KR20130055894A - Sialyltransferase of halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it - Google Patents
Sialyltransferase of halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it Download PDFInfo
- Publication number
- KR20130055894A KR20130055894A KR1020110121562A KR20110121562A KR20130055894A KR 20130055894 A KR20130055894 A KR 20130055894A KR 1020110121562 A KR1020110121562 A KR 1020110121562A KR 20110121562 A KR20110121562 A KR 20110121562A KR 20130055894 A KR20130055894 A KR 20130055894A
- Authority
- KR
- South Korea
- Prior art keywords
- sialic acid
- transferase
- derived
- acid transferase
- halocynthia
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1081—Glycosyltransferases (2.4) transferring other glycosyl groups (2.4.99)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/005—Glycopeptides, glycoproteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/99—Glycosyltransferases (2.4) transferring other glycosyl groups (2.4.99)
Abstract
Description
우렁쉥이(멍게)에서 유래한 시알산 전이효소를 코딩하는 유전자, 상기 유전자를 이종 숙주에서 발현시킨 활성형의 시알산 전이효소, 및 이를 이용하여 시알산을 올리고당, 당단백질, 당지질에 부가하여 시알화 복합당질를 합성하는 기술에 관한 것이다.
A gene encoding sialic acid transferase derived from R. japonicum, an active sialic acid transferase expressing the gene in a heterologous host, and sialic acid by adding sialic acid to oligosaccharides, glycoproteins, and glycolipids using the same It relates to a technique for synthesizing complex sugars.
세포막 표면에 존재하는 많은 종류의 당단백질(glycoprotein), 당지질(glycolipid) 및 프로테오글라이칸(proteoglycan)의 당쇄(glycan)는 박테리아 및 바이러스의 숙주세포로의 감염, 세균 독소의 접착, 세포의 암화 및 암전이, 면역세포와 신경세포의 분화 유도 등을 포함한 수정 및 발생, 분화 과정에서 세포간의 인식, 접착 등의 상호 작용에 의한 다세포 사회의 기간적인 생명현상에 깊이 관여하고 있는 것이 알려져 있다. 당지질, 프로테오글리칸 등에 존재하는 당쇄는 복합당질(glycoconjugates)로 총칭되고, 각각의 당쇄는 그들 당쇄를 합성하는 당전이효소(glycosyltransferase)와 분해하는 당쇄분해효소(glycosidase)에 의하여 구축 및 재설계되는데, 일반적으로 이러한 2개의 효소군을 코드하는 유전자를 당쇄유전자(glycogene)로 일컫는다. 당쇄 합성은 단백질 합성과는 달리 유전자의 직접적인 지배를 받지 않고 당쇄유전자에 코드되어 있는 당전이효소나 당쇄분해효소에 의한 조절적인 제어에 의해 2차적으로 구축되어진다. 당전이효소는 공여체인 당뉴클레오티드로부터 단당을 수용체에 전이하여 새로운 글리코시드 결합을 형성하는 일련의 효소를 총칭한다. 공여체의 경우, 당뉴클레오티드의 뉴클레오티드 부분에 의해 서로 다르게 존재하며, 글루코스(Glc), 갈락토스(Gal), N-아세틸글루코사민(GlcNAc), N-아세틸갈락토사민(GalNAc), 글루쿠론산, 자일로오스(xylose), 퓨코스(Fuc), 만노스(Man), 시알산(NeuAc, NeuGc) 등이 있다. 수용체로는 단당, 올리고당, 다당, 펩티드, 단백질, 당단백질, 지질, 당지질, 프로테오글리칸 등이 있다. 당쇄 합성은 당의 아노머 구조(α-, β-)와 글리코시드 결합 부위 및 형성되는 당쇄에 대해서 각각 특이적인 당전이효소에 의해 행해지므로, 생체내에는 약 200 내지 300 종의 서로 다른 당전이효소가 존재하고 있으며, 세포내에서 일어나는 복합당질 당쇄의 당전이 반응은 주로 골지체에서 일어난다(Hakomori and Kannagi (1983) J. Natl. Cancer Inst. 71: 231-251; Weisgerber et al. (1991) Glycobiology 1: 357-365).
Many types of glycoproteins, glycolipids, and proteoglycans on the surface of cell membranes are known as glycans for bacterial and viral host cells, bacterial toxin adhesion, and cell cancer. And cancer metastasis, fertilization and development, including induction of differentiation of immune cells and neurons, and deeply involved in the long-term life phenomena of multicellular society by interactions such as recognition and adhesion between cells during differentiation. Sugar chains present in glycolipids, proteoglycans, etc. are collectively referred to as glycoconjugates, and each sugar chain is constructed and redesigned by glycosyltransferases that synthesize their sugar chains and glycosidases that break down. The genes encoding these two groups of enzymes are referred to as glycogenes. Unlike protein synthesis, sugar chain synthesis is secondarily constructed by regulatory control by glycotransferases or glycolytic enzymes encoded in sugar chain genes without direct control of genes. Glycotransferase refers to a series of enzymes that transfer single sugars from the donor sugarnucleotide to the receptor to form new glycosidic bonds. In the case of donors, they are different from each other by the nucleotide portion of the sugar nucleotides, including glucose (Glc), galactose (Gal), N-acetylglucosamine (GlcNAc), N-acetylgalactosamine (GalNAc), glucuronic acid, xyllo Xylose, Fucose (Fuc), mannose (Man), sialic acid (NeuAc, NeuGc) and the like. Receptors include monosaccharides, oligosaccharides, polysaccharides, peptides, proteins, glycoproteins, lipids, glycolipids, proteoglycans, and the like. Since sugar chain synthesis is performed by sugar transferases specific for the anomer structure (α-, β-) and glycosidic binding sites of sugars and the sugar chains formed, about 200 to 300 different glycotransferases in vivo Glycosaccharide sugar chain reaction occurs in the Golgi apparatus (Hakomori and Kannagi (1983) J. Natl. Cancer Inst. 71: 231-251; Weisgerber et al. (1991) Glycobiology 1). 357-365).
당전이효소 중에서 가장 중요한 기능을 하고 있는 시알산 전이효소는 1982년 ST6Gal Ⅰ이 최초로 정제되었고, 이를 이용하여 1987년 expression library로부터 cDNA가 클로닝되었다. 그 후, 1992년 ST3Gal Ⅰ과 Ⅲ의 cDNA가 CDP-hexanolamine을 이용한 친화력 크로마토그래피에 의해 정제되어 얻어진 단백질의 부분적 아미노산 서열을 이용하여 클로닝되었다. 시알산 전이효소는, 시알산이 부가되는 시알산 수용체 당쇄 말단의 갈락토즈(Gal), 갈락토사민(GalNAc), 혹은 시알산(NeuAc) 등 당잔기의 종류와 여기에 시알산이 부가되는 α(2,3)-, α(2,6)-, α(2,8)-결합의 특성에 따라 20여 가지로 구분하며, 식물을 제외한 거의 모든 고등동물에서 시알산 전이효소가 발견된다고 알려져 있다(Paulson and Rademacher (2009) Nat. Struct. Mol. Biol. 16: 1121-1122).In 1982, ST6Gal Ⅰ was first purified and the cDNA was cloned from the expression library in 1987 using this enzyme. Then, in 1992, the cDNAs of ST3Gal I and III were cloned using the partial amino acid sequence of the protein obtained by purification by affinity chromatography using CDP-hexanolamine. The sialic acid transferase is a type of a sugar residue such as galactose (Gal), galactosamine (GalNAc) or sialic acid (NeuAc) at the end of the sialic acid receptor sugar chain to which sialic acid is added and α (2) to which sialic acid is added. According to the characteristics of, 3)-, α (2,6)-and α (2,8) -binding, it is classified into 20 kinds, and it is known that sialic acid transferase is found in almost all higher animals except plants ( Paulson and Rademacher (2009) Nat. Struct. Mol. Biol. 16: 1121-1122).
다양한 고등동물의 여러 조직으로부터 시알산 전이효소가 클로닝되어 기능이 해석되었으며(Harduin-Lepers et al., (2005) Glycobiology 15: 805-817), 원핵생물 유래의 유전자에 대해서도 연구가 진행 중이다. 최근에는 박테리아에서도 시알산 전이 효소가 보고되고 있으며, 해양성 광합성 세균인 Photobacterium 종으로부터 클로닝된 β-galactoside α-2,6-sialyltransferase, 병원성 세균인 Neisseia로부터 클로닝된 lipooligosaccharide α-2,3-sialyltransferase, 및 E. coli K1으로부터 클로닝된 polysialic acid synthase 유전자들의 진화적 측면, 구조, 및 기능 해석에 관한 연구가 진행되고 있다(Aoki et al., (1992) Proc. Natl, Acad. Sci. U.S.A. 89: 4319-4323; Burke et al., (1992) J. Biol. Chem. 267: 24433-24440; Breton et al., (1998) Glycobiology 8: 87-94; Weston et al., (1992) J. Biol. Chem. 267: 4152-4160).
Sialic acid transferase has been cloned from several tissues of various higher animals and its function has been interpreted (Harduin-Lepers et al., (2005) Glycobiology 15: 805-817). Recently, sialic acid transfer enzymes have been reported in bacteria, and β-galactoside α-2,6-sialyltransferase cloned from Photobacterium species, a marine photosynthetic bacterium, lipooligosaccharide α-2,3-sialyltransferase cloned from the pathogenic bacterium Neisseia , and Evolutionary studies of the evolutionary aspects, structure, and function of polysialic acid synthase genes cloned from E. coli K1 are underway (Aoki et al., (1992) Proc. Natl, Acad. Sci. USA 89: 4319-). 4323; Burke et al., (1992) J. Biol. Chem. 267: 24433-24440; Breton et al., (1998) Glycobiology 8: 87-94; Weston et al., (1992) J. Biol. Chem 267: 4152-4160).
시알산(sialic acid)은 당쇄 말단에 부가되는 음극성(negative charge)을 띄는 성분당으로 자연계에서 지금까지 약 50여종의 시알산 유도체들이 발견되었다. 시알산은 포유류에 있어서 세포간 상호작용, 세포 내의 시그널을 결정하는 매개체의 역할, 당단백질의 안정화 등 세포 내의 생물학적 현상에 중요한 역할을 한다. 특히, 생체 내의 시알산화 당쇄는 병원체 감염시 최초 인지되는 당쇄 중의 하나로 알려져 있으며(Sasisekharan and Myette (2003) Am. Sci. 91: 432-441; Vimr and Lichtensteiger (2002) Trends Microbiol. 10: 254-257), 세포표면에 존재하는 시알산은 병원 미생물 자체에서도 면역 회피 반응이나 세포 보호를 위한 캡슐 형태의 다당성 올리고당을 구성하는 성분으로 알려져 있다(Vimr et al., (2004) Microbiol. Mol. Biol. Rev. 68: 132-153). 병원성 미생물 중 자체적으로 시알산을 합성하는 경우 세포 내에서 시알산 대사회로를 통해 합성되거나, 세포 외부의 시알산을 세포표면에 존재하는 시알산 트랜스포터(transporter)를 통해 세포 내로 이동시킨 후 시알산 대사 경로를 통해 시알산을 합성한다고 알려져 있다(Vimr and Lichtensteiger (2002) Trends Microbiol. 10: 254-257).
About 50 kinds of sialic acid derivatives have been found in nature so far as sialic acid is a negative charge component added to the sugar chain terminal. Sialic acid plays an important role in biological phenomena in cells, such as intercellular interactions, the role of mediators in cells, and the stabilization of glycoproteins in mammals. In particular, sialic oxidized sugar chains in vivo are known as one of the first recognized sugar chains during pathogen infection (Sasisekharan and Myette (2003) Am. Sci. 91: 432-441; Vimr and Lichtensteiger (2002) Trends Microbiol. 10: 254-257 Sialic acid, which is present on the cell surface, is also known to form a polysaccharide oligosaccharide in the form of a capsule for immune evasion reactions or cellular protection even in pathogenic microorganisms (Vimr et al., (2004) Microbiol. Mol. Biol. Rev. 68: 132-153). When sialic acid is synthesized among pathogenic microorganisms, sialic acid is synthesized through sialic acid metabolic circuits in cells, or sialic acid after transporting sialic acid outside cells through sialic acid transporters on the surface of cells It is known to synthesize sialic acid via metabolic pathways (Vimr and Lichtensteiger (2002) Trends Microbiol. 10: 254-257).
시알산은 화학구조상으로 두 번째 탄소의 아노머릭(anomeric) 위치에 연결되어 있는 카복실 그룹, 세 번째 탄소의 디옥시 (deoxy), 그리고 여섯 번째 탄소에 분기되어 있는 글리세롤을 포함하고 있어 화학합성이 어렵고 수율이 매우 낮다고 알려져 있다. 또한 시알산이 부가된 당쇄의 경우 시알산의 복잡한 화학구조 이외에도 시알산 수용체 당쇄에도 작용기가 많아서 원하는 위치에 시알산을 부가하는 반응이 쉽지 않기 때문에, 시알산이 부가된 당쇄의 대다수는 천연물에서 추출하거나 시알산 전이효소인 시알릴트랜스퍼라아제(sialyltransferase) 반응과 화학합성법을 병행하는 화학-효소 합성으로 생산되고 있다. 화학-효소 합성은 시알산 수용체 당쇄와 시알산 공여체로 뉴클레오타이드-당(neucleotide-sugar)인 시스티딘-5-모노포스포-N-아세틸-베타-뉴라믹산(CMP-NeuAc)이 필요하다. 이때 사용되는 시알산 전이효소의 경우, 현재 쥐, 사람 등의 고등동물 유래의 효소만이 제한적으로 사용되고 있다. 하지만 최근 해양생물 유전체 연구가 활발히 진행됨에 따라, 해양무척추 동물에서 다양한 당쇄 합성 유전자가 발견되었으며, 특히 시알산 전이효소와 유사한 단백질을 코딩하는 유전자 염기서열이 다수 보고되었다(Harduin-Lepers et al., (2005) Glycobiology 15: 805-817). 진화적 측면에서 하위단계인 해양무척추동물 유래의 시알산 전이효소는 광범위한 기질 특이성을 갖고 있어 안정적인 효소원이 확보된다면 시알산 부가 당쇄 합성 및 시알산전이 반응을 개선하기 위한 소재로 활용될 수 있을 것이다. 아울러 해양무척추 동물 유래의 시알산 전이효소의 효과적인 시알산 전이 반응은 시알산 당쇄가 중요한 의료용 단백질과 같은 당단백질 제품의 시알산 부가 및 재설계를 가능하게 하여 향후 바이오시밀러 제품의 당쇄 제어 기술에 유용하게 활용될 것으로 판단된다.
Sialic acid contains a carboxyl group that is chemically linked to the anomeric position of the second carbon, deoxy of the third carbon, and glycerol branched to the sixth carbon, making chemical synthesis difficult and yielding. This is known to be very low. In addition, the sialic acid-added sugar chain has many functional groups in the sialic acid receptor sugar chain in addition to the complex chemical structure of sialic acid, so that the reaction of adding sialic acid at a desired position is not easy, so the majority of sialic acid-added sugar chains are extracted from natural products or sialic. It is produced by chemical-enzyme synthesis that combines the reaction of acid transferase sialyltransferase and chemical synthesis. Chem-enzyme synthesis requires sialic acid receptor sugar chains and sialic acid donors as the nucleotide-sugar cytidine-5-monophospho-N-acetyl-beta-neuraminic acid (CMP-NeuAc). In the case of sialic acid transferase used at this time, only enzymes derived from higher animals such as rats and humans are currently used. However, with the recent progress of marine biological genomes, various sugar chain synthesis genes have been found in marine invertebrates, and many gene sequences encoding proteins similar to sialic acid transferase have been reported (Harduin-Lepers et al., (2005) Glycobiology 15: 805-817. The sialic acid transferase derived from marine invertebrates, which is a lower stage in evolution, has a broad substrate specificity, and thus, if a stable enzyme source is secured, it can be used as a material for sialic acid addition sugar chain synthesis and sialic acid transfer reaction. . In addition, the effective sialic acid transfer reaction of sialic acid transferase derived from marine invertebrates enables sialic acid addition and redesign of glycoprotein products such as medical proteins in which sialic acid sugar chains are important, and will be used for future sugar chain control technology of biosimilar products. It is expected to be useful.
따라서, 본 발명의 우렁쉥이(멍게) 유래 시알산 전이효소를 이용한 비시알산 당단백질의 시알산 부가 반응을 통한 당단백질의 시알산화는 시알산이 중요한 의료용 당단백질의 효능과 안전성을 증진시키고 면역반응 등의 부작용을 줄여, 기존의 의약품의 개량 또는 새로운 적응증에의 적용으로 인한 기존 당단백질 제품의 개량 공정에 활용될 것으로 기대된다.
Therefore, sialic oxidation of glycoproteins through sialic acid addition reaction of bisialic acid glycoproteins using sialic acid-transferase of the present invention can enhance the efficacy and safety of medicinal glycoproteins for which sialic acid is important and enhance immune response. To reduce side effects, it is expected to be used in the improvement of existing glycoprotein products due to the improvement of existing drugs or their application to new indications.
본 발명의 목적은 우렁쉥이(멍게, Halocynthia rorentzi)에서 유래한 시알산 전이효소 활성을 갖는 서열번호 2의 아미노산 서열로 구성되는 폴리펩티드를 제공하는 것이다.It is an object of the present invention to provide a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 having sialic acid transferase activity from Halocynthia rorentzi .
또한, 본 발명의 또 다른 목적은 상기 우렁쉥이에서 유래한 시알산 전이효소를 암호화하는 서열번호 1의 폴리뉴클레오티드를 제공하는 것이다.In addition, another object of the present invention to provide a polynucleotide of SEQ ID NO: 1 encoding the sialic acid transferase derived from the above.
또한, 본 발명의 또 다른 목적은 상기 폴리뉴클레오티드를 포함하는 발현 벡터를 제공하는 것이다.In addition, another object of the present invention to provide an expression vector comprising the polynucleotide.
또한, 본 발명의 또 다른 목적은 발현 벡터로 형질전환된 형질전환체를 제공하는 것이다.Still another object of the present invention is to provide a transformant transformed with an expression vector.
또한, 본 발명의 또 다른 목적은 우렁쉥이에서 유래한 활성형 시알산 전이효소의 제조방법을 제공하는 것이다.In addition, another object of the present invention is to provide a method for preparing an active sialic acid transferase derived from larvae.
아울러, 본 발명의 또 다른 목적은 시알산이 부가된 시알화 복합당질의 생산 방법을 제공하는 것이다.
In addition, another object of the present invention is to provide a method for producing a sialated complex sugar to which sialic acid is added.
상기 목적을 달성하기 위하여, 본 발명은 우렁쉥이(멍게, Halocynthia rorentzi)에서 유래한 시알산 전이효소 활성을 갖는 서열번호 2의 아미노산 서열로 구성되는 폴리펩티드를 제공한다In order to achieve the above object, the present invention provides a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 having sialic acid transferase activity derived from Halocynthia rorentzi
또한, 본 발명은 상기 우렁쉥이에서 유래한 시알산 전이효소를 코딩하는 서열번호 1의 폴리뉴클레오티드를 제공한다.The present invention also provides a polynucleotide of SEQ ID NO: 1 encoding the sialic acid transferase derived from the above.
또한, 본 발명은 상기 폴리뉴클레오티드를 포함하는 발현 벡터를 제공한다.The present invention also provides an expression vector comprising the polynucleotide.
또한, 본 발명은 발현 벡터로 형질전환된 형질전환체를 제공한다.The present invention also provides a transformant transformed with the expression vector.
또한, 본 발명은 우렁쉥이에서 유래한 활성형 시알산 전이효소의 제조방법을 제공한다.In addition, the present invention provides a method for preparing an active sialic acid transferase derived from the larvae.
아울러, 본 발명은 시알산이 부가된 올리고당, 당지질, 당펩타이드 또는 당단백질을 생산하는 방법을 제공한다.
In addition, the present invention provides a method for producing oligosaccharide, glycolipid, glycopeptide or glycoprotein to which sialic acid is added.
본 발명의 우렁쉥이에서 유래한 시알산 전이효소는 효모 골지체에 선택적으로 타겟팅되고, 수용체에 대한 시알산 부가 활성이 뛰어나며, 이종숙주에서 시알산 전이효소의 생산이 가능하여, 광범위한 시알산 수용체에 시알산을 부가할 수 있으므로, 치료용 당단백질의 시알산화를 위한 효소자원으로서 유용하게 이용될 수 있다.
The sialic acid transferase derived from the larvae of the present invention is selectively targeted to yeast Golgi, excellent in sialic acid addition activity to the receptor, and capable of producing sialic acid transferase in heterologous hosts, thus making sialic acid to a wide range of sialic acid receptors. Since can be added, it can be usefully used as an enzymatic resource for the sialic oxidation of the therapeutic glycoprotein.
도 1은 우렁쉥이 유래 시알산 전이효소의 모식도이다;
(A): 아미노산 서열을 바탕으로 추정한 시알산 전이효소의 기능 및 구조 요소의 개략적인 모식도; 및
(B): 형광 단백질(GFP)과 융합 형태로 발현되는 시알산 전이효소가 효모 골지체 막에 발현됐을 때의 모식도.
도 2는 효모 골지체에서 형광 단백질(GFP)과 융합 형태의 시알산 전이효소가 발현된 양상을 공촛점현미경(confocal microscopy)을 이용하여 관찰한 사진이다;
eV: 음성 대조군으로 사용한 클로닝 벡터만 형질전환 된 효모;
hST3Gal: 양성대조군으로 사용한 형광 단백질(GFP)과 융합 형태의 인간 유래 시알산 전이효소 단백질의 발현; 및
HrorST: 형광단백질과 융합된 우렁쉥이 유래 시알산 전이효소 단백질의 발현.
도 3은 시알산 전이효소를 이용하여 모델 시알산 수용체 단백질인 비시알산화페투인(asialofetuin)에 대한 시알산 부가 정도를 렉틴 블롯을 통해 확인한 그림이다;
eV: 음성 대조군으로 사용한 클로닝 벡터만 들어있는 효모의 세포 조추출액 처리 시료;
hST3Gal: 양성대조군으로 사용한 인간 유래 시알산 전이효소를 발현하는 재조합 효모의 세포 조추출액 처리 시료;
HrorST: 우렁쉥이 유래 시알산 전이효소를 발현하는 재조합 효모의 세포 조추출액 처리 시료;
fetuin: 양성 대조군인 페투인;
asialofetuin: 음성대조군인 비시알산화페투인;
+, -; 시알산 절단효소(exo-α-sialidase)를 이용하여 해당 단백질로부터 시알산을 제거하기 전과 후의 시료;
위; Maackia amurensis(MAA) 렉틴을 이용한 렉틴 블롯; 및
아래: Sambucus nigra(SNA-I) 렉틴을 이용한 렉틴 블롯.
도 4는 형광단백질과 융합된 형태 시알산 전이효소를 발현하는 재조합 효모를 파쇄하여 해당 시알산 전이효소의 발현량을 형광단백질 검출 항체를 이용한 웨스턴 블롯을 이용하여 확인한 그림이다;
eV: 음성 대조군으로 사용한 클로닝 벡터만 들어있는 효모의 세포 조추출액;
hST3Gal: 양성대조군으로 사용한 형광단백질과 융합된 인간 유래 시알산 전이효소를 발현하는 재조합 효모의 세포 조추출액; 및
HrorST: 형광단백질과 융합된 우렁쉥이 유래 시알산 전이효소를 발현하는 재조합 효모의 세포 조추출액.Figure 1 is a schematic diagram of the sialic acid-transferase derived from Ruri Shungi;
(A): Schematic diagram of function and structural elements of sialic acid transferase estimated based on amino acid sequence; And
(B): Schematic diagram when sialic acid transferase expressed in fusion form with fluorescent protein (GFP) is expressed on the yeast Golgi membrane.
FIG. 2 is a photograph showing the expression of fluorescent protein (GFP) and sialic acid transferase in a fused form in the yeast Golgi apparatus using confocal microscopy;
eV: yeast transformed with only the cloning vector used as negative control;
hST3Gal: expression of human protein sialic acid transferase protein in fusion form with fluorescent protein (GFP) used as positive control; And
HrorST: expression of sialic acid-derived sialic acid transferase protein fused with fluorescent protein.
Figure 3 is a figure confirming the degree of sialic acid addition to the sialic acid receptor protein asialofetuin (sialofetuin) using sialic acid transferase through lectin blot;
eV: crude cell extract treated sample of yeast containing only cloning vector used as negative control;
hST3Gal: A sample of crude cell extract of recombinant yeast expressing sialic acid transferase derived from humans used as a positive control group;
HrorST: Sample of crude cell extract treatment of recombinant yeast expressing Rhubarb-derived sialic acid transferase;
fetuin: fetuin, a positive control;
asialofetuin: bisial oxidized fetuin, a negative control;
+,-; Samples before and after removing sialic acid from the protein using sialic acid cleavage enzyme (exo-α-sialidase);
top; Maackia lectin blot using amurensis (MAA) lectin; And
Below: Sambucus Lectin blot using nigra (SNA-I) lectin.
4 is a diagram showing the quantified expression of the sialic acid transferase fused with a fluorescent protein to confirm the expression level of the sialic acid transferase using Western blot using a fluorescent protein detection antibody;
eV: crude cell extract of yeast containing cloning vector used as negative control;
hST3Gal: cell crude extract of recombinant yeast expressing human-derived sialic acid transferase fused to a fluorescent protein used as a positive control; And
HrorST: A crude cell extract of recombinant yeast expressing leucine-derived sialic acid transferase fused with fluorescent protein.
이하, 본 발명을 상세히 설명한다.
Hereinafter, the present invention will be described in detail.
본 발명은 우렁쉥이(멍게, Halocynthia rorentzi)에서에서 유래한 시알산 전이효소 활성을 갖는 서열번호 2의 아미노산 서열로 구성되는 폴리펩티드를 제공한다.
The present invention is a sea squirrel (squill, Halocynthia) rorentzi ) provides a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 having sialic acid transferase activity derived from.
또한, 본 발명은 상기 우렁쉥이에서 유래한 시알산 전이효소를 암호화하는 서열번호 1의 폴리뉴클레오티드를 제공한다.
The present invention also provides a polynucleotide of SEQ ID NO: 1 encoding the sialic acid transferase derived from the above.
본 발명의 구체적인 실시예에서, 본 발명자들은 우렁쉥이 성체로부터 RNA를 추출하여 cDNA를 합성하였고, 이를 이용하여 우렁쉥이 시알산 전이효소를 코딩하는 cDNA를 확보하여 그 염기서열을 결정하였고(서열번호 1), 신규한 염기서열임을 확인하였다. 또한, 상기 염기서열을 이용하여 우렁쉥이 유래 시알산 전이효소의 아미노산 서열을 확인하였으며(서열번호 2), 이는 전형적인 진핵생물 시알산 전이효소(sialyltransferase)의 sialyl motif를 모두 포함하고 있는 것을 알 수 있었고, sialyl motif에서 발견되는 시스테인(cystein) 잔기를 포함하고 있어 단백질의 구조적인 특성을 갖게 하는 이황화 결합(disulfide bond)을 형성할 것으로 추정되었으며, 골지(golgi) 타겟팅(targeting) 신호(signal)를 포함하고 있어 골지막에 발현되면서 루멘(lumen)의 방향에 활성 도메인(catalytic domain)을 갖는 전형적인 type II transmembrane 단백질일 것으로 추정된다. 아울러, 골지 루멘으로 위치하는 촉매 도메인의 경우 다수의 N-당쇄부가 위치(N-linked glycosylation site)를 포함하고 있어 당단백질(glycoprotein) 형태로 세포에 발현될 것으로 판단된다(도 1A 및 1B).
In a specific embodiment of the present invention, the present inventors synthesized the cDNA by extracting RNA from the adult squirrel, and obtained the cDNA encoding the squirrel sialic acid transferase using this to determine the base sequence (SEQ ID NO: 1), It was confirmed that the novel base sequence. In addition, the nucleotide sequence was used to confirm the amino acid sequence of the sialic acid-derived sialic acid transferase (SEQ ID NO: 2), which was found to include all the sialyl motifs of typical eukaryotic sialic acid transferase (sialyltransferase). It contains cysteine residues found in sialyl motifs and is thought to form disulfide bonds that have the structural properties of the protein, including the Golgi targeting signal. It is thought to be a typical type II transmembrane protein that is expressed in the Golgi membrane and has an active domain in the direction of the lumen. In addition, in the case of the catalytic domain located in the Golgi lumen, a plurality of N-glycosylation sites include a position (N-linked glycosylation site), and thus, it is determined that the cells are expressed in the form of glycoprotein (glycoprotein) (FIGS. 1A and 1B).
또한, 본 발명은 폴리뉴클레오티드를 포함하는 발현 벡터를 제공한다.
The present invention also provides an expression vector comprising the polynucleotide.
또한, 본 발명은 상기 발현 벡터로 형질전환된 형질전환체를 제공한다.
The present invention also provides a transformant transformed with the expression vector.
또한, 본 발명은 In addition,
1) 상기 발현 벡터로 숙주세포를 형질전환시키는 단계; 1) transforming the host cell with the expression vector;
2) 단계 1)의 형질전환체를 배양하는 단계; 및2) culturing the transformant of step 1); And
3) 단계 2)의 배양물로부터 시알산 전이효소를 회수하는 단계를 포함하는 포함하는 우렁쉥이(멍게, Halocynthia rorentzi)에서 유래한 활성형 시알산 전이효소의 제조방법을 제공한다.3) It provides a method for preparing an active sialic acid transferase derived from the locust ( Halocynthia rorentzi ) comprising the step of recovering the sialic acid transferase from the culture of step 2).
상기 숙주세포는 박테리아, 효모, 곤충세포 또는 동물세포인 것을 특징으로 하는 것이 바람직하나 이에 한정되지 않는다.The host cell is preferably, but not limited to, bacteria, yeast, insect cells or animal cells.
상기 박테리아는 스타필로코코스 에우리우스(Staphylococcus aureus), 대장균(E. coli), 바실러스 세레우스(B. cereus), 살모넬라 타이피뮤림(Salmonella typimurium), 살모넬라 콜레라수이스(Salmonella choleraesuis), 여시니아 엔테로콜리티카(Yersinia enterocolitica) 및 리스테리아 모노사이토게네스(Listeria monocytogenes)로 이루어진 군으로부터 선택되는 것을 특징으로 하는 형질전환체로 이루어진 군으로부터 선택되는 어느 하나인 것이 바람직하나 이에 한정되지 않는다. The bacterium is Staphylococcus aureus (Staphylococcus aureus), Escherichia coliE. coli), Bacillus cereus (B. cereus), Salmonella typhimurim (Salmonella typimurium), Salmonella Cholera Suis (Salmonella choleraesuis), Yexinia Enterocholicica (Yersinia enterocolitica) And Listeria monocytogenes (Listeria monocytogenesIt is preferably any one selected from the group consisting of transformants, characterized in that it is selected from the group consisting of), but is not limited thereto.
상기 효모는 사카로마이세스(Saccharomyces), 클루베로마이세스(Kluyveromyces), 피키아(Pichia), 한세눌라(Hansenula) 또는 캔디다(Candida)속에 속하는 것을 특징으로 하는 형질전환체로 이루어진 군으로부터 선택되는 어느 하나인 것이 바람직하며, 사카로마이세스 세레비시아(Saccharomyces cerevisiae) FGY217 균주인 것이 더욱 바람직하나 이에 한정되지 않는다.
Wherein the yeast is one selected from the group consisting of as transformants, characterized in that belonging to the genus Saccharomyces as MY access (Saccharomyces), inclusive Vero My process (Kluyveromyces), Pichia (Pichia), Hanse Cronulla (Hansenula) or Candida (Candida) One is preferred, Saccharomyces cerevisiae ) FGY217 strain is more preferred, but is not limited thereto.
본 발명의 구체적인 실시예에서, 본 발명자들은 상기 우렁쉥이 유래 시알산 전이효소의 cDNA를 yEGFP가 태깅되어 있는 벡터에 삽입하여 활성형 시알산 전이효소 발현 벡터를 제작하여 이를 이종 숙주인 Saccharomyces cerevisiae FGY217(MATα, ura3-52, lys2Δ201, pep4Δ) 균주에 형질전환하여 그 발현 양상 및 발현량을 같은 방법으로 발현한 인간 유래 시알산 전이효소와 비교하였다. 그 결과, 인간 유래 시알산 전이효소에 비해 본 발명의 우렁쉥이 유래 시알산 전이효소가 효모의 골지체 막에 더욱 효과적으로 타겟팅되어 있음을 공촛점현미경(confocal microscopy)를 통해 확인하였으며(도 2 참조), 발현량을 웨스턴 블롯을 통해 대조군인 인간 유래 시알산 전이효소의 발현량과 비교한 결과 유사한 정도의 발현량을 보였다(도 4 참조). 이를 통해, 종래의 인간 유래 시알산 전이효소와 비슷한 정도로 발현함에 불구하고 월등한 표적성을 보임을 알 수 있었다.In a specific embodiment of the present invention, the present inventors inserted the cDNA of the sialic acid-derived sialic acid transferase into a vector tagged with yEGFP to prepare an active sialic acid transferase expression vector, which is then a heterologous host, Saccharomyces. The expression and expression levels of cerevisiae FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) were transformed and compared with those of human-derived sialic acid transferase. As a result, it was confirmed through confocal microscopy (confocal microscopy) that the target of the present invention is more effectively targeted to the Golgi membrane of yeast compared to human-derived sialic acid transferase (see FIG. 2). The amount was compared to the expression level of the human-derived sialic acid transferase as a control group by Western blot, and showed a similar expression level (see FIG. 4). Through this, it can be seen that even though the expression similar to the conventional human-derived sialic acid transferase shows an excellent target.
따라서, 본 발명의 우렁쉥이 유래 시알산 전이효소를 발현하는 상기 벡터 및 형질전환체는 기존의 시알산 전이효소보다 월등히 특이적인 시알산 전이효소를 효과적으로 발현할 수 있다.
Therefore, the vector and the transformant expressing the swelling-derived sialic acid transferase of the present invention can effectively express sialic acid transferase which is much more specific than the existing sialic acid transferase.
또한, 본 발명은 In addition,
1) 상기 우렁쉥이에서 유래한 시알산 전이효소, 시알화 수용체 및 시알산 공여체를 혼합하는 단계; 및1) mixing the sialic acid transferase, sialation receptor and sialic acid donor derived from the larvae; And
2) 단계 1)의 혼합물을 반응시켜 수용체에 시알산을 부가하는 단계를 포함하는 시알산이 부가된 시알화 수용체의 생산 방법을 제공한다.2) provides a method for producing a sialic acid-added sialated receptor, which comprises adding sialic acid to the receptor by reacting the mixture of step 1).
상기 시알화 수용체는 단당, 올리고당, 다당, 펩티드, 단백질, 당단백질, 지질, 당지질, 프로테오글리칸으로 이루어진 군으로부터 선택되는 어느 하나인 것이 바람직하나 이에 한정되지 않는다.The sialated receptor is preferably any one selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, peptides, proteins, glycoproteins, lipids, glycolipids, and proteoglycans, but is not limited thereto.
상기 시알화 공여체는 CMP-시알산(sialic acid) 및 CMP-시알산 유도체로 이루어진 군으로부터 선택되는 어느 하나인 것이 바람직하나 이에 한정되지 않는다.
The sialic donor is preferably any one selected from the group consisting of CMP-sialic acid and CMP-sialic acid derivatives, but is not limited thereto.
본 발명의 구체적인 실시예에서, 본 발명자들은 우렁쉥이 유래 시알산 전이효소의 시알산 전이 활성을 비시알산화페투인(asialofetuin)을 기질로 이용하여 시알화 반응을 in vitro로 수행하여 시알화된 단백질을 렉틴 블롯 분석으로 확인한 결과, Neu5Ac α(2,3) Gal β(1,4) GlcNAc의 α2,3-linkage를 인식하는 Maackia amurensis(MAA) 렉틴 및 Neu5Ac α(2,6) Gal 과 Neu5Ac α(2,6) GalNAc을 인지하는 Sambucus nigra(SNA-I) 랙틴 블롯이 모두 확인되었으며(도 3), 유리당쇄(free glycan)를 기질로 이용하여 시알화 반응을 in vitro로 수행하여 시알산 전이효소에 의한 시알화된 산물을 시알산이 당 수용체에 전달된 후 유리되는 Cyclic monophosphate(CMP)에 대한 phosphatase의 효소 반응을 이용하여 확인한 결과, 시알산 전이효소의 비시알산화 유리당쇄(asialo free glycan)에 대한 활성을 확인할 수 있었다(표 1 참조).
In a specific embodiment of the present invention, the inventors of the sialic acid transfer reaction using the sialic acid transfer activity of the sialic acid-transferase sialic acid transferase asia substrate asasialofetuin in vitro confirm the protein to sialic screen performed with a lectin blot analysis, Neu5Ac α (2,3) Gal β (1,4) Maackia recognizing α2,3-linkage of GlcNAc Sammurcus nigra (SNA-I) lactin blots that recognize amurensis (MAA) lectins and Neu5Ac α (2,6) Gal and Neu5Ac α (2,6) GalNAc were identified (FIG. 3), free glycan Sialization reaction was carried out in vitro using as a substrate to determine the sialated product by sialic acid transferase using phosphatase enzyme reaction against Cyclic monophosphate (CMP), which is released after sialic acid is delivered to the sugar receptor. As a result, the activity of the sialic acid transferase on the bisial oxidized free sugar chain (asialo free glycan) was confirmed (see Table 1).
이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.
단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 한정되는 것은 아니다.
However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the present invention is not limited to the following Examples and Experimental Examples.
<< 실시예Example 1> 1> 우렁쉥이(멍게, Ascidian (urchin, Halocynthia rorentziHalocynthia rorentzi )에서)in 유래한 시알산 전이효소의 염기서열 결정 Nucleotide Sequence Determination of Derived Sialic Acid Transferase
본 발명자들은 우렁쉥이(멍게, Halocynthia rorentzi) 유래 시알산 전이효소의 유전자를 클로닝 하였다.The inventors have found that the locust ( Halocynthia) rorentzi ) gene of sialic acid transferase was cloned.
구체적으로, 구체적으로, 우렁쉥이 성체로부터 추출한 RNA로부터 합성한 cDNA 라이브러리에서 시알산 전이효소를 코딩하는 유전자를 클로닝하기 위하여, NCBI (National Center for Biotechnology Information)에 등록된 시알산 전이효소 유전자의 DNA 염기서열과 아미노산 서열상에서의 highly conserved motif를 토대로 degenerated DNA probe를 합성하였다. 합성된 상기 DNA probe를 이용하여, 우렁쉥이(멍게, Halocynthia roretzi)의 highly conserved motif(L-motif 로부터 VS-motif) 단편을 95 ℃에서 3분 전변성, 94 ℃에서 30초 변성, 54 ℃에서 45초 풀림(annealing) 및 72 ℃에서 0.5 분 연장의 30 사이클의 PCR 조건으로 증폭하였고, 이를 토대로 RACE(rapid amplification of cDNA ends)를 통해 전장 시알산 전이효소 유전자를 확보하여 pSPORT1 벡터에 클로닝하였다. 상기 벡터에 클로닝된 시알산 전이효소를 코딩하는 cDNA를 T7 프로모터 프라이머 및 SP6 프라이머를 사용하여 우렁쉥이 유래 시알산 전이효소의 염기서열을 결정하였으며(서열번호 1), NCBI의 BLAST를 통해 신규한 서열임을 확인하였다.
Specifically, specifically, in order to clone a gene encoding sialic acid transferase from a cDNA library synthesized from RNA extracted from an adult adult, DNA sequence of a sialic acid transferase gene registered in the National Center for Biotechnology Information (NCBI). Degenerated DNA probes were synthesized based on highly conserved motifs on amino acids and amino acid sequences. Using the synthesized DNA probe, fragments of highly conserved motifs (L-motif from VS-motif) of Halocynthia roretzi were denatured at 95 ° C for 3 minutes, denatured at 94 ° C for 30 seconds, and at 54 ° C for 45 minutes. It was amplified by 30 cycles of PCR conditions of 0.5 annealing and 0.5 minute extension at 72 ° C. Based on this, the full-length sialic acid transferase gene was obtained and cloned into the pSPORT1 vector through rapid amplification of cDNA ends. The cDNA encoding the sialic acid transferase cloned into the vector was determined using the T7 promoter primer and the SP6 primer to determine the base sequence of the sialic acid-transferase derived from the wild snail (SEQ ID NO: 1). Confirmed.
<< 실시예Example 2> 우렁쉥이(멍게, 2> sea squirt HalocynthiaHalocynthia rorentzirorentzi ) 유래 시알산 전이효소의 아미노산Amino acid of sialic acid transferase 서열 분석Sequencing
본 발명자들은 발명자들은 우렁쉥이(멍게, Halocynthia rorentzi) 유래 시알산 전이효소의 아미노산 서열을 상기 우렁쉥이 유래 시알산 전이효소의 염기서열을 통해 분석하였다.The inventors found that the inventors have locusts The amino acid sequence of sialic acid transferase derived from rorentzi ) was analyzed through the nucleotide sequence of the sialic acid transferase derived from the larvae .
구체적으로, 상기 <실시예 1>에서 결정한 우렁쉥이 유래 시알산 전이효소 염기서열을 바탕으로 Dnasis 3.1 또는 이와 동종의 바이오인포매틱스 프로그램을 사용하여 아미노산 서열분석을 하였다.Specifically, amino acid sequencing was performed using Dnasis 3.1 or the same bioinformatics program based on the nucleotide sequence of the sialic acid-derived sialic acid transfer enzyme determined in <Example 1>.
그 결과, 우렁쉥이 유래 시알산 전이효소의 아미노산 서열을 확인하였으며(서열번호 2), 이는 전형적인 진핵생물 시알산 전이효소(sialyltransferase)의 시알릴 모티브(sialyl motif)를 모두 포함하고 있는 것을 확인하였고, 시알릴 모티브에서 발견되는 시스테인(cystein) 잔기를 포함하고 있음을 확인하였다(도 1A 및 1B).
As a result, it was confirmed that the amino acid sequence of the sialic acid transferase derived from the larvae (SEQ ID NO: 2), which contained all the sialyl motif of the typical eukaryotic sialic acid transferase (sialyltransferase) It was confirmed that it contained cysteine residues found in the reel motif (FIGS. 1A and 1B).
<< 실시예Example 3> 우렁쉥이(멍게, 3> squirm HalocynthiaHalocynthia rorentzirorentzi ) 유래 시알산 전이효소의 발현 벡터의 제작 Construction of Expression Vectors of Derived Sialic Acid Transferase
본 발명자들은 우렁쉥이 유래 시알산 전이효소를 이종 숙주인 효모에서 발현시키기 위하여 발현 벡터를 제작하여 효모에 형질전환하였다.The present inventors transformed the yeast by constructing an expression vector to express the unglong sialic acid-transferase in yeast which is a heterologous host.
구체적으로, 상기 <실시예 1>의 우렁쉥이 유래 시알산 전이효소의 cDNA를 포함하고 있는 pSPORT1 벡터를 주형으로 하여 Hzi2_Forward 프라이머 5'-ACCCCGGATTCTAGAACTAGTGGATCCCCCATGATAAGACCCATTTACCAGCGT-3'(서열번호 3) 및 Hzi2_Reverse 프라이머 5'-TTTAACTGGAACTTTTATATTTAAAAGGGGAGGAGAATGGAACTCAACATTACC-3'(서열번호 4)를 사용하여, 95 ℃에서 3분 전변성, 94 ℃에서 30초 변성, 60 ℃에서 45초 풀림(annealing) 및 72 ℃에서 3분 연장의 40 사이클의 PCR 조건으로 우렁쉥이 유래 시알산 전이효소의 유전자를 증폭하였다. 이때, 양성 대조군을 위하여 인간 유래 시알산 전이효소 (hST3Gal, GenBank accession number: AAM66433)를 코딩하는 클론 hMU003315를 주형으로 하여 hST3Gal_Forward 프라이머 5'-ACCCCGGATTCTAGAACTAGTGGATCCCCCATGGTtAGtAAGTCCCGCTGGAAG-3'(서열번호 5) 및 hST3Gal_Reverse 프라이머 5'- TTAACTGGAACTTTTATATTTAAAAGGGGGAAGGACGTGAGGTTCTTGATAGC-3'(서열번호 6)를 사용하여, 95 ℃에서 3분 전변성, 94 ℃에서 30초 변성, 60 ℃에서 45초 풀림(annealing) 및 72 ℃에서 3분 연장의 40 사이클의 PCR 조건으로 PCR를 수행하였다. 그 후, 증폭된 각각의 DNA를 추출한 후 제한효소인 SpeI/BamHI으로 미리 잘라 둔 yEGFP가 태깅되어 있는 pRS424GAL-yEGFP(URA+) 벡터와 PCR로 증폭된 각각의 유전자를 연결(ligation)하여 대장균(Escherichia coli) DH5α 균주에 형질전환(transformation)하였다. 대장균에서 얻어진 재조합 플라스미드 중 시알산 전이효소 코딩 유전자를 벡터 상의 정확한 클로닝 위치에 포함하고 있는 클론을 제한효소 처리와 DNA 시퀀싱을 통해 확인 및 선별하였다. 또한, 사카로마이세스 세레비시아(Saccharomyces cerevisiae) FGY217(MATα, ura3-52, lys2Δ201, pep4Δ) 균주(strain)에 리튬 아세테이트(lithium acetate) 방법으로 형질전환하여 생긴 콜로니를 분석하였다.Specifically, Hzi2_Forward primer 5'-ACCCCGGATTCTAGAACTAGTGGATCCCCCATGATAAGACCCATTTACCAGCGT-3 '(SEQ ID NO: 3) and Hzi2_Reverse primer 5ATT-GATCTAACTGTAACTAGG Using 3 ′ (SEQ ID NO: 4), 40 cycles of PCR were performed at 40 ° C. with 3 min total denaturation at 95 ° C., 30 sec denaturation at 94 ° C., 45 sec annealing at 60 ° C., and 3 min extension at 72 ° C. The gene of the derived sialic acid transferase was amplified. At this time, hST3Gal_Forward primer 5'-ACCCCGGATTCTAGAACTAGTGGATCCCCCATGGTtAGtAAGTCCCGCTGGAAG-3 'and (SEQ ID NO: 5') of the positive control group were cloned with the clone hMU003315 encoding human-derived sialic acid transferase (hST3Gal, GenBank accession number: AAM66433). 40 cycles of PCR conditions using TTAACTGGAACTTTTATATTTAAAAGGGGGAAGGACGTGAGGTTCTTGATAGC-3 '(SEQ ID NO: 6), 3 minutes full denaturation at 95 ° C, 30 seconds denaturation at 94 ° C, 45 seconds annealing at 60 ° C, and 3 minutes extension at 72 ° C. PCR was performed. Then, each of the amplified DNA was extracted, and then the pRS424GAL-yEGFP (URA + ) vector tagged with yEGFP tagged with the restriction enzyme SpeI / BamHI was tagged with each gene amplified by PCR. Esherichia coli ) was transformed into DH5α strain. Clones containing the sialic acid transferase coding gene in the correct cloning position on the vector of the recombinant plasmid obtained from E. coli were identified and selected through restriction enzyme treatment and DNA sequencing. In addition, Saccharomyces cerevisiae ) FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) strains were analyzed by colonies resulting from the transformation of the lithium acetate (lithium acetate) method.
그 결과, 시알산 전이효소 발현 시 yEGFP 태깅되어 있어 발현된 단백질의 발현양을 세포 전체(whole cell), 조추출액(crude extract) 및 in situ SDS-PAGE에서 목적 단백질의 존재여부 및 정량적 양이 바로 확인 가능한 우렁쉥이(멍게, Halocynthia rorentzi) 유래 시알산 전이효소가 코딩된 벡터를 제작하였다.
As a result, yEGFP was tagged when sialic acid transferase was expressed, and the amount of the expressed protein was expressed in whole cell, crude extract and in situ SDS-PAGE. Identifiable Shrimp (Schlark, Halocynthia) rorentzi ) -derived sialic acid transferase Vectors were produced.
<< 실험예Experimental Example 1> 우렁쉥이(멍게, 1> squirm HalocynthiaHalocynthia rorentzirorentzi ) 유래 시알산 전이효소의 이종Heterogeneity of sialic acid transferase 숙주인 Host 효모에서의In yeast 타겟팅Targeting 및 발현 확인 And expression confirmation
<1-1> 우렁쉥이(멍게, <1-1> Shrimp HalocynthiaHalocynthia rorentzirorentzi ) 유래 시알산 전이효소의 이종Heterogeneity of sialic acid transferase 숙주인 Host 효모에서의In yeast 타겟팅Targeting 확인 Confirm
본 발명자들은 우렁쉥이 유래 시알산 전이효소가 효모에서 발현되는 양상을 확인하고자 공촛점현미경(confocal microscopy)로 관찰하였다.The present inventors observed by confocal microscopy (confocal microscopy) to confirm the expression of the sialic acid-transferase-derived sialic acid transferase in yeast.
구체적으로, 상기 <실시예 3>의 pRS424GAL 유래 재조합 벡터를 사카로마이세스 세레비시아 FGY217(MATα, ura3-52, lys2Δ201, pep4Δ) 균주(strain)에 리튬 아세테이트(lithium acetate) 방법으로 형질전환시켰다. 그 후, 영양요구주(auxotroph) 마커(marker)를 갖는 pRS424GAL 유래 상기 <실시예 3>의 재조합 벡터를 포함하고 있는 상기 사카로마이세스 세레비시아 FGY217균주를 dropout 배지인 SC-Leu 배지에서 배양하였다. 상기 형질전환된 균주의 싱글 콜로니를 2% 글루코스가 포함된 SC-URA 배지에서 24 내지 48시간 동안 배양한 후, 상기 배양물의 1/100을 0.1% 글루코스가 포함 SC-URA 배지에서 OD600 값이 0.6 내지 0.8 이 되도록 배양하였다. 그 후, 20% D-갈락토스를 최종농도가 2%가 되도록 첨가하여 30 ℃에서 배양하면서 세포 내에서의 단위 시간별 단백질의 위치화(localization)를 공촛점현미경(confocal microscopy)를 이용하여 시알산 전이효소에 태깅되어 있는 GFP를 관찰하였다. Specifically, the pRS424GAL-derived recombinant vector of <Example 3> was transformed into a strain of Saccharomyces cerevisiae FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) using a lithium acetate method. . Then, the Saccharomyces cerevisiae containing the recombinant vector of <Example 3> derived from pRS424GAL having an auxotroph marker. FGY217 strain was cultured in SC-Leu medium, a dropout medium. After culturing a single colony of the transformed strain in SC-URA medium containing 2% glucose for 24 to 48 hours, 1/100 of the cultures had an OD600 value of 0.6 in SC-URA medium containing 0.1% glucose. Incubated to 0.8. Subsequently, 20% D-galactose was added at a final concentration of 2%, followed by sialic acid transfer using confocal microscopy for localization of the protein per cell in the cell at 30 ° C. GFP tagged to the enzyme was observed.
그 결과, 시알산 전이효소가 골지 기구(Golgi apparatus)에서 관찰되는 전형적인 형태인 점(spot) 모양으로 존재함을 공촛점현미경(confocal microscopy)을 통해 확인되었으며, 대조군인 인간 유래 시알산 전이효소에 비해, 우렁쉥이 유래 시알산 전이효소가 효모 세포의 골지체 막에 더욱 효과적으로 타겟팅되어 점(dot) 모양으로 위치함을 확인하였다(도 2).
As a result, it was confirmed by confocal microscopy that sialic acid transferase was present in a spot shape which is a typical form observed in the Golgi apparatus. In comparison, the sialic acid-derived sialic acid transferase was more effectively targeted to the Golgi apparatus membrane of the yeast cells to confirm that the dot (dot) is located (Fig. 2).
<1-2> 우렁쉥이(멍게, <1-2> locust HalocynthiaHalocynthia rorentzirorentzi ) 유래 시알산 전이효소의 이종Heterogeneity of sialic acid transferase 숙주인 Host 효모에서의In yeast 발현 확인Confirmation of expression
본 발명자들은 우렁쉥이 유래 시알산 전이효소의 효모에서의 발현량을 확인하고자 웨스턴 블롯으로 관찰하였다.The present inventors observed by Western blot to confirm the expression level in the yeast of woolyong-derived sialic acid transferase.
구체적으로, 상기 <실시예 3>의 pRS424GAL 유래 재조합 벡터를 사카로마이세스 세레비시아 FGY217(MATα, ura3-52, lys2Δ201, pep4Δ) 균주(strain)에 리튬 아세테이트(lithium acetate) 방법으로 형질전환시켰다. 그 후, 영양요구주 마커를 갖는 상기 재조합 벡터를 포함하고 있는 사카로마이세스 세레비시아 FGY217균주를 dropout 배지인 SC-Leu 배지에서 배양하였다. 싱글 콜로니를 2% 글루코스가 포함된 SC-URA 배지에서 24 내지 48시간 동안 배양한 후, 상기 배양물의 1/100을 0.1% 글루코스가 포함된 SC-URA 배지에서 OD600 값이 0.6 내지 0.8 이 되도록 배양하였다. 그 후, 20% D-갈락토스를 최종농도가 2%가 되도록 첨가하여 30 ℃에서 배양하면서 세포 내에서의 단위 시간별 GFP가 태깅된 시알산 전이효소의 발현량조추출액에서 확인하였다. 조추출액은 세포 회수 후, 세포를 bead beater를 이용하여 파쇄하고 원심분리기로 6,000 rpm에서 미파쇄된 세포를 제거한 후 상등액을 취하여 제조하였으며, 이 조추출액에서 발현된 단백질을 웨스턴 블롯을 이용하여 확인하였다. Specifically, the pRS424GAL-derived recombinant vector of <Example 3> was transformed into a strain of Saccharomyces cerevisiae FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) using a lithium acetate method. . Thereafter, Saccharomyces cerevisiae comprising said recombinant vector with nutritional markers. FGY217 strain was cultured in SC-Leu medium, a dropout medium. Single colonies were incubated for 24 to 48 hours in SC-URA medium containing 2% glucose, and then 1/100 of the cultures were cultured so as to have an OD600 value of 0.6 to 0.8 in SC-URA medium containing 0.1% glucose. It was. Thereafter, 20% D-galactose was added to a final concentration of 2%, and cultured at 30 ° C., and the GFP-tagged sialic acid-transferase expression-expression crude extract was cultured at 30 ° C. in cells. The crude extract was prepared by crushing the cells using a bead beater after cell recovery and removing superimmune cells at 6,000 rpm using a centrifuge, and then extracting the supernatant. The protein expressed in the crude extract was confirmed by Western blot. .
그 결과, 대조군인 인간 유래 시알산 전이효소와 본 발명의 우렁쉥이 유래 시알산 전이효소의 발현량이 유사한 정도로 확인되었다(도 4).
As a result, it was confirmed that the expression level of the human-derived sialic acid transferase as a control and the sialic acid-derived sialic acid-derived enzyme of the present invention are similar (FIG. 4).
<< 실험예Experimental Example 2> 우렁쉥이(멍게, 2> sea squirt HalocynthiaHalocynthia rorentzirorentzi ) 유래 시알산 전이효소의 활성 확인) Identification of Sialic Acid Transferase Activity
<2-1> <2-1> 비시알산화페투인Bisial Oxetate (( AsialofetuinAsialofetuin )을 이용한) 시알산 전이효소의 시알산 전이 활성 확인Confirmation of sialic acid transfer activity of sialic acid transferase
본 발명자들은 우렁쉥이 유래 시알산 전이효소의 활성 확인을 위해 비시알산화페투인(asialofetuin)을 기질로 이용하여 in vitro 시알화 반응(sialylation reaction)을 수행한 후, 시알화된 단백질을 렉틴 블롯 분석으로 확인하였다.The inventors of the present invention using bisialfetuin (asialofetuin) as a substrate to confirm the activity of sialic acid-derived sialic acid transferase in vitro After carrying out a siallation reaction, the sialated protein was confirmed by lectin blot analysis.
구체적으로, in vitro 시알화 반응을 수행하기 위해, 앞서 단백질 발현에서 확인된 조추출액을 이용하여 시알화 수용체 비시알산화페투인 1 mg/mL, 시알산 공여체 CMP-시알산 0.5 mg/mL, 10 mM MnCl2 및 1% Triton X-100, 0.02 Unit TEV(Tobacco Etch Virus) 프로테아제를 PBS(phosphate buffered saline)와 혼합하여 25 ℃에서 1 내지 12 시간 동안 반응시켰다. 그 후, 효소 반응물의 시알화를 렉틴 블롯 분석을 통해 확인하기 위하여, 상기 시알화 효소 반응물을 5×램리 버퍼(Laemmli buffer)와 혼합하여 10분 동안 끓인 후, 8% SDS-PAGE 겔로 전기영동하여 단백질을 분리하였다. 분리된 단백질을 니트로셀룰로스(nitrocellulose) 막에 트랜스퍼(transfer) 하고, 이를 3% 소혈청알부민(bovine serum albumin)이 포함된 PBST(0.5% Tween포함)에 넣어 1 시간 동안 블로킹(blocking) 하였다. 그 후, 1 mg/mL의 MAA 렉틴(EY Laboratories, San Mateo, CA) 또는 1 mg/mL의 SNA-I 렉틴(EY Laboratories, San Mateo, CA)이 들어있는 3% BSA-PBS에 막을 넣어 상온에서 4 시간 동안 인큐베이션하였다. 인큐베이션 후, 막을 PBST로 10 분 동안 6회 세척한 후, 0.2 mg/mL horseradish peroxidase(HRP)-conjugated streptavidin(1:500; Sigma-Aldrich)과 한 시간 동안 반응시켰다. 반응 후, 같은 방법으로 막을 PBST로 10 분 동안 6회 세척하여, ECL kit(GE Healthcare)로 시알화된 단백질을 확인하였다. Specifically, in vitro To carry out the sialation reaction, 1 mg / mL of sialated receptor bisialoxidate pethuin, 0.5 mg / mL of sialic acid donor CMP-sialic acid, 10 mM MnCl 2 and 1 were prepared using the crude extract identified in protein expression. % Triton X-100, 0.02 Unit TEV (Tobacco Etch Virus) protease was mixed with PBS (phosphate buffered saline) and reacted at 25 ° C. for 1 to 12 hours. Then, in order to confirm the sialation of the enzyme reactant through lectin blot analysis, the sialase enzyme reactant was mixed with 5 × Laemmli buffer and boiled for 10 minutes, followed by electrophoresis on an 8% SDS-PAGE gel. Protein was isolated. The separated protein was transferred to a nitrocellulose membrane, and placed in PBST (containing 0.5% Tween) containing 3% bovine serum albumin, and blocked for 1 hour. Subsequently, the membrane is placed in 3% BSA-PBS containing 1 mg / mL MAA lectin (EY Laboratories, San Mateo, CA) or 1 mg / mL SNA-I lectin (EY Laboratories, San Mateo, CA). Incubate for 4 hours at. After incubation, the membrane was washed six times with PBST for 10 minutes and then reacted with 0.2 mg / mL horseradish peroxidase (HRP) -conjugated streptavidin (1: 500; Sigma-Aldrich) for one hour. After the reaction, the membrane was washed 6 times with PBST for 10 minutes in the same manner to identify the sialated protein by ECL kit (GE Healthcare).
그 결과, Hror_ST에서는 Neu5Ac α(2,3) Gal β(1,4) GlcNAc의 α2,3-결합을 인식하는 Maackia amurensis(MAA) 렉틴 및 Neu5Ac α(2,6) Gal 과 Neu5Ac α(2,6) GalNAc을 인지하는 Sambucus nigra(SNA) 랙틴 블롯이 모두 확인되었으나, 음성 대조군인 비시알산화페투인에는 MAA 와 SNA-I 렉틴은 거의 측정되지 않았으며, 양성 대조군인 페투인(fetuin)에 대해서는 단지 SNA-I에서만 시그널이 확인되었다(도 3).
As a result, Maackia recognizes α2,3-linkage of Neu5Ac α (2,3) Gal β (1,4) GlcNAc in Hror_ST. Sambucus recognizes amurensis (MAA) lectins and Neu5Ac α (2,6) Gal and Neu5Ac α (2,6) GalNAc Although both nigra (SNA) rattin blots were identified, almost no MAA and SNA-I lectins were measured in the bisial oxidized fetuin, a negative control, and only in SNA-I for the fetuin, a positive control. It was confirmed (FIG. 3).
<2-2> <2-2> 유리당쇄(Free glycan)를Free glycan 이용한 Used 시알산 전이효소의 시알산 전이 활성 확인Confirmation of sialic acid transfer activity of sialic acid transferase
본 발명자들은 우렁쉥이 유래 시알산 전이효소의 다른 기질에 대한 활성의 확인을 위해 유리당쇄(Free glycan)를 기질로 이용하여 in vitro 시알화 반응(sialylation reaction)을 수행한 후, 시알산 전이 활성을 확인하였다.The present inventors used free glycan as a substrate to confirm the activity of other sialic acid-transferase-derived substrates in vitro After carrying out a siallation reaction, the sialic acid transfer activity was confirmed.
구체적으로, in vitro 시알화 반응을 수행하기 위하여, 조추출액을 이용해 시알화 수용체 비시알산화당쇄(asialoglycan) 0.01-10 mg/mL, 시알산 공여체 CMP-시알산 0.1 내지 0.5 mg/mL, 10 mM MnCl2, 1% Triton X-100 및 0.02 Unit TEV(Tobacco Etch Virus) 프로테아제를 PBS와 혼합한 후, 20 내지 40 ℃에서 1 내지 12 시간 동안 반응시켰다. 반응 후, 시알산 전이 효소의 산물의 측정은 시알산 전이효소 반응 후 CMP-시알산에서 시알산이 당 수용체에 전달된 후 유리되는 사이클릭 모노포스페이트(Cyclic monophosphate, CMP)에 대한 포스파타아제(phosphatase)의 효소 반응을 이용하여 Wu et al.(Glycobiology 21, 727 (2011))에 기재된 방법에 따라 확인하였다. Specifically, in vitro To carry out the sialation reaction, the crude extract was used to make the sialylated receptor bisialic oxidized sugar chain (asialoglycan) 0.01-10 mg / mL, sialic acid donor CMP-sialic acid 0.1-0.5 mg / mL, 10 mM MnCl 2 , 1%. Triton X-100 and 0.02 Unit TEV (Tobacco Etch Virus) protease were mixed with PBS and reacted at 20 to 40 ° C. for 1 to 12 hours. After the reaction, the measurement of the product of the sialic acid transferase was determined by phosphatase for cyclic monophosphate (CMP), which is released after the sialic acid is transferred to the sugar receptor from CMP-sialic acid after the sialic acid transferase reaction. Using the enzymatic reaction), according to the method described in Wu et al. (Glycobiology 21, 727 (2011)).
그 결과, 시알산 전이효소의 비시알산화 유리 당쇄(asialo free glycan)에 대한 활성을 확인할 수 있었다(표 1).As a result, the sialic acid transferase was able to confirm the activity of the bisial oxidized free sugar chain (asialo free glycan) (Table 1).
<2-3> 시알산 전이효소의 시알산 결합(linkage) 확인<2-3> Confirmation of sialic acid linkage of sialic acid transferase
본 발명자들은 우렁쉥이 유래 시알산 전이효소에 의해 시알화된 비시알산화페투인(asialofetuin)의 시알산 결합을 확인하기 위하여 결합 특이적 시알리다아제를 처리하여 시알산을 절단한 후 렉틴 분석을 통해 확인하였다.The present inventors have cleaved sialic acid by treatment with binding specific sialidase to confirm sialic acid binding of bisiaalfetuin sialated by sialic acid-transferase-derived sialic acid transferase and confirmed by lectin analysis. It was.
구체적으로, in vitro 시알화 반응을 수행하기 위해, 앞서 단백질 발현에서 확인된 조추출액을 이용하여 시알화 수용체 비시알산화페투인 1 mg/mL, 시알산 공여체 CMP-시알산 0.5 mg/mL, 10 mM MnCl2 및 1% Triton X-100, 0.02 Unit TEV(Tobacco Etch Virus) 프로테아제를 PBS(phosphate buffered saline)와 혼합하여 25 ℃에서 1 내지 12 시간 동안 반응시켰다. 그 후, in vitro 시알화 반응을 통해 합성된 시알화된 비시알산화페투인의 시알산 결합을 확인하기 위해, α(2,3)-시알산 결합 특이적 시알리다아제(sialidase)인 Streptococcus pneumonia exo-시알리다아제(Sigma-Aldrich) 및 Vibrio chorelae의 α2,3(6)(8)-시알산 가수분해 시알리다아제(Sigma-Aldrich)과 각각 30 ℃에서 하룻밤 동안 반응시킨 후, α2,3-linkage 확인을 위한 MAA 렉틴 또는 α2,6-linkage 확인을 위한 SNA-I 렉틴을 사용하여 상기 <실험예 2-1>과 동일한 방법의 렉틴 블롯 분석을 통해 시알산이 부가되어 있는 당단백질을 측정하여 시알산 전이효소에 의해 전이된 시알산의 결합(linkage)을 확인하였다. Specifically, in order to perform the in vitro sialation reaction, the crude extract identified in the protein expression was 1 mg / mL of sialylated receptor bisial oxidized pethuin, sialic acid donor CMP-sialic acid 0.5 mg / mL, 10 mM MnCl 2 and 1% Triton X-100, 0.02 Unit Tobacco Etch Virus (TEV) protease were mixed with PBS (phosphate buffered saline) and reacted at 25 ° C. for 1 to 12 hours. Then in vitro Streptococcus , α (2,3) -sialic acid binding specific sialidase, to confirm the sialic acid binding of sialated bisial oxidized fetuin synthesized through sialation reaction pneumonia exo-sialidase (Sigma-Aldrich) and Vibrio After reacting with α2,3 (6) (8) -sialic acid hydrolysis sialidase (Sigma-Aldrich) of chorelae at 30 ° C. overnight, MAA lectin or α2,6- to confirm α2,3-linkage Binding of sialic acid transferred by sialic acid transferase by measuring glycoprotein to which sialic acid was added by lectin blot analysis using the same method as in <Experiment 2-1> using SNA-I lectin for linkage confirmation (linkage) was confirmed.
그 결과, α2,3-결합 시알산을 특이적으로 가수분해하는 S. penumoniae의 exo-시알리다아제를 처리했음에도 불구하고 MAA 렉틴에 의한 시알화된 비시알산화페투인이 측정되었으며, 양성 대조군으로 사용한 hST3에서도 같은 결과가 관찰되었다(도 3).As a result, sialized bisial oxidized fetuin by MAA lectin was measured despite treatment with exo-sialidase of S. penumoniae that specifically hydrolyzes α2,3-linked sialic acid. The same result was observed with the used hST3 (FIG. 3).
<110> Korea Research Institute of Bioscience and Biotechnology <120> Sialyltransferase of Halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it <130> 11p-08-50 <160> 6 <170> KopatentIn 2.0 <210> 1 <211> 981 <212> DNA <213> Halocynthia rorentzi <400> 1 atgataagac ccatttacca gcgtcatact gcagttatta tcgtttttgg aattacgata 60 gcgctttcaa gcctttccct tatttacaaa ataggtagta gccaattaac tgcgaggtgg 120 cagatgcaaa tcgtactgag cagagacaaa agtattcttg atgaaagcac tgttactaac 180 gtgtcaaggg ggacagggaa tcgaaacaaa agaataataa atggatatca ctcgttcaac 240 agcaaacaaa atctctcatt tgcttgcgat acatgtgctt tagttagcag ttccggaact 300 cttttaggca gcaaatcggg caacgacatc gacaaatatc cttgtgtgtt tcgaatgaac 360 gatgctccca cgttgacata tgaaaaagat gttggaagta agacgactgc tagagtggtt 420 gctcattcag ctgtcaaagc cataactgac tatttacaat acaatacgtt gggaaatcag 480 gaggccaact caacaacatt cattgtttgg ggtcctgaca gaaatatgaa acatggaggg 540 gttgcatatc aaatgctcag ataccttgaa gtaaaatatc catttattaa atttttcatt 600 tacgatcccc gaacggtagc gtatgctgat aaaattttcg aaaaagaaac aggccgccca 660 agaattgggt caggatctta tttgagtacc ggatggttca cgtttctact catgaaaaaa 720 gtttgtggaa gaattgctgt atatggtatg gtcgaagagc aacactgtaa caaaaagatc 780 ctcaatccga aattaattga tgcaccgtac cactattatc gtcctcttgg tccaaaacaa 840 tgcaccactt acatagccca tgaacgtgct aaatttggag cgcaccgttt catcactgag 900 aaaaaggttt tcaaaaaatg ggcaaaggaa tggggtaatg ttgagttcca ttctcctcaa 960 tggaatcttt ccgatatatg a 981 <210> 2 <211> 326 <212> PRT <213> Halocynthia rorentzi <400> 2 Met Ile Arg Pro Ile Tyr Gln Arg His Thr Ala Val Ile Ile Val Phe 1 5 10 15 Gly Ile Thr Ile Ala Leu Ser Ser Leu Ser Leu Ile Tyr Lys Ile Gly 20 25 30 Ser Ser Gln Leu Thr Ala Arg Trp Gln Met Gln Ile Val Leu Ser Arg 35 40 45 Asp Lys Ser Ile Leu Asp Glu Ser Thr Val Thr Asn Val Ser Arg Gly 50 55 60 Thr Gly Asn Arg Asn Lys Arg Ile Ile Asn Gly Tyr His Ser Phe Asn 65 70 75 80 Ser Lys Gln Asn Leu Ser Phe Ala Cys Asp Thr Cys Ala Leu Val Ser 85 90 95 Ser Ser Gly Thr Leu Leu Gly Ser Lys Ser Gly Asn Asp Ile Asp Lys 100 105 110 Tyr Pro Cys Val Phe Arg Met Asn Asp Ala Pro Thr Leu Thr Tyr Glu 115 120 125 Lys Asp Val Gly Ser Lys Thr Thr Ala Arg Val Val Ala His Ser Ala 130 135 140 Val Lys Ala Ile Thr Asp Tyr Leu Gln Tyr Asn Thr Leu Gly Asn Gln 145 150 155 160 Glu Ala Asn Ser Thr Thr Phe Ile Val Trp Gly Pro Asp Arg Asn Met 165 170 175 Lys His Gly Gly Val Ala Tyr Gln Met Leu Arg Tyr Leu Glu Val Lys 180 185 190 Tyr Pro Phe Ile Lys Phe Phe Ile Tyr Asp Pro Arg Thr Val Ala Tyr 195 200 205 Ala Asp Lys Ile Phe Glu Lys Glu Thr Gly Arg Pro Arg Ile Gly Ser 210 215 220 Gly Ser Tyr Leu Ser Thr Gly Trp Phe Thr Phe Leu Leu Met Lys Lys 225 230 235 240 Val Cys Gly Arg Ile Ala Val Tyr Gly Met Val Glu Glu Gln His Cys 245 250 255 Asn Lys Lys Ile Leu Asn Pro Lys Leu Ile Asp Ala Pro Tyr His Tyr 260 265 270 Tyr Arg Pro Leu Gly Pro Lys Gln Cys Thr Thr Tyr Ile Ala His Glu 275 280 285 Arg Ala Lys Phe Gly Ala His Arg Phe Ile Thr Glu Lys Lys Val Phe 290 295 300 Lys Lys Trp Ala Lys Glu Trp Gly Asn Val Glu Phe His Ser Pro Gln 305 310 315 320 Trp Asn Leu Ser Asp Ile 325 <210> 3 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Hzi2_Forward primer <400> 3 accccggatt ctagaactag tggatccccc atgataagac ccatttacca gcgt 54 <210> 4 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Hzi2_Reverse primer <400> 4 tttaactgga acttttatat ttaaaagggg aggagaatgg aactcaacat tacc 54 <210> 5 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> hST3GAL_forward primer <400> 5 accccggatt ctagaactag tggatccccc atggttagta agtcccgctg gaag 54 <210> 6 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> hST3GAL_reverse primer <400> 6 ttaactggaa cttttatatt taaaaggggg aaggacgtga ggttcttgat agc 53 <110> Korea Research Institute of Bioscience and Biotechnology <120> Sialyltransferase of Halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it <130> 11p-08-50 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 981 <212> DNA <213> Halocynthia rorentzi <400> 1 atgataagac ccatttacca gcgtcatact gcagttatta tcgtttttgg aattacgata 60 gcgctttcaa gcctttccct tatttacaaa ataggtagta gccaattaac tgcgaggtgg 120 cagatgcaaa tcgtactgag cagagacaaa agtattcttg atgaaagcac tgttactaac 180 gtgtcaaggg ggacagggaa tcgaaacaaa agaataataa atggatatca ctcgttcaac 240 agcaaacaaa atctctcatt tgcttgcgat acatgtgctt tagttagcag ttccggaact 300 cttttaggca gcaaatcggg caacgacatc gacaaatatc cttgtgtgtt tcgaatgaac 360 gatgctccca cgttgacata tgaaaaagat gttggaagta agacgactgc tagagtggtt 420 gctcattcag ctgtcaaagc cataactgac tatttacaat acaatacgtt gggaaatcag 480 gaggccaact caacaacatt cattgtttgg ggtcctgaca gaaatatgaa acatggaggg 540 gttgcatatc aaatgctcag ataccttgaa gtaaaatatc catttattaa atttttcatt 600 tacgatcccc gaacggtagc gtatgctgat aaaattttcg aaaaagaaac aggccgccca 660 agaattgggt caggatctta tttgagtacc ggatggttca cgtttctact catgaaaaaa 720 gtttgtggaa gaattgctgt atatggtatg gtcgaagagc aacactgtaa caaaaagatc 780 ctcaatccga aattaattga tgcaccgtac cactattatc gtcctcttgg tccaaaacaa 840 tgcaccactt acatagccca tgaacgtgct aaatttggag cgcaccgttt catcactgag 900 aaaaaggttt tcaaaaaatg ggcaaaggaa tggggtaatg ttgagttcca ttctcctcaa 960 tggaatcttt ccgatatatg a 981 <210> 2 <211> 326 <212> PRT <213> Halocynthia rorentzi <400> 2 Met Ile Arg Pro Ile Tyr Gln Arg His Thr Ala Val Ile Ile Val Phe 1 5 10 15 Gly Ile Thr Ile Ala Leu Ser Ser Leu Ser Leu Ile Tyr Lys Ile Gly 20 25 30 Ser Ser Gln Leu Thr Ala Arg Trp Gln Met Gln Ile Val Leu Ser Arg 35 40 45 Asp Lys Ser Ile Leu Asp Glu Ser Thr Val Thr Asn Val Ser Arg Gly 50 55 60 Thr Gly Asn Arg Asn Lys Arg Ile Ile Asn Gly Tyr His Ser Phe Asn 65 70 75 80 Ser Lys Gln Asn Leu Ser Phe Ala Cys Asp Thr Cys Ala Leu Val Ser 85 90 95 Ser Ser Gly Thr Leu Leu Gly Ser Lys Ser Gly Asn Asp Ile Asp Lys 100 105 110 Tyr Pro Cys Val Phe Arg Met Asn Asp Ala Pro Thr Leu Thr Tyr Glu 115 120 125 Lys Asp Val Gly Ser Lys Thr Thr Ala Arg Val Val Ala His Ser Ala 130 135 140 Val Lys Ala Ile Thr Asp Tyr Leu Gln Tyr Asn Thr Leu Gly Asn Gln 145 150 155 160 Glu Ala Asn Ser Thr Thr Phe Ile Val Trp Gly Pro Asp Arg Asn Met 165 170 175 Lys His Gly Gly Val Ala Tyr Gln Met Leu Arg Tyr Leu Glu Val Lys 180 185 190 Tyr Pro Phe Ile Lys Phe Phe Ile Tyr Asp Pro Arg Thr Val Ala Tyr 195 200 205 Ala Asp Lys Ile Phe Glu Lys Glu Thr Gly Arg Pro Arg Ile Gly Ser 210 215 220 Gly Ser Tyr Leu Ser Thr Gly Trp Phe Thr Phe Leu Leu Met Lys Lys 225 230 235 240 Val Cys Gly Arg Ile Ala Val Tyr Gly Met Val Glu Glu Gln His Cys 245 250 255 Asn Lys Lys Ile Leu Asn Pro Lys Leu Ile Asp Ala Pro Tyr His Tyr 260 265 270 Tyr Arg Pro Leu Gly Pro Lys Gln Cys Thr Thr Tyr Ile Ala His Glu 275 280 285 Arg Ala Lys Phe Gly Ala His Arg Phe Ile Thr Glu Lys Lys Val Phe 290 295 300 Lys Lys Trp Ala Lys Glu Trp Gly Asn Val Glu Phe His Ser Pro Gln 305 310 315 320 Trp Asn Leu Ser Asp Ile 325 <210> 3 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Hzi2_Forward primer <400> 3 accccggatt ctagaactag tggatccccc atgataagac ccatttacca gcgt 54 <210> 4 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Hzi2_Reverse primer <400> 4 tttaactgga acttttatat ttaaaagggg aggagaatgg aactcaacat tacc 54 <210> 5 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> hST3GAL_forward primer <400> 5 accccggatt ctagaactag tggatccccc atggttagta agtcccgctg gaag 54 <210> 6 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> hST3GAL_reverse primer <400> 6 ttaactggaa cttttatatt taaaaggggg aaggacgtga ggttcttgat agc 53
Claims (13)
Polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 having sialic acid transferase activity derived from the locust ( Halocynthia rorentzi ).
A polynucleotide encoding the polypeptide of claim 1.
The polynucleotide of claim 2, wherein the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 1.
An expression vector comprising the polynucleotide of claim 2.
A transformant transformed with the expression vector of claim 4.
2) 단계 1)의 형질전환체를 배양하는 단계; 및
3) 단계 2)의 배양물로부터 시알산 전이효소를 회수하는 단계를 포함하는 우렁쉥이(멍게, Halocynthia rorentzi) 유래 활성형 시알산 전이효소의 제조방법.
1) transforming the host cell with the expression vector of claim 4;
2) culturing the transformant of step 1); And
3) A method for preparing an active sialic acid transferase derived from Halocynthia rorentzi , comprising recovering sialic acid transferase from the culture of step 2).
The transformant of claim 6, wherein the host cell is a bacterium or a yeast.
The method of claim 7, wherein the bacterium is Staphylococcus aureus), Escherichia coli (E. coli), Bacillus cereus (B. cereus), Salmonella tie blood myurim (Salmonella typimurium ), Salmonella choleraesuis , Yersinia enterocolitica ) and Listeria monocytogenes .
The method of claim 7, wherein the yeast transformant, characterized in that belonging to the genus Saccharomyces as MY access (Saccharomyces), Pichia (Pichia), inclusive Vero My process (Kluyveromyces), Hanse Cronulla (Hansenula) or Candida (Candida) .
According to claim 7, wherein the yeast Saccharomyces ( Saccharomyces) cerevisiae ) Transformant characterized in that the FGY217 strain.
2) 단계 1)의 혼합물을 반응시켜 수용체에 시알산을 부가하는 단계를 포함하는 시알산이 부가된 시알화 복합당질의 생산 방법.
1) mixing the sialic acid transferase, sialylation receptor and sialic acid donor of claim 1; And
2) A method for producing a sialic acid added saccharide complexed saccharide comprising reacting the mixture of step 1) to add sialic acid to the receptor.
12. The method of claim 11, wherein the sialated receptor is monosaccharide, oligosaccharide, polysaccharide, peptide, protein, glycoprotein, lipid, glycolipid, proteoglycan.
12. The method of claim 11, wherein the sialic donor is a CMP-sialic acid and a CMP-sialic acid derivative.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020110121562A KR101457514B1 (en) | 2011-11-21 | 2011-11-21 | Sialyltransferase of Halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it |
PCT/KR2012/008919 WO2013077563A1 (en) | 2011-11-21 | 2012-10-29 | Halocynthia roretzi-derived sialic acid transferase and method for synthesizing sialicated glycoconjugates using same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020110121562A KR101457514B1 (en) | 2011-11-21 | 2011-11-21 | Sialyltransferase of Halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20130055894A true KR20130055894A (en) | 2013-05-29 |
KR101457514B1 KR101457514B1 (en) | 2014-11-03 |
Family
ID=48469968
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020110121562A KR101457514B1 (en) | 2011-11-21 | 2011-11-21 | Sialyltransferase of Halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR101457514B1 (en) |
WO (1) | WO2013077563A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101667677B1 (en) * | 2015-05-29 | 2016-10-19 | 한국생명공학연구원 | Method for preparing recombinant ST6Gal1 protein as an active form |
KR20160127124A (en) * | 2014-03-05 | 2016-11-02 | 울트라제닉스 파마수티컬 인코포레이티드 | Sialylated glycoprotein compositions and uses thereof |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
ATE440959T1 (en) | 2000-06-28 | 2009-09-15 | Glycofi Inc | METHOD FOR PRODUCING MODIFIED GLYCOPROTEINS |
US7863020B2 (en) * | 2000-06-28 | 2011-01-04 | Glycofi, Inc. | Production of sialylated N-glycans in lower eukaryotes |
WO2006112025A1 (en) * | 2005-04-15 | 2006-10-26 | Japan Tobacco Inc. | NOVEL β-GALACTOSIDE-α-2,3-SIALYLTRANSFERASE, GENE ENCODING THE SAME AND METHOD FOR PRODUCING THE SAME |
KR20070060439A (en) * | 2005-12-08 | 2007-06-13 | 대한민국(관리부서:농촌진흥청) | MAMMALIANIZATION OF GLYCOPROTEINS PRODUCED IN INSECT CELLS EXPRESSING STABLY HUMAN beta;1,4-GALACTOSYLTRANSFERASE AND RAT alpha;2,6-SIALYLTRANSFERASE AND METHOD THEREOF |
-
2011
- 2011-11-21 KR KR1020110121562A patent/KR101457514B1/en active IP Right Grant
-
2012
- 2012-10-29 WO PCT/KR2012/008919 patent/WO2013077563A1/en active Application Filing
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20160127124A (en) * | 2014-03-05 | 2016-11-02 | 울트라제닉스 파마수티컬 인코포레이티드 | Sialylated glycoprotein compositions and uses thereof |
KR101667677B1 (en) * | 2015-05-29 | 2016-10-19 | 한국생명공학연구원 | Method for preparing recombinant ST6Gal1 protein as an active form |
Also Published As
Publication number | Publication date |
---|---|
KR101457514B1 (en) | 2014-11-03 |
WO2013077563A1 (en) | 2013-05-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
RU2642307C2 (en) | New fucosyltransferases and their application | |
KR101891649B1 (en) | Novel fucosyltransferases and their applications | |
KR100325552B1 (en) | Novel β1 → 4N-acetylglucosaminyltransferases and genes encoding them | |
KR101457514B1 (en) | Sialyltransferase of Halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it | |
KR20220108114A (en) | Nucleic acids, vectors, host cells and methods for the production of beta-fructofuranosidase from Aspergillus niger | |
KR101673195B1 (en) | The Recombinant Sialic Acid-Specific Binding Lectin, PSL1b, from the Mushroom Polyporus squamosus | |
JP5892489B2 (en) | Novel polypeptide, polynucleotide encoding the polypeptide, and use thereof | |
KR101842226B1 (en) | Mushroom Hericium erinaceus lectin specifically binding to core 1 O-linked glycan and uses thereof | |
JP5967725B2 (en) | Complex sugar chain hydrolase | |
JP4781851B2 (en) | Novel carbohydrate hydrolase that hydrolyzes αN-acetylglucosaminyl linkage | |
KR101221666B1 (en) | Yeast surface displayed Corynebacterium diphtheriae trans-sialidase and its use for the production of sialic acid derivatives | |
KR101083065B1 (en) | Novel bacterial trans-sialidase and its use for the production of sialoconjugates | |
JP7353616B2 (en) | Novel carbohydrate-binding protein and polynucleotide encoding it | |
JP5917913B2 (en) | Improved methods for carbohydrate-related enzymes | |
JPWO2016136984A1 (en) | End M mutant and method for producing N-linked sugar chain-containing compound or N-linked sugar chain-containing protein | |
Pillai | Heterologous expression of human ST6GAL1 in trichoderma reesei | |
JP2021177713A (en) | Nucleic acid encoding protein having deaminoneuraminic acid-specific sialidase activity and use thereof | |
KR100481910B1 (en) | Fusion protein producing galactose α-1,3-galactose-β-1,4-N-acetyl glucosamine | |
Al-Amoodi | Expression and Purification of Glycosyltransferases in Pichia Pastoris: Towards Improving the Migration of Stem Cells by Enhancing Surface Expression of Sialyl Lewis X | |
Lim | Synthesis of O-Linked glycopeptides using enzymatic catalysis. | |
Mrázek | α-N-Acetylgalactosaminidase as a tools in the synthesis of complex oligosaccharide immune stimulators | |
Both | Structure–function study of Arabidopsis thaliana core alpha1, 3-fucosyltransferase (FucTA) |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
N231 | Notification of change of applicant | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20180913 Year of fee payment: 5 |
|
FPAY | Annual fee payment |
Payment date: 20190925 Year of fee payment: 6 |