KR20130011343A - Method for producing diol compound with high yield using mutant of glycerol fermenting microorganism - Google Patents

Abstract

PURPOSE: A method for preparing diol compounds from glycerol using a mutant strain is provided to improve production of 1,3-propandiol and 2,3-butandiol. CONSTITUTION: A method for preparing 1,3-propandiol comprises: a step of culturing a lactate dehydrogenase gene-deleted strain in a medium of pH 5.5-6.5 containing 30-80 g/L of glycerol; a step of preparing 1,3-propandiol; and a step of collecting the prepared 1,3-propandiol. The strains is prepared using a microorganism which produces 1,3-propandiol from glycerol. The microorganism is K. pneumoniae. The medium contains glycerol as a carbon source. A method for preparing 2,3-butandiol comprises: a step of culturing lactate dehydrogenase gene-deleted strain in a medium of pH 5.5-6.5 containing 10-60 g/L of glycerol; a step of producing 2,3-butandiol; and a step of collecting the prepared 2,3-butandiol.

Description

Method for Producing Diol Compound with High Yield Using Mutant of Glycerol Fermenting Microorganism}

The present invention relates to a method for producing a diol compound from glycerol using a mutant strain, a diol compound in a high yield using a variant lacking a gene encoding a lactate dehydrogenase in a microorganism having glycerol fermentation ability A method for producing phosphorous 1,3-propanediol and 2,3-butanediol.

As a major by-product of current biodiesel manufacturing processes, waste glycerol is generated in an amount equivalent to about 10% (w / w) of total production (Johnson and Taconi, Environ Prog, 26: 338, 2007). This waste glycerol not only affects the price of the traditional glycerol market, but also can be released into the environment, and thus has emerged as an important environmental problem such as treatment cost (da Silva et al . Biotechnol Adv , 27:30, 2009). Therefore, there is an active development of a method for converting low-cost waste glycerol into industrially valuable materials, including fuels and bioactive substances.

Glycerol can be converted to a variety of chemical raw materials by microbial fermentation, a typical example is 1,3-propanediol. 1,3-propanediol is a material that can be used as a synthetic material such as polyester, polyether, or polyurethane. It is used for various purposes such as. In particular, polytrimethylene terephtalate (PTT) produced by the polymerization reaction of 1,3-propanediol and terephtalic acid has excellent physical properties and has a lower point than polyethylene terephthalate (PET) at 228 ° C. It is attracting attention as a next-generation textile material that can replace PET in the future due to its substantial utility. In addition, plastics and polymers made of 1,3-propanediol as monomers have better optical stability than products made of butanediol and ethylene glycol. In addition, since 1,3-propanediol can be used as a polyglycol-type lubricant and solvent, its commercial value is higher than that of glycerol. In addition, the microbial fermentation of glycerol can be utilized as a raw material for the production of synthetic rubber 2,3-butanediol can be produced.

As possible the fermentation metabolism of glycerol microorganisms produce a Clostridium (Clostridium), Enterobacter (Enterobacter), keurep when Ella (Klebsiella), Lactobacillus (Lactobacillus) and the like is known, 1,3-propanediol by these (US Pat. No. 5,254,467) and genetic engineering method may be used to improve the ability to produce 1,3-propanediol by using a variant that amplifies or knocks out the glycerol dihydrogenase gene (US 2007 / 0148749), it is necessary to improve the production yield for commercialization.

Accordingly, the present inventors have made intensive efforts to develop a method for producing chemical raw materials such as 1 and 3-propanediol in high yield using glycerol, resulting in a gene encoding a lactate dehydrogenase in a glycerol fermented microorganism strain. The present invention was completed by confirming that the production conditions of the diol compounds 1,3-propanediol and 2,3-butanediol can be greatly increased by improving the culture conditions of the modified variants.

The present invention is to provide a method for producing a diol compound in high yield by culturing the glycerol fermentation microbial variant.

In order to achieve the above object, the present invention is a microorganism having the ability to produce 1, 3-propanediol from glycerol by culturing the strain in which the lactate dehydrogenase gene is deleted in a glycerol containing medium 1, 3- propanediol Producing a; And it provides a method for producing 1, 3-propanediol comprising the step of obtaining the produced 1, 3-propanediol.

The present invention also provides a method for producing 2,3-butanediol by culturing a strain in which a lactate dehydrogenase gene is deleted in a glycerol-containing medium in a microorganism having the ability to produce 2,3-butanediol from glycerol; And it provides a method for producing 2,3-butanediol comprising the step of obtaining the produced 2,3-butanediol.

According to the present invention, the production of 1,3-propanediol or 2,3-butanediol can be significantly improved through a new culture method of glycerol fermented microbial variants.

Figure 1 shows the manufacturing process of K. pneumoniae Δ ldhA mutant strain.
Figure 2 shows the result of glycerol fermentation culture in neutral culture conditions (pH 7.0).
Figure 3 shows the result of glycerol fermentation culture in acidic culture conditions (pH 6.0).
Figure 4 shows the glycerol fermentation culture results in the air injection amount 1.0 (A), 2.0 (B), 3.5 (C).
5 shows glycerol fermentation culture results at a glycerol concentration of 30-80 g / l.

The present invention relates to a method for producing a diol compound from glycerol using a variant strain, and more particularly, to a method for producing 1,3-propanediol and 2,3-butanediol from glycerol using a variant strain.

In view of the above, the present invention contains 30-80 g / l glycerol of a strain in which a lactate dehydrogenase gene is deleted in a microorganism having the ability to produce 1, 3-propanediol from glycerol, pH 5.5-6.5 Culturing with an air injection of 1.5-2.5vvm in phosphorus medium to produce 1, 3-propanediol; And it relates to a method for producing 1, 3-propanediol comprising the step of obtaining the produced 1, 3-propanediol.

In the present invention, the microorganism having the ability to produce 1, 3-propanediol from the glycerol is preferably Krebsiella pneumoniae, it is preferable to culture in a medium containing glycerol as the only carbon source.

In one embodiment of the present invention, the strain from which the D-lactate dehydrogenase gene ( ldhA ) is removed on the chromosome of K. pneumoniae is maintained in a medium of pH 6.0 maintained at a glycerol concentration of 30-80 g / L. Incubation with an air injection of 2.0 vvm yielded 102.7 g / L of 1,3 propanediol.

This resulted in 69.3 g of 1,3 propanediol when 1, 3 propanediol was produced by incubating the mutant strain from which the existing ldhA gene was removed in an air supply of 0.5vvm in a pH 7.0 medium containing 20 g / l glycerol. That's much better than / L.

In another aspect, the present invention is a medium containing 10 ~ 60g / l glycerol, strain containing a lactate dehydrogenase gene in a microorganism having the ability to produce 2,3-butanediol from glycerol, pH 5.5 ~ 6.5 medium At 3.0 to 4 vvm of air injection, culturing to produce 2,3-butanediol; And it relates to a method for producing 2,3-butanediol comprising the step of obtaining the produced 2,3-butanediol.

In the present invention, the microorganism having the ability to produce 2,3-butanediol from the glycerol is preferably Krebsiella pneumoniae, and preferably cultured in a medium containing glycerol as the only carbon source.

In one embodiment of the present invention, the strain from which the D-lactate dehydrogenase gene ( ldhA ) is removed on the chromosome of K. pneumoniae is maintained in a medium of pH 6.0 maintained at a glycerol concentration of 10-60 g / L. Incubation with an air injection of 3.5 vvm yielded 71.5 g / L of 2,3-butanediol.

This resulted in the production of 2,3-butanediol when the mutant strain from which the existing ldhA gene was removed was cultured at 20 g / l glycerol containing pH 7.0 medium at an air supply of 0.5vvm, compared to 38.0 g / L. It can be said to be an improved amount.

In the present invention, "deletion" of a gene means a state in which the gene is deleted on a chromosome or a plasmid to be unable to produce a protein encoded by the gene, and "disabling" of the gene means that the gene is inserted, translocated, By some deletion, it means a state in which the gene cannot be encoded.

Cultivation of the variant according to the present invention can be carried out according to well-known methods, conditions such as the culture temperature and time, the pH of the medium can be appropriately adjusted. Recovery of 1,3-propanediol from the culture medium of the mutant may use a conventional separation technique, for example, distillation, electrodialysis, pervaporation, chromatography, solvent extraction, reaction extraction, etc., usually high purity These may be used in combination to separate the materials.

Hereinafter, the present invention will be described in more detail with reference to Examples. It will be apparent to those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited to these embodiments.

Example 1 Preparation of Mutant Wines with Deficient Lactic Acid Production in Klebsiella pneumoniae

The D-lactate dehydrogenase gene ( ldhA ) present on the chromosome of K. pneumoniae was replaced with the antibiotic apramycin resistance gene and removed on the chromosome.

To this end, first, the upstream and downstream regions of the ldhA gene were amplified and linked by 900 bp, respectively, and then a DNA fragment into which the apramycin resistance gene was inserted was prepared. The prepared DNA fragments were introduced into K. pneumoniae strains (ATCC 20071), and recombinant strains forming colonies in the medium to which the antibiotic apramycin was added were obtained. The chromosomal DNA of the obtained recombinant strain was analyzed by PCR to confirm that homologous recombination occurred correctly, thereby finally obtaining a mutant strain (Δ ldhA ) in which the ldhA gene was deleted.

Klebsiella pneumoniae Δ ldhA Oligonucleotide Sequences Used in the Production of Mutant Strains Primer Sequence ldhA
up F: CAGCCAGACGGGAATAGCTT (SEQ ID NO: 1) R: CGCCAATTTTCTGGTGCTTCAGATATCGCCTCAAGGTCGACGTTGTTAA (SEQ ID NO: 2) ldhA
down F: TTAACAACGTCGACCTTGAGGCGATATCTGAAGCACCAGAAAATTGGCG (SEQ ID NO: 3) R: AGCTCGATGGTTCGGCGATT (SEQ ID NO: 4)

Example 2: Culture of Lactic Acid Deficient Mutant

Metabolites were analyzed by fed-batch fermentation of the Δ ldhA strain prepared in Example 1 in a medium containing glycerol as the only carbon source.

Medium composition was 20 g / l glycerol, 3.4g / l K ₂ HPO ₄ , 1.3g / l KH ₂ PO ₄ , 0.2g / l MgSO ₄ , 0.002g / l CaCl ₂ 2H ₂ O, 1g / l yeast extract, 1 ml / L iron solution [5 g / l FeSO ₄ 7H ₂ O, 4 ml HCl (37%, w / v)] and 1 ml / L trace element solution [70 mg / l ZnCl ₂ , 100 mg / l MnCl ₂ 4H ₂ O, 60 mg / l H ₃ BO ₃ , 200 mg / l CoCl ₂ 4H ₂ O, 20 mg / l CuCl ₂ 2H ₂ O, 25 mg / l NiCl ₂ 6H ₂ O, 35 mg / l Na ₂ MoO ₄ 2H ₂ O, 4 ml HCl (37% , w / v)].

In the 5-L fermentation tank to which 2 L of the medium was added, the bacterial inoculation amount was 10%, the culture temperature was 37 ° C, the stirring speed was 200 rpm, pH 7.0, and the air supply rate was 0.5 vvm). The yield of was increased to 35.2 g / L or more, whereas the Δ ldhA strain produced little lactic acid, and the production of 1,3-propanediol was about 69.3 g / L, which was about the wild type strain (Cu). 10% higher. The hourly productivity and conversion were 1.33 g / h and 0.42 mol / mol (1,3-propanediol / glycerol), respectively (FIG. 1). Meanwhile, the yield of 2,3-butanediol was 32.5 g / l.

Glycerol Fermentation in Neutral Culture Conditions (pH 7.0) Cu ΔldhA Glycerol consumed (g / l) 182.6 199.5 1,3-Propanediol (g / l) 63.4 69.3 2,3-Butanediol (g / l) 15.4 32.5 Lactate (g / l) 35.2 0.0 Succinate (g / l) 5.7 14.9 Acetate (g / l) 3.0 2.2 Ethanol (g / l) 7.8 8.9 1,3-PD conversion (mol / mol) 0.42 0.42 1,3-PD productivity (g / l.h) 1.32 1.33

Example 3. Δ ldhA  Optimum Culture pH Condition of Mutant Strains

In this example, the pH of the culture solution was confirmed to be optimal for 1,3-propanediol production by the ΔldhA mutant strain. In contrast, K. pneumoniae strains produced the highest 1,3-propanediol at neutral pH, whereas ΔldhA mutant strains produced more 1,3-propanediol when the pH of the culture was reduced to 6. Appeared (FIG. 2). Finally, the yield of 1,3-propanediol was 80.8 g / L, and the conversion and hourly productivity from glycerol were 0.50 mol / mol and 1.39 g / h, respectively. Likewise the yield of 2,3-butanediol also increased to 38.0 g / l.

Glycerol Fermentation in Acidic Culture Conditions (pH 6.0) Cu Δ ldhA Glycerol consumed (g / l) 169.5 196.7 1,3-Propanediol (g / l) 56.9 80.8 2,3-Butanediol (g / l) 18.0 38.0 Lactate (g / l) 13.6 0.0 Succinate (g / l) 3.5 8.6 Acetate (g / l) 3.0 2.4 Ethanol (g / l) 4.0 4.8 1,3-PD conversion (mol / mol) 0.42 0.50 1,3-PD productivity (g / l.h) 1.17 1.39

Example 4 Optimal Air Injection Condition

Δ ldhA mutant strains were cultured under various air injection conditions to examine 1,3-propanediol production (FIG. 4 1.0vvm: FIG. 4A, 2.0vvm: 4B, 3.5vvm: FIG. 4C).

Culture conditions were 2 L medium containing 2% glycerol, inoculum amount 10%, pH 6, incubation temperature 37 ° C., stirring speed 200 rpm. At 2.0 vvm, the yield of 1,3-propanediol was highest (94.3 g / L) and decreased again at 3.5 vvm (52.6 g / L). On the other hand, the production of 2,3-butanediol from glycerol was the highest when the 3.4 vvm (71.5 g / L) (Table 4).

Δ ldhA Effect of Air Injection and Glycerol Concentration on Glycerol Fermentation of Mutant Strains Cu Δ ldhA C1 C1 C2 C3 C4 C5 Glycerol consumed (g / l) 169.5 196.7 240.0 255.8 306.3 251.0 1,3-Propanediol (g / l) 56.9 80.8 90.6 94.3 52.6 102.7 2,3-Butanediol (g / l) 18.0 38.0 62.7 57.9 71.5 54.0 Lactate (g / l) 13.6 ND ND ND ND ND Succinate (g / l) 3.5 8.6 14.5 11.8 12.5 11.4 Acetate (g / l) 3.0 2.4 6.1 3.5 7.0 6.1 Ethanol (g / l) 4.0 4.8 5.0 5.5 4.1 0.8 1,3-PD conversion (mol / mol) 0.42 0.50 0.46 0.45 0.21 0.50 1,3-PD productivity (g / l.h) 1.17 1.39 1.51 1.55 1.28 1.53

C1; pH 6.0, 0.5 vvm, glycerol feed 10-60 g / l.

C2; pH 6.0, 1.0 vvm, glycerol feed 10-60 g / l.

C3; pH 6.0, 2.0 vvm, glycerol feed 10-60 g / l.

C4; pH 6.0, 3.5 vvm, glycerol feed 10-60 g / l.

C5; pH 6.0, 2.0 vvm, glycerol feed 30-80 g / l.

ND, not detected.

Example 5 Influence of Glycerol Concentration

The effect of glycerol concentration in the fermentation culture of Δ ldhA mutant strains was investigated (FIG. 5). Culture conditions were 2 L medium containing 2% glycerol, inoculum 10%, pH 6, incubation temperature 37 ° C., stirring speed 200 rpm, air injection amount was 2.0 vvm. When the glycerol concentration in the fermentation broth was raised to the 30 ~ 80 g / l level, the production of 1,3-propanediol was found to increase (102.7 g / l) (Table 4).

The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Korea institute of Bioscience and Biotechnology <120> Method for Producing Diol Compound with High Yield Using Mutant          of Glycerol Fermenting Microorganism <160> 4 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 cagccagacg ggaatagctt 20 <210> 2 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 cgccaatttt ctggtgcttc agatatcgcc tcaaggtcga cgttgttaa 49 <210> 3 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ttaacaacgt cgaccttgag gcgatatctg aagcaccaga aaattggcg 49 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 agctcgatgg ttcggcgatt 20

Claims (6)

In a microorganism having the ability to produce 1, 3-propanediol from glycerol, the strain which deleted the lactate dehydrogenase gene contains 30-80 g / l of glycerol and 1.5-2.5vvm in a medium of pH 5.5-6.5 In the air injection amount of 1, to produce 1, 3- propanediol; And obtaining 1, 3-propanediol produced above.
The method of claim 1 wherein the microorganism having the ability to produce 1, 3-propanediol from glycerol is Krebsciella pneumoniae.
The method of claim 1 wherein the medium contains glycerol as the only carbon source.
In a microorganism having the ability to produce 2,3-butanediol from glycerol, the strain that deleted the lactate dehydrogenase gene contained 10 to 60 g / l of glycerol and 3.0 to 4 vvm of air in a medium of pH 5.5 to 6.5. Injecting, culturing to produce 2,3-butanediol; And obtaining 2,3-butanediol produced above.
The method of claim 4, wherein the microorganism having the ability to produce 2,3-butanediol from glycerol is Krebsciella pneumoniae.
5. The method of claim 4, wherein the medium contains glycerol as the only carbon source.

Images