KR101516786B1 - Method for Preparing Diol Compounds Using Glycerol Fermenting Microogranism Mutants - Google Patents

Abstract

The present invention, more specifically phospho transferase azepin system (PTS) glucose-specific IIA component gene crr (carbon catabolite repression) defects to coat in a method for producing a diol compound by using a glycerol fermentation microorganism mutant And a method for producing a diol compound such as 1,3-propanediol and 2,3-butanediol from glycerol in the presence of glucose using a microorganism variant having the ability to produce a diol compound from glycerol.
When the glycerol fermenting microorganism variant of the present invention is used, a diol compound such as 1,3-propanediol and 2,3-butanediol can be produced from glycerol in the presence of glucose. Therefore, it is possible to produce a fuel and a physiologically active substance Which can be useful for the conversion of industrially valuable materials, including

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for preparing a diol compound using glycerol fermentation microorganism variant,

The present invention, more specifically phospho transferase azepin system (PTS) glucose-specific IIA component gene crr (carbon catabolite repression) defects to coat in a method for producing a diol compound by using a glycerol fermentation microorganism mutant And a method for producing a diol compound such as 1,3-propanediol and 2,3-butanediol from glycerol in the presence of glucose using a microorganism variant having the ability to produce a diol compound from glycerol.

(Johnson and Taconi, Environ Prog, 26: 338, 2007), which is a major by-product of the biodiesel manufacturing process, produces about 10% (w / w) of the crude glycerol. This waste glycerol has been recognized as an important environmental problem factor, not only because it affects the price of the conventional glycerol market but also because it can not be released directly to the environment (da Silva et al . Biotechnol Adv. , 27:30, 2009). Therefore, development of methods for converting industrial low-grade waste glycerol into industrially valuable materials including fuel and bioactive materials is actively under way.

Glycerol can be converted into various chemical raw materials by microbial fermentation, and a representative example is 1,3-propanediol. 1,3-Propanediol is a material that can be used as a raw material for synthesis such as polyester, polyether and polyurethanes, and can be used for high-performance clothing, fibers such as carpets and automobile fabrics, and plastic films Is used for various purposes. In particular, polytrimethylene terephthalate (PTT), which is produced by the polymerization of 1,3-propanediol with terephthalic acid, is excellent in physical properties and at a temperature of 228 ° C lower than that of polyethylene terephthalate (PET) It has been attracting attention as a next-generation fiber material that can replace PET in the future. In addition, plastics and polymers made from 1,3-propanediol as monomers exhibit better optical stability than products made from butanediol and ethylene glycol. In addition, 1,3-propanediol can be used as a polyglycol-type lubricant and solvent, and thus its commercial value is higher than that of glycerol.

Also, 2,3-butanediol, which can be used as a starting material for synthetic rubber, can be produced by microbial fermentation of glycerol. As possible the fermentation metabolism of glycerol microorganism Clostridium (Clostridium), Enterobacter (Enterobacter), keurep when Ella (Klebsiella), Lactobacillus (Lactobacillus) and so on are known, (US Patent No. 5254467 No.), glycerol fermentation using the same. Studies on the production of diol compounds by metabolism have been made (Sun-Ae Jun et al ., Korean J. Biotechnol . Bioeng 23: 413, 2008; Hassiba Malaoui. meat al ., Appl Microbiol Biotechnol , 55: 226, 2001; WO 2004033646).

However, since the glycerol fermentation metabolism of microorganisms is inhibited in the presence of the most abundant nutrient, glucose, there is a problem in that 1,3-propanediol is not produced in the glycerol culture medium in which glucose is present to support microbial cell growth Aka glucose repression or carbon catabolite repression.

Accordingly, the present inventors have made intensive efforts to develop a method capable of producing 1,3-propanediol and 2,3-butanediol from glycerol in the presence of glucose. As a result, they have found that glucose-specific IIA and the gene crr (carbon catabolite repression) for coating a component is defective, by using a mutant microorganism having the diol compound-producing ability from the glycerol, and the like in the presence of glucose is also 1, 3-propanediol and 2,3-butanediol from glycerol Diol compound, and thus the present invention has been completed.

It is an object of the present invention to provide a microorganism variant having deletion of crr (carbon catabolite repression) which is a gene for coating a glucose-specific IIA component in a phosphotransferase system (PTS) and capable of producing a diol compound from glycerol, And a method for producing a diol compound using a variant.

In order to achieve the above object, the present invention provides a microorganism having a deficiency of crr (carbon catabolite repression) which is a gene for coating a glucose-specific IIA component in a phosphotransferase system (PTS) and which is capable of producing a diol compound from glycerol Provide variants.

The present invention also relates to a method for producing a microorganism having (a) a microorganism variant having a deletion of crr (carbon catabolite repression) which is a gene for coating a glucose-specific IIA component in a phosphotransferase system (PTS) Culturing in a glycerol-containing medium to produce a diol compound; And (b) obtaining the produced diol compound.

When the glycerol fermenting microorganism variant of the present invention is used, a diol compound such as 1,3-propanediol and 2,3-butanediol can be produced from glycerol in the presence of glucose. Therefore, it is possible to produce a fuel and a physiologically active substance Which can be useful for the conversion of industrially valuable materials, including

FIG. 1 shows the expression of krbsiella pneumoniae ) mutant strains.
Figure 2 is a graph showing the expression of Klebsiella < RTI ID = 0.0 > pneumoniae ) in a glucose-containing glycerol culture medium.
FIG. 3 is a graph showing the activity of klebsiella ( Klebsiella spp.) Deficient in crr gene using glycerol medium containing glucose pneumoniae ) variant in a fed-batch fermentation culture.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

In one aspect of the present invention, there is provided a method for producing a microorganism capable of producing a diol compound from glycerol, which is deficient in crr (carbon catabolite repression), which is a gene for coating glucose-specific IIA component in a phosphotransferase system (PTS) Lt; / RTI >

In the present invention, a 'deletion' of a gene means a state in which the gene is deleted on a chromosome or a plasmid so that a protein coated by the gene can not be produced.

In the present invention, the microorganism variant may be characterized as klebsiella pneumoniae .

In one embodiment of the present invention, the crr gene (KPN_02764) present on Klebsiella lysimonica chromosome is replaced with an antibiotic apramycin resistance gene and removed on the chromosome to produce a microorganism mutant lacking the crr gene (Fig. 1).

The crr gene may be represented by the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.

In another aspect of the present invention, the present invention provides a method for producing a glycoprotein comprising the steps of: (a) deleting crr (carbon catabolite repression) which is a gene for coating glucose-specific IIA component in a phosphotransferase system (PTS) Is cultivated in a glycerol-containing medium to produce a diol compound; And (b) obtaining the produced diol compound.

In the present invention, the diol compound may be 1,3-propanediol or 2,4-butanediol.

In the present invention, the microorganism variant may be characterized as klebsiella pneumoniae .

In the present invention, the glycerol-containing medium may be further characterized by containing glucose.

In order to analyze the glycerol fermentation characteristics of the microorganism mutants lacking the crr gene, the microorganism mutants lacking the crr gene were cultured in a medium containing glycerol as the only carbon source. As a result, the microorganism mutants lacking the crr gene had similar cell proliferation and glycerol metabolism characteristics a was found to be seen, as a result of culture in glycerol medium with glucose was added, 1,3-propanediol production by the control strain but was reduced by about 25%, the crr gene of 1,3-propanediol in the microorganism defect mutant (Table 2).

In addition, confirming the effect on the glucose concentration of the crr gene of the microorganism defect mutant result, the concentration of the glucose showed the highest production of 1,3-propanediol to 9.9g / ℓ when comprising 5g / ℓ, As the concentration of glucose increased, the production of 1,3-propanediol gradually decreased (Table 3).

As a result of examining the effect of glucose on the production of 1,3-propanediol by the fermentation of the fermentation broth of the microorganism mutants lacking the crr gene, it was found that, in the presence of glucose, , The production of 3-propanediol decreased from 50.9 g / l to 35 g / l, but the production of 1,3-propanediol increased from 50.6 g / l to 55.0 g / l in microbial mutants lacking the crr gene (Fig. 2 and Table 4).

In addition, as a result of investigation of the influence of air injection amount on the fermentation fermentation culture of the microorganism mutants lacking crr gene, the production amount of 1,3-propanediol from glycerol increased from 0.5 vvm to 1.0 vvm and 2.0 vvm, Increased by 24% and 41%, respectively, at 68.4 g / l and 77.8 g / l, respectively. The production of 2,3-butanediol also increased by 76% and 118% from 22.6g / ℓ to 39.7g / ℓ and 49.2g / ℓ, respectively. It was confirmed that the increase of the diol compound production with the increase of the air injection amount is mainly due to the increase of the glycerol metabolic rate, and the use rate of glucose is not greatly influenced by the change of the air injection amount.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Example  One: Krebscheiler In New Mono crr  The gene Deficient Mutant  making

The crr gene (KPN_02764, SEQ ID NO: 1) present on the chromosome of Klebsiella pneumoniae was replaced with an antibiotic apramycin resistance gene and removed on the chromosome to prepare a microorganism mutant lacking the crr gene.

For this purpose, the upstream and downstream regions of the crr gene were amplified by PCR of about 800 bp, and a DNA fragment in which the apramycin resistance gene was inserted was constructed in the middle. The prepared DNA fragment was introduced into Klebsiella pneumoniae strain (ATCC 20071), and a recombinant strain was obtained which formed a colony on a medium supplemented with the antibiotic apramycin. The chromosomal DNA of the obtained recombinant strain was analyzed by PCR to confirm that homologous recombination occurred correctly, and finally a microorganism mutant lacking the crr gene was obtained (FIG. 1).

From Klebsiella New Moonia The oligonucleotide sequence used in the preparation of the microorganism variant in which the crr gene was deleted Primer Sequence UP-crr F: (SEQ ID NO: 2) ATTCCTGTTCATGGACCGTGAC R: (SEQ ID NO: 3) TCTCGCGAGAAGTGCTATCGACgttaacAGCGTCATTAACTCGTCCGTTGT DN-crr F: (SEQ ID NO: 4) ACAACGGACGAGTTAATGACGCTgttaacGTCGATAGCACTTCTCGCGAGA R: (SEQ ID NO: 5) AAGAGTGGTTTGTCGGGTATCTG

Example  2: crr  gene Deficient Mutant  Characterization of glycerol fermentation metabolism

First, in the medium containing glycerol as the only carbon source, the microorganism mutant lacking the crr gene produced in Example 1 was fermented and analyzed for metabolites.

The medium composition was 20 g / l glycerol, 3.4 g / l K ₂ HPO ₄ , 1.3 g / l KH ₂ PO ₄ , 0.2 g / l MgSO ₄ , 0.002 g / l CaCl ₂ 2H ₂ O, 1 g / ㎖ / ℓ iron solution _{(5g / ℓ FeSO 4 7H 2} O, 4㎖ HCl (37%, w / v)) and 1㎖ / ℓ trace element solution _{(70㎎ / ℓ ZnCl 2, 100㎎} / ℓ MnCl 2 4H _{2 O, 60㎎ / ℓ H 3} BO 3, 200㎎ / ℓ CoCl 2 4H 2 O, 20㎎ / ℓ CuCl 2 2H 2 O, 25㎎ / ℓ NiCl 2 6H 2 O, 35㎎ / ℓ Na 2 MoO 4 2H ₂ O, 4 mL HCl (37%, w / v)).

When cultured in a 5-liter fermenter containing 2 L of the medium, the microorganism mutants lacking the crr gene were found to be almost identical to the control strain when the inoculum amount was 10%, the culture temperature was 37 ° C, the stirring speed was 200 rpm, the pH was 7.0 and the air feed rate was 0.5 vvm And glycerol metabolism. In the glycerol medium supplemented with glucose, the metabolic characteristics of the mutant microorganisms lacking the crr gene were significantly different from those of the control strains. In the presence of glucose, the production of 1,3-propanediol by the control strain was reduced by about 25%, while the production of 1,3-propanediol in the microbial mutants lacking the crr gene was increased by 11.3% (Table 2) .

As a result of fermentation in the same manner as described above in a medium containing only glucose as a sole carbon source, crr These results suggest that the crr gene is a phosphoenolpyruvate-dependent glucose transporter (PTS) (phosphoenolpyruvate: PTS), and that the cell cycle is slower than that of the control strain. sugar phosphotransferase system (PTS_IIA).

Analysis of metabolic characteristics of microorganism mutants lacking crr gene Parent strain crr mutant strain Glycerol Glucose Glycerol plus glucose Glycerol Glucose Glycerol plus glucose Acetate 3.1 4.2 5.6 3.5 5.0 7.0 2,3-Butanediol 0 1.0 2.5 0 1.2 1.5 Ethanol 2.0 3.8 7.5 2.0 3.6 4.0 1,3-Propanediol 8.2 0 6.2 8.2 0 9.3 Succinate 0.5 0.8 2.5 0.3 0.9 1.6 Glycerol, 20 g / l; glucose 20 g / l; metabolites (g / l)

Example  3. crr  The gene Deficient Mutant  Effect of Glucose Concentration on Glycerol Fermentation Metabolism

In this example, the influence of glucose concentration on the glycerol fermentation metabolism of the microorganism mutants lacking the crr gene was examined. As a result of culturing the microorganism variants in which the crr gene was deleted in the above-mentioned glycerol containing glucose at different concentrations, when the glucose concentration was 5 g / l, the yield of 1,3-propanediol was 9.9 g / And the production of 1,3-propanediol tended to decrease gradually as the concentration of glucose increased (Table 3).

Changes in 1,3-Propanediol Production from Glycerol by Glucose Concentration Glucose concentration (g / l) 0 One 5 10 20 Acetate 3.0 3.7 4.0 5.0 5.0 2,3-Butanediol 0 0 0.5 0.9 1.5 Ethanol 1.0 1.2 0.7 2.0 2.0 1,3-Propanediol 8.2 8.3 9.9 9.5 9.1 Succinate 0.5 0.4 0.5 0.9 2.5 Glycerol concentration, 20 g / l; metabolites (g / l)

Example  4. crr  The gene Deficient Mutant Oil price formula In fermentation culture  1,3- Propanediol  production

The effects of glucose on the production of 1,3-propanediol from glycerol were investigated through fed-batch fermentation of microbial mutants lacking the crr gene. Culture conditions were 2 liters of medium containing glycerol or glycerol and glucose, 10% inoculation amount, pH 7, incubation temperature 37 캜, stirring speed 200 rpm. As in the case of the batch culture of Example 2, the production amount of 1,3-propanediol from glycerol decreased from 50.9 g / l to 35 g / l in the presence of glucose in the control strain, but in the microbial mutants lacking the crr gene, The production of 3-propanediol increased from 50.6 g / l to 55.0 g / l (Fig. 2 and Table 4).

Production of 1,3-propanediol and 2,3-butanediol by crude fermentation of microorganism mutants lacking crr gene Parent strain crr mutant strain C1 C2 C1 C2 C3 C4 Acetate 3.5 2.8 8.8 13.2 7.5 3.0 2,3-Butanediol 18.6 21.6 18.2 22.6 39.7 49.2 Ethanol 10.0 11.0 8.6 13.2 7.5 3 1,3-Propanediol 50.9 35.0 50.6 55.0 68.4 77.8 Succinate 10.7 17.0 9.2 7.0 8.3 7.9 Consumed glycerol 150.1 159.2 136.1 145.8 168.0 181.8 Consumed glucose - 28.3 - 36.8 31.4 33.5 C1: pH 7.0, 0.5 vvm, 200 rpm, glycerol only
C2: pH 7.0, 0.5 vvm, 200 rpm, glycerol plus glucose
C3: pH 7.0, 1.0 vvm, 200 rpm, glycerol plus glucose
C4: pH 7.0, 2.0 vvm, 200 rpm, glycerol plus glucose
Metabolites (g / l)

Example  5. By adjusting air injection amount crr  The gene Deficient Mutant  1,3- Propanediol  Increased production

crr genes were affected by the air injection amount for the fed-batch fermentation culture of the microorganism defect mutant Each of the production of 1,3-propanediol from glycerol 68.4 as the air injection amount at 0.5vvm 1.0vvm, increased 2.0vvm g / ℓ and 77.8 g / ℓ, respectively. The production of 2,3-butanediol also increased by 76% and 118% from 22.6g / ℓ to 39.7g / ℓ and 49.2g / ℓ, respectively. The increase of the diol compound production with the increase of the air injection amount is mostly due to the increase of the glycerol metabolism rate, and the utilization rate of glucose is not significantly influenced by the change of the air injection amount (FIG. 3 and Table 4).

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> korea research institute of bioscience and biotechnology <120> Method for Preparing Diol Compounds Using Glycerol Fermenting          Microogranism Mutants <130> P12-B059 <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 510 <212> DNA <213> Klebsiella pneumoniae <400> 1 atgggtttgt ttgataaatt gaaatctctg gtttctgatg acaagaaaga caccggaact 60 attgagattg ttgctcccct ctccggtgag atcgtcaaca ttgaagacgt gccggatgtg 120 gtttttgcgg aaaaaattgt gggcgatggg attgccatca aaccgactgg caacaaaatg 180 gtcgcgccgg tagacggtac cattggtaaa attttcgaaa ccaaccacgc gttctctatt 240 gaatctgata gcggcatcga gctgttcgtt cacttcggta ttgataccgt tgaactgaaa 300 ggcgaaggct tcaagcgcat cgctgaagaa ggtcagcgcg tgaaagtcgg cgatccggtt 360 atcgaatttg atctgccgct gctggaagag aaagccaagt cgactctgac gccggtggtt 420 atctccaaca tggacgagat caaagagctg atcaaactgt ccggtagcgt gaccgtgggt 480 gaaaccccgg taatccgcat caagaagtaa 510 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> crr upstream forward <400> 2 attcctgttc atggaccgtg ac 22 <210> 3 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> crr upstream reverse <400> 3 tctcgcgaga agtgctatcg acgttaacag cgtcattaac tcgtccgttg t 51 <210> 4 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> crr dowmstream forward <400> 4 acaacggacg agttaatgac gctgttaacg tcgatagcac ttctcgcgag a 51 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> crr dowmstream reverse <400> 5 aagagtggtt tgtcgggtat ctg 23

Claims (6)

delete delete A process for preparing a diol compound comprising the steps of:
(a) a microbial mutant capable of producing a diol compound from glycerol in the presence of glucose in the absence of crr (carbon catabolite repression) which is a gene for coating a glucose-specific IIA component in a phosphotransferase system (PTS) is dissolved in glucose and glycerol In a medium containing glycerol to produce a diol compound from glycerol; And
(b) obtaining the produced diol compound.
4. The process according to claim 3, wherein the diol compound is 1,3-propanediol or 2,4-butanediol.
4. The method of claim 3, wherein the microbial variant is klebsiella pneumoniae .
delete

Images