KR101481779B1 - Composition for preventing or treating inflammatory diseases comprising inhibitor of GADD45 gamma as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for the prophylaxis or treatment of inflammatory diseases, which comprises Gilead 45 Gamma (GADD45?) Inhibitor as an active ingredient. The GADD45 gamma inhibitor according to the present invention has an excellent effect of suppressing inflammation by regulating the production of TNF-alpha (tumor necrosis factor-alpha) and interleukin-6 (IL-6) , And as a therapeutic agent for inflammatory diseases.

Description

[0001] The present invention relates to a composition for preventing or treating an inflammatory disease comprising an anti-inflammatory agent, a Gilead 45 Gamma Inhibitor as an active ingredient,

The present invention relates to a composition for the prophylaxis or treatment of inflammatory diseases, which comprises Gilead 45 Gamma (GADD45?) Inhibitor as an active ingredient.

The human GADD45 consists of three forms of GADD45?, GADD45? And GADD45?, Of which GADD45? Was first cloned by Fornace AJ Jr et al. (Fornace, AJ Jr 1998 Proc Natl Acad Sci USA 85: 8800-8804) The presence of GADD45β and GADD45γ was subsequently confirmed by Takekawa M et al. (Takekawa M et al. 1998 Cell. 25: 521-530). GADD45 is 55 to 58% identical in protein and is known to be present in the nucleus rather than the cytoplasm. GADD45 is induced by DNA-damaging stimuli, etc. and is inhibited by the cell cycle (Wang SW et al., 1998 Proc Natl Acad Sci USA. 96: 3706-3711), cell growth inhibition (Zhan Q et al. Mol Cell Biol 14: 2361-2371 ), Apoptosis (Zerbini LF et al., Proc Natl Acad Sci USA 101: 13618-13623). GADD45 has been extensively studied in relation to tumors, and inhibition of GADD45α and GADD45γ by NF-kB has been shown to promote cancer proliferation (Zerbini LF et al., Proc Natl Acad Sci USA 101: 13618-13623) It has been found that the decreased or inactivated expression of GADD45γ induces the proliferation of cancer cells (Ying J et al. 2005 Clin Cancer Res 11: 6442-6449). The present inventors also found that GADD45? Is involved in the progression of a new disease (Shin GT et al. 2008 Kidney Int 73: 1251-1265 and Yu S et al. 2009 American J Nephrol 30: 135-139). However, it is not known to date that GADD45 gamma can inhibit or increase the production of inflammatory substances.

The inflammatory response is stimulated by foreign substances such as damage, bacteria, fungi, and viruses, and a series of complex physiological responses such as enzyme activation by various inflammatory mediators and immune cells, inflammatory mediator secretion, body fluid infiltration, cell migration, It is accompanied by symptoms such as erythema, edema, fever, and pain. Inflammation reaction removes the external infectious agent and regenerates the damaged tissue to regenerate the organism's function. However, if the inflammation reaction occurs excessively or continuously such as the antigen is not removed or is caused by the internal substance, mucous membrane damage, tissue destruction occurs, Cancer, inflammatory skin disease, inflammatory bowel disease, and arthritis.

Blood mononuclear cells are the most important cells that produce TNF-α and IL-6, and when they penetrate into inflamed tissues, they become differentiated into macrophages and secrete inflammatory substances (McNaul KL et al., 1990 J Immunol 145: 4154-4166). Actually, a representative disease in which the tissue is destroyed by the inflammatory substance is rheumatoid arthritis (Saklatvala J et al., 1986 Nature 322: 547-549), psoriatic arthritis (Mease PJ et al. 2000 Lancet 356: 385- 390), ankylosing spondylitis (Brandt J et al. 2000 Arthritis Rheum 43: 1346-1352) and Crohn's Disease (Plevy SE et al. 1997 J Immunol 159: 6276-6282) . TNF-α levels in blood or joints are associated with the severity of the disease, especially in rheumatoid arthritis (Tetta C et al. 1990 Ann Rheum Dis 49: 665-667). At present, antibody injections to TNF-α and IL-6 are widely used in clinical trials to treat these chronic inflammatory diseases. TNF-α antibody injections include 5 kinds of Etanercept, Infliximab, Adalimumab, Certolizumab pegol and Golimumab. Tocilizumab is marketed and used as an antibody injectable to IL-6. However, these antibody injections do not inhibit the production of inflammatory substances because they act to neutralize already produced TNF-α or IL-6 in the blood and require repetitive injections (eg once a week) And has a considerable disadvantage.

Accordingly, the present inventors have solved the above-mentioned conventional problems, and while continuing the research for developing a new inflammation therapeutic agent, the inventors of the present invention found that GADD45 gamma inhibitor regulates the production of TNF-α and IL-6, And thus the present invention has been completed.

It is an object of the present invention to provide a pharmaceutical composition for the prophylaxis or treatment of an inflammatory disease comprising an inhibitor of Gd idi5 gamma expression or an activity inhibitor as an active ingredient.

It is still another object of the present invention to provide a composition for the diagnosis of inflammatory diseases, which comprises an agent for measuring mRNA or protein expression level of Grade II 45 gamma.

It is still another object of the present invention to provide a method for screening a prophylactic or therapeutic agent for an inflammatory disease, comprising the step of measuring the expression or activity level of GIIDIDY 45 GAMMA.

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating an inflammatory disease comprising an inhibitor of Gd idi5 gamma expression or an activity inhibitor as an active ingredient.

The present invention also provides a composition for the diagnosis of inflammatory diseases, comprising an agent for measuring mRNA or protein expression level of Grade II 45 gamma.

The present invention also provides a screening method for a prophylactic or therapeutic agent for inflammatory diseases, comprising the step of measuring the expression or activity level of GIIDIDY 45 GAMMA.

The Gileady-45 gamma inhibitor according to the present invention has an excellent effect of suppressing inflammation by regulating the production of TNF-alpha and interleukin-6 (IL-6) And the like.

FIG. 1 shows the results of comparing the degree of RNA production of GADD45γ according to the presence or absence of lentivirus in which shRNA of GADD45γ was inserted in THP-1 cells.
2 shows the results of confirming the production of TNF-? In THP-1 mononuclear cells in which the expression of GADD45? Is inhibited.
FIG. 3 shows the results of confirming the production of IL-6 in THP-1 mononuclear cells in which expression of GADD45γ was inhibited.
FIG. 4 is a graph showing the results of comparing the degree of RNA production of GADD45? According to the presence or absence of lentivirus into which GADD45? ORF was inserted.
FIG. 5 shows the results of confirming the production of TNF-.alpha. In THP-1 monocyte cells overexpressing GADD45.
FIG. 6 shows the results of confirming the production of IL-6 in THP-1 monocyte cells overexpressing GADD45γ.
FIG. 7 is a graph showing the expression level of GADD45? In tissues of patients with rheumatoid arthritis. FIG.
8 is a graph showing the expression of green fluorescent protein in peripheral blood mononuclear cells infected with lentivirus into which a green fluorescent protein gene is inserted.
FIG. 9 is a graph showing the results of comparing the degree of GADD45? Production with the presence or absence of lentivirus in which shRNA of GADD45? Is inserted in peripheral blood mononuclear cells.
FIG. 10 shows the results of confirming the production of TNF-.alpha. And IL-6 in peripheral blood mononuclear cells in which expression of GADD45 gamma was inhibited.
FIG. 11 shows the results of FACS analysis of the production of TNF-.alpha. In peripheral blood mononuclear cells in which expression of GADD45 gamma was inhibited.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for the prophylaxis or treatment of an inflammatory disease comprising an inhibitor of Gd idi5 gamma expression or an activity inhibitor as an active ingredient.

The protein of Gleidy 45 Gamma is preferably represented by the amino acid sequence shown in SEQ ID NO: 1, but is not limited thereto. The protein range of the GIIDIDY 45 gamma of the present invention includes a protein having the amino acid sequence represented by SEQ ID NO: 1 and a functional equivalent of the protein. Is at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 70%, more preferably at least 90%, more preferably at least 90% Refers to a protein having a homology of at least 95% and exhibiting a physiological activity substantially equivalent to that of the protein represented by SEQ ID NO: 1.

The protein of GIIDIDY 45 gamma of the present invention includes not only the protein having the native amino acid sequence but also the amino acid sequence variant thereof within the scope of the present invention. Variants of the Gileadid 45 gamma protein refer to a protein having a sequence that differs by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, with the Gileady 45 natural amino acid sequence and one or more amino acid residues. Amino acid exchanges in proteins and peptides that do not globally alter the activity of the molecule are known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). The most commonly occurring exchanges involve amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu and Asp / Gly. And may be modified by phosphorylation, sulfation, acetylation, glycosylation, methylation, farnesylation, and the like in some cases.

The Gleidy 45 gamma protein or variant thereof may be produced by natural recombinant methods, such as those derived from nature or synthesized (Merrifleld, J. Amer. Chem. Soc. 85: 2149-2156, 1963) or DNA sequences (Sambrook et al, Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, 2nd ed., 1989).

The expression inhibitor of GIDIDY45 gamma is composed of an antisense nucleotide complementary to the mRNA of the GIIDIDY 45 gamma gene, a short hairpin RNA, a small interfering RNA, and a ribozyme The activity inhibitor of GIIDID 45 gamma is preferably selected from the group consisting of compounds, peptides, peptide mimetics, substrate analogs, aptamers, and antibodies that complementarily bind GIIDIDY 45 gamma protein But it is not limited thereto.

The siRNA is composed of a sense sequence of 15 to 30 mers selected in the nucleotide sequence of the mRNA of the gene coding for the Grade ID 45 gamma protein and an antisense sequence complementarily binding to the sense sequence, The sense sequence is preferably composed of 25 bases, though not particularly limited thereto. The antisense nucleotide binds (hybridizes) to a complementary base sequence of DNA, immature-mRNA or mature mRNA, as defined in the Watson-click base pair, to interfere with the flow of genetic information as a protein in DNA. The nature of antisense nucleotides that are specific for the target sequence makes them exceptionally multifunctional. Because antisense nucleotides are long chains of monomeric units they can be readily synthesized against the target RNA sequence. Many recent studies have demonstrated the utility of antisense nucleotides as biochemical means to study target proteins (Rothenberg et al., J. Natl. Cancer Inst., 81: 1539-1544, 1999). The use of antisense nucleotides can be considered as a novel type of inhibitor since there has been much progress in the field of oligonucleotide chemistry and in the field of nucleotide synthesis showing improved cell adsorption, target binding affinity and nuclease resistance.

The peptide mimetics inhibit the binding domain of the Grade II 45 gamma protein and inhibit the activity of the Grade II 45 gamma protein. Peptide mimetics may be peptides or non-peptides and may include amino acids linked by non-peptide bonds, such as psi bonds (Benkirane, N., et al. J. Biol. Chem., 271: 33218-33224, Lt; / RTI > Also included within the scope of the invention are "conformationally constrained" peptides, cyclic mimetics, at least one exocyclic domain, a binding moiety (binding amino acid) and a cyclic mimetic moiety . Peptide mimetics are structurally similar to the secondary structural features of the Gileady 45 gamma protein and are expressed in antibodies (Park, BW et al. Nat Biotechnol 18, 194-198, 2000) or water soluble receptors (Takasaki, W. et al. Nat Biotechnol 15 , 1266-1270, 1997) and can be a novel small molecule that can act as an equivalent of a natural antagonist (Wrighton, NC et al. Nat Biotechnol 15, 1261-1265 , 1997).

The aptamer is a single-chain DNA or RNA molecule, and has a high affinity for a specific chemical molecule or biological molecule by an evolutionary method using an oligonucleotide library called SELEX (systematic evolution of ligands by exponential enrichment) (J. Tuerand L. Gold, Science 249, 505-510, 2005; AD Ellington and JW Szostak, Nature 346, 818-822, 1990; M. Famulok, et al. DS Wilson and Szostak, Annu Rev. Biochem., 68, 611-647, 1999). Aptamers can specifically bind to a target and modulate the activity of the target, for example, by blocking the ability of the target to function through binding.

The antibody specifically binds to and directly binds to GIDIDY45 GAMMA and can effectively inhibit the activity of GIDIDY45 GAMMA. Preferably, the antibody that specifically binds to the GIIDID 45 gamma is a polyclonal antibody or a monoclonal antibody. The antibody specifically binding to the GIIDID 45 Gamma may be produced by a known method known to those skilled in the art, and commercially available GIIDIDY 45 GAMMA antibodies may be purchased and used. The antibody may be prepared by injecting an immunogen, GIIDIDY 45 gamma protein, into an external host according to conventional methods known to those skilled in the art. External hosts include mammals such as mice, rats, sheep, and rabbits. The immunogen may be injected intramuscularly, intraperitoneally or by subcutaneous injection, and may generally be administered with an adjuvant to increase the antigenicity. Blood can be taken regularly from an external host, and the antibody can be isolated by collecting sera showing specificity for the expressed titer and antigen.

The inflammatory diseases of the present invention include, but are not limited to, inflammatory skin diseases, inflammatory bowel diseases such as Crohn's desease and ulcerative colitis, peritonitis, osteomyelitis, meningitis, meningitis, encephalitis, pancreatitis, trauma- , Allergic rhinitis, cystic fibrosis, stroke, acute bronchitis, acute bronchiolitis, chronic bronchitis, osteoarthritis, gout, spondyloarthropathies, ankylosing spondylitis, lager syndrome, psoriatic arthropathy, intestinal disease spondylitis, Arthritis associated with vasculitis syndrome, nodular polyarteritis nodosa, irritable bowel syndrome, rheumatoid arthritis, viral arthritis, fungal arthritis, fungal arthritis, Lyme disease, vasculitis syndrome, rheumatoid arthritis, rheumatoid arthritis, rheumatoid arthritis Vasculitis, ruggenic granulomatosis, rheumatoid polyposis muscular pain, arthritic cell arteritis, calcium Neurofibromatosis, osteoarthritis, psoriatic arthropathy, caustic gout, non-arthritic rheumatism, bursitis, hay fever, suppuritis (tennis elbow), charco and joint, hemarthrosic, Henoch-Schönlein purpura, hypertrophic osteoarthritis Hypercholesterolemia, hypogammaglobulinemia, familial mediterranean fever, Behrth's disease, systemic lupus erythematosus, recurrent fever, psoriasis, hyperlipidemia, psoriasis, hemorrhoids, sickle cell disease and other hemochromatosis, Acute respiratory distress syndrome, chronic obstructive pulmonary disease, rheumatoid arthritis, acute lung injury, and bronchopulmonary dysplasia. The present invention also relates to the use of a compound of formula Broncho-pulmonary dysplasia, and the like. In addition, the inflammatory skin diseases include, but are not limited to, skin inflammation, acute and chronic eczema, contact dermatitis, atopic dermatitis, seborrheic dermatitis, chronic simplex poisoning, biliary cirrhosis, deprivation dermatitis, And acne.

The composition of the present invention can be used in combination with a therapeutic agent for inflammatory diseases as well as an expression inhibitor or an activity inhibitor of GIIDIDY 45 gamma which is an active ingredient.

The composition of the present invention may be formulated into a suitable form together with a pharmaceutically acceptable carrier. &Quot; Pharmaceutically acceptable carrier " refers to a carrier that is physiologically acceptable and does not normally cause an allergic reaction such as gastrointestinal disorder, dizziness, or the like when administered to humans, or a similar reaction. Pharmaceutically acceptable carriers include, for example, carriers and water for oral administration such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like, suitable carriers for parenteral administration such as suitable oils, saline, aqueous glucose and glycols Etc., which may additionally contain stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Other pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995).

When the pharmaceutical composition of the present invention is orally administered, the pharmaceutical composition of the present invention may be formulated into a powder, a granule, a tablet, a pill, a sugar, a tablet, a capsule, a liquid, a gel , Syrups, suspensions, wafers, and the like. Examples of suitable carriers include saccharides including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, and maltitol; Corn starch, wheat starch, rice starch and potato starch; Cellulose such as cellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropylmethyl-cellulose and the like; Gelatin, polyvinylpyrrolidone, and the like. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may optionally be added as a disintegrant. Further, the pharmaceutical composition may further comprise an anti-coagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and an antiseptic agent. In addition, when administered parenterally, the pharmaceutical composition of the present invention can be formulated together with a suitable parenteral carrier according to methods known in the art in the form of injection, transdermal drug delivery, and nasal inhalation. In the case of such injections, they must be sterilized and protected against contamination of microorganisms such as bacteria and fungi. Examples of suitable carriers for injectables include, but are not limited to, solvents or dispersion media containing water, ethanol, polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycol, etc.), mixtures thereof and / or vegetable oils . More preferably, suitable carriers include, but are not limited to, Hank's solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose Etc. may be used. In order to protect the injection from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like may be further included. In addition, the injections may in most cases additionally include isotonic agents, such as sugars or sodium chloride. Examples of transdermal dosage forms include ointments, creams, lotions, gels, solutions for external use, pastes, liniments, and air lozenges. By " transdermal administration " as used herein, it is meant that the pharmaceutical composition is locally administered to the skin so that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin. These formulations are described in Remington's Pharmaceutical Science, 15th Edition, 1975, Mack Publishing Company, Easton, Pennsylvania, which is a commonly known formulary in pharmaceutical chemistry. In the case of an inhalation dosage form, the compounds used according to the invention can be formulated into a pressurized pack or a pressurized pack using a suitable propellant, for example dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gases. It can be conveniently delivered in the form of an aerosol spray from a nebulizer. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve that delivers a metered amount. For example, gelatin capsules and cartridges used in inhalers or insufflators may be formulated to contain the compound and a powder mixture of suitable powder base such as lactose or starch. Other pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995).

The nucleotide or nucleic acid used in the present invention can be produced for oral, topical, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal, and the like administration. Preferably, the nucleic acid or vector is used in an injectable form. And thus may be mixed with any pharmaceutically acceptable vehicle for injectable compositions for direct injection, particularly into the area to be treated. The pharmaceutical compositions of the present invention may comprise a freeze-dried composition which allows for the composition of an injectable solution, in particular by addition of an isotonic sterile solution or dry, in particular sterile water, or an appropriate physiological saline. As used herein, the term "pharmaceutically effective amount" refers to an amount that exhibits a further reaction than the negative control, preferably an amount sufficient to treat or prevent diabetes. The pharmaceutically effective amount of the composition of the present invention is about 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg, and is preferably administered once to several times a day. However, the dosage of the nucleic acid used in the present invention can be controlled by various parameters, in particular genes, vectors, the mode of administration used, the disease in question, or alternatively, the required duration of treatment. Also, the range varies depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of disease.

The present invention also provides a composition for the diagnosis of inflammatory diseases, which comprises an agent for measuring the mRNA or protein level of Grade 45 gama (GADD45 gamma).

As used herein, the term "diagnosis" means identifying the presence or characteristic of a pathological condition. For the purposes of the present invention, the diagnosis is to ascertain whether or not an inflammatory disease has occurred.

The present invention also provides a diagnostic kit for an inflammatory disease comprising an agent for measuring the level of mRNA or protein of GADD45 gamma (GADD45 gamma). The diagnostic kit for the inflammatory disease may further comprise one or more other component compositions, solutions or devices suitable for the assay method.

In addition,

(a) treating the test substance with a G11D45 gamma (GADD45?) protein expressing cell line;

(b) measuring the expression or activity level of Gleidy 45 Gamma of the cell line; And

(c) selecting a test substance whose expression or activity level of the GIIDIDY 45 gamma is lower than that of a control group in which the test substance is not treated, and a method for screening for a prophylactic or therapeutic agent for an inflammatory disease.

In this method, the degree of expression of the protein of step (b) can be determined by immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemistry, RT-PCR, Western blotting, And flow cytometry (FACS), but it is possible to use any method for measuring the amount of a transcript known to a person skilled in the art or a protein encoded therefrom.

In the above method, the degree of activity of the protein of step (b) is preferably measured by any one selected from the group consisting of SDS-PAGE, immunofluorescence, enzyme immunoassay (ELISA), mass spectrometry and protein chip, It is not limited.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited thereto.

Example  1. In monocytic cells GADD45 of γ RNA  Inhibition of Inflammatory Factor Generation by Production Suppression

The following experiment was conducted to confirm the effect of inhibition of GADD45γ on the production of inflammatory factors in monocyte cells. (GCACTGCATCCTCATTTCGAAC) and a short hairpin RNA (shRNA) having a ring sequence (TCGA), which are transcribed by the U6 promoter to inhibit the generation of GADD45γ RNA using RNA interference, Was inserted into the lentivirus. A puromycin resistance gene was inserted into the lentivirus, and lentivirus into which a green fluorescent protein gene was inserted was used as a control. In order to infect THP-1 cells, which are lentivirus produced by the above procedure, THP-1 cells and 10 times / cell of the cells were infected with RPMI medium supplemented with 10 ug / ml of polybrene (O'Doherty U et al. 2000 J Virol 74: 10074-10080), which was centrifuged at a rate of 1,340 g at 22 ° C for 3 hours. Then, 48 hours were further cultured and a stable cell line was obtained by culturing in a medium supplemented with 0.5 ug / ml of puromycin. The inhibition of GADD45? Expression and the production of inflammatory factors were confirmed in the stable cell line. The results are shown in FIG. 1 to FIG.

As shown in Fig. 1, it was confirmed that when lentivirus containing GADD45 gamma shRNA was treated, RNA production of GADD45 gamma was remarkably decreased.

2 and 3, the concentration of TNF-α and IL-6, which are inflammatory factors in LPS-stimulated mononuclear cells, was measured by enzyme-linked immunosorbent assay. As a result, the concentration of GADD45γ TNF-α production was reduced by about 75% and IL-6 production was reduced by about 60% in THP-1 monocyte (GADD45γ RNAi) cells inhibited in expression.

Example  In monocytic cells GADD45 of γ RNA  Overexpression to increase inflammatory factor production

In order to confirm the effect of GADD45γ overexpression on the production of inflammatory factors in monocytes, the following experiment was conducted. First, lentiviruses were prepared in which the ORF (open reading frame) of the nucleotide sequence 111-590 of GADD45γ mRNA (NM_006705) was transcribed by the CMV promoter. As a control group, lentivirus containing beta-galactosidase gene was used. In order to infect THP-1 cells, which are lentivirus produced by the above procedure, THP-1 cells and 10 times / cell of the cells were infected with RPMI medium supplemented with 10 ug / ml of polybrene (O'Doherty U et al. 2000 J Virol 74: 10074-10080), which was centrifuged at a rate of 1,340 g at 22 ° C for 3 hours. The cells were further cultured for 48 hours, and the cells were overexpressed and the level of inflammatory factors was determined. The results are shown in Fig. 4 to Fig.

As shown in Fig. 4, when lentivirus containing GADD45γ ORF was treated, it was confirmed that RNA production of GADD45γ was significantly increased.

5 and 6, the concentrations of TNF-α and IL-6, which are inflammatory factors, in the monocytes stimulated by LPS were measured by enzyme-linked immunosorbent assay. As a result, GADD45γ TNF-α production was increased about 6-fold and IL-6 production was increased more than 80-fold in overexpressed THP-1 monocytes compared to the control group.

Example  3. Human peripheral blood mononuclear cells GADD45 of γ RNA  Inhibition of Inflammatory Factor Generation by Production Suppression

3-1. In the tissues of inflammatory disease patients GADD45 γ expression pattern

In order to confirm the expression pattern of GADD45γ in inflammatory cells infiltrating into the tissues of inflammatory diseases, a tissue section of 4 μm paraffin synovial membrane of rheumatoid arthritis patients, which is a representative inflammatory disease, was treated with a primary antibody against GADD45γ and a secondary antibody The reaction was followed by color development with diaminobenzidine and H & E staining. The results are shown in Fig.

As shown in FIG. 7, it was confirmed that GADD45γ was strongly expressed in lymphocytes and mononuclear cells infiltrated into synovial membrane.

3-2. In human peripheral blood mononuclear cells GADD45 of γ RNA  Inhibition of Inflammatory Factor Generation by Production Suppression

The following experiments were carried out to confirm the effect of inhibition of GADD45γ on the production of inflammatory factors in human peripheral blood mononuclear cells (PBMC) composed of lymphocytes and monocytes. GADD45? Inhibition was performed by preparing lentivirus in which GADD45? ShRNA was inserted in the same manner as in Example 1 above. First, the blood was separated from venous blood of healthy volunteers, mixed with PBS 1: 1 in a heparin tube, and peripheral blood mononuclear cells were obtained by Ficoll-Paque and centrifugation. The lentivirus in which the RNA interference base sequence for GADD45γ was inserted was added to the cells in an amount corresponding to 40-50 times of the number of cells, followed by spinoculation using centrifugation at 1,340 g at 22 ° C for 3 hours And cultured. As a control, lentivirus containing a green fluorescent protein gene or a non-target sequence in which a target gene is not present was used. The cells were cultured for 72 hours. Lipopolysaccharide (LPS) at a concentration of 100 ng / ml was added to the medium to activate peripheral blood mononuclear cells for 24 hours. Cell culture medium was then cultured for TNF-α and IL- 6 was measured by enzyme immunoassay. The results are shown in Fig. 8 to Fig.

As shown in FIG. 8, the peripheral blood mononuclear cells infected with the lentivirus into which the green fluorescent protein gene was inserted were observed with a fluorescence microscope, and it was confirmed that the lentiviruses were well infected with the cells. In addition, as shown in Fig. 9, expression of GADD45γ was increased by LPS treatment in peripheral blood mononuclear cells, and GADD45γ expression was inhibited by RNA interference.

10, the production of TNF-a and IL-6 was significantly higher in the peripheral blood mononuclear cells (GADD45G RNAi, n = 4) in which the expression of GADD45γ was inhibited compared to the control (control, n = 4) Respectively.

In addition, LPS and BD GolgiStop (BD bioscience) were added to the medium and cultured for 4 hours. Then, the expression level of intracellular TNF-α was measured using FACS (Fluorescence Activated Cell Sorting). The results are shown in Fig.

As shown in Fig. 11, it was confirmed that the expression of TNF-a was significantly reduced by inhibition of GADD45? Expression compared to the control.

These results demonstrate that GADD45γ modulates the expression of TNF-α and IL-6, which are inflammatory factors, and thus inhibitors of GADD45γ can be used as agents for the treatment of inflammatory diseases mediated by TNF-α and IL-6 Respectively.

Hereinafter, formulation examples of a pharmaceutical composition containing the composition of the present invention will be described, but the present invention is not specifically limited thereto, but rather is specifically described.

Formulation example  One. Sanje  Produce

GIIDID 45 Gamma Inhibitor 20 mg

Lactose 100 mg

Talc 10 mg

The above components are mixed and filled in airtight bags to prepare powders.

Formulation example  2. Preparation of tablets

GIIDID 45 Gamma Inhibitor 10 mg

Corn starch 100 mg

Lactose 100 mg

Magnesium stearate 2 mg

After mixing the above components, tablets are prepared by tableting according to the usual preparation method of tablets.

Formulation example  3. Preparation of capsules

GIIDID 45 Gamma Inhibitor 10 mg

Crystalline cellulose 3 mg

Lactose 14.8 mg

Magnesium stearate 0.2 mg

The above components are mixed according to a conventional capsule preparation method and filled in gelatin capsules to prepare capsules.

Formulation example  4. Preparation of injections

GIIDID 45 Gamma Inhibitor 10 mg

180 mg mannitol

Sterile sterilized water for injection 2974 mg

Na ₂ HPO ₄ 2H ₂ O 26 mg

(2 ml) per 1 ampoule in accordance with the usual injection preparation method.

Formulation example  5. Liquid  Produce

GIIDID 45 Gamma Inhibitor 20 mg

10 g per isomer

5 g mannitol

Purified water quantity

<110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Composition for preventing or treating inflammatory diseases          comprising inhibitor of GADD45 gamma as an active ingredient <130> a <150> 11/124425 <151> 2011-11-25 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 159 <212> PRT <213> Homo sapiens <400> 1 Met Thr Leu Glu Glu Val Arg Gly Gln Asp Thr Val Pro Glu Ser Thr   1 5 10 15 Ala Arg Met Gln Gly Ala Gly Lys Ala Leu His Glu Leu Leu Leu Ser              20 25 30 Ala Gln Arg Gln Gly Cys Leu Thr Ala Gly Val Tyr Glu Ser Ala Lys          35 40 45 Val Leu Asn Val Asp Pro Asp Asn Val Thr Phe Cys Val Leu Ala Ala      50 55 60 Gly Glu Glu Asp Glu Gly Asp Ile Ala Leu Gln Ile His Phe Thr Leu  65 70 75 80 Ile Gln Ala Phe Cys Cys Glu Asn Asp Ile Asp Ile Val Arg Val Gly                  85 90 95 Asp Val Gln Arg Leu Ala Ala Ile Val Gly Ala Gly Glu Glu Ala Gly             100 105 110 Ala Pro Gly Asp Leu His Cys Ile Leu Ile Ser Asn Pro Asn Glu Asp         115 120 125 Ala Trp Lys Asp Pro Ala Leu Glu Lys Leu Ser Leu Phe Cys Glu Glu     130 135 140 Ser Arg Ser Val Asn Asp Trp Val Pro Ser Ile Thr Leu Pro Glu 145 150 155

Claims (10)

A pharmaceutical composition for preventing or treating rheumatoid arthritis comprising shRNA (short hairpin RNA) which is an inhibitor of GADD45 gamma (GADD45?) Expression as an active ingredient.
The pharmaceutical composition for preventing or treating rheumatoid arthritis according to claim 1, wherein the Gileady 45 gamma is represented by the amino acid sequence of SEQ ID NO: 1.
delete delete delete A diagnostic composition for the treatment of rheumatoid arthritis comprising an antibody of Gleidy 45 Gamma (GADD45 gamma).
A kit for the diagnosis of rheumatoid arthritis, comprising an antibody of Gleidy 45 Gamma (GADD45?).
(a) treating the test substance with a G11D45 gamma (GADD45?) protein expressing cell line;
(b) measuring the expression or activity level of Gleidy 45 Gamma of the cell line; And
(c) selecting the test substance whose expression or activity level of the GIIDID 45 gamma is decreased as compared with the control group not treated with the test substance.
9. The method according to claim 8, wherein the expression of Grade ID 45 gamma in step (b) is selected from the group consisting of immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemistry, RT- A method of screening for a prophylactic or therapeutic agent for rheumatoid arthritis, which method comprises measuring at least one method selected from the group consisting of Western blotting and flow cytometry (FACS).
9. The method according to claim 8, wherein the activity of GIIDID 45 gamma in step (b) is measured by at least one method selected from the group consisting of SDS-PAGE, immunofluorescence, enzyme immunoassay (ELISA) &Lt; / RTI &gt; or a pharmaceutically acceptable salt thereof, and a method for screening for a prophylactic or therapeutic agent for rheumatoid arthritis.

Images