KR20130055894A - Sialyltransferase of halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it - Google Patents

Abstract

PURPOSE: Halocynthia roretzi-derived sialyltransferase is provided to selectively target yeast golgi body, to produce sialyltransferase in a heterologous host, and to be used as an enzyme resource for sialydation of glycoprotein for therapy. CONSTITUTION: A polypeptide contains an amino acid of sequence number 2 and has Halocynthia roretzi-derived sialyltransferase activity. A polynucleotide encodes the polypeptide and has a base sequence of sequence number 1. An expression vector contains the polynucleotide. A transformant is prepared by transforming with the expression vector. A method for producing sialoglycoconjugates comprises: a step of mixing Halocynthia roretzi-derived sialyltransferase, a sialydation receptor, and a sialic acid donor; and a step of reacting the mixture.

Description

Sialyltransferase of Halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it}

A gene encoding sialic acid transferase derived from R. japonicum, an active sialic acid transferase expressing the gene in a heterologous host, and sialic acid by adding sialic acid to oligosaccharides, glycoproteins, and glycolipids using the same It relates to a technique for synthesizing complex sugars.

Many types of glycoproteins, glycolipids, and proteoglycans on the surface of cell membranes are known as glycans for bacterial and viral host cells, bacterial toxin adhesion, and cell cancer. And cancer metastasis, fertilization and development, including induction of differentiation of immune cells and neurons, and deeply involved in the long-term life phenomena of multicellular society by interactions such as recognition and adhesion between cells during differentiation. Sugar chains present in glycolipids, proteoglycans, etc. are collectively referred to as glycoconjugates, and each sugar chain is constructed and redesigned by glycosyltransferases that synthesize their sugar chains and glycosidases that break down. The genes encoding these two groups of enzymes are referred to as glycogenes. Unlike protein synthesis, sugar chain synthesis is secondarily constructed by regulatory control by glycotransferases or glycolytic enzymes encoded in sugar chain genes without direct control of genes. Glycotransferase refers to a series of enzymes that transfer single sugars from the donor sugarnucleotide to the receptor to form new glycosidic bonds. In the case of donors, they are different from each other by the nucleotide portion of the sugar nucleotides, including glucose (Glc), galactose (Gal), N-acetylglucosamine (GlcNAc), N-acetylgalactosamine (GalNAc), glucuronic acid, xyllo Xylose, Fucose (Fuc), mannose (Man), sialic acid (NeuAc, NeuGc) and the like. Receptors include monosaccharides, oligosaccharides, polysaccharides, peptides, proteins, glycoproteins, lipids, glycolipids, proteoglycans, and the like. Since sugar chain synthesis is performed by sugar transferases specific for the anomer structure (α-, β-) and glycosidic binding sites of sugars and the sugar chains formed, about 200 to 300 different glycotransferases in vivo Glycosaccharide sugar chain reaction occurs in the Golgi apparatus (Hakomori and Kannagi (1983) J. Natl. Cancer Inst. 71: 231-251; Weisgerber et al. (1991) Glycobiology 1). 357-365).

In 1982, ST6Gal Ⅰ was first purified and the cDNA was cloned from the expression library in 1987 using this enzyme. Then, in 1992, the cDNAs of ST3Gal I and III were cloned using the partial amino acid sequence of the protein obtained by purification by affinity chromatography using CDP-hexanolamine. The sialic acid transferase is a type of a sugar residue such as galactose (Gal), galactosamine (GalNAc) or sialic acid (NeuAc) at the end of the sialic acid receptor sugar chain to which sialic acid is added and α (2) to which sialic acid is added. According to the characteristics of, 3)-, α (2,6)-and α (2,8) -binding, it is classified into 20 kinds, and it is known that sialic acid transferase is found in almost all higher animals except plants ( Paulson and Rademacher (2009) Nat. Struct. Mol. Biol. 16: 1121-1122).

Sialic acid transferase has been cloned from several tissues of various higher animals and its function has been interpreted (Harduin-Lepers et al., (2005) Glycobiology 15: 805-817). Recently, sialic acid transfer enzymes have been reported in bacteria, and β-galactoside α-2,6-sialyltransferase cloned from Photobacterium species, a marine photosynthetic bacterium, lipooligosaccharide α-2,3-sialyltransferase cloned from the pathogenic bacterium Neisseia , and Evolutionary studies of the evolutionary aspects, structure, and function of polysialic acid synthase genes cloned from E. coli K1 are underway (Aoki et al., (1992) Proc. Natl, Acad. Sci. USA 89: 4319-). 4323; Burke et al., (1992) J. Biol. Chem. 267: 24433-24440; Breton et al., (1998) Glycobiology 8: 87-94; Weston et al., (1992) J. Biol. Chem 267: 4152-4160).

About 50 kinds of sialic acid derivatives have been found in nature so far as sialic acid is a negative charge component added to the sugar chain terminal. Sialic acid plays an important role in biological phenomena in cells, such as intercellular interactions, the role of mediators in cells, and the stabilization of glycoproteins in mammals. In particular, sialic oxidized sugar chains in vivo are known as one of the first recognized sugar chains during pathogen infection (Sasisekharan and Myette (2003) Am. Sci. 91: 432-441; Vimr and Lichtensteiger (2002) Trends Microbiol. 10: 254-257 Sialic acid, which is present on the cell surface, is also known to form a polysaccharide oligosaccharide in the form of a capsule for immune evasion reactions or cellular protection even in pathogenic microorganisms (Vimr et al., (2004) Microbiol. Mol. Biol. Rev. 68: 132-153). When sialic acid is synthesized among pathogenic microorganisms, sialic acid is synthesized through sialic acid metabolic circuits in cells, or sialic acid after transporting sialic acid outside cells through sialic acid transporters on the surface of cells It is known to synthesize sialic acid via metabolic pathways (Vimr and Lichtensteiger (2002) Trends Microbiol. 10: 254-257).

Sialic acid contains a carboxyl group that is chemically linked to the anomeric position of the second carbon, deoxy of the third carbon, and glycerol branched to the sixth carbon, making chemical synthesis difficult and yielding. This is known to be very low. In addition, the sialic acid-added sugar chain has many functional groups in the sialic acid receptor sugar chain in addition to the complex chemical structure of sialic acid, so that the reaction of adding sialic acid at a desired position is not easy, so the majority of sialic acid-added sugar chains are extracted from natural products or sialic. It is produced by chemical-enzyme synthesis that combines the reaction of acid transferase sialyltransferase and chemical synthesis. Chem-enzyme synthesis requires sialic acid receptor sugar chains and sialic acid donors as the nucleotide-sugar cytidine-5-monophospho-N-acetyl-beta-neuraminic acid (CMP-NeuAc). In the case of sialic acid transferase used at this time, only enzymes derived from higher animals such as rats and humans are currently used. However, with the recent progress of marine biological genomes, various sugar chain synthesis genes have been found in marine invertebrates, and many gene sequences encoding proteins similar to sialic acid transferase have been reported (Harduin-Lepers et al., (2005) Glycobiology 15: 805-817. The sialic acid transferase derived from marine invertebrates, which is a lower stage in evolution, has a broad substrate specificity, and thus, if a stable enzyme source is secured, it can be used as a material for sialic acid addition sugar chain synthesis and sialic acid transfer reaction. . In addition, the effective sialic acid transfer reaction of sialic acid transferase derived from marine invertebrates enables sialic acid addition and redesign of glycoprotein products such as medical proteins in which sialic acid sugar chains are important, and will be used for future sugar chain control technology of biosimilar products. It is expected to be useful.

Therefore, sialic oxidation of glycoproteins through sialic acid addition reaction of bisialic acid glycoproteins using sialic acid-transferase of the present invention can enhance the efficacy and safety of medicinal glycoproteins for which sialic acid is important and enhance immune response. To reduce side effects, it is expected to be used in the improvement of existing glycoprotein products due to the improvement of existing drugs or their application to new indications.

It is an object of the present invention to provide a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 having sialic acid transferase activity from Halocynthia rorentzi .

In addition, another object of the present invention to provide a polynucleotide of SEQ ID NO: 1 encoding the sialic acid transferase derived from the above.

In addition, another object of the present invention to provide an expression vector comprising the polynucleotide.

Still another object of the present invention is to provide a transformant transformed with an expression vector.

In addition, another object of the present invention is to provide a method for preparing an active sialic acid transferase derived from larvae.

In addition, another object of the present invention is to provide a method for producing a sialated complex sugar to which sialic acid is added.

In order to achieve the above object, the present invention provides a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 having sialic acid transferase activity derived from Halocynthia rorentzi

The present invention also provides a polynucleotide of SEQ ID NO: 1 encoding the sialic acid transferase derived from the above.

The present invention also provides an expression vector comprising the polynucleotide.

The present invention also provides a transformant transformed with the expression vector.

In addition, the present invention provides a method for preparing an active sialic acid transferase derived from the larvae.

In addition, the present invention provides a method for producing oligosaccharide, glycolipid, glycopeptide or glycoprotein to which sialic acid is added.

The sialic acid transferase derived from the larvae of the present invention is selectively targeted to yeast Golgi, excellent in sialic acid addition activity to the receptor, and capable of producing sialic acid transferase in heterologous hosts, thus making sialic acid to a wide range of sialic acid receptors. Since can be added, it can be usefully used as an enzymatic resource for the sialic oxidation of the therapeutic glycoprotein.

Figure 1 is a schematic diagram of the sialic acid-transferase derived from Ruri Shungi;
(A): Schematic diagram of function and structural elements of sialic acid transferase estimated based on amino acid sequence; And
(B): Schematic diagram when sialic acid transferase expressed in fusion form with fluorescent protein (GFP) is expressed on the yeast Golgi membrane.
FIG. 2 is a photograph showing the expression of fluorescent protein (GFP) and sialic acid transferase in a fused form in the yeast Golgi apparatus using confocal microscopy;
eV: yeast transformed with only the cloning vector used as negative control;
hST3Gal: expression of human protein sialic acid transferase protein in fusion form with fluorescent protein (GFP) used as positive control; And
HrorST: expression of sialic acid-derived sialic acid transferase protein fused with fluorescent protein.
Figure 3 is a figure confirming the degree of sialic acid addition to the sialic acid receptor protein asialofetuin (sialofetuin) using sialic acid transferase through lectin blot;
eV: crude cell extract treated sample of yeast containing only cloning vector used as negative control;
hST3Gal: A sample of crude cell extract of recombinant yeast expressing sialic acid transferase derived from humans used as a positive control group;
HrorST: Sample of crude cell extract treatment of recombinant yeast expressing Rhubarb-derived sialic acid transferase;
fetuin: fetuin, a positive control;
asialofetuin: bisial oxidized fetuin, a negative control;
+,-; Samples before and after removing sialic acid from the protein using sialic acid cleavage enzyme (exo-α-sialidase);
top; Maackia lectin blot using amurensis (MAA) lectin; And
Below: Sambucus Lectin blot using nigra (SNA-I) lectin.
4 is a diagram showing the quantified expression of the sialic acid transferase fused with a fluorescent protein to confirm the expression level of the sialic acid transferase using Western blot using a fluorescent protein detection antibody;
eV: crude cell extract of yeast containing cloning vector used as negative control;
hST3Gal: cell crude extract of recombinant yeast expressing human-derived sialic acid transferase fused to a fluorescent protein used as a positive control; And
HrorST: A crude cell extract of recombinant yeast expressing leucine-derived sialic acid transferase fused with fluorescent protein.

Hereinafter, the present invention will be described in detail.

The present invention is a sea squirrel (squill, Halocynthia) rorentzi ) provides a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 having sialic acid transferase activity derived from.

The present invention also provides a polynucleotide of SEQ ID NO: 1 encoding the sialic acid transferase derived from the above.

In a specific embodiment of the present invention, the present inventors synthesized the cDNA by extracting RNA from the adult squirrel, and obtained the cDNA encoding the squirrel sialic acid transferase using this to determine the base sequence (SEQ ID NO: 1), It was confirmed that the novel base sequence. In addition, the nucleotide sequence was used to confirm the amino acid sequence of the sialic acid-derived sialic acid transferase (SEQ ID NO: 2), which was found to include all the sialyl motifs of typical eukaryotic sialic acid transferase (sialyltransferase). It contains cysteine residues found in sialyl motifs and is thought to form disulfide bonds that have the structural properties of the protein, including the Golgi targeting signal. It is thought to be a typical type II transmembrane protein that is expressed in the Golgi membrane and has an active domain in the direction of the lumen. In addition, in the case of the catalytic domain located in the Golgi lumen, a plurality of N-glycosylation sites include a position (N-linked glycosylation site), and thus, it is determined that the cells are expressed in the form of glycoprotein (glycoprotein) (FIGS. 1A and 1B).

The present invention also provides an expression vector comprising the polynucleotide.

The present invention also provides a transformant transformed with the expression vector.

In addition,

1) transforming the host cell with the expression vector;

2) culturing the transformant of step 1); And

3) It provides a method for preparing an active sialic acid transferase derived from the locust ( Halocynthia rorentzi ) comprising the step of recovering the sialic acid transferase from the culture of step 2).

The host cell is preferably, but not limited to, bacteria, yeast, insect cells or animal cells.

The bacterium is Staphylococcus aureus (Staphylococcus aureus), Escherichia coliE. coli), Bacillus cereus (B. cereus), Salmonella typhimurim (Salmonella typimurium), Salmonella Cholera Suis (Salmonella choleraesuis), Yexinia Enterocholicica (Yersinia enterocolitica) And Listeria monocytogenes (Listeria monocytogenesIt is preferably any one selected from the group consisting of transformants, characterized in that it is selected from the group consisting of), but is not limited thereto.

Wherein the yeast is one selected from the group consisting of as transformants, characterized in that belonging to the genus Saccharomyces as MY access (Saccharomyces), inclusive Vero My process (Kluyveromyces), Pichia (Pichia), Hanse Cronulla (Hansenula) or Candida (Candida) One is preferred, Saccharomyces cerevisiae ) FGY217 strain is more preferred, but is not limited thereto.

In a specific embodiment of the present invention, the present inventors inserted the cDNA of the sialic acid-derived sialic acid transferase into a vector tagged with yEGFP to prepare an active sialic acid transferase expression vector, which is then a heterologous host, Saccharomyces. The expression and expression levels of cerevisiae FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) were transformed and compared with those of human-derived sialic acid transferase. As a result, it was confirmed through confocal microscopy (confocal microscopy) that the target of the present invention is more effectively targeted to the Golgi membrane of yeast compared to human-derived sialic acid transferase (see FIG. 2). The amount was compared to the expression level of the human-derived sialic acid transferase as a control group by Western blot, and showed a similar expression level (see FIG. 4). Through this, it can be seen that even though the expression similar to the conventional human-derived sialic acid transferase shows an excellent target.

Therefore, the vector and the transformant expressing the swelling-derived sialic acid transferase of the present invention can effectively express sialic acid transferase which is much more specific than the existing sialic acid transferase.

In addition,

1) mixing the sialic acid transferase, sialation receptor and sialic acid donor derived from the larvae; And

2) provides a method for producing a sialic acid-added sialated receptor, which comprises adding sialic acid to the receptor by reacting the mixture of step 1).

The sialated receptor is preferably any one selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, peptides, proteins, glycoproteins, lipids, glycolipids, and proteoglycans, but is not limited thereto.

The sialic donor is preferably any one selected from the group consisting of CMP-sialic acid and CMP-sialic acid derivatives, but is not limited thereto.

In a specific embodiment of the present invention, the inventors of the sialic acid transfer reaction using the sialic acid transfer activity of the sialic acid-transferase sialic acid transferase asia substrate asasialofetuin in vitro confirm the protein to sialic screen performed with a lectin blot analysis, Neu5Ac α (2,3) Gal β (1,4) Maackia recognizing α2,3-linkage of GlcNAc Sammurcus nigra (SNA-I) lactin blots that recognize amurensis (MAA) lectins and Neu5Ac α (2,6) Gal and Neu5Ac α (2,6) GalNAc were identified (FIG. 3), free glycan Sialization reaction was carried out in vitro using as a substrate to determine the sialated product by sialic acid transferase using phosphatase enzyme reaction against Cyclic monophosphate (CMP), which is released after sialic acid is delivered to the sugar receptor. As a result, the activity of the sialic acid transferase on the bisial oxidized free sugar chain (asialo free glycan) was confirmed (see Table 1).

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the present invention is not limited to the following Examples and Experimental Examples.

< Example  1> Ascidian (urchin, Halocynthia rorentzi )in  Nucleotide Sequence Determination of Derived Sialic Acid Transferase

The inventors have found that the locust ( Halocynthia) rorentzi ) gene of sialic acid transferase was cloned.

Specifically, specifically, in order to clone a gene encoding sialic acid transferase from a cDNA library synthesized from RNA extracted from an adult adult, DNA sequence of a sialic acid transferase gene registered in the National Center for Biotechnology Information (NCBI). Degenerated DNA probes were synthesized based on highly conserved motifs on amino acids and amino acid sequences. Using the synthesized DNA probe, fragments of highly conserved motifs (L-motif from VS-motif) of Halocynthia roretzi were denatured at 95 ° C for 3 minutes, denatured at 94 ° C for 30 seconds, and at 54 ° C for 45 minutes. It was amplified by 30 cycles of PCR conditions of 0.5 annealing and 0.5 minute extension at 72 ° C. Based on this, the full-length sialic acid transferase gene was obtained and cloned into the pSPORT1 vector through rapid amplification of cDNA ends. The cDNA encoding the sialic acid transferase cloned into the vector was determined using the T7 promoter primer and the SP6 primer to determine the base sequence of the sialic acid-transferase derived from the wild snail (SEQ ID NO: 1). Confirmed.

< Example  2> sea squirt Halocynthia rorentzi Amino acid of sialic acid transferase Sequencing

The inventors found that the inventors have locusts The amino acid sequence of sialic acid transferase derived from rorentzi ) was analyzed through the nucleotide sequence of the sialic acid transferase derived from the larvae .

Specifically, amino acid sequencing was performed using Dnasis 3.1 or the same bioinformatics program based on the nucleotide sequence of the sialic acid-derived sialic acid transfer enzyme determined in <Example 1>.

As a result, it was confirmed that the amino acid sequence of the sialic acid transferase derived from the larvae (SEQ ID NO: 2), which contained all the sialyl motif of the typical eukaryotic sialic acid transferase (sialyltransferase) It was confirmed that it contained cysteine residues found in the reel motif (FIGS. 1A and 1B).

< Example  3> squirm Halocynthia rorentzi Construction of Expression Vectors of Derived Sialic Acid Transferase

The present inventors transformed the yeast by constructing an expression vector to express the unglong sialic acid-transferase in yeast which is a heterologous host.

Specifically, Hzi2_Forward primer 5'-ACCCCGGATTCTAGAACTAGTGGATCCCCCATGATAAGACCCATTTACCAGCGT-3 '(SEQ ID NO: 3) and Hzi2_Reverse primer 5ATT-GATCTAACTGTAACTAGG Using 3 ′ (SEQ ID NO: 4), 40 cycles of PCR were performed at 40 ° C. with 3 min total denaturation at 95 ° C., 30 sec denaturation at 94 ° C., 45 sec annealing at 60 ° C., and 3 min extension at 72 ° C. The gene of the derived sialic acid transferase was amplified. At this time, hST3Gal_Forward primer 5'-ACCCCGGATTCTAGAACTAGTGGATCCCCCATGGTtAGtAAGTCCCGCTGGAAG-3 'and (SEQ ID NO: 5') of the positive control group were cloned with the clone hMU003315 encoding human-derived sialic acid transferase (hST3Gal, GenBank accession number: AAM66433). 40 cycles of PCR conditions using TTAACTGGAACTTTTATATTTAAAAGGGGGAAGGACGTGAGGTTCTTGATAGC-3 '(SEQ ID NO: 6), 3 minutes full denaturation at 95 ° C, 30 seconds denaturation at 94 ° C, 45 seconds annealing at 60 ° C, and 3 minutes extension at 72 ° C. PCR was performed. Then, each of the amplified DNA was extracted, and then the pRS424GAL-yEGFP (URA ⁺ ) vector tagged with yEGFP tagged with the restriction enzyme SpeI / BamHI was tagged with each gene amplified by PCR. Esherichia coli ) was transformed into DH5α strain. Clones containing the sialic acid transferase coding gene in the correct cloning position on the vector of the recombinant plasmid obtained from E. coli were identified and selected through restriction enzyme treatment and DNA sequencing. In addition, Saccharomyces cerevisiae ) FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) strains were analyzed by colonies resulting from the transformation of the lithium acetate (lithium acetate) method.

As a result, yEGFP was tagged when sialic acid transferase was expressed, and the amount of the expressed protein was expressed in whole cell, crude extract and in situ SDS-PAGE. Identifiable Shrimp (Schlark, Halocynthia) rorentzi ) -derived sialic acid transferase Vectors were produced.

< Experimental Example  1> squirm Halocynthia rorentzi Heterogeneity of sialic acid transferase Host In yeast Targeting  And expression confirmation

<1-1> Shrimp Halocynthia rorentzi Heterogeneity of sialic acid transferase Host In yeast Targeting  Confirm

The present inventors observed by confocal microscopy (confocal microscopy) to confirm the expression of the sialic acid-transferase-derived sialic acid transferase in yeast.

Specifically, the pRS424GAL-derived recombinant vector of <Example 3> was transformed into a strain of Saccharomyces cerevisiae FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) using a lithium acetate method. . Then, the Saccharomyces cerevisiae containing the recombinant vector of <Example 3> derived from pRS424GAL having an auxotroph marker. FGY217 strain was cultured in SC-Leu medium, a dropout medium. After culturing a single colony of the transformed strain in SC-URA medium containing 2% glucose for 24 to 48 hours, 1/100 of the cultures had an OD600 value of 0.6 in SC-URA medium containing 0.1% glucose. Incubated to 0.8. Subsequently, 20% D-galactose was added at a final concentration of 2%, followed by sialic acid transfer using confocal microscopy for localization of the protein per cell in the cell at 30 ° C. GFP tagged to the enzyme was observed.

As a result, it was confirmed by confocal microscopy that sialic acid transferase was present in a spot shape which is a typical form observed in the Golgi apparatus. In comparison, the sialic acid-derived sialic acid transferase was more effectively targeted to the Golgi apparatus membrane of the yeast cells to confirm that the dot (dot) is located (Fig. 2).

<1-2> locust Halocynthia rorentzi Heterogeneity of sialic acid transferase Host In yeast Confirmation of expression

The present inventors observed by Western blot to confirm the expression level in the yeast of woolyong-derived sialic acid transferase.

Specifically, the pRS424GAL-derived recombinant vector of <Example 3> was transformed into a strain of Saccharomyces cerevisiae FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) using a lithium acetate method. . Thereafter, Saccharomyces cerevisiae comprising said recombinant vector with nutritional markers. FGY217 strain was cultured in SC-Leu medium, a dropout medium. Single colonies were incubated for 24 to 48 hours in SC-URA medium containing 2% glucose, and then 1/100 of the cultures were cultured so as to have an OD600 value of 0.6 to 0.8 in SC-URA medium containing 0.1% glucose. It was. Thereafter, 20% D-galactose was added to a final concentration of 2%, and cultured at 30 ° C., and the GFP-tagged sialic acid-transferase expression-expression crude extract was cultured at 30 ° C. in cells. The crude extract was prepared by crushing the cells using a bead beater after cell recovery and removing superimmune cells at 6,000 rpm using a centrifuge, and then extracting the supernatant. The protein expressed in the crude extract was confirmed by Western blot. .

As a result, it was confirmed that the expression level of the human-derived sialic acid transferase as a control and the sialic acid-derived sialic acid-derived enzyme of the present invention are similar (FIG. 4).

< Experimental Example  2> sea squirt Halocynthia rorentzi ) Identification of Sialic Acid Transferase Activity

<2-1> Bisial Oxetate ( Asialofetuin ) Confirmation of sialic acid transfer activity of sialic acid transferase

The inventors of the present invention using bisialfetuin (asialofetuin) as a substrate to confirm the activity of sialic acid-derived sialic acid transferase in vitro After carrying out a siallation reaction, the sialated protein was confirmed by lectin blot analysis.

Specifically, in vitro To carry out the sialation reaction, 1 mg / mL of sialated receptor bisialoxidate pethuin, 0.5 mg / mL of sialic acid donor CMP-sialic acid, 10 mM MnCl ₂ and 1 were prepared using the crude extract identified in protein expression. % Triton X-100, 0.02 Unit TEV (Tobacco Etch Virus) protease was mixed with PBS (phosphate buffered saline) and reacted at 25 ° C. for 1 to 12 hours. Then, in order to confirm the sialation of the enzyme reactant through lectin blot analysis, the sialase enzyme reactant was mixed with 5 × Laemmli buffer and boiled for 10 minutes, followed by electrophoresis on an 8% SDS-PAGE gel. Protein was isolated. The separated protein was transferred to a nitrocellulose membrane, and placed in PBST (containing 0.5% Tween) containing 3% bovine serum albumin, and blocked for 1 hour. Subsequently, the membrane is placed in 3% BSA-PBS containing 1 mg / mL MAA lectin (EY Laboratories, San Mateo, CA) or 1 mg / mL SNA-I lectin (EY Laboratories, San Mateo, CA). Incubate for 4 hours at. After incubation, the membrane was washed six times with PBST for 10 minutes and then reacted with 0.2 mg / mL horseradish peroxidase (HRP) -conjugated streptavidin (1: 500; Sigma-Aldrich) for one hour. After the reaction, the membrane was washed 6 times with PBST for 10 minutes in the same manner to identify the sialated protein by ECL kit (GE Healthcare).

As a result, Maackia recognizes α2,3-linkage of Neu5Ac α (2,3) Gal β (1,4) GlcNAc in Hror_ST. Sambucus recognizes amurensis (MAA) lectins and Neu5Ac α (2,6) Gal and Neu5Ac α (2,6) GalNAc Although both nigra (SNA) rattin blots were identified, almost no MAA and SNA-I lectins were measured in the bisial oxidized fetuin, a negative control, and only in SNA-I for the fetuin, a positive control. It was confirmed (FIG. 3).

<2-2> Free glycan  Used Confirmation of sialic acid transfer activity of sialic acid transferase

The present inventors used free glycan as a substrate to confirm the activity of other sialic acid-transferase-derived substrates in vitro After carrying out a siallation reaction, the sialic acid transfer activity was confirmed.

Specifically, in vitro To carry out the sialation reaction, the crude extract was used to make the sialylated receptor bisialic oxidized sugar chain (asialoglycan) 0.01-10 mg / mL, sialic acid donor CMP-sialic acid 0.1-0.5 mg / mL, 10 mM MnCl ₂ , 1%. Triton X-100 and 0.02 Unit TEV (Tobacco Etch Virus) protease were mixed with PBS and reacted at 20 to 40 ° C. for 1 to 12 hours. After the reaction, the measurement of the product of the sialic acid transferase was determined by phosphatase for cyclic monophosphate (CMP), which is released after the sialic acid is transferred to the sugar receptor from CMP-sialic acid after the sialic acid transferase reaction. Using the enzymatic reaction), according to the method described in Wu et al. (Glycobiology 21, 727 (2011)).

As a result, the sialic acid transferase was able to confirm the activity of the bisial oxidized free sugar chain (asialo free glycan) (Table 1).

<2-3> Confirmation of sialic acid linkage of sialic acid transferase

The present inventors have cleaved sialic acid by treatment with binding specific sialidase to confirm sialic acid binding of bisiaalfetuin sialated by sialic acid-transferase-derived sialic acid transferase and confirmed by lectin analysis. It was.

Specifically, in order to perform the in vitro sialation reaction, the crude extract identified in the protein expression was 1 mg / mL of sialylated receptor bisial oxidized pethuin, sialic acid donor CMP-sialic acid 0.5 mg / mL, 10 mM MnCl ₂ and 1% Triton X-100, 0.02 Unit Tobacco Etch Virus (TEV) protease were mixed with PBS (phosphate buffered saline) and reacted at 25 ° C. for 1 to 12 hours. Then in vitro Streptococcus , α (2,3) -sialic acid binding specific sialidase, to confirm the sialic acid binding of sialated bisial oxidized fetuin synthesized through sialation reaction pneumonia exo-sialidase (Sigma-Aldrich) and Vibrio After reacting with α2,3 (6) (8) -sialic acid hydrolysis sialidase (Sigma-Aldrich) of chorelae at 30 ° C. overnight, MAA lectin or α2,6- to confirm α2,3-linkage Binding of sialic acid transferred by sialic acid transferase by measuring glycoprotein to which sialic acid was added by lectin blot analysis using the same method as in <Experiment 2-1> using SNA-I lectin for linkage confirmation (linkage) was confirmed.

As a result, sialized bisial oxidized fetuin by MAA lectin was measured despite treatment with exo-sialidase of S. penumoniae that specifically hydrolyzes α2,3-linked sialic acid. The same result was observed with the used hST3 (FIG. 3).

<110> Korea Research Institute of Bioscience and Biotechnology <120> Sialyltransferase of Halocynthia rorentzi and a method for          synthesis of sialoglycoconjugates using it <130> 11p-08-50 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 981 <212> DNA <213> Halocynthia rorentzi <400> 1 atgataagac ccatttacca gcgtcatact gcagttatta tcgtttttgg aattacgata 60 gcgctttcaa gcctttccct tatttacaaa ataggtagta gccaattaac tgcgaggtgg 120 cagatgcaaa tcgtactgag cagagacaaa agtattcttg atgaaagcac tgttactaac 180 gtgtcaaggg ggacagggaa tcgaaacaaa agaataataa atggatatca ctcgttcaac 240 agcaaacaaa atctctcatt tgcttgcgat acatgtgctt tagttagcag ttccggaact 300 cttttaggca gcaaatcggg caacgacatc gacaaatatc cttgtgtgtt tcgaatgaac 360 gatgctccca cgttgacata tgaaaaagat gttggaagta agacgactgc tagagtggtt 420 gctcattcag ctgtcaaagc cataactgac tatttacaat acaatacgtt gggaaatcag 480 gaggccaact caacaacatt cattgtttgg ggtcctgaca gaaatatgaa acatggaggg 540 gttgcatatc aaatgctcag ataccttgaa gtaaaatatc catttattaa atttttcatt 600 tacgatcccc gaacggtagc gtatgctgat aaaattttcg aaaaagaaac aggccgccca 660 agaattgggt caggatctta tttgagtacc ggatggttca cgtttctact catgaaaaaa 720 gtttgtggaa gaattgctgt atatggtatg gtcgaagagc aacactgtaa caaaaagatc 780 ctcaatccga aattaattga tgcaccgtac cactattatc gtcctcttgg tccaaaacaa 840 tgcaccactt acatagccca tgaacgtgct aaatttggag cgcaccgttt catcactgag 900 aaaaaggttt tcaaaaaatg ggcaaaggaa tggggtaatg ttgagttcca ttctcctcaa 960 tggaatcttt ccgatatatg a 981 <210> 2 <211> 326 <212> PRT <213> Halocynthia rorentzi <400> 2 Met Ile Arg Pro Ile Tyr Gln Arg His Thr Ala Val Ile Ile Val Phe   1 5 10 15 Gly Ile Thr Ile Ala Leu Ser Ser Leu Ser Leu Ile Tyr Lys Ile Gly              20 25 30 Ser Ser Gln Leu Thr Ala Arg Trp Gln Met Gln Ile Val Leu Ser Arg          35 40 45 Asp Lys Ser Ile Leu Asp Glu Ser Thr Val Thr Asn Val Ser Arg Gly      50 55 60 Thr Gly Asn Arg Asn Lys Arg Ile Ile Asn Gly Tyr His Ser Phe Asn  65 70 75 80 Ser Lys Gln Asn Leu Ser Phe Ala Cys Asp Thr Cys Ala Leu Val Ser                  85 90 95 Ser Ser Gly Thr Leu Leu Gly Ser Lys Ser Gly Asn Asp Ile Asp Lys             100 105 110 Tyr Pro Cys Val Phe Arg Met Asn Asp Ala Pro Thr Leu Thr Tyr Glu         115 120 125 Lys Asp Val Gly Ser Lys Thr Thr Ala Arg Val Val Ala His Ser Ala     130 135 140 Val Lys Ala Ile Thr Asp Tyr Leu Gln Tyr Asn Thr Leu Gly Asn Gln 145 150 155 160 Glu Ala Asn Ser Thr Thr Phe Ile Val Trp Gly Pro Asp Arg Asn Met                 165 170 175 Lys His Gly Gly Val Ala Tyr Gln Met Leu Arg Tyr Leu Glu Val Lys             180 185 190 Tyr Pro Phe Ile Lys Phe Phe Ile Tyr Asp Pro Arg Thr Val Ala Tyr         195 200 205 Ala Asp Lys Ile Phe Glu Lys Glu Thr Gly Arg Pro Arg Ile Gly Ser     210 215 220 Gly Ser Tyr Leu Ser Thr Gly Trp Phe Thr Phe Leu Leu Met Lys Lys 225 230 235 240 Val Cys Gly Arg Ile Ala Val Tyr Gly Met Val Glu Glu Gln His Cys                 245 250 255 Asn Lys Lys Ile Leu Asn Pro Lys Leu Ile Asp Ala Pro Tyr His Tyr             260 265 270 Tyr Arg Pro Leu Gly Pro Lys Gln Cys Thr Thr Tyr Ile Ala His Glu         275 280 285 Arg Ala Lys Phe Gly Ala His Arg Phe Ile Thr Glu Lys Lys Val Phe     290 295 300 Lys Lys Trp Ala Lys Glu Trp Gly Asn Val Glu Phe His Ser Pro Gln 305 310 315 320 Trp Asn Leu Ser Asp Ile                 325 <210> 3 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Hzi2_Forward primer <400> 3 accccggatt ctagaactag tggatccccc atgataagac ccatttacca gcgt 54 <210> 4 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Hzi2_Reverse primer <400> 4 tttaactgga acttttatat ttaaaagggg aggagaatgg aactcaacat tacc 54 <210> 5 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> hST3GAL_forward primer <400> 5 accccggatt ctagaactag tggatccccc atggttagta agtcccgctg gaag 54 <210> 6 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> hST3GAL_reverse primer <400> 6 ttaactggaa cttttatatt taaaaggggg aaggacgtga ggttcttgat agc 53

Claims (13)

Polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 having sialic acid transferase activity derived from the locust ( Halocynthia rorentzi ).
A polynucleotide encoding the polypeptide of claim 1.
The polynucleotide of claim 2, wherein the polynucleotide comprises a nucleotide sequence of SEQ ID NO: 1.
An expression vector comprising the polynucleotide of claim 2.
A transformant transformed with the expression vector of claim 4.
1) transforming the host cell with the expression vector of claim 4;
2) culturing the transformant of step 1); And
3) A method for preparing an active sialic acid transferase derived from Halocynthia rorentzi , comprising recovering sialic acid transferase from the culture of step 2).
The transformant of claim 6, wherein the host cell is a bacterium or a yeast.
The method of claim 7, wherein the bacterium is Staphylococcus aureus), Escherichia coli (E. coli), Bacillus cereus (B. cereus), Salmonella tie blood myurim (Salmonella typimurium ), Salmonella choleraesuis , Yersinia enterocolitica ) and Listeria monocytogenes .
The method of claim 7, wherein the yeast transformant, characterized in that belonging to the genus Saccharomyces as MY access (Saccharomyces), Pichia (Pichia), inclusive Vero My process (Kluyveromyces), Hanse Cronulla (Hansenula) or Candida (Candida) .
According to claim 7, wherein the yeast Saccharomyces ( Saccharomyces) cerevisiae ) Transformant characterized in that the FGY217 strain.
1) mixing the sialic acid transferase, sialylation receptor and sialic acid donor of claim 1; And
2) A method for producing a sialic acid added saccharide complexed saccharide comprising reacting the mixture of step 1) to add sialic acid to the receptor.
12. The method of claim 11, wherein the sialated receptor is monosaccharide, oligosaccharide, polysaccharide, peptide, protein, glycoprotein, lipid, glycolipid, proteoglycan.
12. The method of claim 11, wherein the sialic donor is a CMP-sialic acid and a CMP-sialic acid derivative.

Images