KR20130058649A - Composition for preventing or treating inflammatory diseases comprising inhibitor of gadd45 gamma as an active ingredient - Google Patents

Abstract

PURPOSE: A composition containing GADD45 gamma inhibitor for preventing or treating inflammatory diseases is provided to suppress inflammation by regulating generation of TNF-alpha and IL-6, and to be used as a therapeutic agent for inflammatory diseases. CONSTITUTION: A pharmaceutical composition for preventing or treating inflammatory diseases contains an inhibitor of GADD45 gamma expression or activation as an active ingredient. GADD 45 gamma has an amino acid sequence of sequence number 1. A method for screening a preventive or therapeutic agent for inflammatory diseases comprises: a step of treating a test material to a GADD45 gamma-expressing cell line; a step of measuring GADD45 gamma expression or activation level in the cell line; and a step of selecting the test material with reduced expression or activation level compared with a control group.

Description

Composition for preventing or treating inflammatory diseases comprising inhibitor of GADD45 gamma as an active ingredient}

The present invention relates to a composition for the prevention or treatment of inflammatory diseases comprising a gdydi45 gamma (GADD45γ) inhibitor as an active ingredient.

Human GADD45 consists of three forms, GADD45α, GADD45β and GADD45γ, of which GADD45α was first cloned by Fornace AJ Jr et al. (Fornace, AJ Jr et al. 1998 Proc Natl Acad Sci USA. 85: 8800-8804). GADD45β and GADD45γ were then revealed by Takekawa M et al. (Takekawa M et al. 1998 Cell. 25: 521-530). GADD45 is 55-58% of the same protein and is known to be present in the nucleus rather than the cytoplasm. GADD45 is induced by DNA damaging stimuli and the like, cell cycle arrest (Wang SW et al. 1998 Proc Natl Acad Sci USA. 96: 3706-3711), cell growth inhibition (Zhan Q et al. Mol Cell Biol 14: 2361-2371 ) And cell death (Zerbini LF et al. Proc Natl Acad Sci USA 101: 13618-13623). Many studies have been conducted on GADD45, particularly in relation to tumors, and it has been shown that inhibition of GADD45α and GADD45γ by NF-kB promotes cancer proliferation (Zerbini LF et al. Proc Natl Acad Sci USA 101: 13618-13623). Degradation or inactivation of GADD45γ has been shown to induce proliferation of cancer cells (Ying J et al. 2005 Clin Cancer Res 11: 6442-6449). It has also been found by the inventor that GADD45γ is involved in the progression of renal disease (Shin GT et al. 2008 Kidney Int 73: 1251-1265 and Yu S et al. 2009 American J Nephrol 30: 135-139). However, to date, it is not known that GADD45γ can inhibit or increase the production of inflammatory substances.

Inflammatory reactions are stimulated by external substances such as damage, bacteria, fungi, and viruses, resulting in a series of complex physiological reactions including enzyme activation by various inflammatory mediators and immune cells, secretion of inflammatory mediators, fluid infiltration, cell migration, and tissue destruction. This is accompanied by symptoms such as erythema, edema, fever and pain. Inflammatory reactions restore the function of life by removing external infectious agents and regenerating damaged tissues.However, when inflammatory reactions occur excessively or continuously such as antigens are not removed or internal substances are caused, mucosal damage and tissue destruction occur. It can also lead to diseases such as cancer, inflammatory skin diseases, inflammatory bowel disease, and arthritis.

Monocytes in the blood are the most important cells that produce TNF-α and IL-6, and when these cells penetrate into inflamed tissues and become activated, they become differentiated into macrophages (McNaul KL et al. 1990 J Immunol). 145: 4154-4166). In fact, representative diseases in which tissues are destroyed by these inflammatory substances are rheumatoid arthritis (Saklatvala J et al. 1986 Nature 322: 547-549), psoriatic arthritis (Mease PJ et al. 2000 Lancet 356: 385- 390), ankylosing spondylitis (Brandt J et al. 2000 Arthritis Rheum 43: 1346-1352) and Crohn's Disease (Plevy SE et al. 1997 J Immunol 159: 6276-6282). . Especially in rheumatoid arthritis, blood or joint TNF-α levels were found to be associated with the severity of the disease (Tetta C et al. 1990 Ann Rheum Dis 49: 665-667). In order to treat these chronic inflammatory diseases, antibody injections against TNF-α and IL-6 are widely used in the clinic. TNF-α antibody injections are widely used in the US FDA by Etanercept, Infliximab, Adalimumab, Certolizumab pegol and Golimumab. It is commercially available with the permission, and the antibody injection against IL-6 is marketed and used by Tocilizumab. However, these antibody injections neutralize the already produced TNF-α or IL-6 in the blood and thus do not prevent the production of inflammatory substances. Repeated injections (e.g. once a week) are required, resulting in expensive treatment costs. There are significant drawbacks as required.

Accordingly, the present inventors have solved the above-mentioned problems and continue research to develop new inflammatory agents, and GD45 gamma (GADD45γ) inhibitors regulate inflammation by regulating the production of TNF-α and IL-6. This invention was completed by confirming that it has the outstanding effect of suppressing.

An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of inflammatory diseases, including the expression inhibitor or activity inhibitor of GMID45 gamma as an active ingredient.

Still another object of the present invention is to provide a composition for diagnosing inflammatory disease, including an agent for measuring mRNA or protein expression level of GD45 gamma.

Still another object of the present invention is to provide a method for screening a prophylactic or therapeutic agent for inflammatory disease, comprising measuring the level of expression or activity of GB45 gamma.

In order to achieve the above object, the present invention provides a pharmaceutical composition for the prophylaxis or treatment of inflammatory diseases, including the expression inhibitor or activity inhibitor of GMID45 gamma as an active ingredient.

In another aspect, the present invention provides a composition for diagnosing inflammatory diseases, including an agent for measuring the mRNA or protein expression level of GD45 gamma.

In another aspect, the present invention provides a method for screening a prophylactic or therapeutic agent for inflammatory diseases comprising the step of measuring the expression or activity of GD45 gamma.

GD45 gamma inhibitor according to the present invention has an excellent effect of inhibiting inflammation by regulating the production of TNF-α (tumor necrosis factor-alpha) and interleukin-6 (IL-6), inflammatory diseases It can be usefully used as a therapeutic agent for.

1 is a diagram showing the results of comparing the degree of RNA production of GADD45γ according to the presence or absence of the lentiviral in which GADD45γ shRNA is inserted in THP-1 cells.
2 shows the results of confirming the production of TNF-? In THP-1 mononuclear cells in which the expression of GADD45? Is inhibited.
Figure 3 is a diagram showing the results confirming the production of IL-6 in THP-1 monocyte cells in which GADD45γ expression is suppressed.
Figure 4 is a view showing the result of comparing the degree of RNA production of GADD45γ according to the presence or absence of the lentiviral GADD45γ ORF inserted.
5 is a diagram showing the results of confirming the production of TNF-α in THP-1 monocytes overexpressed GADD45γ.
Figure 6 is a diagram showing the results confirming the production of IL-6 in THP-1 monocytes overexpressed GADD45γ.
7 is a diagram showing the expression level of GADD45γ in the tissues of rheumatoid arthritis patients.
Figure 8 is a diagram showing the expression of green fluorescent protein in peripheral blood monocyte cells infected with a lentivirus inserted with a green fluorescent protein gene.
Figure 9 shows the results of comparing the degree of RNA production of GADD45γ according to the presence or absence of the lentiviral in which GADD45γ shRNA is inserted in peripheral blood monocytes.
10 is a diagram showing the results of confirming the production of TNF-α and IL-6 in peripheral blood mononuclear cells suppressed GADD45γ expression.
11 is a diagram showing the results of confirming the production of TNF-α through FACS in peripheral blood mononuclear cells suppressed GADD45γ expression.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for the prophylaxis or treatment of inflammatory diseases, including the inhibitor or activity inhibitor of GMID45 gamma as an active ingredient.

The GD45 gamma protein is preferably represented by an amino acid sequence represented by SEQ ID NO: 1, but is not limited thereto. The protein range of GD45 gamma of the present invention includes a protein having the amino acid sequence represented by SEQ ID NO: 1 and a functional equivalent of the protein. The term "functional equivalent" means at least 70%, preferably 80% or more, more preferably 90% or more, and even more preferably at least 70% of the amino acid sequence represented by SEQ ID NO: 1 as a result of the addition, substitution or deletion of the amino acid. Preferably it refers to a protein having a sequence homology of 95% or more, and exhibits substantially homogeneous physiological activity with the protein represented by SEQ ID NO: 1.

The proteins of GD45 gamma of the present invention are not only proteins having their natural amino acid sequence, but also amino acid sequence variants thereof are also included in the scope of the present invention. Variant of a protein of GIDD45 gamma refers to a protein whose GDHD45 gamma natural amino acid sequence and one or more amino acid residues have different sequences by deletion, insertion, non-conservative or conservative substitution, or a combination thereof. Amino acid exchanges in proteins and peptides that do not alter the activity of the molecule as a whole are known in the art (H. Neurode, R. L. Hill, The Proteins, Academic Press, New York, 1979). The most commonly occurring exchanges involve amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu and Asp / Gly. In some cases, it may be modified by phosphorylation, sulfation, acetylation, glycosylation, methylation, farnesylation, or the like.

The GD45 gamma protein or variant thereof may be extracted from nature or synthesized (Merrifleld, J. Amer. Chem. Soc. 85: 2149-2156, 1963) or by genetic recombination methods based on DNA sequences. (Sambrook et al, Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, 2nd edition, 1989).

The inhibitor of GDYD45 gamma expression is composed of antisense nucleotides, short hairpin RNAs, small interfering RNAs, and ribozymes that complementarily bind to mRNA of GDYD45 gamma gene. It is preferred that any one selected from the group, wherein the inhibitor of GIDD45 gamma activity is a compound, peptide, peptide mimetics, substrate analogs, aptamers and antibodies that complementarily bind to GDD45 gamma protein It is preferably one selected from the group consisting of, but is not limited thereto.

The siRNA is composed of a 15 to 30 mer sense sequence selected from the base sequence of the mRNA of the gene encoding the GDYD45 gamma protein and an antisense sequence complementary to the sense sequence, wherein The sense sequence is not particularly limited to this, but preferably consists of 25 bases. The antisense nucleotides, as defined in Watson-click base pairs, bind (hybridize) the complementary sequencing of DNA, immature-mRNA or mature mRNA to hinder the flow of genetic information as a protein in DNA. The nature of antisense nucleotides specific to the target sequence makes them exceptionally multifunctional. Since antisense nucleotides are long chains of monomeric units they can be easily synthesized for the target RNA sequence. Many recent studies have demonstrated the utility of antisense nucleotides as biochemical means for studying target proteins (Rothenberg et al., J. Natl. Cancer Inst., 81: 1539-1544, 1999). The use of antisense nucleotides can be considered as a new type of inhibitor because of recent advances in nucleotide synthesis and in the field of nucleotide synthesis that exhibit improved cell adsorption, target binding affinity and nuclease resistance.

Peptide mimetics (Peptide Minetics) is to inhibit the activity of the Gdydyd45 gamma protein by inhibiting the binding domain of Giddy45 gamma protein. Peptide mimetics can be peptides or non-peptides and are amino acids bound by non-peptide bonds, such as psi bonds (Benkirane, N., et al. J. Biol. Chem., 271: 33218-33224, 1996). Can be configured. Also, a cyclic mimetic comprising a “conformationally constrained” peptide, a cyclic mimetics, at least one exocyclic domain, a binding moiety (binding amino acid) and an active site. Can be. Peptide mimetics are structured similar to the secondary structural properties of GID4545 gamma protein and are either antibodies (Park, BW et al. Nat Biotechnol 18, 194-198, 2000) or water soluble receptors (Takasaki, W. et al. Nat Biotechnol 15). , 1266-1270, 1997), which can mimic the inhibitory properties of large molecules and may be novel small molecules that can act equivalent to natural antagonists (Wrighton, NC et al. Nat Biotechnol 15, 1261-1265). , 1997).

The aptamer is a single-chain DNA or RNA molecule, and has a high affinity for a specific chemical or biological molecule by an evolutionary method using an oligonucleotide library called systemic evolution of ligands by exponential enrichment (SELEX). Oligomers that have the ability to select and bind can be obtained by isolation (C. Tuerand L. Gold, Science 249, 505-510, 2005; AD Ellington and JW Szostak, Nature 346, 818-822, 1990; M. Famulok, et. al., Acc. Chem. Res. 33, 591-599, 2000; DS Wilson and Szostak, Annu. Rev. Biochem. 68, 611-647, 1999). Aptamers can specifically bind to a target and modulate the activity of the target, such as by blocking the ability of the target to function.

The antibody specifically and directly binds to GD45 gamma, thereby effectively inhibiting the activity of GDG45 gamma. It is preferable to use a polyclonal antibody or a monoclonal antibody as an antibody that specifically binds to GD45 gamma. The antibody that specifically binds to GD45 gamma may be prepared by a known method known to those skilled in the art, and a GIDD45 gamma antibody known commercially may be purchased and used. The antibody can be prepared by injecting a Gdydi45 gamma protein, which is an immunogen, into an external host according to conventional methods known to those skilled in the art. External hosts include mammals such as mice, rats, sheep, rabbits. Immunogens are injected intramuscularly, intraperitoneally or subcutaneously, and can generally be administered in conjunction with an adjuvant to increase antigenicity. Antibodies can be isolated by collecting blood periodically from an external host and collecting serum showing shaped titers and specificity for the antigen.

Inflammatory diseases in the present invention is not limited thereto, but inflammatory skin diseases, Crohn's desease and inflammatory bowel diseases such as ulcerative colitis, peritonitis, osteomyelitis, cellulitis, meningitis, encephalitis, pancreatitis, traumatic shock, bronchial asthma , Allergic rhinitis, cystic fibrosis, stroke, acute bronchitis, chronic bronchitis, acute bronchiolitis, chronic bronchiolitis, osteoarthritis, gout, spondyloarthropathy, ankylosing spondylitis, lighter syndrome, psoriatic arthrosis, enteropathic spondylitis, juvenile arthrosis , Juvenile ankylosing spondylitis, reactive arthritis, infectious arthritis, post-infectious arthritis, gonococcal arthritis, tuberculosis arthritis, viral arthritis, fungal arthritis, syphilis arthritis, Lyme disease, arthritis associated with vasculitis syndrome, nodular polyarthritis, hypersensitivity Vasculitis, Leukemic Granulomatosis, Rheumatoid Multiple Muscle Pain, Joint Cell Arteritis, Calcium Texture Arthropathy, pseudogout, non-articular rheumatism, bursitis, hay fever, epicondylitis (tennis elbow), neuropathic joint disease (charco and joint), hemarthrosic, henoch-Scholine purpura, thickening osteoarthritis , Multicentric reticulocytosis, surcoilosis, hemochromatosis, sickle cell disease and other hemoglobinopathies, hyperlipoproteinemia, hypomagglobulinemia, familial Mediterranean fever, Behart's disease, systemic lupus erythematosus, recursive fever, psoriasis , Multiple sclerosis, sepsis, septic shock, multiple organ dysfunction syndrome, acute respiratory distress syndrome, chronic obstructive pulmonary disease, rheumatoid arthritis, acute lung injury and bronchial Pulmonary dysplasia (broncho-pulmonary dysplasia). In addition, the inflammatory skin disease is not limited thereto, but skin inflammation, acute and chronic eczema, contact dermatitis, atopic dermatitis, seborrheic dermatitis, chronic simple thyroid gland, interrogation, deprivation dermatitis, papular urticaria, psoriasis, sun dermatitis And acne and the like.

The composition of the present invention can be used in combination with an agent for inhibiting the expression or activity of GIDD45 gamma, an active ingredient, as well as a therapeutic agent for inflammatory diseases.

The compositions of the present invention may be formulated in a suitable form with a pharmaceutically acceptable carrier. 'Pharmaceutically acceptable carrier' refers to a carrier that is physiologically acceptable and does not cause an allergic or similar reaction, such as gastrointestinal disorders, dizziness, etc., when administered to humans. Pharmaceutically acceptable carriers include, for example, carriers for oral administration such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like, and parenteral administration such as water, suitable oils, saline, aqueous glucose and glycols. And the like, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Other pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995).

In the case of oral administration of the pharmaceutical composition of the present invention, the pharmaceutical composition of the present invention may be prepared in powder, granule, tablet, pill, dragee, capsule, liquid, gel according to a method known in the art together with a suitable oral carrier. , Syrups, suspensions, wafers and the like. Examples of suitable carriers include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol and the like; Starches, including corn starch, wheat starch, rice starch and potato starch; Celluloses including cellulose, methyl cellulose, sodium carboxymethyl cellulose, hydroxypropylmethyl-cellulose and the like; Fillers such as gelatin, polyvinylpyrrolidone and the like can be included. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid or sodium alginate and the like may optionally be added as a disintegrant. Further, the pharmaceutical composition may further comprise an anti-coagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and an antiseptic agent. In addition, when administered parenterally, the pharmaceutical compositions of the present invention may be formulated according to methods known in the art in the form of injections, transdermal and nasal inhalants together with suitable parenteral carriers. In the case of such injections, they must be sterilized and protected against contamination of microorganisms such as bacteria and fungi. Examples of suitable carriers for injectables include, but are not limited to, solvents or dispersion media containing water, ethanol, polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycol, etc.), mixtures thereof and / or vegetable oils . More preferably, suitable carriers include Hanks solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanol amine or sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose Etc. can be used. In order to protect the injection from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like may be further included. In addition, the injections may in most cases additionally include isotonic agents, such as sugars or sodium chloride. Examples of transdermal dosage forms include ointments, creams, lotions, gels, solutions for external use, pastes, liniments, and air lozenges. As used herein, "transdermal administration" means that the pharmaceutical composition is topically administered to the skin such that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin. These formulations are described in Remington's Pharmaceutical Science, 15th Edition, 1975, Mack Publishing Company, Easton, Pennsylvania, a prescription generally known in pharmaceutical chemistry. In the case of inhaled dosages, the compounds used according to the invention may be pressurized packs or by means of suitable propellants, for example dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be delivered conveniently from the nebulizer in the form of an aerosol spray. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve that delivers a metered amount. For example, gelatin capsules and cartridges for use in inhalers or blowers can be formulated to contain a mixture of the compound and a suitable powder base such as lactose or starch. Other pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995).

Nucleotides or nucleic acids used in the present invention can be prepared for the purpose of oral, topical, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal and the like. Preferably, the nucleic acid or vector is used in injectable form. It may therefore be admixed with any pharmaceutically acceptable mediator for injectable compositions, in particular for direct injection into the area to be treated. The pharmaceutical compositions of the present invention may in particular comprise isotonic sterile solutions or lyophilized compositions which allow the composition of injectable solutions upon the addition of dry, in particular sterile water or appropriate physiological saline. As used herein, the term “pharmaceutically effective amount” refers to an amount that exhibits a higher response than a negative control, and preferably an amount sufficient to treat or prevent diabetes. The pharmaceutically effective amount of the composition of the present invention is about 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg, preferably administered once to several times a day. However, the dosage of nucleic acids used in the present invention can be adjusted by various parameters, in particular genes, vectors, mode of administration used, disease in question or alternatively desired duration of treatment. In addition, the range varies depending on the weight, age, sex, health status, diet, administration time, administration method, excretion rate and severity of the patient.

The present invention also provides a composition for diagnosing inflammatory diseases, including an agent for measuring mRNA or protein levels of GID45 gamma (GADD45γ).

As used herein, the term "diagnostic" means identifying the presence or characteristic of a pathological condition. For the purposes of the present invention, the diagnosis is to determine whether an inflammatory disease is developed.

The present invention also provides a kit for diagnosing inflammatory diseases, including an agent for measuring mRNA or protein levels of GID45 gamma (GADD45γ). The diagnostic kit for inflammatory disease may further comprise one or more other component compositions, solutions or devices suitable for analytical methods.

In addition,

(a) treating the test substance with a GDY45 gamma (GADD45γ) protein expressing cell line;

(b) measuring the level of expression or activity of GMID45 gamma of the cell line; And

(c) screening a test material whose expression or activity of GMID45 gamma is reduced compared to a control that has not been treated with the test material; and provides a method for screening an agent for preventing or treating an inflammatory disease.

In the method, the expression level of the protein of step (b) is immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemistry, RT-PCR, Western blotting And flow cytometry (FACS), preferably any one selected from the group consisting of, but any method of determining the amount of transcript or protein encoded therefrom known to those skilled in the art can be used.

In the above method, the activity of the protein of step (b) is preferably measured by any one selected from the group consisting of SDS-PAGE, immunofluorescence, enzyme immunoassay (ELISA), mass spectrometry and protein chip. It is not limited.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited thereto.

Example  1. from monocyte cells GADD45 γ RNA  Inhibition of inflammatory factor production through production inhibition

In order to confirm the effect of the inhibition of RNA production of GADD45γ on the production of inflammatory factors in monocytes, the following experiment was performed. First, short hairpin RNA (shRNA) having a target sequence (GCACTGCATCCTCATTTCGAAC) and a ring sequence (TCGA) of GADD45γ transcribed by the U6 promoter to suppress RNA production of GADD45γ using RNA interference. Was prepared a lentiviral inserted. The lentiviral was inserted into a puromycin resistance gene, and a lentiviral into which a green fluorescent protein gene was inserted was used as a control. In order to infect the lentivirus prepared by the above process to THP-1 cells, which are monocytes, 10 times the number of THP-1 cells and the cell number in RPMI medium to which polybrene was added at a concentration of 10 ug / ml. A number of lentiviruses were added and cultured using a spinoculation method of centrifugation at 1,340 g at 22 ° C. for 3 hours (O'Doherty U et al. 2000 J Virol 74: 10074-10080). Thereafter, 48 hours were further incubated and a stable cell line was obtained by culturing in a medium to which 0.5 ug / ml of puromycin was added. In the stable cell line, GADD45γ expression was inhibited and the degree of inflammatory factor production was confirmed. The results are shown in FIG. 1 to FIG.

As shown in Figure 1, when the lentiviral in which the GADD45γ shRNA is inserted, it was confirmed that the RNA production of GADD45γ is significantly reduced.

In addition, as shown in FIGS. 2 and 3, the concentrations of inflammatory factors TNF-α and IL-6 in LPS-stimulated monocytes were measured by an enzyme-linked immunosorbent assay. In THP-1 monocytes (GADD45γ RNAi) cells with suppressed expression, TNF-α production was reduced by about 75% and IL-6 production by about 60% compared to the control (labeled as control).

Example  2. in monocyte cells GADD45 γ RNA  Verification of increased inflammatory factor production through overexpression

In order to determine the effect of RNA overexpression of GADD45γ on the production of inflammatory factors in monocytes, the following experiment was performed. First, an lentiviral in which an open reading frame (ORF) of nucleotide sequences 111-590 of GADD45γ mRNA (NM_006705) was transcribed by a CMV promoter was prepared. As a control, a lentiviral in which beta galactosidase gene was inserted was used. In order to infect the lentivirus prepared by the above process to THP-1 cells, which are monocytes, 10 times the number of THP-1 cells and the cell number in RPMI medium to which polybrene was added at a concentration of 10 ug / ml. A number of lentiviruses were added and cultured using a spinoculation method of centrifugation at 1,340 g at 22 ° C. for 3 hours (O'Doherty U et al. 2000 J Virol 74: 10074-10080). After 48 hours further culture, cells were obtained to check whether GADD45γ was overexpressed and the degree of inflammatory factor production. The results are shown in FIGS. 4 to 6.

As shown in FIG. 4, when the lentiviral into which the GADD45γ ORF was inserted, RNA production of GADD45γ was markedly increased.

In addition, as shown in Figures 5 and 6, the concentration of inflammatory factors TNF-α and IL-6 in LPS-stimulated monocytes was measured by an enzyme-linked immunosorbent assay, indicating that GADD45γ In overexpressed THP-1 monocytes, TNF-α production was increased by about 6 times and IL-6 production by about 80 times compared to the control group.

Example  3. In human peripheral blood monocytes GADD45 γ RNA  Inhibition of inflammatory factor production through production inhibition

3-1. In tissues of patients with inflammatory diseases GADD45 Confirmation of γ Expression

In order to confirm the expression of GADD45γ in inflammatory cells infiltrating tissues of inflammatory diseases, a 4 um paraffin synovial membrane tissue section of rheumatoid arthritis, a representative inflammatory disease, was used as a primary antibody and a secondary antibody against GADD45γ. After the reaction, the mixture was colored with diaminobenzidine and stained with H & E. The results are shown in Fig.

As shown in Figure 7, it was confirmed that GADD45γ is strongly expressed in lymphocytes and monocytes infiltrated into the synovial membrane.

3-2. In human peripheral blood monocytes GADD45 γ RNA  Inhibition of inflammatory factor production through production inhibition

The following experiments were performed to determine the effect of GADD45γ on the production of inflammatory factors in human peripheral blood mononuclear cells (PBMC) consisting of lymphocytes and monocytes. GADD45γ inhibition was produced by using a lentiviral in which GADD45γ shRNA was inserted in the same manner as in Example 1. First, blood was separated from venous blood of healthy volunteers, and then mixed 1: 1 with PBS in a heparin tube, and peripheral blood mononuclear cells were obtained using Ficoll-Paque and centrifugation. The lentiviral in which the RNA interference sequence for GADD45γ was inserted into the cells was added in an amount corresponding to 40-50 times the number of cells, followed by spinoculation using a centrifugation at 1,340g at 22 ° C. for 3 hours. And incubated. As a control, a lentiviral in which a green fluorescent protein gene or a non-target sequence was inserted without a target gene was used. After culturing for 72 more hours, lipopolysaccharide (LPS) at a concentration of 100 ng / ml was added to the medium to activate peripheral blood mononuclear cells for 24 hours, and then a cell medium was obtained to obtain TNF-α and IL-. The concentration of 6 was measured by enzyme immunoassay. The results are shown in FIGS. 8 to 10.

As shown in FIG. 8, peripheral blood mononuclear cells infected with the lentivirus into which the green fluorescent protein gene was inserted were observed under a fluorescence microscope to confirm that the lentivirus was well infected with the cells. In addition, as shown in FIG. 9, GADD45γ expression was increased by LPS treatment in peripheral blood mononuclear cells, and GADD45γ expression was inhibited by RNA interference.

In addition, as shown in FIG. 10, peripheral blood mononuclear cells (GADD45G RNAi, n = 4) in which GADD45γ expression was suppressed significantly produced TNF-α and IL-6 as compared to the control group (control, n = 4). It was confirmed that the decrease.

In addition, LPS and BD GolgiStop (BD bioscience) were added to the medium and incubated for 4 hours, and then the expression level of TNF-α was measured using Fluorescence Activated Cell Sorting (FACS). The results are shown in Fig.

As shown in FIG. 11, it was confirmed that the expression of TNF-α was significantly decreased compared to the control group by suppressing GADD45γ expression.

Through the above experimental results, it was confirmed that GADD45γ regulates the expression of inflammatory factors TNF-α and IL-6, so that the inhibitor of GADD45γ can be used as a treatment for TNF-α and IL-6-mediated inflammatory diseases It was confirmed that there is.

Hereinafter, the preparation examples of the pharmaceutical composition containing the composition of the present invention, but not intended to limit the present invention is intended to be described in detail only.

Formulation example  One. Sanje  Produce

GEDIID45 Gamma Inhibitor 20 mg

Lactose 100 mg

Talc 10 mg

The above components are mixed and filled in airtight bags to prepare powders.

Formulation example  2. Preparation of tablets

GEDIID45 Gamma Inhibitor 10 mg

Corn starch 100 mg

Lactose 100 mg

Magnesium stearate 2 mg

After mixing the above components, tablets are prepared by tableting according to the usual preparation method of tablets.

Formulation example  3. Preparation of capsules

GEDIID45 Gamma Inhibitor 10 mg

Crystalline cellulose 3 mg

Lactose 14.8 mg

Magnesium stearate 0.2 mg

The above components are mixed according to a conventional capsule preparation method and filled in gelatin capsules to prepare capsules.

Formulation example  4. Preparation of injections

GEDIID45 Gamma Inhibitor 10 mg

180 mg mannitol

Sterile sterilized water for injection 2974 mg

Na ₂ HPO ₄ 2H ₂ O 26 mg

(2 ml) per 1 ampoule in accordance with the usual injection preparation method.

Formulation example  5. Liquid  Produce

GEDIID45 Gamma Inhibitor 20 mg

10 g per isomer

5 g mannitol

Purified water quantity

<110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Composition for preventing or treating inflammatory diseases          comprising inhibitor of GADD45 gamma as an active ingredient <130> a <150> 11/124425 <151> 2011-11-25 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 159 <212> PRT <213> Homo sapiens <400> 1 Met Thr Leu Glu Glu Val Arg Gly Gln Asp Thr Val Pro Glu Ser Thr   1 5 10 15 Ala Arg Met Gln Gly Ala Gly Lys Ala Leu His Glu Leu Leu Leu Ser              20 25 30 Ala Gln Arg Gln Gly Cys Leu Thr Ala Gly Val Tyr Glu Ser Ala Lys          35 40 45 Val Leu Asn Val Asp Pro Asp Asn Val Thr Phe Cys Val Leu Ala Ala      50 55 60 Gly Glu Glu Asp Glu Gly Asp Ile Ala Leu Gln Ile His Phe Thr Leu  65 70 75 80 Ile Gln Ala Phe Cys Cys Glu Asn Asp Ile Asp Ile Val Arg Val Gly                  85 90 95 Asp Val Gln Arg Leu Ala Ala Ile Val Gly Ala Gly Glu Glu Ala Gly             100 105 110 Ala Pro Gly Asp Leu His Cys Ile Leu Ile Ser Asn Pro Asn Glu Asp         115 120 125 Ala Trp Lys Asp Pro Ala Leu Glu Lys Leu Ser Leu Phe Cys Glu Glu     130 135 140 Ser Arg Ser Val Asn Asp Trp Val Pro Ser Ile Thr Leu Pro Glu 145 150 155

Claims (10)

A pharmaceutical composition for the prophylaxis or treatment of inflammatory diseases comprising an inhibitor of GADD45 gamma (GADD45γ) or an activity inhibitor as an active ingredient.
The pharmaceutical composition for preventing or treating an inflammatory disease according to claim 1, wherein the GB45 gamma is represented by the amino acid sequence of SEQ ID NO: 1.
The method of claim 1, wherein the expression inhibitor is any one or more selected from the group consisting of antisense nucleotides, siRNA (short interfering RNA), shRNA (short hairpin RNA) and ribozyme complementary to the mRNA of the GDYD45 gamma gene Characterized in that for the prevention or treatment of inflammatory diseases.
The method according to claim 1, wherein the activity inhibitor is any one or more selected from the group consisting of compounds, peptides, peptide mimetics, aptamers, matrix analogs, and antibodies that complement the GID45 gamma protein, inflammatory Pharmaceutical compositions for the prevention or treatment of diseases ..
The method of claim 1, wherein the inflammatory disease is skin inflammation, acute and chronic eczema, contact dermatitis, atopic dermatitis, seborrheic dermatitis, chronic simple mammary glands, interrogation, deprived dermatitis, papular urticaria, psoriasis, sun dermatitis, acne, Crohn's desease, ulcerative colitis, peritonitis, osteomyelitis, cellulitis, meningitis, encephalitis, pancreatitis, trauma-induced shock, bronchial asthma, allergic rhinitis, cystic fibrosis, stroke, acute bronchitis, chronic bronchitis, acute bronchitis, chronic Bronchiolitis, osteoarthritis, gout, spondyloarthropathies, ankylosing spondylitis, lighter syndrome, psoriatic arthrosis, intestinal disease spondylitis, juvenile arthrosis, juvenile ankylosing spondylitis, reactive arthrosis, infectious arthritis, post-infectious arthritis, gonococcal arthritis, Tuberculosis arthritis, viral arthritis, fungal arthritis, syphilis arthritis, Lyme disease, nodular polyarthritis, irritable vasculitis, lu Genomic granulomatosis, rheumatoid polymyalgia, articular cell arteritis, calcium crystalline arthritis, pseudogout, non-articular rheumatoid, bursitis, hay fever, epicondylitis, neuropathic joint disease (charco and joint), hemarthrosic , Henoch-Scholine purpura, hypertrophic osteoarthritis, multiple psychotic retinopathy, surcoilosis, hemochromatosis, sickle cell disease, hyperlipoproteinemia, hypomagglobulinemia, familial Mediterranean fever, Behart's disease, systemic Lupus erythematosus, recursive fever, psoriasis, multiple sclerosis, sepsis, septic shock, multiple organ dysfunction syndrome, acute respiratory distress syndrome, chronic obstructive pulmonary disease, rheumatoid arthritis, acute lung injury ( inflammation, characterized in that at least one selected from the group consisting of acute lung injury) and broncho-pulmonary dysplasia Pharmaceutical compositions for the prevention or treatment of sexual diseases.
A diagnostic composition for inflammatory diseases comprising an agent for measuring the mRNA or protein level of GID45 gamma (GADD45γ).
A kit for diagnosing inflammatory diseases, comprising an agent for measuring mRNA or protein levels of GID45 gamma (GADD45γ).
(a) treating the test substance with a GDY45 gamma (GADD45γ) protein expressing cell line;
(b) measuring the level of expression or activity of GMID45 gamma of the cell line; And
(c) screening the test material whose expression or activity of GMID45 gamma is reduced compared to the control group not treated with the test material; screening method for preventing or treating an inflammatory disease.
The method of claim 8, wherein in the step (b), the expression of GIDD45 gamma is immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemistry, RT-PCR, Western blot A method for screening a prophylactic or therapeutic agent for an inflammatory disease, which is measured by one or more methods selected from the group consisting of Western Blotting and Flow Cytometry (FACS).
9. The method of claim 8, wherein the activity of GIDD45 gamma in step (b) is measured by one or more methods selected from the group consisting of SDS-PAGE, immunofluorescence, enzyme immunoassay (ELISA), mass spectrometry and protein chips. A method for screening an agent for preventing or treating an inflammatory disease.

Images