KR20130082406A - Composition for preventing and treating inflammatory diseases containing gouania leptostachya extract - Google Patents

Abstract

PURPOSE: A composition containing a Gouania leptostachya extract as an active ingredient is provided to be used in medical industries related to treatment of inflammatory diseases and cosmetic industries related to regulation of skin inflammation. CONSTITUTION: An anti-inflammatory composition contains a Gouania leptostachya extract as an active ingredient. The extract is prepared from Eupatorium japonicum Thunb. ex Murray flowers using one or more solvents selected from the group consisting of water, C1-C5 alcohols, and a mixture thereof. A pharmaceutical composition for preventing and treating inflammatory diseases contains the extract as an active ingredient. The inflammatory diseases are selected from the group consisting of dermatitis, allergy, gastric ulcer, duodenal ulcer, hepatitis, esophagitis, gastritis, enteritis, pancreatitis, colitis, nephritis, stomach cancer, anasarca, local edema, and combination thereof.

Description

COMPOSITION FOR PREVENTING AND TREATING INFLAMMATORY DISEASES CONTAINING GOUANIA LEPTOSTACHYA EXTRACT}

The present invention relates to a composition for preventing and treating inflammatory diseases comprising a plant extract as an active ingredient.

Inflammatory reactions are caused by various factors, such as exposure to harmful substances or organisms from outside, including external infectious agents such as bacteria, fungi, viruses, or various types of allergens, or exposure to harmful substances or organisms from outside. When this damage is done or destroyed, it means a locally occurring immune response to minimize the damage and restore the damaged area.

In addition, various factors that cause inflammation include physical factors such as trauma, burns, frostbite, radioactivity, chemical factors such as acids, and immunological factors due to antibody reactions. It can also be caused by imbalance.

The inflammatory response is a protective mechanism useful for protecting the living body and removing products generated by tissue damage. The inflammatory response is associated with various inflammatory mediators and immune cells present in local blood vessels and body fluids, such as enzyme activation, inflammatory mediator secretion, fluid infiltration, Cell migration, tissue destruction, erythema, edema, fever or pain. In addition, dysfunction may be caused by the above symptoms.

In the normal case, the inflammation removes external sources of radiation through inflammatory reactions in vivo, or neutralizes or eliminates pathogenic factors, and regenerates upper tissues to restore normal structure and function. However, if the antigen is not removed continuously or a specific internal substance causes the degree of inflammation to be above a certain level or becomes chronic, it becomes a problem when progressing to a disease state such as irritability or chronic inflammation. In addition to observing the inflammatory response in almost all diseases, it is known that enzymes related to the inflammatory response play an important role in carcinogenesis. It is also an obstacle in the treatment process such as blood transfusion, drug administration or organ transplantation.

In vivo, the inflammatory response involves various biochemical phenomena, and in particular, the reaction is initiated or regulated by various enzymes related to the inflammatory response produced by immune cells.

Specifically, the immune cells move through the blood vessels to the damaged site with the help of histamine, nitric oxide (NO) or prostaglandin E2 (progetaglandin E2, PGE ₂ ) to initiate an inflammatory response. . The immune cells that migrated to the damaged area were cytokines such as tumor necrosis factor-α, interleukin-1β, or interleukin-6, MIP-1, IL Chemokines such as -8 or MCP-1 secrete chemoine to destroy direct external invaders or to gather other immune cells to initiate an inflammatory response.

Inflammatory substances such as interferon-γ, lipoteichoic acid, and lipopolysaccharide (LPS) that cause the inflammatory response or when exposed to various inflammatory-induced cytokines, iNOS (inducible Nitric Oxide synthase) and COX-2 (cyclooxygenase-2) expression As a result, excess NO and PGE ₂ are generated. Many of these inflammatory initiators (iNOS, COX-2, TNF-α, IL-6, etc.) are promoted by activated NF-κB. When NO is produced more than necessary, vasodilation by shock, It causes tissue damage, mutagenesis, and nerve tissue damage caused by inflammatory reactions.

On the other hand, the cosmetics used in everyday life is a product used to protect the skin and beautify cleanliness, but when looking at the cosmetic composition, components different from the purpose of skin protection are used as essential to the formation of the product. For example, surfactants, preservatives, fragrances, sunscreens, pigments, and other ingredients used to impart other benefits or effects. Ingredients essential for the preparation of the cosmetics are generally known to cause various side effects such as inflammation, rash or edema on the skin.

In addition, when fatty acids, higher alcohols, proteins, etc. in sebum, sweat, and cosmetic components discharged from the body are decomposed into highly toxic substances by skin floras present on the skin, skin inflammation may be caused by them. It is well known that skin irritation is caused by ultraviolet rays from the sun.

As such, the cause of skin side effects in cosmetics is always latent, and various studies have been conducted to solve them. To date, non-steroidal substances such as flufenamic acid, ibuprofen, benzydamine, and indomethacin are used as nonsteroidal substances to stimulate irritation and inflammation, such as erythema and edema. The steroids include prednisolone and dexamethasone, and allantoin, azulene, ε-aminokiproic acid, hydrocortisone, licoriceic acid, and derivatives thereof (α-glycilechinic acid and glycylacenic acid derivatives) It is known to be effective in anti-inflammatory.

However, the indomethacin generally used as an anti-inflammatory agent is a substance that can not be used in cosmetics. The amount of hydrocotisin is limited. The licorice acid and its derivatives are difficult to stabilize or have poor solubility, It is difficult to achieve a substantial effect. Thus, known anti-inflammatory agents have problems in terms of skin safety and stability in mixing cosmetics, and their use is limited.

In addition, the mechanism of treatment related to gastritis is mainly based on H2-blockers, which block the second histamine receptor (H2 receptor) to reduce the secretion of gastric acid in gastric wall cells. Reduced gastric acid prevents further damage to already damaged gastric parietal cells (such as stomach ulcers). These H2 inhibitors interfere with the metabolism of other drugs in the liver (potent inhibitors of P-450), so they must be used with other drugs and have anti-Androgen effects, resulting in male gynecomastia. ), Side effects such as impotence and decreased libido may occur. In addition, because it passes through the placenta and cerebrovascular barrier, side effects may be more dangerous for pregnant women and the elderly, and may cause headaches, confusion, confusion, and dizziness.

Therefore, it is possible to effectively suppress the expression of NF-κB, iNOS and TNF-α with little or no risk of such side effects or cytotoxicity, and thus have excellent anti-inflammatory and preventive effects, and can suppress inflammation without side effects. Development is required.

KR 0530843 B KR 0614465 B KR 0941133 B KR 0954984 B

In order to meet the needs as described above, an object of the present invention is to provide a pharmaceutical composition for preventing and treating inflammatory diseases comprising a natural plant extract as an active ingredient.

It is also an object of the present invention to provide a cosmetic composition comprising a component capable of inhibiting the expression of NF-κB, iNOS and TNF-α associated with inflammation as an active ingredient.

In order to achieve the above object, the present invention provides an anti-inflammatory composition comprising guanine leptostakia extract as an active ingredient.

The guania leptostakia extract can inhibit the expression of each level of protein expression associated with inflammation, can inhibit the expression of iNOS, can control the transcription factors of inflammation-related proteins, as well as from natural products As a result, the side effects were less likely to be problematic, and MTT analysis showed no cytotoxicity.

Therefore, the anti-inflammatory composition of the present invention can be provided as an active ingredient of the anti-inflammatory agent or an active ingredient of the cosmetic composition for the purpose of inhibiting inflammation.

The inventors of the present invention can inhibit the secretion of NO, which can directly induce inflammation, and suppress the expression of iNOS and COX-2 associated with the production of prostaglandins that induce the secretion and inflammation of NO. In addition, it is possible to control the mRNA transcription of the iNOS and COX-2, as well as to inhibit the mRNA transcription of cytokines associated with inflammation. It was confirmed that the present invention was completed.

Hereinafter, the present invention will be described in more detail.

The present invention relates to an anti-inflammatory composition comprising guanine leptostakia extract as an active ingredient.

The guania leptostachya ( Gouania leptostachya ) is a shrub distributed in the Himalayas and the northwest Indian region, specifically Himalayas, India, Indochina, Malaysia, Burma, and is distributed in an altitude of 200 to 2000 m above sea level.

The guania leptostakia extract may be prepared according to a conventional method for producing a plant extract, for example flowers, leaves, branches, roots, berries or shells of spines, or crushed products thereof, preferably spines The extract may be prepared by adding an extraction solvent to the flower or may be prepared by adding a fractional solvent to the crude extract prepared by extracting with the extraction solvent.

The extraction solvent may be at least one selected from the group consisting of water and an organic solvent. The organic solvent may be a polar solvent such as an alcohol having 1 to 5 carbon atoms, the alcohol dilution ethyl acetate or acetone and a nonpolar solvent of ether, chloroform, benzene, hexane or dichloromethane, or a mixed solvent thereof. The alcohol having 1 to 5 carbon atoms may be methanol, ethanol, propanol, butanol, or isopropanol, but is not limited thereto. In addition, the alcohol dilution water may be one obtained by diluting the alcohol to 50 to 99.9% (v / v).

Extraction solvent of the guanine lepto takiya extract of the present invention is preferably at least one selected from the group consisting of water, alcohol having 1 to 5 carbon atoms, alcohol dilution water and mixtures thereof, more preferably water, carbon number It may be any one selected from the group consisting of alcohols of 1 to 4 and mixtures thereof, and more preferably methanol or aqueous methanol solution. For example, the extraction process may be performed at 4 ° C. to 120 ° C., or 50 ° C. to 4 ° C. to 90 ° C., or 60 ° C. to 80 ° C., but is not limited thereto. The extraction time is not particularly limited, but may be 10 minutes to 12 hours.

Guanian lepto takiya extract of the present invention may be prepared according to the conventional method for producing a plant extract, specifically may be cold extraction, hot extraction, heat extraction, ultrasonic extraction, etc., conventional extraction equipment, ultrasonic grinding Extractors or fractionators can be used.

In addition, the extract extracted with the solvent is then any one solvent selected from the group consisting of hexane, methylene chloride, acetone, ethyl acetate, ethyl ether, chloroform, water and mixtures thereof, preferably hexane and methylene chloride group The fractionation process may be further carried out with one or more solvents selected from. Two or more solvents may be used in the fractionation, and each solvent extract may be prepared using sequentially or mixed according to the polarity of the solvent. In addition, the fractionation process may be performed at 4 ° C. to 120 ° C., or 50 ° C. to 90 ° C., or 60 ° C. to 80 ° C., but is not limited thereto.

The thus-prepared extract or the fraction obtained by performing the fractionation process may be filtered, concentrated or dried to remove the solvent, and may be subjected to both filtration, concentration and drying. Specifically, the filtration can be performed using a filter paper or a vacuum filter, and the concentration can be reduced by using a vacuum concentrator, for example, a rotary evaporator. The drying can be performed by, for example, freeze drying.

Thus, the anti-inflammatory composition may be used to suppress inflammation or to treat or prevent inflammation. The inflammation may include one or more selected from the group consisting of various dermatitis, allergy, systemic lupus erythematosis, retinitis, gastritis, hepatitis, enteritis, pancreatitis and nephritis, The allergies may be selected from the group consisting of anaphylaxis, allergic rhinitis, asthma, allergic conjunctivitis, allergic dermatitis, atopic dermatitis, contact dermatitis, urticaria, Allergies and drug allergies.

Accordingly, the anti-inflammatory composition of the present invention can be applied as a composition for treating or preventing inflammatory diseases or as a food composition for preventing or ameliorating the inflammatory diseases. The food composition may be, for example, a health functional food composition for preventing or ameliorating the inflammatory disease.

The above-mentioned health functional foods are used to control the bio-defense rhythm of the food group or the food composition imparted with added value to function and express the function of the relevant food by physical, biochemical and biotechnological techniques, Means a food which is processed and designed so that the body controlling function of the body is sufficiently expressed to the living body. The health functional food may include a food-acceptable food-aid additive, and may further comprise suitable carriers, excipients and diluents conventionally used in the production of health functional foods.

Health functional food composition for the prevention or improvement of inflammatory diseases of the present invention may contain 0.001 to 15% by weight of the total food weight of the guanine lepto takiya extract.

Anti-inflammatory composition comprising the guanine lepto takiya extract as an active ingredient can be applied directly to animals, including humans. The animal is a group of organisms corresponding to plants. It mainly consumes organic matter as nutrients, and differentiates digestive organs, excretory or respiratory organs. Preferably, it is a mammal, more preferably a human.

The guania leptostakia extract may be used alone in the anti-inflammatory composition, and may further include other pharmacologically acceptable carriers, excipients, diluents or subcomponents. More specifically, when the composition comprising the guanian leptostatiya extract is used as a medicament, or for medicinal or pharmaceutical use, the guania leptostakia extract is pharmaceutically acceptable according to conventional methods It can be used mixed with a carrier or excipient or diluted with a diluent.

In this case, the content of guania leptostakia extract in the composition may be 0.001% by weight to 99.9% by weight, 0.1% by weight to 99% by weight or 1% by weight to 50% by weight, but is not limited thereto. Depending on the sun and the method of use, the content of the extract may be used by appropriately adjusting the desired content.

Examples of the pharmaceutically acceptable carrier, excipient or diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, propylhydroxybenzoate, talc, magnesium stearate and mineral oil , Dextrin, calcium carbonate, propylene glycol, liquid paraffin, and physiological saline. However, the present invention is not limited thereto, and any conventional carrier, excipient or diluent may be used. In addition, the pharmaceutical composition may further comprise at least one selected from the group consisting of conventional fillers, extenders, binders, disintegrants, anticoagulants, lubricants, humectants, pH adjusters, nutrients, vitamins, electrolytes, alginic acid and its salts, pectic acid and its salts, , Fragrances, emulsifiers, preservatives, and the like. The ingredients may be added independently or in combination to the guanine lepto takiya extract is the active ingredient.

In addition, the composition of the present invention may further include a substance used as an anti-inflammatory agent, an NO inhibitor, or a COX-2 inhibitor, etc., in addition to the active ingredient, which is known to have a known anti-inflammatory effect.

When the composition is used as a medicine, it can be administered orally or parenterally. In one example, it can be administered through various routes including oral, transdermal, subcutaneous, intravenous or muscular.

In addition, the formulations of the compositions may vary depending on the method of use and may be formulated using methods well known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to the mammal . In general, solid dosage forms for oral administration include tablets, pills, soft or hard capsules, pills, powders and granules, which may contain one or more Excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral use include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, Sweeteners, fragrances, preservatives, and the like.

Forms for parenteral administration include creams, looses, ONITMENTS, PLASTERS, LIQUIDS AND SOULTIONS, AEROSOLS, FRUIDEXTRACTS, (ELIXIR), INFUSIONS, SACHET, PATCH or INJECTIONS.

Furthermore, the compositions of the present invention may be formulated using any suitable method known in the art or using methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA .

The dosage of the composition may be determined in consideration of the administration method, the age, sex, the severity of the patient, the condition of the patient, the degree of absorption of the active ingredient in the body, the inactivity and the drug to be used in combination. Kg body weight to 500 mg / kg body weight, 0.1 mg / kg body weight to 400 mg / kg body weight or 1 mg / kg body weight to 300 mg / kg body weight, And may be administered once or several times in divided doses. The dose is not intended to limit the scope of the invention in any way.

The present invention also provides an anti-inflammatory agent comprising an anti-inflammatory composition comprising the guanine leptostakia extract as an active ingredient.

The guanine leptostakia extract may preferably be an extract of guanine leptostakia methanol or an aqueous solution of guanine leptostakia methanol.

The anti-inflammatory agent may include the active ingredient alone, and may further include a pharmaceutically acceptable carrier or excipient depending on the formulation, the method of use, and the intended use. When provided in a mixture, the active ingredient may be included in an amount of 0.1 to 99.9% by weight based on the total anti-inflammatory agent, but is generally included in an amount of 0.001 to 50% by weight.

The anti-inflammatory agent is used for the prevention and treatment of various acute inflammatory diseases such as rheumatoid arthritis, lupus, multiple sclerosis such as various chronic inflammatory diseases, septicemia, shock, rejection of organ transplantation, ophthalmic diseases, bronchitis or inflammatory bowel disease It is possible.

Examples of the carrier or the excipient include water, dextrin, calcium carbonate, lactose, propylene glycol, liquid paraffin, physiological saline, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gelatin, calcium phosphate, But are not limited to, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. Carrier or excipient may be used two or more kinds.

In addition, when the anti-inflammatory agent is weakly formulated, it may further contain conventional fillers, extenders, binders, disintegrants, surfactants, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers or preservatives.

In addition, the anti-inflammatory agent of the present invention may further include a compound or plant extract having a known anti-inflammatory activity in addition to the guanine leptostakia extract, it may be included in 5 to 20 parts by weight with respect to 100 parts by weight of guanian leptostakia extract, respectively. have.

The formulations of anti-inflammatory agents may be in their preferred forms depending on the method of use, and may be formulated employing methods known in the art to provide rapid, sustained or delayed release of the active ingredient, especially after administration to the mammal. Exemplary formulations include, but are not limited to, excipients, granules, lotions, liniments, rimonadense, powders, syrups, ointments, liquids, aerosols, EXTRACTS, elixirs, ointments, Suspensions, premixes, infusions, eye drops, tablets, suppositories, injections, main tablets, capsules, creams, pills, soft or hard gelatin capsules.

The anti-inflammatory agent according to the present invention may be used orally or parenterally and may be used, for example, through the intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intramuscular, epidural and oral routes, , The age, sex, and weight of the recipient, and the severity of the disease. In one embodiment, the anti-inflammatory agent of the present invention can be administered one or more times 0.1 to 100 mg / kg (body weight) per day based on the active ingredient. However, the above-mentioned dosage is only for illustrative purposes and is not limited to the above range.

The present invention may be directed to a pharmaceutical composition for preventing and treating inflammatory diseases comprising guanine leptostakia extract as an active ingredient.

The pharmaceutical composition comprising the guanine leptostakia extract as an active ingredient may be used to suppress, treat or prevent inflammatory diseases.

The inflammatory diseases include, for example, various dermatitis, allergies, systemic lupus erythematosus, retinitis, gastric ulcer, duodenal ulcer, hepatitis, esophagitis, gastritis, enteritis, pancreatitis, colitis, arthritis, nephritis, gastric cancer, systemic edema, local edema and combinations thereof It may be any one selected from the group consisting of, the systemic edema may be any one selected from the group consisting of congestive heart failure, interlocking pericarditis, restrictive cardiomyopathy, cirrhosis, renal failure, nephrotic syndrome and combinations thereof , The local edema refers to a swollen part of the skin and soft tissues, specifically, cellulitis and inflammation of the skin and soft tissues, reflux disorders of the veins and leaf ducts, burns in which parts of the skin and soft tissues are lost, Insect bites, bacterial infections, and the like, the allergies (anaphylaxis), allergic rhinitis (allergic rhinitis), asthma (ast hma), allergic conjunctivitis, allergic dermatitis, atopic dermatitis, contact dermatitis, urticaria, insect allergy, food allergy and drug allergy. Preferably, it may be any one selected from the group consisting of dermatitis, allergy, gastric ulcer, duodenal ulcer, hepatitis, esophagitis, gastritis, enteritis, pancreatitis, colitis, nephritis, gastric cancer, systemic edema, local edema, and combinations thereof, and more preferably. For example, it may be any one selected from the group consisting of gastric ulcer, duodenal ulcer, gastritis, enteritis, pancreatitis, local edema and a combination thereof.

The pharmaceutical composition for preventing and treating inflammatory diseases comprising the guanine leptostakia extract as an active ingredient can be directly applied to animals including humans. The animal is a group of organisms corresponding to plants. It mainly consumes organic matter as nutrients, and differentiates digestive organs, excretory or respiratory organs. Preferably, it is a mammal, more preferably a human.

The guania leptostakia extract may be used alone in the inflammatory disease prevention or pharmaceutical composition, and may further include other pharmacologically acceptable carriers, excipients, diluents or accessory ingredients. More specifically, when the composition comprising the guanian leptostatiya extract is used as a medicament, or for medicinal or pharmaceutical use, the guania leptostakia extract is pharmaceutically acceptable according to conventional methods It can be used mixed with a carrier or excipient or diluted with a diluent.

In this case, the content of guania leptostakia extract in the composition may be 0.001% by weight to 99.9% by weight, 0.1% by weight to 99% by weight or 1% by weight to 50% by weight, but is not limited thereto. Depending on the sun and the method of use, the content of the extract may be used by appropriately adjusting the desired content.

Examples of the pharmaceutically acceptable carrier, excipient or diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, propylhydroxybenzoate, talc, magnesium stearate and mineral oil , Dextrin, calcium carbonate, propylene glycol, liquid paraffin, and physiological saline. However, the present invention is not limited thereto, and any conventional carrier, excipient or diluent may be used. In addition, the pharmaceutical composition may further comprise at least one selected from the group consisting of conventional fillers, extenders, binders, disintegrants, anticoagulants, lubricants, humectants, pH adjusters, nutrients, vitamins, electrolytes, alginic acid and its salts, pectic acid and its salts, , Fragrances, emulsifiers, preservatives, and the like. The ingredients may be added independently or in combination to the guanine lepto takiya extract is the active ingredient.

In addition, the composition of the present invention may further include a substance used as an anti-inflammatory agent, an NO inhibitor, or a COX-2 inhibitor, etc., in addition to the above-mentioned effective ingredient, which is recognized as being effective for a known inflammatory disease.

When the composition is used as a medicament, the administration method may be oral or parenteral, and may be administered through various routes including oral, transdermal, subcutaneous, intravenous, oral, epidural, and muscle.

In addition, the formulations of the compositions may vary depending on the method of use and may be formulated using methods well known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to the mammal . In general, solid dosage forms for oral administration include tablets, pills, soft or hard capsules, pills, powders and granules, which may contain one or more Excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral use include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, Sweeteners, fragrances, preservatives, and the like.

Forms for parenteral administration include creams, looses, ONITMENTS, PLASTERS, LIQUIDS AND SOULTIONS, AEROSOLS, FRUIDEXTRACTS, (ELIXIR), INFUSIONS, SACHET, PATCH or INJECTIONS.

Furthermore, the compositions of the present invention may be formulated using any suitable method known in the art or using methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA .

The dosage of the composition may be determined in consideration of the administration method, the age, sex, the severity of the patient, the condition of the patient, the degree of absorption of the active ingredient in the body, the inactivity and the drug to be used in combination. Kg body weight to 500 mg / kg body weight, 0.1 mg / kg body weight to 400 mg / kg body weight or 1 mg / kg body weight to 300 mg / kg body weight, And may be administered once or several times in divided doses. The dose is not intended to limit the scope of the invention in any way.

The present invention also provides a cosmetic composition for preventing and improving inflammatory diseases comprising the guanine leptostakia extract as an active ingredient.

The guania leptostakia extract is a plant-derived extract, which is less likely to cause side effects, and even when used within a range without cytotoxicity, because of its excellent anti-inflammatory effect, it is excellent in preventing and improving inflammation. Since the inflammation induced by the components and the inflammation induced by the external environment can be effectively controlled, the guania leptostakia extract can be used as an active ingredient of a cosmetic composition having an effect of preventing and improving inflammatory diseases.

The cosmetic composition may be used as a cosmetic composition for basic cosmetics, makeup cosmetics, body cosmetics, hair cosmetics, scalp cosmetics, shaving cosmetics or oral cosmetics.

Examples of the cosmetic cosmetic include a cream, a lotion, a pack, a massage cream, and a milky lotion. Examples of the cosmetic cosmetic include a foundation, a makeup base, a lipstick, an eye shadow, an eyeliner, a mascara, an eyebrow pencil, Examples of the cosmetic material include soap, liquid cleansing agent, bathing agent, sunscreen cream, and sun oil. Examples of the cosmetic for hair include shampoo, rinse, hair treatment, hair mousse, hair liquid, pomade, hair color, hair bleach Examples of the cosmetic composition for scalp include hair tonic or scarf treatment, and examples of the cosmetic composition for shaving include aftershave lotion or shaving cream. Examples of the oral cosmetic composition include Toothpaste or mouth washer.

In addition to the active ingredient, the cosmetic composition is a component that is usually formulated in the cosmetic composition according to the purpose of use and the nature of the cosmetic composition, for example, moisturizers, ultraviolet absorbers, vitamins, animal and plant extracts, digestive agents, whitening agents, vasodilators, astringents, refreshing agents, Hormonal agents and the like may further be combined. In addition, the cosmetic composition may further include a medicament or a mechanism necessary for infiltrating or transferring the active ingredient into the dermal tissue.

The formulation of the cosmetic composition may take an appropriate form depending on the purpose of use and the nature of the cosmetic composition, for example, an aqueous solution, solubilizing, emulsifying, emulsion, gel, paste, ointment, aerosol, water-oil It may be a two-layered or water-oil-powder three-layered, examples of the formulations are merely illustrative, and the formulations and forms of the cosmetic composition of the present invention are not limited by the above examples.

The active ingredient may be contained in an amount of 0.001 to 50% by weight, and preferably 0.01 to 20% by weight, based on the total weight of the cosmetic composition, but the content is preferably such that the content of components other than the active ingredient contained in the formulation or cosmetic composition , And the content of the active ingredient contained in the present invention is not limited by the above content.

The composition comprising the guanine lepto takiya extract of the present invention as an active ingredient is an ingredient or externally used in the manufacture of cosmetics in connection with pharmaceutical compositions, food compositions and specific formulations for preventing and treating inflammation by inhibiting inflammation Since the present invention can be applied to a cosmetic composition having a characteristic that can effectively suppress the inflammation of the skin caused by the environment, the present invention is in the field of the medical industry related to the treatment of diseases related to inflammatory diseases and the cosmetic industry related to the control of skin inflammation. It can be widely used.

1 is a graph confirming the cytotoxicity of guanine leptostakia extract (GI-ME) according to an embodiment of the present invention, the horizontal axis of the graph means the content of guanine leptostakia extract, the graph The vertical axis of represents the cell viability (%) of control.
2 is a graph quantitatively confirming the effect of guanine leptostakia extract on NO production according to an embodiment of the present invention, the vertical axis of the graph is relative to the control (control) of the NO content of RAW 264.7 cells Value, and the horizontal axis means the content of guanine leptostakia extract.
3 is a graph quantitatively confirming the effect of guanine leptostakia extract on the production of PGE ₂ according to an embodiment of the present invention, the vertical axis of the graph is a control of the PGE ₂ content of RAW 264.7 cells The relative value for, and the horizontal axis means the content of guanine lepto takiya extract.
Figure 4 is a case showing the effect on the expression of iNOS, COX-2 and GAPDH-induced guanine leptostakia extract according to an embodiment of the present invention, when the guania leptostakia extract was not treated, When treated at 50, 100, 200 and 300 μg / ml respectively, the expression level is shown.
Figure 5 is a photograph showing the effect on the expression of p65 of the guanine leptostakia extract according to an embodiment of the present invention, the time the LPS and guanine leptostakia extract treatment of the nuclear section and whether each treatment + Means positive treatment and-means no treatment.
6 is a graph quantitatively confirming the effect of guanine leptostakia extract on gastritis according to an embodiment of the present invention, the vertical axis of the graph is relative to the control of the inflammation area of the stomach inflamed Value, the horizontal axis indicates whether Guania Leptostakia extract and Ranitidine are treated, + means positive treatment,-means no treatment, and the number on the horizontal axis It refers to the content of guania leptostakia extract.
7 is a photograph showing the effect of guanine leptostakia extract on gastritis according to an embodiment of the present invention, the control group (Normal) that does not do any treatment from the left, when the inflammation (Na CMC), It is a photograph showing the change in the case of 200 mg / kg of guania leptostakia extract treatment and the treatment of ranitidine.

Hereinafter, the present invention will be described in more detail with reference to production examples and examples. However, the following Preparation Examples and Examples are merely illustrated to aid the understanding of the present invention, and may be modified in various other forms, and the scope of the present invention is not limited to the following Examples.

Example ; Confirm anti-inflammatory effect

While studying a substance having an anti-inflammatory effect, the inventors of the present invention dried and pulverized the leaves, berries, and stems of Gouania leptostachya , and then added methanol to each pulverized powder, followed by extraction. Nia leptostakia methanol extract was prepared.

Example  1. Preparation of Samples and Cells

In order to measure the prophylactic and therapeutic effects on the inflammatory disease, tests were performed using the following samples and cells.

The acquisition destination of the said sample is as follows.

Src, Syk, ERK, p38, JNK, TAK1, MKK3 / 6, TLR4, iNOS, Akt, PDK1 (phosphoinsitide-dependent kinase 1), IKK, c-Jun, c-fos, b-actin, histone H4, p65 ( NF-κB), all antibodies against MyD88 were purchased from Cell signaling (USA). ELISA Kits for TNF-α and IL-6 were also purchased from Pierce Endogen (USA). In addition, 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyl tetrazolium bromide (MTT), sulfanilamide, lipopolysaccharide (LPS) and all other reagents were purchased from Sigma (USA).

The mouse macrophage lines RAW264.7 cells and HEK293 cells used in the experiment were purchased from the Korea Cell Line Research Foundation (Korea). The RAW264.7 cells and HEK293 cells were added with 10% heat-inactivated fetal bovine serum (Gibco, Grand Island, NY), glutamine and antibiotics (penicillin and streptomycin) in RPMI1640 medium, and at 37 ° C. and 5% CO The culture was carried out in an incubator of ₂ conditions. In each example, the experiment was performed at a cell density of 2 × 10 ⁶ cells / ml, and it was confirmed by trypan blue staining that 99% or more cells survived at the density.

The rats used in the experiment were prepared from 17 g to 21 g of 6 to 8 week old male ICR mice (Biolink), and water and feed (Samyangsa) were fed freely.

Example 2 . Confirmation of Cytotoxicity

In order to confirm the cytotoxicity of the ST-005141, it was confirmed the cell viability through the MTT assay using RAW264.7 cells.

More specifically, after dispensing the RAW264.7 cells in a 96 well plate at 2 × 10 ⁶ cells / ml, stabilizing the cells for 16 hours, dissolving the guania leptostakia methanol extract in DMSO, and then by concentration ( 25, 50, 100, 200 and 300 ug / ml) and incubated for 1 hour. After the incubation, LPS was treated at a concentration of 1 μg / ml and incubated in an incubator at 37 ° C. and 5% CO ₂ for 24 hours. After the culture, the cell culture was removed and treated with MTT (3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyl tetrazolium bromide) at a concentration of 0.5 mg / ml and incubated for 4 hours. After incubation, the supernatant was removed by centrifugation, and formazan crystals were dissolved by adding 150 ul of DMSO, and then absorbance was measured at 570 nm using an ELISA microplate reader (TECAN, USA) to measure cell viability. Obtained. The measurement results are shown in FIG. 1, and the viability of the cells shown in FIG. 1 is expressed as a percentage of a control in which no sample is added.

As shown in FIG. 1, guania leptostakia methanol extract was found to be safe at all concentrations from 25 uM to 300 uM. More specifically, when the 25 uM treatment resulted in a survival rate of about 100% of RAW264.7 cells in the experimental results, even when the highest concentration of 300 uM cell survival rate of about 80% was confirmed, ST-005141 was found not to induce cytotoxicity at concentrations from 25 uM to 300 uM.

Example 3 . Anti-inflammatory effect 1; Nitric oxide ( NO ) Inhibition  Confirm

In order to confirm the prophylactic and therapeutic effects of the guanine leptostakia methanol extract, it was confirmed by analyzing the inhibition of NO production.

First, RAW264.7 cells were divided into 2 × 10 ⁶ cells / ml in a 96 well plate, and the cells were incubated for 18 hours after the RAW264.7 cells were dispensed. 50, 100, 200 and 300 ug / ml) for 30 minutes and incubated for 24 hours. After the incubation, LPS was treated at a concentration of 1 μg / ml and incubated in an incubator at 37 ° C. and 5% CO ₂ for 20 hours. Griess reagent was added to the culture, and the content of NO (Nitric Oxide) was quantified.

Specifically, 100 ul of the cultured cell culture solution and 100 ul of Griess reagent (1% sulfanilamide in 5% phosphoric acid and 1% α-naphthylamide in H ₂ 0) were mixed and reacted at room temperature for 5 minutes, followed by ELISA at 540 nm. Absorbance was measured with a microplate reader (Tecan, USA). After absorbance was measured with sodium nitrite (NaNO ₂ ) to obtain a standard curve, the concentration of NO was calculated from the measured absorbance. The calculated NO value is shown in FIG. 2.

As shown in FIG. 2, the guanine leptostakia methanol extract was found to have NO production inhibitory ability. More specifically, guania leptostakia methanol extract inhibited the increased NO production by LPS treatment, and the NO content was reduced by about 80% compared to the control without any treatment at 25 ug / ml, NO concentration was continuously reduced depending on the concentration, it was confirmed that about 80% decreased when treated with 300 ug / ml. From the above results, it was confirmed that guanine leptostakia methanol extract was excellent in preventing and treating inflammatory diseases.

Example 4 . Anti-inflammatory effect 2; PGE ₂ Creation of Inhibition  Confirm

After incubating the RAW264.7 cells (1 × 10 ⁶ cells / ml) for 18 hours and pretreatment with the guanine leptostakia methanol extract for 24 hours, the inflammation is induced using LPS, and the pretreated culture solution Were incubated again for 24 hours. Griess reagent was added to the culture, and the content of PGE ₂ was quantified. Specifically, 100 ul of the cultured cell culture solution and 100 ul of Griess reagent (1% sulfanilamide in 5% phosphoric acid and 1% α-naphthylamide in H ₂ 0) were mixed and reacted for 5 minutes at room temperature, followed by ELISA at 540 nm. Absorbance was measured with a microplate reader (Tecan, USA) and the results are shown in FIG. 3.

As shown in FIG. 3, it was confirmed that the PGE ₂ content was reduced by almost 50% when RAW264.7 cells were treated with 300 g / ml of the guanine leptostakia methanol extract.

Therefore, it was confirmed that the guanine leptostakiya methanol extract is effective in the prevention and treatment of inflammatory diseases.

Example  5. anti-inflammatory effect 3; Inflammation-related proteins mRNA  Quantitative analysis

In order to confirm the anti-inflammatory activity of the guanine leptostakia methanol extract, the expression level of iNOS, COX-2 and GAPDH was confirmed by analyzing the mRNA.

RNA was prepared from LPS treated RAW264.7 cells. The method was prepared using TRIzol Reagent (Gibco BRL) as described by Lee et al., 2008. All RNA is used after storage at -70 ℃. Semi-quantitative RT reaction was performed using MuLV reverse transcriptase. All RNA (1 μg) was incubated with oligo-dT15 at 70 ° C. for 5 minutes and mixed with 5 × first strand buffer, 10 mM dNTPs and 0.1 M DTT. The reaction mixture was further incubated at 37 ° C. for 5 minutes and incubated for 60 minutes after MuLV reverse transcriptase (2 U) was added. The reaction was terminated by incubating at 70 ° C. for 10 minutes. RNase H was added to remove all RNA and PCR reactions were performed (conditions: 2 μl cDNA, 4 μM 5 ′ primer and 3 ′ primer, 10 × buffer (10 mM Tris-HCl, pH 8.3; 50 mM KCl and 0.1% Triton X-100), 250 μΜ dNTPs, 25 mM MgCl ₂ and 1 unit of Taq DNA polymerase (Promega, USA) The PCR reaction was denatured at 94 ° C. for 30 seconds and after annealing at 55-60 ° C. for 30 seconds, Extend 42 seconds at 72 ° C. and finally 5 minutes at 72 ° C. 1 μg of RNA is reverse transcribed with Molony murine leukemia virus reverse transcriptase (Invitrogen). Applied Biosystems, Foster City, CA) The reaction proceeded to ABI's sequence detection system The results were generalized according to 18S transcript Primers of iNOS, COX-2 and GAPDH are summarized in Table 1 below. The confirmed result is shown in FIG.

Name Sequence (5 '→ 3') iNOS F GGA GCC TTT AGA CCT CAA CAGE R TGA ACG AGG AGG GTG GTG COX-2 F CACTACATCCTGACCCACTT R ATGCTCCTGCTTGAGTATGT GAPDH F CAA TGA ATA CGG CTA CAG CAA C R AGG GAG ATG CTC AGT GTT GG

As shown in FIG. 4, mRNA analysis of RAW264.7 cells revealed that iNOS, COX-2 and GAPDH were increased by the addition of LPS, iNOS, COX-2 and GAPDH induced by LPS. The expression of the guanine leptostakiya methanol extract was treated when the degree of expression was reduced, the expression reduction degree can be confirmed that the concentration-dependently reduced depending on the amount of the treated guanine leptostakia methanol extract.

Example 6 . Anti-inflammatory effect 5; Whether Inflammation-related Proteins Inhibit Transcription Factor Generation

In relation to inflammation induced by LPS, the production and activation of p65, a transcription factor related to transcription of inflammatory proteins in the nucleus, was confirmed.

For this confirmation, cell fractions and nuclear extracts of RAW264.7 cells treated with LPS or LPS and guanine leptostakia methanol extracts are described by Byeon, et. al (Archives of Pharmacal Research 32, 1565-1572 (2009)), and immunoblotting analysis to determine the level of nuclear content and activation therefrom was carried out by Lee meat Analyzes as described in al (British Journal of Pharmacology 154, 852-863 (2008)). The observed results are shown in FIG. 5.

As shown in FIG. 5, a significant decrease in content was observed when the guania leptostatya methanol extract was treated, especially when treated for 60 minutes.

Example 7 . Anti-inflammatory effect 5; Confirmation of inhibitory effect on gastritis using experimental animals

In order to confirm that the guanine leptostakia methanol extract is effective in the treatment and prevention of gastritis, ranitidine and the guanine leptostakia methanol extract were used to confirm the treatment of gastritis.

Gastritis was induced in the ICR mice, ranitidine 300mg / kg and guanine leptostakia methanol extracts were treated at 100 and 200 mg / kg and the changes in the area of gastritis induced were shown in FIGS. 6 and 7. . Ranitidine is a therapeutic agent used for gastric ulcer or reflux esophagitis, and is one of H2-Blocker that blocks gastric acid secretion in gastric wall cells by blocking histamine receptor (H2 receptor).

Referring to Figure 6, even when treated with 100 mg / kg of the guanine lepto takiya methanol extract was reduced gastritis area compared to the control group, and treated with 200 mg / kg significantly reduced the area of gastritis induced each As can be seen, the guanine leptostakia methanol extract has a therapeutic and prophylactic effect of gastritis.

In addition, looking at Figure 7, it can be seen that the difference between the case of inflammation-induced mice (vehicle) and not induced, and when treated with guanine leptostakiya methanol extract can be confirmed that the degree of inflammation is alleviated.

Claims (5)

Gouania leptostachya ) anti-inflammatory composition comprising the extract as an active ingredient. The method of claim 1,
The guanian lepto takiya extract is an anti-inflammatory composition that extracts at least one selected from the group consisting of water, spinel sprouts of alcohol having 1 to 5 carbon atoms, and mixtures thereof. Pharmaceutical composition for preventing and treating inflammatory diseases comprising guanine leptostakia extract as an active ingredient. The method of claim 3,
The inflammatory disease is any one selected from the group consisting of dermatitis, allergy, gastric ulcer, duodenal ulcer, hepatitis, esophagitis, gastritis, enteritis, pancreatitis, colitis, nephritis, stomach cancer, systemic edema, local edema and combinations thereof Therapeutic pharmaceutical composition. Inflammatory disease prevention and improvement cosmetic composition comprising guanine lepto takiya extract as an active ingredient.

Images