTAT
(SEQ ID NO: 54) NC-1 13q32.1 CGCTACCACCACACCAAGCAG
(SEQ ID NO: 55) CCACCTGGCTGTTGTAGTCCTC
(SEQ ID NO: 56) NC-2 1q42.2 ACAGAAGAGGCAACCAAGAGACCA
(SEQ ID NO: 57) TGGCTTCAACAGTGGCACAACATC
(SEQ ID NO: 58) NC-3 11q22.3 ACGCTGACAAGGTTCCTCCTTTGT
(SEQ ID NO: 59) TCAGCTTTCAGCTCAGTGTCACCT
(SEQ ID NO: 60) CTRL Xq22.3 TCTACCAGTGCCGTTGACATCCAA
(SEQ ID NO: 61) AACTGGTGAGGCAGGCTAGTTCAT
(SEQ ID NO: 62)

Example  3. MLPA

MLPA was performed according to the instructions provided by MRC-Holland. All buffers and enzymes were purchased from MRC-Holland. Briefly, after 5 μL of genomic DNA (40-60 ng / μL) was initially denatured at 98 ° C for 5 minutes, 1.5 μL of probe set (2 fmol each / μL for synthetic probes) and 1.5 μL of MLPA buffer were added . The mixture is 95? For 1 min and then incubated at 60 ° C for 16 hrs for hybridization. After hybridization, 3 μL of each ligase buffer A and B, 25 μL of nuclease-free water, and 1 μL of Ligase-65 were added at 54 ° C. and incubated at 54 ° C. for 15 minutes Respectively. After thermal inactivation at 98 ° C for 5 min, 10 μL of the ligation reaction mixture was mixed with 30 μL of diluted SALSA PCR buffer, heated to 60 ° C., and then 0.5 μL of SALSA polymerase, 2 μL of SALSA enzyme dilution Buffer, 2 [mu] L of SALSA primer, and 5.5 [mu] L of nuclease free purified water. After all the PCR reagents were added, PCR was performed immediately under the following conditions: 30 cycles at 95 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 60 seconds, followed by final extension at 72 ° C for 20 minutes. All reactions were repeated 3 times, followed by capillary electrophoresis alone, single-stranded polymorphism and capillary electrophoresis.

Example  4. Single strand structure polymorphism and capillary electrophoresis

Capillary electrophoresis was performed using the protocol provided by MRC-Holland ( http://www.mlpa.com ) using an ABI 3130XL Genetic Analyzer (36-cm capillary array and POP7 polymer; Applied Biosystems, Foster City, Respectively. 0.7 μL of the PCR reaction aliquot was mixed with 9 μL of Hi-Di formamide and 0.3 μL of GeneScan 500 ROX Size Standard (Applied Biosystems), incubated at 80 ° C. for 2 minutes, and then chilled in ice. Samples were injected into the capillary and applied for 15 seconds at a voltage of 1.6 kV, followed by electrophoresis at an electrophoresis voltage of 10 kV and a temperature of 60 ° C.

Single stranded structural polymorphism and capillary electrophoresis analysis showed some modifications to our previous report (Shin et al. Electrophoresis 31: 2405-2410, 2010; Shin et al. J Sep Sci 33: 1639-1643, 2010) Lt; / RTI > 0.7 μL of a 50-fold diluted PCR reaction sample was mixed with 9 μL of Hi-Di formamide and 0.3 μL of GeneScan 500 ROX Size Standard (Applied Biosystems). The sample mixture was denatured at 95 ° C for 5 minutes and immediately cooled in ice for 2 minutes. Non-denaturing electrophoresis was performed on an ABI 3130XL Genetic Analyzer using a 50 cm capillary array (Applied Biosystems) and 15 wt% Pluronic F108 (Product No. 542342; Sigma-Aldrich, St. Louis, (Applied Biosystems). A polymer solution containing polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) triblock copolymer was prepared, samples were injected into a capillary and applied for 5 seconds at a voltage of 15 kV, Lt; RTI ID = 0.0 > 35 C < / RTI >

In both methods, the peak area was calculated using GeneMapper software (Applied Biosystems). For standardization, all signals were divided by the control probe signal and the standardized signals obtained from the DNA samples were compared. In the analysis according to the existing MLPA, one of three denaturing control probes was selected for standardization. In the analysis according to the present invention, a probe targeting RNaseP was added for standardization.

Example  5. Real time qPCR  analysis

Genomic qPCR was performed using the Mx3000P qPCR system (Stratagene, La Jolla, Calif., USA). A primer set targeting RNaseP was used as a diploid control (Cat. No. 4316844; Applied Biosystems). The PCR efficiency of all primers was determined experimentally and all primers appeared to be suitable for reliable copy number quantification. The PCR reactions included a 1X Maxima SYBR Green qPCR Master Mix (Fermentas, Eugene, OR, USA), 10 ng of DNA sample, and 10 pmol of primer and a total volume of 10 mu L. qPCR was performed under the following conditions: initial denaturation at 95 캜 for 30 seconds, followed by 40 cycles at 95 캜 for 5 seconds, 60 캜 for 10 seconds, and 72 캜 for 20 seconds. The relative DNA copy number was determined by the ΔΔCT method (Yim et al., Hum Mol Genet 19: 1001-1008). All experiments were performed in triplicate.

Experiment result

1. Principle of the Invention

In order to establish a reliable multi-CNV detection technique while minimizing the disadvantages associated with long stuffer in the probe, MLPA technology which analyzes the number of copies in accordance with the length difference of the probe has been modified, We have developed a new method to determine the number. The principle of the present invention is illustrated in Fig. First, a probe having a total length similar to that of a stuffer-free or stuffer-containing probe was hybridized with the template DNA, and the first probe and the second probe were connected to each other to form a probe-linked product containing a primer recognition site at both ends. Second, the probe-linked product was amplified using a fluorescently tagged universal primer. Unlike conventional MLPA, the probes of the present invention generate amplicons of similar length, and thus can not be separated based on the length of the product. Third, the amplified product was denatured into heat, single strand structure polymorphism formation and non-denaturing capillary electrophoresis analysis were performed. Polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) triblock copolymer solution was used for high resolution separation in place of the conventional separation medium (eg POP-CAP; Applied Biosystems) during electrophoresis. Finally, the number of DNA copies in multiple target regions was quantified by peak analysis.

2. Existing MLPA  Variations of the invention compared to the method MLPA  Validating the system

To ensure that the modified MLPA technology of the present invention reliably discriminates between single copy differences, the present inventors have applied this technique to genomic DNAs from five cell lines to X chromosome copies (1-5 copies). Using nine stuffer-free probes with the same target hybridization sequence as previously included in the SALSA MLPA Kit P106 MRX (MRC-Holland, Amsterdam, The Netherlands) among the 47 probes targeting the X chromosome, And MLPA technology. The nine stuffer-containing probe amplicons used in the conventional MLPA are between 148 and 481 nucleotides (nt), whereas the nine stuffer-free probe amplicons of the present invention are shorter in length than the conventional method (109-112 nt). Detailed information on the stuffer-free probes used in the present invention is summarized in Tables 1 and 2.

In order to confirm that the electrophoretic mobility of each stuffer-free probe amplicon is unique, the present inventors have used stuffer-free probes to hybridize the probes with the target nucleic acid, the first and second probes And PCR amplification were performed, and analytes were separated either by single analysis of capillary electrophoresis analysis or by single stranded structural polymorphism and capillary electrophoresis analysis. Capillary electrophoresis analysis In a single reaction, each of the nine probes generated an amplified product of the expected size. Thus, multiple reaction products were not separated using conventional capillary electrophoresis settings (FIG. 2A). However, all nine targets could be distinguished by high resolution single stranded structural polymorphism and capillary electrophoresis analysis on the same PCR product (Fig. 2B). Characteristic shifts in single stranded structural polymorphism and capillary electrophoresis analysis were reproducible even when randomly distributing fragments of similar lengths with different sequences on an electropherogram.

Next, in order to confirm the accuracy and reliability of the measurement of the number of copies by the modified MLPA technique of the present invention which does not depend on the probe length, the inventors of the present invention compared and analyzed the MLPA method. In MLPA electrophoresis, the expected number of target peaks (47 target peaks, 4 control peaks, and 2 Y chromosome specific peaks on the X chromosome) showed their exact size, and peak heights corresponded to the number of X copies n = 1-5) (Fig. 3A). In the electrophoresis of the modified MLPA technique of the present invention, all 10 target peaks (9 X chromosome targets and reference peaks) were clearly separated and the peak area also increased in a dose dependent manner (Fig. 3B). The relative copy number was calculated from the peak area of the nine probes sharing the same target hybridization sequence. To this end, a GM15510 cell line carrying two copies of the X chromosome was used as a calibrator. Autosomal control peaks and RNase P peaks were used as endogenous controls. After calculating the number of copies, a linear regression analysis was performed to evaluate the accuracy of the number of copies. Both analytical techniques showed consistently good results, but the modified MLPA technique of the present invention without Stuffer showed better results than the conventional MLPA (Figs. 3C and D). The average R squared value for the nine targets was similar to that of the conventional MLPA (0.98) and the modified MLPA (0.99) of the present invention. However, the slope value (0.94 + 0.08) (0.76 ± 0.08), respectively. In addition, the standard error was less in the modified MLPA of the present invention, indicating that the present invention is more effective in distinguishing single copy number differences compared to conventional MLPA.

3. Amplicon  Size-dependency increases the effectiveness of copy number determination.

The present inventors have examined whether the difference in probe length affects the stability of the probe amplification and ultimately the reliability of the measurement of the number of copies by measuring the coefficient of variation (CV) of the measured number of copies was examined 4). Regardless of the number of X chromosome copies, the mean CV of the number of copies measured by the conventional MLPA method was significantly higher than that of the modified MLPA of the present invention (25.7% ± 7.4% vs. 5.5% ± 4.0%, P = 1.79 × 10 ^-18 ). In the conventional MLPA method, the CVs of nine targets increased as the probe length was increased (Fig. 4A). Conversely, in the modified MLPA technique of the present invention, the CVs of all nine targets with similar sizes of short amplicon (109-112 bp) were all low (FIG. 4B). This tendency was further confirmed in all 47 existing MLPA probes on the X chromosome (Fig. 5). For example, the length of the smallest probe (AGTR2) was 130 nt, the average CV for its five cell lines was 17%, while the length of the longest probe (PAK3) was 481 nt, 37%.

4. Multiple Autosomal CNV  Variations of the invention on detection MLPA  Application of technology

In order to confirm that the modified MLPA of the present invention is able to detect CNV on autosomal, we used the Caucasian HapMap sample GM10851 (male, reference) and GM15510 (female, test) using the Agilent 2X244K whole- Were measured. We randomly selected 9 autosomal regions: 6 regions containing CNV (2 copies of CNV, L-1 and -2; 4 copies of added CNV, G-1, -2 , -3 and -4) and three genomic regions without CNV (NC-1, -2 and -3) (Figure 6). The copy number profile of the nine autosomal target is shown in FIG. Probes on the X-chromosome (Xp22.3) were included as positive controls to detect one copy difference known between GM10851 (male) and GM15510 (female), and RNaseP probe was included as an endogenous control. Detailed information on the MLPA probes used in the present invention is summarized in Tables 1 and 2. All peaks for the autosomal CNV target show the expected number of copies changes based on the values obtained in the CNV array analysis (Fig. 6A). For example, homozygous loss of GM15510 (L-1) did not reveal a peak for an individual and heterozygous loss region (L-2) had a lower GM15510 than GM10851 Peak. CNV array analysis showed similar signal intensities in the genomic region without CNV. As a result of adjusting the magnification of the peak signal for the intrinsic control signal, all targets were accurately detected by the modified MLPA analysis of the present invention (Fig. 6B). We performed singleplex qPCR analysis on the same target and compared the results with the results of the modified MLPA assay of the present invention. As a result, all of the modified MLPAs of the present invention showed consistent results, which supports that the modified MLPA technique of the present invention has reliability and suitability for determining the number of copies.

<110> CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Method for multiplex determination of copy number variation using          modified MLPA <130> DPP20121478KR <160> 62 <170> Kopatentin 1.71 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-1 <400> 1 gacacaccga ttcatgaatg tctgcttct 29 <210> 2 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-2 <400> 2 gctgcccaat tggccagggt tatggactga cagaatca 38 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-1 <400> 3 tggagatctt ccgccatgaa gactgtgcca a 31 <210> 4 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-2 <400> 4 tgccagcctg gccaacctca cctgtgacca gcttgct 37 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-1 <400> 5 cttcctggcc tactcctctc acttccatg 29 <210> 6 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-2 <400> 6 catactgctg gacactctga gcagagcacc ttttccat 38 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-1 <400> 7 gacaggaaca ctccatcccc agtgtctctc a 31 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-2 <400> 8 acaacgtctc ccccatcaac gcaatgggga actgtaac 38 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Xp21.3 probe-1 <400> 9 cctttaagag ctggaagatg aaagctc 27 <210> 10 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Xp21.3 probe-2 <400> 10 cgattccaca cttgattctc ttatacgcta cttttactca gag 43 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-1 <400> 11 ccagccccta ggaaagaacc aagacct 27 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Xq28 probe-2 <400> 12 aacatccctt tggctcccga gaagaagaag tacagagggc 40 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Xq23 probe-1 <400> 13 cgtcccagcg tctgagagaa cgag 24 <210> 14 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Xq23 probe-2 <400> 14 taagcacaga attcaaagca ttctgcagcc tgaattttga agg 43 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-1 <400> 15 cgaggatgaa tagtaacaac cgggattctt ca 32 <210> 16 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-2 <400> 16 gcactcaacc acagctccaa accacttccc atggc 35 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-1 <400> 17 cgcggctgct gttcttaatt gcttcc 26 <210> 18 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-2 <400> 18 tttgcagcga taatcagagg agtcaggctg gagagaggct t 41 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 14q11.2 probe-1 <400> 19 ccattgaact cacttcgctg gccgtga 27 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 14q11.2 probe-2 <400> 20 gtctgttcca agctccggca aagga 25 <210> 21 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 2q22.3 probe-1 <400> 21 ccatctcttt ggtagtaagt ggcatatagg caaatc 36 <210> 22 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 2q22.3 probe-2 <400> 22 catctaagca aactccatct tcattagtgt tgcggt 36 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 10q21.1 probe-1 <400> 23 ggacatgata taaactcaga gcaggactgc 30 <210> 24 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> 10q21.1 probe-2 <400> 24 ttagccccaa tcactagatt ggtcatcac 29 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 4p15.1 probe-1 <400> 25 ctccaccaga gtgcatttga gca 23 <210> 26 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 4p15.1 probe-2 <400> 26 gcctgctaac cttttggata tcccag 26 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 22q11.22 probe-1 <400> 27 ccaggaacag ggggtatttg agcat 25 <210> 28 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> 22q11.22 probe-2 <400> 28 ctctgagctg cagcctgagg acgaggctat gtatt 35 <210> 29 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 22q11.22 probe-1 <400> 29 ccagatcagc tcaggagtga ggccataaca c 31 <210> 30 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> 22q11.22 probe-2 <400> 30 aacctacagt gacgatgtca acccagatga tgg 33 <210> 31 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 6q14.1 probe-1 <400> 31 ctccctgtgg aatgtgaaca atctagc 27 <210> 32 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> 6q14.1 probe-2 <400> 32 ataggtttct gaagggaacc tggcgcta 28 <210> 33 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> 13q32.1 probe-1 <400> 33 cgagtatgca aaagatctct tccagcagcg ctac 34 <210> 34 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 13q32.1 probe-2 <400> 34 caccacacca agcagctaga gcacca 26 <210> 35 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 1q42.2 probe-1 <400> 35 ccagagagca gaggaaacag aagagg 26 <210> 36 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 1q42.2 probe-2 <400> 36 caaccaagag accactctgg ttttcac 27 <210> 37 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 11q22.3 probe-1 <400> 37 ctgagctgaa agctgaaaac taaggaagag ccaatc 36 <210> 38 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 11q22.3 probe-2 <400> 38 ttgggagaac caagcaaagg atgtgggtag 30 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-1 <400> 39 cctgaagagc tatctaccag tgccgttgac at 32 <210> 40 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-2 <400> 40 ccaagccaca gaattctttt cctcacttcg 30 <210> 41 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> universal primer recognition sequence <400> 41 gggttcccta agggttgga 19 <210> 42 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> universal primer recognition sequence <400> 42 tctagattgg atcttgctgg cac 23 <210> 43 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 2q22.3 probe-1 <400> 43 tgagtctctg ggcctggttc attt 24 <210> 44 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 2q22.3 probe-2 <400> 44 tccttgcact ctgccagctt atct 24 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 10q21.1 probe-1 <400> 45 gttcttgccc aggtccatat aa 22 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 10q21.1 probe-2 <400> 46 aaatggcaaa ctggacagaa gt 22 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 4p15.1 probe-1 <400> 47 gcattgctcc accagagtgc attt 24 <210> 48 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 4p15.1 probe-2 <400> 48 tgggctcctc ttactcaatt gcca 24 <210> 49 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 22q11.22 probe-1 <400> 49 agcctgagga cgaggctatg tatt 24 <210> 50 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 22q11.22 probe-2 <400> 50 tgggttccat ttcttcctcc cact 24 <210> 51 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 22q11.22 probe-1 <400> 51 agtgggagga agaaatggaa ccca 24 <210> 52 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 22q11.22 probe-2 <400> 52 tttacagcaa cactgcagga ccag 24 <210> 53 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 6q14.1 probe-1 <400> 53 tttctgaagg gaacctggcg ctat 24 <210> 54 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 6q14.1 probe-2 <400> 54 agtgtggtca tgcaaggctc ctat 24 <210> 55 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 13q32.1 probe-1 <400> 55 cgctaccacc acaccaagca g 21 <210> 56 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 13q32.1 probe-2 <400> 56 ccacctggct gttgtagtcc tc 22 <210> 57 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 1q42.2 probe-1 <400> 57 acagaagagg caaccaagag acca 24 <210> 58 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 1q42.2 probe-2 <400> 58 tggcttcaac agtggcacaa catc 24 <210> 59 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 11q22.3 probe-1 <400> 59 acgctgacaa ggttcctcct ttgt 24 <210> 60 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 11q22.3 probe-2 <400> 60 tcagctttca gctcagtgtc acct 24 <210> 61 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-1 <400> 61 tctaccagtg ccgttgacat ccaa 24 <210> 62 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Xq22.3 probe-2 <400> 62 aactggtgag gcaggctagt tcat 24

Claims (13)

(a) contacting a sample nucleic acid and a reference nucleic acid with a probe set, respectively,
Each of the probe sets
A first probe comprising a target hybridization sequence of SEQ ID NO: 21 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 22 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 23 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 24 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 25 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 26 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 27 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 28 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 29 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 30 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 31 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 32 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 33 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 34 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 35 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 36 and a universal primer recognition sequence of SEQ ID NO: Set, and
A first probe comprising a target hybridization sequence of SEQ ID NO: 37 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 38 and a universal primer recognition sequence of SEQ ID NO: &Lt; / RTI &gt;
(b) incubating the sample nucleic acid and the standard nucleic acid with the probe set, respectively, to hybridize the target portion of each nucleic acid with a target hybridization sequence in the probe;
(c) linking a first probe hybridized with the target nucleic acid and a second probe to produce a probe-linked product;
(d) PCR amplifying the probe-linked products using a universal primer;
(e) denaturing the PCR product amplified in step (d) to induce a single strand structural polymorphism;
(f) non-denaturing capillary electrophoresis for each PCR product from which the single-strand conformation polymorphism is derived; And
(g) comparing the result of the non-denaturing capillary electrophoresis to a peak, and then comparing the peak area in the sample nucleic acid and the standard nucleic acid.
Multiple detection method of copy number variation on autosomes.
2. The method of claim 1, wherein the method is to analyze the number of copies according to the difference in moving phase according to the single stranded conformation of each PCR product, which is the result of non-denaturing capillary electrophoresis of step (f).
2. The method of claim 1, wherein the probe-linked product of step (c) ranges in length from 90 to 114 nt.
4. The method of claim 3, wherein the probe-linked product of step (c) ranges in length from 109 to 112 nt.
delete 2. The method of claim 1, wherein step (c) comprises treating the heat-resistant nucleic acid ligating enzyme to produce a probe-linked product.
2. The method of claim 1, wherein step (e) modifies each PCR product by the addition and heating of formamide to induce a single stranded structural polymorphism.
The method of claim 1, wherein the capillary electrophoresis in step (f) uses a filling gel comprising polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) triblock copolymer.
delete delete A first probe comprising a target hybridization sequence of SEQ ID NO: 21 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 22 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 23 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 24 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 25 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 26 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 27 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 28 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 29 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 30 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 31 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 32 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 33 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 34 and a universal primer recognition sequence of SEQ ID NO: set,
A first probe comprising a target hybridization sequence of SEQ ID NO: 35 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 36 and a universal primer recognition sequence of SEQ ID NO: Set, and
A first probe comprising a target hybridization sequence of SEQ ID NO: 37 and a universal primer recognition sequence of SEQ ID NO: 41, and a second probe comprising a target hybridization sequence of SEQ ID NO: 38 and a universal primer recognition sequence of SEQ ID NO: Set;
Kits for multiple detection of copy number polymorphism of target nucleic acid on autosomal. delete delete

Images