KR101457514B1 - Sialyltransferase of Halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it - Google Patents

Abstract

The present invention relates to a treatment marine invertebrate origin of sialic acid transferase for sialic oxide required for remodeling a sugar chain of a glycoprotein for, and more specifically to squirt (sea squirts, Halocynthia a novel gene encoding a sialic acid transferase derived from rorentzi , an expression vector containing the novel gene, a transformant transformed using the expression vector, an active type expressed in a transgenic host, Methods for producing sialic acid-added oligosaccharides, glycolipids, and glycoproteins using sialic acid transferase protein and techniques for adding sialic acid using the same, increase the stability of the therapeutic glycoprotein, Can be advantageously used for the targeting of the < / RTI >

Description

Technical Field [0001] The present invention relates to a sialyltransferase derived from Aspergillus oryzae and a method for synthesizing a sialylated complex saccharide using the same,

A gene encoding a sialyltransferase derived from an amphibian (mermaid), an active sialyltransferase in which the gene is expressed in a heterologous host, and a sialic acid transferase using the same to add sialic acid to an oligosaccharide, a glycoprotein, To a technique for synthesizing a complex saccharide.

Many types of glycoprotein, glycolipid and proteoglycan glycans present on the surface of cell membranes are responsible for the infection of host cells of bacteria and viruses, adhesion of bacterial toxins, And cancer metastasis are deeply involved in the periodic life phenomena of multicellular societies due to interactions such as recognition and adhesion of cells in the processes of fertilization and development and differentiation including induction of differentiation of immune cells and nerve cells. Sugar chains present in glycolipids, proteoglycans, etc. are collectively referred to as glycoconjugates, and each sugar chain is constructed and redesigned by a glycosyltransferase that synthesizes the sugar chains thereof and a glycosidase that degrades the glycoconjugate. The gene encoding these two enzymes is referred to as a glycogene. Unlike protein synthesis, sugar chain synthesis is not directly regulated by genes but is secondarily constructed by regulatory control of sugar chain transferase enzymes or sugar chain enzymes encoded by sugar chain genes. Glycosyltransferases are a group of enzymes that transfer donor sugar from a donor nucleotide to a receptor to form a new glycosidic bond. (GIc), galactose (Gal), N-acetylglucosamine (GlcNAc), N-acetylgalactosamine (GalNAc), glucuronic acid, xylose Xylose, fucose, mannose, sialic acid (NeuAc, NeuGc), and the like. Receptors include monosaccharides, oligosaccharides, polysaccharides, peptides, proteins, glycoproteins, lipids, glycolipids, proteoglycans, and the like. Since the sugar chain synthesis is carried out by a glycosyltransferase specific to the anomer structure (? -,? -) of the sugar, the glycosidic bond site and the sugar chain to be formed, about 200 to 300 different glycosyltransferases (1983) J. Natl. Cancer Inst. 71: 231-251; Weisgerber et al. (1991) Glycobiology 1 : 357-365).

In 1982, ST6Gal Ⅰ was first purified and the cDNA was cloned from the expression library in 1987 using this enzyme. Subsequently, in 1992, the cDNAs of ST3Gal I and III were purified by affinity chromatography using CDP-hexanolamine and cloned using the partial amino acid sequence of the obtained protein. The sialyltransferase is a sialic acid-transferring enzyme which is produced by reacting sialic acid with a sialic acid such as galactose (Gal), galactosamine (GalNAc), or sialic acid (NeuAc) (2, 6) -, and α (2,8) - bonds, and it is known that sialyltransferases are found in almost all of the higher animals except for plants Paulson and Rademacher (2009) Nat. Struct. Mol. Biol. 16: 1121-1122).

Sialic acid transferase has been cloned and functionally interpreted from various tissues of various higher animals (Harduin-Lepers et al., (2005) Glycobiology 15: 805-817) and studies on prokaryotic genes are underway. Recently, sialic acid transferase has also been reported in bacteria, and β-galactoside α-2,6-sialyltransferase cloned from the marine photosynthetic bacterium Photobacterium species, lipooligosaccharide α-2,3-sialyltransferase cloned from the pathogenic bacterium Neisseia , Structural and functional analyzes of polysialic acid synthase genes cloned from E. coli K1 have been under way (Aoki et al., (1992) Proc Natl Acad Sci USA 89: 4319- (1992) J. Biol. Chem. 267: 24433-24440; Breton et al., (1998) Glycobiology 8: 87-94; Weston et al. 267: 4152-4160).

Sialic acid is a negative charge added to the end of the sugar chain. About 50 kinds of sialic acid derivatives have been found in the natural world so far. Sialic acid plays an important role in cellular biological phenomena such as intercellular interactions in mammals, the role of mediators in signaling in cells, and the stabilization of glycoproteins. In particular, in vivo sialylated sugar chains are known to be one of the first recognized sugar chains upon pathogen infection (Sasisekharan and Myette (2003) Am. Sci. 91: 432-441; Vimr and Lichtensteiger (2002) Trends Microbiol. 10: 254-257 ), Sialic acid present on the cell surface is known to constitute a capsule-type polysaccharide oligosaccharide for immunosuppressive action and cell protection even in the microorganism of the hospital itself (Vimr et al., (2004) Microbiol. 68: 132-153). When sialic acid is synthesized by itself in pathogenic microorganisms, sialic acid is synthesized in the cell through a sialic acid metabolism circuit, or sialic acid outside the cell is transferred into a cell through a sialic acid transporter existing on the cell surface, It is known to synthesize sialic acid through metabolic pathways (Vimr and Lichtensteiger (2002) Trends Microbiol. 10: 254-257).

Sialic acid is chemically structurally difficult to synthesize because it contains a carboxyl group linked to the anomeric position of the second carbon, a deoxy of the third carbon, and glycerol branched at the sixth carbon, Is known to be very low. In addition, in the case of sialic acid-added sugar chains, in addition to the complicated chemical structure of sialic acid, the sialic acid receptor sugar chain also has many functional groups, so that it is not easy to add sialic acid to a desired position. Therefore, most of the sialic acid- It is produced by chemical - enzymatic synthesis in which sialyltransferase reaction, which is an acid transferase, and chemical synthesis are combined. Chemo-enzyme synthesis requires a sialic acid acceptor sugar chain and a sialic acid donor, a neucleotide-sugar, cystidine-5-monophospho-N-acetyl-beta-neuamic acid (CMP-NeuAc). In the case of the sialyltransferase used at this time, only enzymes derived from higher animals such as rats and humans are currently being used in a limited manner. However, as recent marine biosynthetic studies have been actively studied, a variety of sugar chain synthetic genes have been found in marine invertebrates, and in particular, a number of gene sequences encoding proteins similar to sialyltransferases have been reported (Harduin-Lepers et al. (2005) Glycobiology 15: 805-817). In the evolutionary aspect, the sialyltransferase from marine invertebrate has broad substrate specificity, so that if a stable source of enzyme is obtained, sialic acid addition can be utilized as a material for improving sugar chain synthesis and sialic acid reaction . In addition, the effective sialic acid transfer reaction of sialyltransferases from marine invertebrates enables sialic acid addition and redesign of glycoprotein products such as sialic acid glycoproteins, It will be useful.

Therefore, the sialylation of glycoprotein through sialic acid addition of biscarboxylic acid glycoprotein using the asialic acid-transferring enzyme of the present invention improves the efficacy and safety of sialic acid-important medical glycoprotein, It is expected to be used in the improvement process of existing glycoprotein products due to the improvement of existing drugs or the application to new indications.

It is an object of the present invention to provide a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, which has sialic acid transferase activity derived from Ascidian ( Hallocynthia rorentzi ).

Yet another object of the present invention is to provide a polynucleotide of SEQ ID NO: 1 which encodes the sialic acid transferase derived from the asparagus.

It is still another object of the present invention to provide an expression vector comprising the polynucleotide.

It is still another object of the present invention to provide a transformant transformed with an expression vector.

It is still another object of the present invention to provide a method for producing an active sialyltransferase derived from ascidia.

It is another object of the present invention to provide a method for producing a sialic acid complexed saccharide.

In order to achieve the above object, the present invention provides a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 having a sialic acid transferase activity derived from an aspen ( Halocynthia rorentzi )

In addition, the present invention provides a polynucleotide of SEQ ID NO: 1 which encodes a sialic acid transferase derived from the asparagus.

The present invention also provides an expression vector comprising the polynucleotide.

The present invention also provides a transformant transformed with an expression vector.

The present invention also provides a method for producing an active sialyltransferase derived from ascidia.

In addition, the present invention provides a method for producing a sialic acid-added oligosaccharide, a glycolipid, a sugar peptide, or a glycoprotein.

The sialyltransferase derived from the asparagus of the present invention is selectively targeted to yeast Golgi, is excellent in sialic acid addition activity to the receptor, is capable of producing a sialic acid transferase in a heterologous host, And thus can be usefully used as an enzyme resource for sialylation of a therapeutic glycoprotein.

1 is a schematic diagram of an asparagine-derived sialic acid transferase;
(A): schematic diagram of the function and structural elements of sialyltransferases deduced from amino acid sequences; And
(B): a schematic diagram when a sialyltransferase expressed in fusion with a fluorescent protein (GFP) is expressed on a yeast Golgi membrane.
FIG. 2 is a photograph showing the appearance of a sialic acid transferase in the form of fusion with a fluorescent protein (GFP) in yeast Golgi using confocal microscopy;
eV: only the cloning vector used as the negative control; the transformed yeast;
hST3Gal: Expression of human-derived sialyltransferase protein in fusion with fluorescent protein (GFP) used as a positive control; And
HrorST: Expression of sialyltransferase protein from ascid fused with fluorescent protein.
3 is a graph showing the degree of sialic acid addition to a model sialic acid receptor protein asialofetuin using a sialic acid transferase through a lectin blot; Fig.
eV: sample of cell-cell extract treated yeast containing only the cloning vector used as a negative control;
hST3Gal: a cell crude extract treatment sample of a recombinant yeast expressing human-derived sialic acid transferase used as a positive control;
HrorST: a cell crude extract-treated sample of recombinant yeast expressing asparagine-derived sialic acid transferase;
fetuin: a positive control, fetuin;
asialofetuin: negative control; bisacylphosphate;
+, -; A sample before and after the removal of sialic acid from the protein using an exo-α-sialidase;
top; Maackia Lectin blot using amurensis (MAA) lectin; And
Below: Sambucus Lectin blot using nigra (SNA-I) lectin.
FIG. 4 is a graph showing the amount of expression of the sialic acid transferase expressed in a recombinant yeast expressing a sialic acid transferase fused with a fluorescent protein using Western blot using a fluorescent protein detection antibody;
eV: Cellular crude extract of yeast containing only the cloning vector used as a negative control;
hST3Gal: cell-cell extract of recombinant yeast expressing human-derived sialic acid transferase fused with fluorescent protein used as a positive control; And
HrorST: Cellular crude extract of recombinant yeast expressing asparagine-derived sialic acid transferase fused with fluorescent protein.

Hereinafter, the present invention will be described in detail.

The present invention relates to a method for the treatment of ascidia 2 , which has sialic acid transferase activity derived from < RTI ID = 0.0 > rorentzi . < / RTI >

The present invention also provides a polynucleotide of SEQ ID NO: 1 encoding the sialic acid transferase derived from the asparagus.

In a specific embodiment of the present invention, the present inventors have extracted cDNA from RNA from an ascid adult, and using this, cDNA encoding an ascanic sialic acid transferase was obtained and its nucleotide sequence was determined (SEQ ID NO: 1) It was confirmed that this was a novel base sequence. In addition, the amino acid sequence of the sialic acid transferase from Ascaris was confirmed using the above base sequence (SEQ ID NO: 2), and it was found that it contains all of the sialyltransferase sialyltransferase, it was assumed to form a disulfide bond that contains the cysteine residue found in the sialyl motif and has structural characteristics of the protein and includes a golgi targeting signal And it is presumed to be a typical type II transmembrane protein having an active domain (catalytic domain) in the direction of the lumen when expressed on the ossification membrane. In addition, the catalytic domain located in the lumen of the lumen contains a number of N-linked glycosylation sites and is thus expected to be expressed in cells in glycoprotein form (FIGS. 1A and 1B).

The present invention also provides an expression vector comprising a polynucleotide.

The present invention also provides a transformant transformed with the expression vector.

In addition,

1) transforming the host cell with the expression vector;

2) culturing the transformant of step 1); And

3) recovering the sialyltransferase from the culture of step 2). The present invention also provides a method for producing an active sialyltransferase derived from an Ascidian ( Halocynthia rorentzi ).

The host cell is preferably a bacterial, yeast, insect or animal cell, but is not limited thereto.

The bacteria may be selected from the group consisting of Staphylococcus aureus), Escherichia coli (E. coli), Bacillus cereus (B. cereus), Salmonella Thai blood myurim (Salmonella typimurium), cholera, salmonella can be device (Salmonella choleraesuis , Yersinia < RTI ID = 0.0 > enterocolitica , and Listeria monocytogenes . However, the present invention is not limited thereto.

Wherein the yeast is one selected from the group consisting of as transformants, characterized in that belonging to the genus Saccharomyces as MY access (Saccharomyces), inclusive Vero My process (Kluyveromyces), Pichia (Pichia), Hanse Cronulla (Hansenula) or Candida (Candida) it is one of, and preferably, my process to the three saccharide Levy cyano (Saccharomyces cerevisiae FGY217 strain, but is not limited thereto.

In a specific embodiment of the present invention, the present inventors inserted the cDNA of sialyltransferase derived from ascension into a vector tagged with yEGFP to prepare an active sialyltransferase expression vector, which was then transformed into Saccharomyces The expression level and expression level of the strain were transformed into the strain of S. cerevisiae FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) and compared with the human sialyltransferase expressed in the same manner. As a result, it was confirmed through confocal microscopy (see FIG. 2) that the asialic acid transferase of the present invention was more effectively targeted to the Golgi apparatus membrane of the yeast than the human sialic acid transferase (see FIG. 2) (Fig. 4). As shown in Fig. 4, the expression level of human sialic acid-transferase was comparable to that of control. From these results, it can be seen that although the expression is similar to that of conventional human sialic acid transferase, it shows superior marking ability.

Therefore, the vector and the transformant expressing the sialic acid transferase of the present invention can effectively express the sialic acid transferase, which is more specific than the conventional sialic acid transferase.

In addition,

1) mixing the sialic acid transferase, sialylated receptor and sialic acid donor derived from the ascidium; And

2) reacting the mixture of step 1) to add sialic acid to the receptor.

The sialylated receptor may be any one selected from the group consisting of monosaccharide, oligosaccharide, polysaccharide, peptide, protein, glycoprotein, lipid, glycolipid and proteoglycan, but is not limited thereto.

The sialylation donor is preferably selected from the group consisting of CMP-sialic acid and CMP-sialic acid derivatives, but is not limited thereto.

In a particular embodiment of the present invention, the inventors have found that by using a sialic acid transfer activity of sialic acid transferase to squirt derived bicyclic alsan currency-to-substrate of the (asialofetuin) sialic reaction in The sialylated protein was examined in vitro by lectin blot analysis. As a result, Maackia recognition of α2,3 -linkage of Neu5Ac α (2,3) Gal β (1,4) GlcNAc Sambucus nigra (SNA-I) -cactin blots that recognize amurensis (MAA) lectin and Neu5Ac alpha (2,6) Gal and Neu5Ac alpha (2,6) GalNAc were all identified (Figure 3), free glycans Was used as a substrate to carry out the sialylation reaction in vitro to confirm that the sialylated product of the sialyltransferase was transferred to the receptor of sialic acid by the enzyme reaction of phosphatase to the released cyclic monophosphate (CMP) As a result, the activity of the sialyltransferase on the asialo free glycan was confirmed (see Table 1).

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the present invention is not limited to the following Examples and Experimental Examples.

< Example  1> Ascidian (urchin, Halocynthia rorentzi )in  Determination of nucleotide sequence of sialic acid transferase

The present inventors have found that ascidia The gene for sialyltransferase from rorentzi was cloned.

Specifically, specifically, in order to clone a gene encoding a sialic acid transferase in a cDNA library synthesized from RNA extracted from an ascid adult, a DNA sequence of a sialic acid transferase gene registered in NCBI (National Center for Biotechnology Information) And degenerated DNA probes based on highly conserved motifs on amino acid sequences. Using the synthesized DNA probe, a highly conserved motif (VS-motif from L-motif) fragment of Halocynthia roretzi was denatured at 95 ° C for 3 minutes, denatured at 94 ° C for 30 seconds, Amplification was carried out by 30 cycles of annealing and extension at 72 ° C for 0.5 min. Based on this, a full-length sialyltransferase gene was obtained through RACE (rapid amplification of cDNA ends) and cloned into pSPORT1 vector. The cDNA encoding the sialyltransferase cloned into the above vector was determined using the T7 promoter primer and the SP6 primer to determine the nucleotide sequence of the sialyltransferase from ascidian (SEQ ID NO: 1), which is a novel sequence through BLAST of NCBI Respectively.

< Example  2> Ascidian (urchin, Halocynthia rorentzi ) Derived amino acid of sialic acid transferase Sequencing

The present inventors have found that the inventors believe that ascidia The amino acid sequence of the sialyltransferase from rorentzi was analyzed through the base sequence of the sialyltransferase from the ascidium .

Specifically, amino acid sequence analysis was performed using Dnasis 3.1 or a bioinformatics program of the same type based on the asanate transferase base sequence derived from the ascidium as determined in Example 1 above.

As a result, it was confirmed that the amino acid sequence of the asparagine-derived sialyltransferase was confirmed (SEQ ID NO: 2), which contained all the sialyl motifs of a typical eukaryotic sialyltransferase, Containing cysteine residues found in reel motifs (FIGS. 1A and 1B).

< Example  3> Ascidian (urchin, Halocynthia rorentzi ) Derived sialic acid transferase

The present inventors constructed an expression vector and transformed into yeast in order to express the asparagine-derived sialic acid transferase in the yeast as a heterologous host.

Specifically, the pSPORT1 vector containing the cDNA of sialic acid transferase derived from the asparagine of Example 1 was used as a template and the hi2_Forward primer 5'-ACCCCGGATTCTAGAACTAGTGGATCCCCATGATAAGACCCATTTACCAGCGT-3 '(SEQ ID NO: 3) and the Hz2_Reverse primer 5'-TTTAACTGGAACTTTTATATTTAAAAGGGGAGGAGAATGGAACTCAACATTACC- 3 cycles of denaturation at 95 ° C for 3 sec, denaturation at 94 ° C for 30 sec, annealing at 60 ° C for 45 sec and extension at 72 ° C for 3 min. And the gene of the derived sialic acid transferase was amplified. At this time, the hST3Gal_Forward primer 5'-ACCCCGGATTCTAGAACTAGTGGATCCCCCATGGTTAGtAAGTCCCGCTGGAAG-3 '(SEQ ID NO: 5) and the hST3Gal_Reverse primer 5'- PCR conditions of 40 cycles of denaturation at 95 DEG C for 3 minutes, denaturation at 94 DEG C for 30 seconds, annealing at 45 DEG C for 45 seconds and extension at 72 DEG C for 3 minutes were carried out using TTAACTGGAACTTTTATATTTAAAAGGGGGAAGGACGTGAGGTTCTTGATCG-3 '(SEQ ID NO: 6) PCR was performed. Then, each amplified DNA was extracted and ligated with the PCR-amplified pRS424GAL-yEGFP (URA ⁺ ) vector in which yEGFP tagged with the restriction enzyme SpeI / BamHI was ligated with E. coli Escherichia E. coli ) DH5 [alpha]. Clones containing the sialyltransferase coding gene in the recombinant plasmid obtained in Escherichia coli at the correct cloning site of the vector were identified and sequenced by restriction enzyme treatment and DNA sequencing. In addition, my process to the three saccharide Levy cyano (Saccharomyces S. cerevisiae FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) strains were analyzed by a lithium acetate method.

As a result, yEGFP-tagged expression of the sialyltransferase was detected in the whole cell, crude extract and in situ SDS-PAGE. Identifiable umpires (uk, Halocynthia rorentzi- derived sialic acid transferase-encoded Vector.

< Experimental Example  1> Ascidian (urchin, Halocynthia rorentzi ) Derived sialic acid transferase Host Yeast Targeting  And expression confirmation

<1-1> Ascidian (urchin, Halocynthia rorentzi ) Derived sialic acid transferase Host Yeast Targeting  Confirm

The present inventors observed confocal microscopy to confirm the appearance of the asparagine-derived sialic acid transferase in yeast.

Specifically, the pRS424GAL-derived recombinant vector of Example 3 was transformed into strain Saccharomyces cerevisiae FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) by the lithium acetate method . Thereafter, the above-mentioned saccharomyces cerevisiae containing the recombinant vector of Example 3 derived from pRS424GAL having an auxotroph marker FGY217 strain was cultured in SC-Leu medium, which is a dropout medium. Single colonies of the transformed strains were cultured in SC-URA medium containing 2% glucose for 24 to 48 hours, and then 1/100 of the culture was cultured in SC-URA medium containing 0.1% glucose at OD600 of 0.6 To 0.8. Then, 20% D-galactose was added to a final concentration of 2%, and the protein localization in the cell per unit time was incubated at 30 ° C using a confocal microscope to perform sialic acid transfer The tagged GFP in the enzyme was observed.

As a result, it was confirmed through confocal microscopy that the sialyltransferase exists in a spot shape, which is a typical form observed in the Golgi apparatus, and the control group, human sialic acid transferase , It was confirmed that the asialic acid-transferring enzyme derived from aspen was more effectively targeted to the Golgi apparatus membrane of the yeast cell and was located in a dot shape (FIG. 2).

<1-2> Ascites (mukae, Halocynthia rorentzi ) Derived sialic acid transferase Host Yeast Confirmation of expression

The present inventors observed western blot to determine the amount of expressed sialyltransferase from yeast in yeast.

Specifically, the pRS424GAL-derived recombinant vector of Example 3 was transformed into strain Saccharomyces cerevisiae FGY217 (MATα, ura3-52, lys2Δ201, pep4Δ) by the lithium acetate method . Thereafter, Saccharomyces cerevisiae containing the above recombinant vector with nutritional requirement marker FGY217 strain was cultured in SC-Leu medium, which is a dropout medium. Single colonies were cultured in SC-URA medium containing 2% glucose for 24 to 48 hours, and 1/100 of the culture was cultured in an SC-URA medium containing 0.1% glucose such that an OD600 value was 0.6 to 0.8 Respectively. Then, 20% D-galactose was added to a final concentration of 2%, and the cells were incubated at 30 ° C., and the expression of the tagged sialyltransferase gene was confirmed by GFP in the cells per unit time. After extracting the cells, the cells were disrupted using a bead beater, centrifuged at 6,000 rpm to remove microfractured cells, and the supernatant was taken. Proteins expressed in this crude extract were identified by Western blotting .

As a result, the expression amounts of the human sialyltransferase, which is a control group, and the sialyltransferase from Ascidia of the present invention were confirmed to be similar to each other (FIG. 4).

< Experimental Example  2> Ascidian (urchin, Halocynthia rorentzi ) Identification of Sialic Acid Transferase Activity

<2-1> Bisacylphosphate ( Asialofetuin ) Identification of sialic acid transfer activity of sialyltransferase

The present inventors have found that by using as a substrate a bicyclic alsan currency-to-person (asialofetuin) to determine the activity of the squirt-derived sialic acid transferase in vitro After performing the sialylation reaction, the sialylated protein was confirmed by lectin blot analysis.

Specifically, in vitro To carry out the sialylation reaction, the crude extract identified in protein expression was used to express sialylated receptor bisphosphate 1 mg / mL, sialic acid donor CMP-sialic acid 0.5 mg / mL, 10 mM MnCl ₂ and 1 % Triton X-100, 0.02 Unit TEV (Tobacco Etch Virus) protease was mixed with PBS (phosphate buffered saline) and reacted at 25 ° C for 1 to 12 hours. Then, in order to confirm the sialization of the enzyme reaction product by means of a lectin blot analysis, the sialylated enzyme reaction product was mixed with 5 × Laemmli buffer, boiled for 10 minutes, and electrophoresed on 8% SDS-PAGE gel Proteins were isolated. The separated proteins were transferred to a nitrocellulose membrane and blocked with PBST (containing 0.5% Tween) containing 3% bovine serum albumin for 1 hour. The membrane was then placed in 3% BSA-PBS containing 1 mg / mL MAA lectin (EY Laboratories, San Mateo, CA) or 1 mg / mL SNA-I lectin (EY Laboratories, San Mateo, CA) Lt; / RTI &gt; for 4 hours. After incubation, the membranes were washed 6 times for 10 minutes with PBST and then reacted with 0.2 mg / mL horseradish peroxidase (HRP) -conjugated streptavidin (1: 500; Sigma-Aldrich) for one hour. After the reaction, the membrane was washed with PBST 6 times for 10 minutes in the same manner, and the sialylated protein was identified by ECL kit (GE Healthcare).

As a result, the Maackia Hror_ST recognizing α2,3- combination of Neu5Ac α (2,3) Gal β ( 1,4) GlcNAc Sambucus recognizing amurensis (MAA) lectins and Neu5Ac alpha (2,6) Gal and Neu5Ac alpha (2,6) GalNAc Although nigra (SNA) -cactin blots were all detected, MAA and SNA-I lectin were almost not detected in the negative control bisphosphate ptuin, whereas only the SNA-I signal was detected in the positive control fetuin (Fig. 3).

<2-2> Free glycan  Used Identification of sialic acid transfer activity of sialyltransferase

The present inventors have found that in using the free sugar (Free glycan) as a substrate to determine activity on other substrates of the squirt-derived sialic acid transferase vitro After performing the sialylation reaction, the sialic acid transfer activity was confirmed.

Specifically, in vitro In order to carry out the sialylation reaction, a sialylated receptor bicaly acid asialoglycan 0.01-10 mg / mL, a sialic acid donor CMP-sialic acid 0.1-0.5 mg / mL, 10 mM MnCl ₂ , 1% Triton X-100 and 0.02 Unit TEV (Tobacco Etch Virus) protease were mixed with PBS and reacted at 20 to 40 ° C for 1 to 12 hours. After the reaction, measurement of the product of the sialyltransferase was carried out in the presence of phosphatase (CMP) on cyclic monophosphate (CMP) liberated after the transfer of sialic acid from the CMP-sialic acid to the receptor after the sialic acid transferase reaction ) According to the method described in Wu et al. (Glycobiology 21, 727 (2011)).

As a result, the activity of the sialyltransferase on the asialo free glycan was confirmed (Table 1).

<2-3> Identification of sialic acid linkage of sialic acid transferase

The present inventors have found that sialic acid is cleaved by treating binding specific sialidase to confirm sialic acid binding of asialofetuin sialylated by sialic acid transferase from ascidia and then confirmed by lectin analysis Respectively.

Specifically, in order to carry out the in vitro sialylation reaction, a crude extract identified in protein expression was used to obtain a sialylated receptor bisphosphate phytoune 1 mg / mL, a sialic acid donor CMP-sialic acid 0.5 mg / mL, 10 mM MnCl ₂ and 1% Triton X-100, 0.02 Unit TEV (Tobacco Etch Virus) protease were mixed with PBS (phosphate buffered saline) and reacted at 25 ° C for 1 to 12 hours. Then, in vitro In order to confirm the sialic acid binding of the sialylated bisacylphosphate synthesized through sialylation reaction, an α (2,3) -sialic acid binding specific sialidase, Streptococcus pneumonia exo-sialidase (Sigma-Aldrich) and Vibrio (6) (8) -sialic acid hydrolysis sialidase (Sigma-Aldrich) at 30 ° C overnight, and then MAA lectin or α2,6- Using the SNA-I lectin for linkage confirmation, the sialic acid-added glycoprotein was measured by a lectin blot analysis in the same manner as in <Experimental Example 2-1>, and the binding of the sialic acid transferred by the sialic acid transferase (linkage).

As a result, sialylated bisacylphosphate by MAA lectin was measured despite the treatment of exo-sialidase of S. penumoniae that specifically hydrolyzed the α2,3-linked sialic acid, and as a positive control The same result was also observed in the used hST3 (Fig. 3).

<110> Korea Research Institute of Bioscience and Biotechnology <120> Sialyltransferase of Halocynthia rorentzi and a method for          synthesis of sialoglycoconjugates using it <130> 11p-08-50 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 981 <212> DNA <213> Halocynthia rorentzi <400> 1 atgataagac ccatttacca gcgtcatact gcagttatta tcgtttttgg aattacgata 60 gcgctttcaa gcctttccct tatttacaaa ataggtagta gccaattaac tgcgaggtgg 120 cagatgcaaa tcgtactgag cagagacaaa agtattcttg atgaaagcac tgttactaac 180 gtgtcaaggg ggacagggaa tcgaaacaaa agaataataa atggatatca ctcgttcaac 240 agcaaacaaa atctctcatt tgcttgcgat acatgtgctt tagttagcag ttccggaact 300 cttttaggca gcaaatcggg caacgacatc gacaaatatc cttgtgtgtt tcgaatgaac 360 gatgctccca cgttgacata tgaaaaagat gttggaagta agacgactgc tagagtggtt 420 gctcattcag ctgtcaaagc cataactgac tatttacaat acaatacgtt gggaaatcag 480 gaggccaact caacaacatt cattgtttgg ggtcctgaca gaaatatgaa acatggaggg 540 gttgcatatc aaatgctcag ataccttgaa gtaaaatatc catttattaa atttttcatt 600 tacgatcccc gaacggtagc gtatgctgat aaaattttcg aaaaagaaac aggccgccca 660 agaattgggt caggatctta tttgagtacc ggatggttca cgtttctact catgaaaaaa 720 gtttgtggaa gaattgctgt atatggtatg gtcgaagagc aacactgtaa caaaaagatc 780 ctcaatccga aattaattga tgcaccgtac cactattatc gtcctcttgg tccaaaacaa 840 tgcaccactt acatagccca tgaacgtgct aaatttggag cgcaccgttt catcactgag 900 aaaaaggttt tcaaaaaatg ggcaaaggaa tggggtaatg ttgagttcca ttctcctcaa 960 tggaatcttt ccgatatatg a 981 <210> 2 <211> 326 <212> PRT <213> Halocynthia rorentzi <400> 2 Met Ile Arg Pro Ile Tyr Gln Arg His Thr Ala Val Ile Ile Val Phe   1 5 10 15 Gly Ile Thr Ile Ale Leu Ser Ser Leu Ser Leu Ile Tyr Lys Ile Gly              20 25 30 Ser Ser Gln Leu Thr Ala Arg Trp Gln Met Gln Ile Val Leu Ser Arg          35 40 45 Asp Lys Ser Ile Leu Asp Glu Ser Thr Val Thr Asn Val Ser Arg Gly      50 55 60 Thr Gly Asn Arg Asn Lys Arg Ile Ile Asn Gly Tyr His Ser Phe Asn  65 70 75 80 Ser Lys Gln Asn Leu Ser Phe Ala Cys Asp Thr Cys Ala Leu Val Ser                  85 90 95 Ser Ser Gly Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Soy             100 105 110 Tyr Pro Cys Val Phe Arg Met Asn Asp Ala Pro Thr Leu Thr Tyr Glu         115 120 125 Lys Asp Val Gly Ser Lys Thr Thr Ala Arg Val Val Ala His Ser Ala     130 135 140 Val Lys Ala Ile Thr Asp Tyr Leu Gln Tyr Asn Thr Leu Gly Asn Gln 145 150 155 160 Glu Ala Asn Ser Thr Thr Phe Ile Val Trp Gly Pro Asp Arg Asn Met                 165 170 175 Lys His Gly Gly Val Ala Tyr Gln Met Leu Arg Tyr Leu Glu Val Lys             180 185 190 Tyr Pro Phe Ile Lys Phe Phe Ile Tyr Asp Pro Arg Thr Val Ala Tyr         195 200 205 Ala Asp Lys Ile Phe Glu Lys Glu Thr Gly Arg Pro Arg Ile Gly Ser     210 215 220 Gly Ser Tyr Leu Ser Thr Gly Trp Phe Thr Phe Leu Leu Met Lys Lys 225 230 235 240 Val Cys Gly Arg Ile Ala Val Tyr Gly Met Val Glu Glu Gln His Cys                 245 250 255 Asn Lys Lys Ile Leu Asn Pro Lys Leu Ile Asp Ala Pro Tyr His Tyr             260 265 270 Tyr Arg Pro Leu Gly Pro Lys Gln Cys Thr Thr Tyr Ile Ala His Glu         275 280 285 Arg Ala Lys Phe Gly Ala His Arg Phe Ile Thr Glu Lys Lys Val Phe     290 295 300 Lys Lys Trp Ala Lys Glu Trp Gly Asn Val Glu Phe His Ser Pro Gln 305 310 315 320 Trp Asn Leu Ser Asp Ile                 325 <210> 3 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Hz2_Forward primer <400> 3 accccggatt ctagaactag tggatccccc atgataagac ccatttacca gcgt 54 <210> 4 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Hz2_Reverse primer <400> 4 tttaactgga acttttatat ttaaaagggg aggagaatgg aactcaacat tacc 54 <210> 5 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> hST3GAL_forward primer <400> 5 accccggatt ctagaactag tggatccccc atggttagta agtcccgctg gaag 54 <210> 6 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> hST3GAL_reverse primer <400> 6 ttaactggaa cttttatatt taaaaggggg aaggacgtga ggttcttgat agc 53

Claims (13)

2. A polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 with sialic acid transferase activity derived from ascidia ( Hallucinosidia rorentzi ).
A polynucleotide encoding the polypeptide of claim 1.
3. The polynucleotide of claim 2, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 1.
An expression vector comprising the polynucleotide of claim 2.
A transformant prepared by transforming a mammalian host cell other than a human with the expression vector of claim 4.
1) transforming a host cell with the expression vector of claim 4;
2) culturing the transformant of step 1); And
3) step 2) Ascidian (sea squirts, Halocynthia rorentzi) comprises the step of recovering the sialic acid transferase from the culture of a method of manufacturing a sialic acid transferase activity derived type.
7. The method according to claim 6, wherein the host cell is a bacterium or yeast.
The method of claim 7, wherein the bacteria is Staphylococcus Cocos Aust Julius (Staphylococcus aureus), Escherichia coli (E. coli), Bacillus cereus (B. cereus), Salmonella tie blood myurim (Salmonella typimurium), Salmonella choleraesuis could device (Salmonella choleraesuis , Yersinia enterocolitica , and Listeria monocytogenes . 2. The method according to claim 1, wherein the enzyme is selected from the group consisting of cholerae , choleraesuis , Yersinia enterocolitica and Listeria monocytogenes .
The method of claim 7, wherein in the yeast is Saccharomyces My process (Saccharomyces), Pichia (Pichia), inclusive Vero My process (Kluyveromyces), Hanse squirt derived activity, characterized in that belonging to the genus Cronulla (Hansenula) or Candida (Candida) Type sialic acid transferase.
8. The method according to claim 7, wherein the yeast is Saccharomyces cerevisiae strain FGY217.
1) mixing the sialic acid transferase, sialylated receptor and sialic acid donor from the ascendant of claim 1; And
2) reacting the mixture of step 1) to add sialic acid to the receptor.
12. The method of claim 11, wherein the sialylated receptor is monosaccharide, oligosaccharide, polysaccharide, peptide, protein, glycoprotein, lipid, glycolipid, proteoglycan.
12. The method of claim 11, wherein the sialylated donor is CMP-sialic acid.

Images