KR20120117568A - Novel narbomycin derivatives compounds, antibacterial composition comprising the same and manufacturing method of the same - Google Patents

Abstract

PURPOSE: A novel narbomycin derivative compound, a compound for anti-biopsies which includes the compound, and a manufacturing method of the compound are provided to synthesize the narbomycin derivative including various glycine parts and to enhance antibiosis. CONSTITUTION: A manufacturing method of narbomycin derivative comprises the following steps: cultivating recombinant microorganisms; and collecting the narbomycin derivative from the cultivated cells or culture fluid. The antibiotic compound includes a compound of chemical formula 1 or a pharmaceutically acceptable salt. In a narbomycin derivative production recombinant microorganism, a nucleic acid which codes the combination of the protein including desVIII, desVII, desIII and desIV protein from a group including desVIII, desVII, desIII, desIV, desI, desII, desV, desVI, oleL, oleU, oleV, eryBII, urdR and oleW.

Description

Novel narbomycin derivatives compounds, antibacterial composition comprising the same and manufacturing method of the same

The present invention relates to a novel narcamycin derivative compound, an antimicrobial composition comprising the compound and a method of producing the compound.

As infectious bacteria gain resistance to most antibiotics, efforts are being made to obtain new kinds of antibiotics to treat bacteria, fungi, viruses and cancer cells that are resistant to conventional antibiotics. To this end, until now, the strains that search for microorganisms in the natural world to produce new antibiotics have been found.However, the process of searching for new antibiotics requires enormous time, effort, and cost, and pharmacological and toxicological tests must be completed. It is a very difficult and difficult task because it can be recognized as an available antibiotic. As a result, many pharmaceutical companies, universities and research institutes are expecting breakthroughs unlike traditional methods.

Accordingly, a method has been attempted to obtain various physiologically active substances with new structures by manipulating the genes of strains producing antibiotics. This method is mainly introduced into the structural modification of polyketide-based antibiotics, and it is called combinatorial biosynthesis because it can generate various structures through the combination of various biosynthetic genes. This method saves time and cost in the screening process compared to the conventional chemical synthesis or enzyme synthesis method, and can be predicted biological activity because it is designed by applying the relationship between the structure and activity of the existing antibiotics, many times Can reduce the cost.

Polyketide-based compounds are complex compounds produced from microorganisms, and more than about 10,000 compounds are known to date. Polyketide-based compounds are biosynthesized by a multifunctional protein complex called polyketide synthase (PKS). These PKS complexes consist of several modules (a bundle of catalytic domains responsible for one condensation reaction) involved in a continuous condensation reaction. Since the structure of the polyketide is biosynthesized in one-to-one correspondence according to the configuration of the catalytic domains constituting the module, the structure of the polyketide may be modified by the modification of the PKS gene.

Macrolides, on the other hand, consist of a polyketide macrolactone ring and one or more deoxysaccharides attached thereto. The macrolides exhibit mainly antimicrobial activity against Gram-positive bacteria such as Staphylococcus and Enterococcus. Since the deoxysugar moiety in macrolides greatly affects the biological activity of the molecule by specific contact with the target molecule, the structure of the deoxy sugar moiety is important, and therefore, it is necessary for the aforementioned PKS gene modification. In addition to polyketide structural modifications, post-PKS tailoring steps such as glycosylation are necessary. Due to the emergence of macrolide antibiotic-resistant pathogens, research continues to find new macrolide derivatives. In the past, many studies using chemical and enzymatic synthesis have been conducted, but there is a problem in that enzymatic synthesis of deoxy sugar moieties or in vitro enzymatic synthesis of nucleotide-activated deoxy sugars is not easy.

Narvomycin is Streptomyces As a macrolide material formed in Venezuela , it is converted to neo-, nova-, and pyromycin by PikC (FIG. 1). Narbomycin is Staphylococcus Aureus , Streptococcus piogenes , Corynebacterium Terry deep cliff, gram - have been reported to have excellent activity toward such resistant strains - erythromycin positive Rhodococcus. Natural narbomycin includes deoxysaccharide D-desosamin as the sugar moiety. Streptomyces Venezuela 's glycosyltransferase DesVII and its auxiliary partner DevVIII transfer the TDP-deoxy sugar to the nagliconide, the naglycone (non-sugar component) of narcamycin, and six open readings. Open reading frame desI to desVI are presumed to be involved in desosamin biosynthesis. Although it has been thought that the protein can be used to induce glycosylation of narcoimycin derivatives in vitro and in vivo , narcamycin derivatives containing various sugar moieties in narcamycin by the method of combinatorial biosynthesis in vivo. There is no example of synthesizing and reporting its antimicrobial activity.

Against this background, the inventors have prepared a cassette comprising a nucleic acid encoding a combination of various sugar biosynthesis related proteins to express a variety of novel navomycin derivatives by heterologous expression in Streptomyces Venezuelan accumulating navonolide . The present invention was completed by discovering that it can be produced.

The present invention is a microorganism of the genus Streptomyces, desVIII, desVII, desIII, desIV, desI, desII, desV, desVI, oleL, oleU, oleV, eryBII, urdR and oleW among a combination of proteins selected from the group consisting of It is an object of the present invention to provide a recombinant microorganism producing a narcamycin derivative, in which a nucleic acid encoding a combination of proteins, including desIII and desIV proteins, has been introduced.

In addition, the present invention is desVIII-desVII-desIII-desIV, desVIII-desVII-desIII-desIV-oleL-oleU, desVIII-desVII-desIII-desIV-desI-desII, desVIII-desVII-desIII-desIV-oleV-eryBII-urdR Or an expression vector comprising a nucleic acid encoding a combination of proteins of desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU.

In addition, the present invention comprises the steps of culturing the recombinant microorganism; And it is to provide a method for producing a narcamycin derivative comprising the step of recovering a narcamycin derivative from the cultured cells or culture medium.

In addition, the present invention is to provide a narbomycin derivative compound represented by the following formula (1), a pharmaceutically acceptable salt thereof.

,

,

또는

이다.In which R is

,

,

or

to be.

In addition, the present invention is to provide an antimicrobial composition comprising the compound of Formula 1 or a pharmaceutically acceptable salt.

In one embodiment, the present invention provides a microorganism of the genus Streptomyces, the protein selected from the group consisting of desVIII, desVII, desIII, desIV, desI, desII, desV, desVI, oleL, oleU, oleV, eryBII, urdR and oleW Provided is a recombinant microorganism producing a narcamycin derivative, in which a nucleic acid encoding a combination of proteins including desVIII, desVII, desIII and desIV proteins in combination is introduced. The combination of these proteins is desVIII-desVII-desIII-desIV, desVIII-desVII-desIII-desIV-oleL-oleU, desVIII-desVII-desIII-desIV-desI-desII, desVIII-desVII-desIII-desIV-oleV-eryBII-urdR Or a combination of proteins of desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU.

Microorganism of the genus Streptomyces in the present invention means a microorganism of the genus Streptomyces capable of biosynthesis of narbomycin intrinsically. The microorganism capable of biosynthesizing narcamycin implicitly means a microorganism that expresses all enzymes necessary for in vivo biosynthesis. The term "intrinsic" refers to the activity of the wild-type microorganism in its natural state. Narvomycin in the present invention is a macrolide-based material, and has a structure as shown in FIG.

Genus Streptomyces microorganism of the present invention is Streptomyces Venezuela Days However, the present invention includes, but is not limited to, all Streptomyces genus microorganisms capable of producing narbomycin. Streptomyces Bene share elrae is so easy to have a relatively fast growth rate genetically modified (doubling time, ca. 1 h ), the shorter the incubation period necessary for the production of metabolites. The microorganism is composed of a single polyketide synthase (PKS) and a number of post-PKS modified enzymes (glycosylation by des clusters involved in biosynthesis and transfer of desosamin sugars and hydroxylation by PikC P450 monooxygenase). Through action it is possible to produce both 12- and 14-membered ring macrolides, methymycin and picromycin (FIG. 1). In a specific embodiment of the invention, Streptomyces Vanessa can use Zwolle below ATCC 15439.

Preferably, the microorganism of the genus Streptomyces is a gene encoding a protein for biosynthesizing and transferring D-desamine, a sugar portion of narvomycin, in a microorganism of the genus Streptomyces capable of intrinsically biosynthesizing narcamycin. The cluster may be deleted from the genome. Microorganisms of Streptomyces, whose gene clusters encode proteins that biosynthesize and transfer the sugar moiety of narbomycin, result in the accumulation of narbonolide, an aglycone (non-sugar component) of narbomycin. do. The gene cluster is desVIII-desVII-desIII-desIV-desI-desII-desV-desVI (SEQ ID NO: 1), which is a gene cluster (GenBank: AF079762.1) encoding a group of proteins necessary for biosynthesis and metastasis of D-desosamine. It can be configured as. The microorganism may be a gene cluster consisting of the nucleotide sequence of SEQ ID NO: 1 from the genome.

Specific deletion of only the gene of interest in the genome can be carried out through methods established in the art, the method is not particularly limited, homologous recombination method can be used. Recombination may be induced between the genome and the vector by transforming a strain of Streptomyces genus with a vector comprising a selection marker between the N- and C-terminal nucleic acids encoding the protein of interest. The selection marker used is not particularly limited, and markers may be used that confer a selectable phenotype such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins.

Preferably Streptomyces Venezuela YJ003 can be used. The strain can be prepared by the method described in the Examples of the present invention.

The present invention has revealed the function of the proteins in the narcamycin derivative production pathway as can be seen in FIG. In addition, by producing recombinant microorganisms expressing a variety of novel combinations of these proteins, new narcommycin derivatives with modified sugar moieties were biosynthesized and their antimicrobial activity was also evaluated.

Protein sequence information necessary for the production of the narcamycin derivative of the present invention can be found in GenBank: AF079762.1, AF055579.2, U77454.1, AF269227.1. Specifically, in the present invention, DesIII is a protein having a function of Nucleotidylyl transferase (NT) based on glucose-1-phosphate and has an amino acid sequence of SEQ ID NO. In the present invention, DesIV is a protein having a function of 4,6-dehydratase (4,6-dehydratase, 4,6-DH), and has the amino acid sequence of SEQ ID NO. DesI in the present invention is a protein that functions as an aminotransferase (AT), and has the amino acid sequence of SEQ ID NO. In the present invention, DesII is a protein having a deaminase (DA) function and has an amino acid sequence of SEQ ID NO. In the present invention, DesV is a protein having an aminotransferase (AT) function, and has the amino acid sequence of SEQ ID NO. In the present invention DesVI is N - as the methyl transferase protein kinase (N -methyltransferase, N-MT) function, and has an amino acid sequence of SEQ ID NO: 7. In the present invention, OleL is an epimerase (EP) protein and has an amino acid sequence of SEQ ID NO: 8. In the present invention, OleU is a protein that functions as 4-ketoreductase (4-ketoreductase, 4-KR) and has an amino acid sequence of SEQ ID NO. In the present invention, OleV is a protein having a function of 2,3-dehydratase (2,3-DH) and has an amino acid sequence of SEQ ID NO: 10. In the present invention, EryBII is a protein that functions as 3-ketoreductase (3-KR) and has the amino acid sequence of SEQ ID NO. UrdR in the present invention is a protein that functions as 4-ketoreductase (4-ketoreductase, 4-KR), and has the amino acid sequence of SEQ ID NO: 12. In the present invention, OleW is a protein having a 3-ketoreductase (3-KR) function, and has an amino acid sequence of SEQ ID NO. In the present invention, DesVIII is a protein having an auxiliary relative function of DesVII, and has the amino acid sequence of SEQ ID NO. In the present invention, DesVII is a protein having a glycosyltransferase function and has an amino acid sequence represented by SEQ ID NO: 15.

Introducing a nucleic acid encoding a combination of these proteins may further introduce the nucleic acid on a chromosome, or introduce the nucleic acid on a vector with a self or enhanced discrete promoter. Preferably, an expression vector may be used to transform microorganisms of Streptomyces spp. Methods for preparing transformed recombinant microorganisms using expression vectors include Sambrook, J., et al., Molecular Cloning, A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory, 1. 74, 1989 The calcium phosphate method or the calcium chloride / rubidium chloride method, the electroporation method, the electroinjection method, the chemical treatment method, such as PEG, the method using a gene gun, etc. are mentioned.

In a specific embodiment of the invention, the recombinant microorganism YJ003 / pDDSS (glycosyltransferase gene desVIII / desVII together with the D -desosamin [DDSS] biosynthetic gene combination ( desIII-desIV-desI-desII-desV-desVI ) plasmid expression), YJ003 / pDQNV (desVIII / desVII and D- quinolyl Novo agarose with [DQNV] biosynthetic gene combinations (desIII - desIV) plasmid expressing), and YJ003 / pODDC (3'- O with desVIII / desVII -Demethyl-D-chalcose [ODDC] biosynthetic gene combination (plasmid expressing desIII - desIV - desI - desII )) is narcamycin , D-quinovoosyl-narbonolide (DQNVNB), and 3 ' O -demethyl-D-chalcoosyl-narbornolide (ODDCNB) was produced respectively (FIGS. 2 to 4). However, recombinant YJ003 / pLRHM2 coming L- ramno the two derivative from the fermentation of (desVIII / L- ramno with desVII OSU [LRHM] biosynthetic gene combinations (desIII-desIV-oleL-oleU ) plasmid expressing) carrying beam Nolide (LRHMNB) and DQNVNB were produced simultaneously (Figures 3 and 4). Simultaneous production of DQNVNB in this strain was achieved by the 4-ketoductase (SvRed) independent of the Streptomyces Venezuela pathway, where 4-keto-6-deoxy-D-glucose, a biosynthetic intermediate of LRHM, was converted to DQNV. Because it was reduced (FIG. 2). Recombinant YJ003 / pDDGT2 (desVIII / D- with desVII digital Messenger source [DDGT] plasmid expressing the biosynthetic gene combinations (desIII-desIV-oleV-eryBII -urdR)) is D- digital Toxoplasma coming-carrying beam surprised Id (DDGTNB ) And D-boibino-osyl-narbonolide (DBVNNB) were produced and combined with recombinant YJ003 / pLOLV2 ( desVIII / desVII L-oliboose [LOLV] and L-digitoxose [LDGT] biosynthetic gene combination ( desIII plasmids expressing -desIV-oleV-oleW-oleL-oleU ) produced L -olibosyl-narbornolide (LOLVNB), L -digitotoxoyl-narbornolide (LDGTNB), and DBVNNB ( 3 and 4). The production of DBVNNB in both strains indicated that the native Streptomyces Venezuelan 3-ketoductase was 2,6-dideoxy-3 as an intermediate of D-digitoxose, L-oliboose and L-digitoxose. Recognizes, 4-diketo-D-glucose and combines with the 4-keto reduction by other unidentified Streptomyces venezuelan 4-ketoductases, reducing at C3 to reduce D-vobinose I think it produced. Simultaneous production of LOLVNB and LDGTNB in YJ003 / pLOLV2 resulted in TDP-4-keto-LOLV and TDP-4-keto formed by OleU 4-ketoductase due to tautomerization from C-3 to C-4 It is thought that LOLV and LDGT were synthesized by acting on -LDGT (Fig. 2).

Among the recombinant microorganisms prepared in a specific embodiment of the present invention, pDDGT2 (plasmid expressing the D-digitoxose [DDGT] biosynthetic gene combination ( desIII-desIV-oleV-eryBII-urdR ) together with desVIII / desVII ) is introduced. Introduced recombinant microorganism and pLOLV2 ( plasmid expressing L-oliboose [LOLV] and L-digitoxose [LDGT] biosynthetic gene combination ( desIII - desIV - oleV - oleW - oleL - oleU ) with desVIII / desVII ) The recombinant microorganisms were deposited at the Korean Culture Center of Microorganisms (KCCM) on March 10, 2011 under the accession numbers KFCC11507P and KFCC11508P, respectively.

In another embodiment, the present invention provides desVIII-desVII-desIII-desIV, desVIII-desVII-desIII-desIV-oleL-oleU, desVIII-desVII-desIII-desIV-desI-desII, desVIII-desVII-desIII-desIV-oleV An expression vector is provided comprising a nucleic acid encoding a combination of proteins of -eryBII-urdR or desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU.

In the present invention, an "expression vector" is a recombinant vector capable of expressing a protein of interest in a suitable host cell, and is a gene construct containing essential regulatory elements operably linked to express a gene insert. Standard recombinant DNA techniques can be used for this purpose. As used herein, the term "operably linked" refers to a functional linkage of a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein can be operably linked to affect the expression of the encoding nucleic acid sequence. The type of expression vector is not particularly limited as long as it expresses a gene of interest in various host cells of prokaryotic cells and produces a protein of interest, but a form similar to that of a natural state with a strong promoter and strong expression ability Vectors capable of producing large amounts of foreign proteins of are preferred. The expression vector preferably contains at least a promoter, an initiation codon, a gene encoding a protein of interest, and a termination codon terminator. In addition, the DNA encoding the signal peptide, an operator sequence, a non-translated region, a selectable marker region, or a replicable unit on the five and three sides of the gene of interest may be appropriately included. The initiation codon and the termination codon can generally be considered part of the nucleic acid sequence encoding the protein of interest and must be functional when the gene construct is introduced and must be in frame with the coding sequence. The promoter of the vector may be constitutive or inducible.

In a specific embodiment of the invention, the nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV is SEQ ID NO: 16, the nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-oleL-oleU is SEQ ID NO: 17, The nucleic acid encoding the protein combination of desVIII-desVII-desIII-desIV-desI-desII is SEQ ID NO: 18, the nucleic acid encoding the protein combination of desVIII-desVII-desIII-desIV-oleV-eryBII-urdR is SEQ ID NO: 19, desVIII- The nucleic acid encoding a protein combination of desVII-desIII-desIV-oleV-oleW-oleL-oleU may be SEQ ID NO: 20.

Further, in a specific embodiment of the present invention, pDQNV (expression vector comprising nucleic acid of SEQ ID NO: 16 encoding a protein combination of desVIII-desVII-desIII-desIV) is a cleavage map of Figure 7, pLRHM2 (desVIII-desVII-desIII An expression vector comprising a nucleic acid of SEQ ID NO: 17 encoding a protein combination of -desIV-oleL-oleU) is a cleavage map of FIG. 8, a sequence encoding a protein combination of pODDC (desVIII-desVII-desIII-desIV-desI-desII). Expression vector comprising a nucleic acid of No. 18) is a cleavage map of Figure 9, pDDGT2 (expression vector comprising a nucleic acid of SEQ ID NO: 19 encoding a protein combination of desVIII-desVII-desIII-desIV-oleV-eryBII-urdR) The cleavage map of FIG. 10, pLOLV2 (expression vector comprising the nucleic acid of SEQ ID NO: 20 encoding a protein combination of desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU), is a cleavage map of FIG. 11, pDDSS (desVIII). Contains a nucleic acid of SEQ ID NO: 1 encoding a protein combination of -desVII-desIII-desIV-desI-desII-desV-desVI Is an expression vector) may have a cleavage map of FIG.

In another aspect, the present invention comprises the steps of culturing the recombinant microorganism; And it provides a method for producing a narcamycin derivative, comprising the step of recovering a narcamycin derivative from the cultured cells or culture medium.

The term "culture" in the present invention means to grow microorganisms under environmental conditions that are appropriately artificially controlled. Microbial culture for producing a novel naromycin derivative of the present invention can be cultured in a medium containing nutrients that can be used by conventional microorganisms. As a nutrient source of microorganisms, a nutrient source commonly used in the art may be used without limitation, and a known nutrient source used for culturing bacteria of Streptomyces genus may be used. For example, it is preferably made in a medium containing malonic acid, ethanol, methionine, a carbon source and a nitrogen source. At this time, the carbon source is preferably at least one selected from the group consisting of starch, glucose, corn oil, glycerol, maltose, mannose and inositol, and most preferably starch, glucose and corn oil. In addition, the nitrogen source is preferably at least one selected from the group consisting of cottonseed wheat, corn steep liquor, corn steep flour, soy flour, peptone and yeast extract, it is most preferred that the cottonseed mill and corn steep liquor. The spawn culture was incubated in a fermentor containing the culture medium. As a culture method, shaking culture or political culture is possible under aerobic conditions. The culture temperature is slightly different depending on the conditions when incubated in each of the above conditions, it is usually suitable to incubate at 20-37 ℃, preferably can be cultured at 26-30 ℃. In addition, the culture period can also be cultured for a known period used in the art, the period can be adjusted as necessary. Preferably shaking culture, in the case of stationary culture, all can be cultured for 4 days to 7 days.

The method of recovering narbomycin derivatives from cultured cells or cultures can be carried out according to methods well known in the art. Filtration, anion exchange chromatography, crystallization and HPLC may be used as the method for recovering the narcamycin derivative, but is not limited thereto.

인 경우는 D-보이비노오실-나르보놀라이드(DBVNNB), R이

인 경우는 D-디지톡소오실-나르보놀라이드 (DDGTNB), R이

인 경우는 L-올리보오실-나르보놀라이드 (LOLVNB), R이

인 경우는 L-디지톡소오실-나르보놀라이드 (LDGTNB)이다.As another aspect, the present invention provides a narbomycin derivative compound represented by the formula (1), a pharmaceutically acceptable salt thereof. R in the narcamycin derivative represented by Formula 1

In the case of D-boibino-osyl-narbornolide (DBVNNB), R is

When D-Digitoxosyl-narbornolide (DDGTNB), R is

L-olibosilyl-narbornolide (LOLVNB), R

In the case of L-digitoxosol-narbonolide (LDGTNB).

As a result of identification using nuclear magnetic resonance spectra, it was confirmed that the compound of Formula 1 was a novel naromycin derivative.

 Compounds of the invention may be in the form of solvates or prodrugs, which are included within the scope of the invention. Solvates preferably include hydrates and ethanolates.

The term "pharmaceutically acceptable salt" in the present invention may be a relatively nontoxic inorganic and organic acid addition salt of a compound. As the salts, acid addition salts formed by pharmaceutically acceptable free acid are useful. Concentrations having a relatively nontoxic and harmless effect on a patient include any organic or inorganic addition salt that does not adversely affect the beneficial effects of the compound of formula (I).

Acid addition salts are prepared by conventional methods, for example by dissolving a compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. Equivalent molar amounts of the compound and acid or alcohol (eg, glycol monomethyl ether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.

At this time, an organic acid and an inorganic acid may be used as the free acid, and hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, and the like may be used as the inorganic acid, and methanesulfonic acid, p-toluenesulfonic acid, acetic acid, and trifluoroacetic acid may be used as the organic acid. , Maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid , Gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanic acid, hydroiodic acid, etc. Can be used, but not limited to these.

Bases can also be used to make pharmaceutically acceptable metal salts. Alkali metal salts or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and then evaporating and drying the filtrate. In this case, as the metal salt, it is particularly suitable to prepare sodium, potassium or calcium salt, but is not limited thereto. Corresponding silver salts may also be obtained by reacting alkali or alkaline earth metal salts with a suitable silver salt (eg, silver nitrate).

Pharmaceutically acceptable salts of the compounds represented by Formula 1 include salts of acidic or basic groups which may be present in the compound, unless otherwise indicated. For example, pharmaceutically acceptable salts may include sodium, calcium and potassium salts of the hydroxy group, and other pharmaceutically acceptable salts of the amino group include hydrobromide, sulfate, hydrogen sulphate, phosphate, Hydrogen phosphate, dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate) and p-toluenesulfonate (tosylate) salts and the like, and are known in the art. It may be prepared through a method for preparing a salt.

The compounds of the present invention can be synthesized according to methods commonly used in the art, and preferably can be produced from recombinant microorganisms using the methods of the present invention.

As another aspect, the present invention provides a composition for antimicrobial comprising the compound of Formula 1 or a pharmaceutically acceptable salt. In the present invention, "antimicrobial composition" means a composition that functions to inhibit the survival and / or proliferation of microorganisms. The composition may have antimicrobial activity against erythromycin-sensitive strains and erythromycin-resistant strains, specifically, E. paesium ATCC 19434, E. paella City Stadium P00558, S. aureus ATCC 25923 and S. aureus It may have antimicrobial activity against a microorganism selected from the group consisting of P00740. In addition, the composition may treat an infectious disease caused by the microorganism.

The composition may further comprise a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" in the present invention refers to liquid or solid fillers involved in the transport or transport of any subject composition or component from one organ or part of the body to another organ or part of the body. Refers to a pharmaceutically acceptable material, composition or vehicle, such as a diluent, excipient, solvent or encapsulating material, wherein the composition of the present invention comprises a pharmaceutically acceptable carrier, excipient or diluent in addition to the active ingredients described above for administration. It may further include. The carrier, excipient and diluent may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In addition, the compositions of the present invention can be used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, oral dosage forms, external preparations, suppositories, or sterile injectable solutions, respectively, according to conventional methods. have. Specifically, when formulated, it may be prepared using conventional diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, and the like. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like. Such solid preparations may be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose, lactose, gelatin and the like with the compound of Formula 1 or a pharmaceutically acceptable salt thereof. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral use include, but are not limited to, suspending agents, liquid solutions, emulsions, syrups, and the like, and various excipients, such as wetting agents, sweeteners, fragrances, It can be prepared by adding a preservative or the like. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate and the like can be used. As the base of the suppository, utopsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

The present invention also provides a method for treating a microbial infectious disease comprising administering to a subject a compound of Formula 1 or a pharmaceutically acceptable salt thereof. The present invention also provides a method of inhibiting survival and / or proliferation of microorganisms including erythromycin-sensitive strains and erythromycin-resistant strains using the compound of Formula 1 or a pharmaceutically acceptable salt thereof.

As used herein, the term "treatment" refers to any action that inhibits or delays the onset of a disease, and is particularly local or systemic in animals, particularly mammals, and more particularly in humans caused by pharmacologically active substances. Indicates an effect.

In a specific embodiment of the invention, the DQNVNB is S. aureus. It was more effective than narbomycin in inhibiting the growth of P00740. LOLVNB S. Aureus Selective activity against ATCC 25923 indicates that the 3′-equaltorial-hydroxyl group of LOLVNB has a positive effect on antimicrobial activity. LRHMNB showed strong activity (1.25-2.50 μM). The antimicrobial activity of ODDCNB (2.5-5.0 μM) was better than narbomycin (10-20 μM) and DQNVNB (≦ 10 μM). DBVNNB (≤ 10 μM) is helpful when par E. ATCC 19434, P00558, and S. aureus It showed high antimicrobial activity against ATCC 25923, which means that the 4'-axial-hydroxyl group of DBVNNB reduces MIC.

The composition of the present invention may be administered via any general route as long as it can reach the desired tissue. Thus, the compositions of the present invention may be administered topically, orally, parenterally, intranasally, intravenously, intramuscularly, subcutaneously, intraocularly, transdermally, and formulated into solutions, suspensions, tablets, pills, capsules, sustained release formulations, and the like. can do.

 The composition of the present invention may be administered in a therapeutically effective amount. Dosage may vary depending on various factors such as disease type and severity, age, sex, administration method, target cell, expression level, etc. of the patient, and can be easily determined by those skilled in the art.

Through the production method of the present invention, it is possible to synthesize a narcamycin derivative including various sugar moieties in narcamycin by a method of in vivo combinatorial biosynthesis, and in particular to synthesize various narcamycin derivatives having novel and excellent antibacterial activity. Can be.

1 is Streptomyces Biosynthesis of Narvomycin from Venezuela It is a figure which shows a path | route and the structure of narbomycin.
Figure 2 shows the pathway by which the narcamycin derivative comprising the sugar moiety modified by the method of the present invention is biosynthesized. The functions of the proteins involved in the biosynthesis are shown in parentheses. NT, nucleotidyl transferase; 4,6-DH, 4,6-dehydratase; 2,3-DH, 2,3-dehydratase; AT, aminotransferases; DA, deaminase; EP, epimerase; 4-KR, 4-ketoriductase; N-MT, N -methyltransferase; 3-KR, 3-ketoriductase; SvRed, Streptomyces Venezuela Route independent reductase.
3 shows the structure of narbomycin and its derivatives.
4 is Streptomyces Venezuela HPLC-ESI-MS chromatogram from the culture of the strain is shown. (A) Narvomycin detected from YJ003 / pDDSS ([M + H] ⁺ = 510). (B) DQNVNB detected from YJ003 / pDQNV ([M + NH ₄ ] ⁺ = 516). (C) LRHMNB ([M + NH ₄ ] ⁺ = 516) and DQNVNB ([M + NH ₄ ] ⁺ = 516) detected from YJ003 / pLRHM2. (D) ODDCNB detected from YJ003 / pODDC ([M + NH ₄ ] ⁺ = 500). (E) DBVNNB ([M + NH ₄ ] ⁺ = 500) and DDGTNB ([M + NH ₄ ] ⁺ = 500) detected from YJ003 / pDDGT2. (F) DBVNNB detected from YJ003 / pLOLV2 ([M + NH ₄ ] ⁺ = 500), LOLVNB ([M + NH ₄ ] ⁺ = 500), and LDGTNB ([M + NH ₄ ] ⁺ = 500).
Figure 5 shows the Nuclear Overhauser effect (NOE) correlation of the sugar portion of narbomycin.
Figure 6 Streptomyces with deletion of des cluster It is a schematic diagram showing the structure of a gene construct for producing a Venezuelan deletion mutant.
FIG. 7 is a cleavage map of pDQNV (an expression vector comprising a nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV).
8 is a cleavage map of pLRHM2 (an expression vector comprising a nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-oleL-oleU).
9 is a cleavage map of pODDC (an expression vector comprising nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-desI-desII).
10 is a cleavage map of pDDGT2 (an expression vector comprising a nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-oleV-eryBII-urdR).
11 is a cleavage map of pLOLV2 (an expression vector comprising a nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU).
12 is a cleavage map of pDDSS (expression vector comprising nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-desI-desII-desV-desVI).

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Bacterial strains, culture conditions, and genetic engineering

Streptomyces Protoplast preparation and transformation in Venezuela were performed according to the method of Kieser, T. et al. (Kieser, T. et al., 2000, Practical Streptomyces) genetics. John Innes Centre, Norwich, United Kingdom). Streptomyces Transformants of Venezuela were selected from R2YE agar plates supplemented with thiostrepton. Streptomyces Venezuela Recombinant strains were grown on SPA agar (1 g yeast extract, 1 g beef extract, 2 g tryptose, 10 g glucose, traces of iron sulfate, and 15 g / liter agar). Streptomyces Venezuela ATCC 15439, Streptomyces Antibioticus ATCC 11891, and Saccharopolis Fora Eritrea Genomic DNA was obtained using NRRL 2338.

E. coli General subcloning was done using DH5α and plasmid Litmus28 (New England Biolabs). Constituent ermE * promoter (Schmitt-John, T. et al., 1992. Appl. Microbiol. Biotechnol. 36: 493-498) and high-copy-number E. coli- streptomyces including thiostrepton resistant markers Seth Shuttle vector pSE34 (Yoon, YJ et al., 2002. Chem. Biol. 9: 203-214) was used to express genes involved in the biosynthesis of deoxysaccharides and their attachments.

des  Preparation of Cluster-Deleted Mutants

Streptomyces lacking desosamin biosynthesis via replication plasmid-mediated homologous recombination method (Xue et al., PNAS USA, 95: 12111, 1998) Venezuelan deletion mutant (YJ003) was prepared.

The plasmid has a kanamycin resistance gene, aphII (Ward et al., Mol. Gen. Genet., 203: 468, 1986), which is upstream and downstream of the des cluster instead of the entire des cluster. It was prepared to have a flanking DNA fragment (Fig. 6). By using: (43-9, 1992 Bierman, M. et al, Gene, 116.) Construct (construct) is transformed protoplasts (protoplast transformation) the Streptomyces venetian weeks inserted through pKC1139 elrae for gene replacement Prepared. Streptomyces Venezuelan ATCC 15439 was transformed with a plasmid containing the gene. Spores obtained from each transformant were cultured in kanamycin selective agar plates and the cycle was repeated three times to increase recombination potential. Crossovers in which the target gene was replaced with aphII were selected and screened to obtain a kanamycin-resistant and apramycin-sensitive phenotype, and the mutant genotype was confirmed by genomic DNA Southern blot hybridization.

To prepare the des deletion plasmid (pYJ003), a 1 kb HindIII-Pst I fragment having a region flanked by a 5'-des cluster using a Streptomyces Venezuela genomic DNA cut with Sph I was used as a template. PCR was carried out using 21 and 22 as primers, and the 1 kb KpnI-EcoRl fragments having portions located on the 3'-des cluster side, using SEQ ID NOs: 23 and 24 as primers. Reactive components used in PCR were 100ng of template DNA, 30pmol of each primer, 2.5units of pfu DNA polymerase, each dNTP 2mM, Tris-HCl 20mM, (NH ₄ ) ₂ SO ₄ 10mM, KCl 10mM, Triton X-100 1%, BSA At 1 mg / ml, MgSO ₄ 20 mM and DMSO 10%, these were mixed to a total volume of 50 μl.

SEQ ID NO: 21 (forward): 5'-GGCAAGCTTAGCGGGGCGACTGGCGTGCCCACT-3 '

SEQ ID NO: 22 (reverse): 5'-GGTCTGCAGTCACCGTGGGTTCTGCCATCTCTT-3 '

SEQ ID NO: 23 (forward): 5'-GCTGGTACCGGATGTTCCCTCCGGGCCACCGTC-3 '

SEQ ID NO: 24 (reverse): 5'-TGAGAATTCCCTCGCCGTCCTGCCCGCGCTTGG-3 '

Expression plasmids and Streptomyces Venezuela Preparation of Recombinant Strains

DNA fragments comprising a plurality of deoxysaccharide biosynthesis genes were amplified by PCR using specific deoxyoligonucleotide primers and template DNA (Table 1). PCR allows Pfu under manufacturer's recommendations It was performed using polymerase (Fermentas).

primer Sequence (5'-3 ') Restriction enzyme DNA origin
(GenBank accession No.) desVIII - VII F TTAATTAAGATATCACCGGCAAGGAAGGACACGACGCC (SEQ ID NO: 25) PacI-EcoRV Streptomyces venezuelae ATCC 15439
(GenBank AF079762.1) desVIII - VII R TCTAGACATATGGCGCAGATACAGGGGTGAGGCCTG (SEQ ID NO: 26) NdeI-XbaI desI - II F TTAATTAAACTAGTATCGATGACGGTGGCCCGGAGGG (SEQ ID NO: 27) PacI-SpeI-ClaI Streptomyces venezuelae ATCC 15439
(GenBank AF079762.1) desI - II R TCTAGATGCGGGTCAGCGCAGGAAGCCGCG (SEQ ID NO: 28) XbaI desIII - IV F TTAATTAAACTAGTTAACTCGCCACGCCGACCGTT (SEQ ID NO: 29) PacI-SpeI Streptomyces venezuelae ATCC 15439
(GenBank AF079762.1) desIII - IV R TCTAGAGAGCTCCTCGTAGGCGGCCTT (SEQ ID NO: 30) XbaI desV F TTAATTAAACTAGTCAGGTCTCCTTCGCGGACGGCCTC (SEQ ID NO: 31) PacI-SpeI Streptomyces venezuelae ATCC 15439
(GenBank AF079762.1) desV R TCTAGAACCTGACTAGGCCTGGTCGACCCG (SEQ ID NO 32) XbaI desVI F TTAATTAAACTAGTCCCCAGGCCTCACCCCTGTATCTG (SEQ ID NO: 33) PacI-SpeI Streptomyces venezuelae ATCC 15439
(GenBank AF079762.1) desVI R TCTAGAGAATTCGCTCAGGCGGGGACGCCGACGAAG (SEQ ID NO: 34) XbaI-EcoRI oleL F TTAATTAAACTAGTATCGATATCGCTCCGAGCCCGAAGGGA (SEQ ID NO: 35) PacI / SpeI / ClaI Streptomyces antibioticus ATCC 11891
(GenBank AF055579.2) oleL R TCTAGAGCCGGCCAGTACGAGGGCCTT (SEQ ID NO: 36) XbaI oleU F TTAATTAAACTAGTGTACCGCGACAACCGC (SEQ ID NO: 37) PacI / SpeI S. antibioticus ATCC 11891
(GenBank AF055579.2) oleU R TCTAGAGAAGAGGGCCAGGTCGTGCACGC (SEQ ID NO: 38) XbaI oleV F TTAATTAAACTAGTATCGATGGGAATCGCGGAAGCG (SEQ ID NO: 39) PacI / SpeI / ClaI S. antibioticus ATCC 11891
(GenBank AF055579.2) oleV R TCTAGAATCAGCTCAGGGCCTGGATGC (SEQ ID NO: 40) XbaI eryBII F TTAATTAAACTAGTGGTCGTCGGCATCTGCG (SEQ ID NO: 41) PacI / SpeI Saccharopolyspora erythraea NRRL 2338
(GenBank U77454.1) eryBII R TCTAGACTCGGTTCCTCTTGTGCTCACTGC (SEQ ID NO: 42) XbaI urdR F TTAATTAAACTAGTACAGAGATCCAGGACGACGCA (SEQ ID NO: 43) PacI / SpeI pYJ146
urdR R TCTAGATCAGATACGGACGGCGGAGGT (SEQ ID NO: 44) XbaI oleW F TTAATTAAACTAGTAAGGGAACCCCATGCCCTCCC (SEQ ID NO: 45) PacI / SpeI S. antibioticus ATCC 11891
(GenBank AF055579.2) oleW R TCTAGAATCAGCACCAGCGCACCCGCGCCA (SEQ ID NO: 46) XbaI

pYJ146 is from Hong, JS et al., 2004. FEMS Microbiol. Lett. 238: 291-299.

The genes involved in glycosylation of the navonolides having the various deoxysaccharides were cloned into the cloned plasmid pSE34. In order to efficiently construct plasmids containing various genes, PacI / XbaI fragments containing one gene were linked to PacI / SpeI-cleaved Litmus28 containing other genes. The procedure was repeated recursively until all the genes required for the conversion of navonolide to glycosylated narbnolide were transferred into pSE34, which is combined in Litmus28 and cleaved with PacI / XbaI. The combined gene sequence is summarized in Table 2.

Plasmid Gene combination product pDDSS desIII - desIV - desI - desII - desV - desVI Narvomycin pDQNV desIII - desIV DQNVNB pLRHM2 desIII - desIV - oleL - oleU DQNVNB
LRHMNB pODDC desIII - desIV - desI - desII ODDCNB pDDGT2 desIII - desIV - oleV - eryBII - urdR DDGTNB
DBVNNB pLOLV2 desIII - desIV - oleV - oleW - oleL - oleU LOLVNB
LDGTNB
DBVNNB

To construct pDDSS, pDDSS_lit28 was prepared by sequentially cloning genes encoding DesVII / DesVIII glycosyltransferase / adjuvant protein pairs and TDP-D-desosamine biosynthetic enzymes into Litmus28. Insertion DNA of pDDSS_lit28 was digested with PacI / XbaI and linked to pSE34 to prepare pDDSS.

To construct pDQNV, ClaI / EcoRI-cleaved pDDSS_lit28 was blunted using Klenow fragments and linked to clone PacI / XbaI fragments containing desVIII - desVII - desIII - desIV into pSE34.

In order to construct multiple plasmids (pLRHM2, pODDC, pDDGT2, and pLOLV2) that direct the biosynthesis of various deoxysaccharides and their transition, pDDSS_lit28 to independently ClaI / XbaI-cutting ClaI / XbaI fragments containing various sugar gene cassettes Cloned into. PacI / XbaI fragments of the prepared plasmids were respectively cloned into pSE34 and the plasmids were introduced into Streptomyces Venezuelan deletion mutants (YJ003). Specifically, a recombinant microorganism is introduced by introducing pDDSS ( a plasmid expressing the D-desosamine [DDSS] biosynthetic gene combination ( desIII-desIV-desI-desII-desV-desVI ) together with the glycosyltransferase gene desVIII / desVII ). Preparing YJ003 / pDDSS (producing narcamycin); pDQNV (plasmid expressing the D-quinobose [DQNV] biosynthetic gene combination ( desIII-desIV ) together with desVIII / desVII ) was introduced to prepare the recombinant microorganism YJ003 / pDQNV (D-quinovoosyl-narbonolide ( DQNVNB) production); pODDC ( plasmid expressing 3'- O -demethyl-D-chalcose [ODDC] biosynthetic gene combination ( desIII-desIV-desI-desII ) together with desVIII / desVII) was introduced to prepare recombinant microorganism YJ003 / pODDC ( 3'- 0 -demethyl-D-chalcoosyl-narbornolide (ODDCNB) production); Recombinant microorganism YJ003 / pLRHM2 was prepared by introducing a plasmid expressing pLRHM2 ( desVIII / desVII together with L-rhamnose [LRHM] biosynthetic gene combination ( desIII-desIV-oleL-oleU ) the recombinant microorganism YJ003 / pDDGT2 by introducing a plasmid expressing pDDGT2 (D- digital Messenger source [DDGT] biosynthetic gene combinations (desIII-desIV-oleV-eryBII -urdR with desVIII / desVII); (LRHMNB) and DQNVNB production) Preparation (produces D-Digitoxoosyl-narbonolide (DDGTNB) and D-vobinooxyl-narbornolide (DBVNNB)); pLOLV2 (with L-Olivose [LOLV] and L-Digi with desVIII / desVII ) Recombinant microorganism YJ003 / pLOLV2 was prepared by introducing a plasmid expressing the toxoose [LDGT] biosynthetic gene combination ( desIII-desIV-oleV-oleW-oleL-oleU ) (L -olibosyl-narvonolide (LOLVNB), L Digitoxosol-narbonolide (LDGTNB), and DBVNNB production).

Among the recombinant microorganism prepared, pDDGT2 (desVIII / with desVII D- digital Messenger source [DDGT] biosynthetic gene combinations (desIII-desIV-oleV-eryBII -urdR) plasmid expressing) a recombinant microorganism, and introducing pLOLV2 (desVIII / L- come with desVII ribose [LOLV] and L- digital Messenger source [LDGT] biosynthetic gene combinations (desIII-desIV-oleV-oleW -oleL-oleU) Korea preserve microorganism a recombinant microorganism the plasmid) is introduced to express the It was deposited with the Korean Culture Center of Microorganisms (KCCM) on March 10, 2011 under the accession numbers KFCC11507P and KFCC11508P, respectively.

HPLC - ESI - MS  analysis of Narvomycin  And his Glycosylation  derivative

Streptomyces Venezuela Macrolides produced in the culture were extracted using SPE and the metabolites were analyzed by high-performance liquid chromatography-electrospray ionization-mass spectrometry (HPLC-ESI-MS). It was. Each culture was centrifuged (5,000 xg for 10 minutes). The supernatant was passed through an OASIS HLB (Waters, Milford, Mass.) SPE column pretreated with 5 ml methanol and 5 ml water. Washing the column with 5 ml 20% (vol / vol ) methanol and ca. Air dried for 30 seconds. The column was eluted three times with 1 ml 0.5% (vol / vol) methanolic acetic acid. Analytical HPLC-ESI-MS was performed on a Waters / Micromass Quattro micro / MS interface using a Waters Nova-Pak C18 column (150 × 3.9 mm, 5 μm) in cation mode. The analyte was -0.05% (vol / vol) acetic acid aqueous solution (solution A) and 80% (vol /) with the same additional concentration using a concentration gradient of 5 mM (wt / vol) ammonium acetate at 250 μl / min flow rate. vol) acetonitrile (ACN) (solution B) for 20-70% Solution B for 25 minutes, Solution B 90% for 15 minutes, 90% Solution B for 9 minutes, and column re-equilibrium for 11 minutes Solution B up to 20%-eluted. 6 Streptomyces containing various expression plasmids Venezuela HPLC-ESI-MS analysis of SPE extracts of recombinant microorganisms detected narbomycin and seven glycosylated derivatives of narbomycin (FIG. 4).

Narvomycin  And his Glycosylation  Extraction, Separation and Identification of Derivatives

Chromatographic separations were performed using reverse phase HPLC on preparative Spherisorb S5 ODS2 (Waters, 250 x 20 mm, 5 μm) or semi-preparation Watchers 120 ODS-BP (250 x 10 mm, 5 μm, Daiso, Osaka, Japan) column. Was performed. ¹ H, Correlation Spectroscopy (COSY), Heteronuclear Multiple Binding Correlation (HMBC), Heteronuclear Single Quantum Correlation (HSQC), and Nuclear Overhauser Effect Spectroscopy (NOESY) NMR Spectra of Varian INOVA 500 Spectrometer (Varian, Inc., Palo Alto, CA) was used to record at 500 MHz. ¹³ C NMR spectra were recorded at 125 MHz on the same machine. Chemical shifts were reported for each solvent peak (δ _H 7.27 and δ c 77.0 for CDCl ₃ ; δ _H 3.30 and δc 49.0 for CD ₃ OD).

The whole culture (0.5 L) of the narbomycin-producing strain Streptomyces Venezuela YJ003 / pDDSS was centrifuged and the supernatant layer was allowed to have solvent-solvent distribution using ethyl acetate (Et ₂ OAc). The resulting brown residue, after evaporation of the extract obtained, was fractionated using preparative HPLC using gradient elution. The analyte was subjected to a concentration gradient of 0.1% aqueous acetic acid (solution C) and acetonitrile-acetic acid (99.9: 0.1, v / v) (solution D) from 0 to 15 minutes at solution D 15%, at 53 minutes. Eluted with a flow rate of 5 ml / min with 15% Solution D again for up to 35% of Solution D, from 58 minutes to 60% of Solution D, for 63-73 minutes. The narcamycin containing fractions were further purified using semi-preparative HPLC using 3 ml / min 30% aqueous CAN as mobile phase to yield pure compound as an amorphous white solid (0.67 mg; retention time (Rt), 37.6 min. ESI-MS [M + H] ⁺ 510; NMR data is shown in Table 3 below.

The entire culture (1.0 L) of D-quinobosyl-narbonolide (DQNVNB) -producing strain YJ003 / pDQNV was similarly treated to obtain a brownish material. The residue was 2 ml / min using semi-preparative HPLC using gradient elution (30% aqueous ACN up to 30 minutes, 50% aqueous ACN for 40-80 minutes, and 30% aqueous ACN again for 81-90 minutes). Fractionated at a flow rate of. The DQNVNB containing fractions were further purified using semi-preparative HPLC using 2 ml / min 30% aqueous ACN as mobile phase to yield pure compound as an amorphous white solid (4.25 mg; retention time (Rt), 25.8 min; ESI-MS [M + NH ₄ ] ⁺ 516; NMR data is shown in Table 4 below.

Gradient elution (35% aqueous ACN up to 55 minutes, 60% aqueous for 55-65 minutes) from the residue obtained from the total culture (0.5 L) of L-Rhamonosyl-narbonolide (LRHMNB) -producing strain YJ003 / pLRHM2 Fractionation was performed at a flow rate of 6 ml / min using preparative HPLC using ACN, and again 35% aqueous ACN) for 70-80 minutes. The LRHMNB containing fractions were purified using semi-preparative HPLC using 30% aqueous ACN as mobile phase to yield pure compound (0.54 mg; retention time (Rt), 25.2 min; Formula; ESI-MS [M + NH ₄ ] ⁺ 516; NMR data is to Table 5).

a: numerical value based on HSQC and HMBC spectrum

The whole culture (1.0 L) of 3′- O -demethyl-D-chalcoosyl-narbonolide (ODDCNB) -producing strain YJ003 / pODDC was treated in the same manner. The residue was fractionated using preparative HPLC using 45% aqueous ACN as a mobile phase at a flow rate of 5 ml / min. The ODDCNB containing fractions were purified using semi-preparative HPLC using 30% aqueous ACN as the mobile phase at a flow rate of 2 ml / min to produce pure compounds (2.44 mg; retention time (Rt), 29.6 min; Formula; ESI- MS [M + NH ₄ ] ⁺ 500; NMR data is shown in Table 6 below.

The whole culture (14.6 L) of D-Ditotoxosil-narbonolide (DDGTNB) and D-voinoosino-narbonolide (DBVNNB) -producing strain YJ003 / pDDGT2 was similarly treated and the final residue gradientd. Fractionation was performed at a flow rate of 6 ml / min using preparative HPLC using elution (40% aqueous ACN up to 45 minutes, 45% aqueous ACN for 50-60 minutes, and 40% aqueous ACN again for 65-75 minutes). The fractions containing DBVNNB and DDGTNB were passed through a semi-preparative HPLC column using a 35% aqueous ACN at a flow rate of 2 ml / min to give pure DBVNNB (9.16 mg; retention time (Rt), 29.3 min; chemical formula: ESI-MS [M ⁺ NH _4] + 500; NMR data are in Table 7) and DDGTNB (4.18 mg; retention time (Rt), 31.2 min; the formula; ESI-MS [M + NH 4] + 500; NMR data are in Table 8) Respectively.

a: numerical value based on HSQC and HMBC spectrum

Gradient elution of the residue obtained from the total culture (2.5 L) of L-olibosyl-narbonolide (LOLVNB) and L-digitotoxoyl-narbonolide (LDGTNB) -producing strain YJ003 / pLOLV2 (30 min) Fractionation at a flow rate of 2 ml / min using semi-preparative HPLC using 30% aqueous ACN, 40% aqueous ACN for 40-80 minutes, and 30% aqueous ACN again for 81-90 minutes). The LOLVNB containing fractions were passed through a semi-preparative HPLC column using 35% aqueous ACN as the mobile phase at a flow rate of 2 ml / min to give pure compounds (0.55 mg; retention time (Rt), 28.7 min; Formula; ESI-MS [M + NH ₄ ] ⁺ 500; NMR data produced Table 9).

a: numerical value based on HSQC and HMBC spectrum

Gradient elution (38% aqueous ACN up to 50 minutes, 42% aqueous ACN for 55-75 minutes) by treating the entire culture (21.6 L) of LOLVNB and LDGTNB-producing strain YJ003 / pLOLV2 in the same manner as the previous strain And preparative HPLC using 38% aqueous ACN) again for 76-85 minutes at a flow rate of 6 ml / min. The LDGTNB containing fractions were passed through a semi-preparative HPLC column using 35% aqueous ACN as the mobile phase at a flow rate of 2 ml / min to give pure compounds (1.81 mg; retention time (Rt), 31.0 minutes; Formula; ESI-MS [M + NH ₄ ] ⁺ 500; NMR data produced Table 10).

a: numerical value based on HSQC and HMBC spectrum

Narvomycin  And its derivative structure

The structure of the isolated metabolites was inferred using NMR spectroscopy ( ₁ H, ₁₃ C, COZY, HSQC, and HMBC). ¹³ C NMR data of DQNVNB confirmed the presence of 26 carbons which can be found in 14-membered macrolide glycosides such as narbomycin. Analysis of 2D NMR data including COSY, HSQC, and HMBC spectra revealed the overall structure of DQNVNB. 7 methyl groups through ¹ H NMR spectrum (δ _H 1.35 / H ₃ -16, 1.30 / H ₃ -6 ', 1.30 / H ₃ -17, 1.10 / H ₃ -19, 1.08 / H ₃ -20, 0.98 / H ₃ -18, and 0.89 / H ₃ -15), 2 of a methylene group _{(δ H 1.48, 1.19 / H} 2 -7 and _{1.61, 1.52 / H 2 -14)} , 5 of the meth (methine) proton (δ _H 3.82 / H-2, 2.89 / H-4, 2.81 / H-8, 2.72 / H-12, and 1.80 / H-6), seven oxygenated metain protons (δ _H 4.94 / H-13, 4.34 / H-1 ', 4.16 / H-5, 3.46 / H-3', 3.34 / H-5 ', 3.33 / H-2', and 3.16 / H-4 '), and two olefin protons (δ _H 6.65 / H-11 and 6.05 / H-10). The COSY spectrum identified five spin systems including those for 6-deoxyhexose from anomer protons (δ _H 4.34 / H-1 ′) to H-6 ′ (δ _H 1.30). The presence of 6-deoxyhexose sugars was characterized by four oxygenated carbons (δc 76.9 / C-3 ', 75.5 / C- with anomer carbon at δc 103.1 / C-1' through ¹³ C NMR and HSQC spectra). 4 ', 74.7 / C-2', 72.0 / C-5 '), and confirmed again by detecting the methyl signal in (delta) c 17.8 / C-6'. In the HMBC spectrum, anomer protons (δ _H 4.34 / H-1 ′) were associated with carbon C-5 (δc 78.8), meaning that the sugar was attached to C-5. Moreover, the major HMBC correlation of each carbon and methyl proton confirmed their position.

If the mechanism of glycosylation is known (stereochemistry is reversed or preserved), the stereoconfiguration of the sugar can be determined from the coupling constants of the anomer protons. Glycosyltransferase DesVII transfers sugars by reversing the stereochemistry at the anomer carbon of the activated sugar. Accordingly, a large coupling constant (ca. 7 Hz) having a glycopeptide seed ⁴ C ₁ conformation in a sense that it includes a transverse direction of the (equatorial) β- glycoside-linked sugar and D-, a small couple to the anomeric protons Ring constants (<5 Hz) refer to L-sugars with ¹ C ₄ conformation with axial α-glycosidic bonds. The correct conformation ( ⁴ C ₁ ) can be identified again via the NOE cross peak between H-1 ′ and H-5 ′. As a result, the sugar was identified as D-quinobose having a ⁴ C ₁ conformation. The longitudinal position was confirmed by the large coupling constant of the anomer protons ( J _{1 ′ , 2 ′} = 7.0 Hz), thus identifying β-glycoside linked D-sugars according to Klyne's law. Large coupling constants ( J _{2 ' , 3'} = 9.0 Hz, J _{3 ' , 4'} = 9.0 Hz, and J _{4 ' , 5'} = 9.0 Hz) are H-2 ', H-3', H-4 ', And H-5' protons are located in the longitudinal direction. Moreover, the NOE correlation between H-1 'and H-5' (FIG. 5) supports the ⁴ C ₁ conformation.

1D and 2D NMR data of ODDCNB were similar to DQNVNB. This means that the substance is also a narcamycin derivative. The only difference is the presence of additional methylene groups in the sugar, meaning that it is dideoxyhexose. In the COSY spectrum, it was confirmed that proton H-1 '(δ _H 4.31) was coupled to H-2' (δ _H 3.25) coupled to H-3 '(δ _H 3.70). Proton H-3 'was coupled to methylene H-4' protons (δ _H 1.95 and 1.42), and in turn to H-5 'proton (δ _H 3.62) coupled to H3-6' proton (δ _H 1.25) It was confirmed that it was coupled. This means the presence of the 4,6-dideoxyhexose moiety. According to the coupling constants, the protons H-2 ', H-3', and H-5 'were found to be in the longitudinal direction. This means that the sugar is 3- O demethyl-chalcose. Large coupling constants ( J _{1 ′ , 2 ′} = 7.5 Hz) generally mean β-glycosidic bonds to D-sugars in the ⁴ C ₁ conformation. This is supported by the NOE cross peak (FIG. 5) between H-1 'and H-5'. In this way, the obtained 1D and 2D NMR data indicate that the sugar moiety is 3- O -demethyl-D-chalcose attached to C-5.

NMR data of DBVNNB was similar to ODDCNB. This means the presence of narbomycin derivatives, including dideoxyhexose sugars. In the COSY spectrum, anomer proton H-1 '(δ _H 4.81, dd, J = 8, 4.5 Hz) is a methylene proton (H ₂ -2': δ _H coupled to H-3 '(δ _H 4.11) 1.78 / 1.80). Coupled to proton H-3 'H-4' (δ _H 3.26) and in turn coupled to H-5 '(δ _H 4.05) coupled to H3-6' proton (δ _H 1.24). Confirmed. This means that the sugar moiety is 2,6-dideoxyhexose. Large coupling constants of the anomer protons (δ _H 4.81, dd, J _{1 ′ , 2 ′} = 8.0, 4.5 Hz) mean transverse β-glycosidic bonds and thus stereochemistry in the ⁴ C ₁ conformation This was determined as D-sugars. The small coupling constants of H-3 '( J = 3 Hz) and H-4' (brs) mean that both protons are located transversely and each hydroxyl group is longitudinal. Thus, the sugar was identified as D-vobinose and the data corresponded well to known reports. In addition, the ⁴ C ₁ conformation was identified through the NOE cross peak (FIG. 5) between H-1 ′ and H-5 ′.

NMR data of DDGTNB were similar to DBVNNB except for differences in the coupling constants of the sugar protons. Based on the NMR data, dideoxysaccharides were identified as D-digitoxose, and the large coupling constants of the anomer protons ( J _{1 ′ , 2 ′} = 9.5 Hz) were β-glycosidically linked with longitudinal protons. D sugar. ^{The 1} H NMR spectrum corroborates the longitudinal direction of the 3'-OH group through the small coupling constant of H-3 '(δ _H 4.11, m, J = 3 Hz), which is common for e, a and e, e coupling. And, therefore, was useful for distinguishing digitoxose and oligoose sugars. A biaxial coupling ( J _{4 ′ , 5 ′} = 9.5 Hz) was observed between H-4 ′ and H-5 ′, meaning transverse 5′-CH ₃ and 4′-OH. The ⁴ C ₁ conformation of digitoxose sugars (common to D-sugars) was confirmed using NOE correlations between H-1 ′ and H-5 ′ (FIG. 5).

NMR data of LOLVNB were similar to DDGTNB except for the major change in coupling constants and split pattern for H-3 ′ (δ _H 3.90, ddd, J = 12.0, 9.0, 5.0 Hz). Coupling Constants J _{3 ' , 2' ax} = 12.0 Hz and J _{3 ' , 4'} = 9.0 Hz mean that the H-3 'proton is located longitudinally while the 3'-OH is located transversely. Thus, unlike digitoxose in DDGTNB, the sugar moiety was identified as oligoose. The stereoconfiguration of sugars was determined as L-olivose via the coupling constants of the anomer protons ( J = 3 Hz) and the NOE cross peak (FIG. 5).

The ¹ H NMR spectrum of LDGTNB was similar to DDGTNB except for a slight difference in the chemical shift of the sugar moiety. The most significant difference is the anomeric proton signal (δ _H 5.03, brs, J _{1 ′ , 2 ′} = 3 Hz), which is longitudinally unlike DDGTNB (δ _H 4.84, J _{1 ′ , 2 ′} = 9.5 Hz). Means the presence of a glycoside linkage. 1D and 2D NMR data supported the structure of LDGTNB. In addition, the ¹ H NMR spectrum is obtained through the coupling constants ( J _{3 ′ , 4 ′} = 3.0 Hz and J _{4 ′, 5 ′} = 10.0 Hz), H-3 ′ in the transverse direction and H-4 ′ in the longitudinal direction, and H-5 'was identified and identified as Digitoxose sugar. In the NOESY spectrum, instead of the NOE correlation between H-1 'and H-5' observed in DDGTNB, H-2'ax (δ _H 1.91, dt, J = 15.0, 3.5 Hz) and H-4 '( δ _H 3.15, dd, J = 10.0, 3.0 Hz) Correlation between protons was observed (FIG. 5). Thus, the sugar was identified as L-digitoxose attached to C-5 (δ _C 78.5) as measured by the HMBC cross peak from H-1 ′ to C-5. The data was in good agreement with the data reported for L-digitoxose.

Narvomycin and LRHMNB were identified through HPLC-ESI-MS and 1D ( ¹ H and ¹³ C) and 2D (COZY, HMBC, HSQC, and NOESY) NMR data. The configuration and conformation of sugars in the compounds were determined through coupling constants and NOE cross peaks.

Isolation of Clinical Strains and Measurement of Antimicrobial Susceptibility

Erythromycin-resistant strain E. paesium P00558 and S. aureus P00740 was separated from the 3rd university hospital in Daegu, South Korea. The isolates were processed using MicroScan WalkAway 96 system (Dade Behring, West Sacramento, CA) for genus and species identification and antimicrobial susceptibility measurements. Antimicrobials using MicroScan Gram Positive MIC / Combo (PC1A) Panel (Dade Behring), Gram Negative MIC / Combo (NC44) Panel (Dade Behring), and Gram Negative Breakpoint Combo (NBC39) Panel (Dade Behring) Sensitivity and species levels of E. paesium and S. aureus were identified, respectively. Inoculum suspensions for testing were treated on the same day using the same clean 18- to 24-hour-passage plates. Inoculum was standardized using Prompt Inoculation System-D (Dade Behring) for microdilution antimicrobial susceptibility testing. All antimicrobial susceptibility tests were performed according to the latest Clinical and Laboratory Standards Institute methods. Quality Control S. Aureus Observation was made using ATCC 25923.

Antimicrobial activity Assay

Erythromycin-sensitive strain E. paesium ATCC 19434 and S. Aureus ATCC 25923, and erythromycin-resistant strains E. par when Titanium P00558 and S. aureus P00740 was used to determine the antimicrobial activity of narbomycin and its derivatives including neutral deoxysaccharides. Erythromycin was used as a control. Bacterial cells (2 × 10 ⁷ / ml) were seeded in LB or Mueller-Hinton medium and divided into 0.1 ml / well into 96-well microtiter plates. MIC was measured using serial 2-fold dilutions of antibiotics according to the National Committee for Clinical Laboratory Standards. After 24 hours of inoculation at 37 ° C., the minimum antibiotic concentration that interfered with the growth of the test subject was determined as MIC. Growth was assayed by observing absorbance at 620 nm using a microtiter ELISA Reader (Molecular Devices Emax, CA). The results are shown in Table 11 below.

matter
MIC (μM) ATCC
19434 P00558 ATCC
25923 P00740 Narvomycin 10 10 10 20 DQNVNB 10 10 10 <10 LRHMNB 2.5 2.5 <2.5 1.25 ODDCNB 5 5 2.5 5 DBVNNB <10 10 10 20 DDGTNB 10 <20 <20 20 LOLVNB 10 20 5 10 LDGTNB 10 20 10 20 Erythromycin 10 > 20 10 > 40

Narvomycin with D-desosamin showed antimicrobial activity similar to erythromycin (10 μM) against erythromycin-sensitive strains. On the other hand, higher activity (10-20 μM) was observed for erythromycin-resistant strains than erythromycin (> 20 μM). DQNVNB is helpful when par E. ATCC 19434, E. paella City Stadium P00558 did not show improved activity against S. aureus ATCC 25923, but S. aureus It was more effective than narbomycin in inhibiting the growth of P00740. LOLVNB showed selective activity against S. aureus ATCC 25923. In this experimental example, LRHMNB showed strong activity (1.25-2.50 μM). ODDCNB also showed significant activity (2.5-5.0 μM) for all strains. In vitro antimicrobial activity of LRHMNB (1.25-2.50 μM) was compared with that of LOLVNB (5-20 μM), confirming the structure-activity information of the 2'-hydroxyl group of LRHMNB, which is the most important of antimicrobial activity. It may be a determining factor. The antimicrobial activity of ODDCNB (2.5-5.0 μM) was better than narbomycin (10-20 μM) and DQNVNB (≦ 10 μM). It was confirmed that the 3'-dimethylamino group of narcamycin was replaced with a 3'-hydroxyl group and the absence of the 4'-hydroxyl group in DQNVNB improved the antimicrobial activity of ODDCNB. S. Aureus Comparing the MICs of LOLVNB (5-10 μM) and LDGTNB (10-20 μM) for ATCC 25923 and P00740, the 3′-equaltorial-hydroxyl group of LOLVNB positively affects antimicrobial activity Means that. DBVNNB (≤ 10 μM) is helpful when par E. ATCC 19434, P00558, and S. Leu brother's ATCC About 25923 DDGTNB (<20 μM) was it exhibited a higher antibacterial activity than the bar, which the DBVNNB 4'- longitudinal (axial) - hydroxyl group reduces the MIC It means.

Korea Microbial Conservation Center (Domestic) KFCC11507P 20110310 Korea Microbial Conservation Center (Domestic) KFCC11508P 20110310

<110> Ewha University-Industry Collaboration Foundation <120> Novel narbomycin derivatives compounds, antibacterial composition          comprising the same and manufacturing method of the same <130> PA110076 / KR <160> 46 <170> Kopatentin 1.71 <210> 1 <211> 9715 <212> DNA <213> Artificial Sequence <220> <223> desVIII-desVII-desIII-desIV-desI-desII-desV-desVI <400> 1 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tcctggagac ccgcggcatc cactggatcc 180 acgccgcgaa cggcgacccg tacgccaccg tgctgcgcgg ccaggcggac gacccgtatc 240 ccgcgtacga gcgggtgcgt gcccgcggcg cgctctcctt cagcccgacg ggcagctggg 300 tcaccgccga tcacgccctg gcggcgagca tcctctgctc gacggacttc ggggtctccg 360 gcgccgacgg cgtcccggtg ccgcagcagg tcctctcgta cggggagggc tgtccgctgg 420 agcgcgagca ggtgctgccg gcggccggtg acgtgccgga gggcgggcag cgtgccgtgg 480 tcgaggggat ccaccgggag acgctggagg gtctcgcgcc ggacccgtcg gcgtcgtacg 540 ccttcgagct gctgggcggt ttcgtccgcc cggcggtgac ggccgctgcc gccgccgtgc 600 tgggtgttcc cgcggaccgg cgcgcggact tcgcggatct gctggagcgg ctccggccgc 660 tgtccgacag cctgctggcc ccgcagtccc tgcggacggt acgggcggcg gacggcgcgc 720 tggccgagct cacggcgctg ctcgccgatt cggacgactc ccccggggcc ctgctgtcgg 780 cgctcggggt caccgcagcc gtccagctca ccgggaacgc ggtgctcgcg ctcctcgcgc 840 atcccgagca gtggcgggag ctgtgcgacc ggcccgggct cgcggcggcc gcggtggagg 900 agaccctccg ctacgacccg ccggtgcagc tcgacgcccg ggtggtccgc ggggagacgg 960 agctggcggg ccggcggctg ccggccgggg cgcatgtcgt cgtcctgacc gccgcgaccg 1020 gccgggaccc ggaggtcttc acggacccgg agcgcttcga cctcgcgcgc cccgacgccg 1080 ccgcgcacct cgcgctgcac cccgccggtc cgtacggccc ggtggcgtcc ctggtccggc 1140 ttcaggcgga ggtcgcgctg cggaccctgg ccgggcgttt ccccgggctg cggcaggcgg 1200 gggacgtgct ccgcccccgc cgcgcgcctg tcggccgcgg gccgctgagc gtcccggtca 1260 gcagctcctg agacaccggg gccccggtcc gcccggcccc ccttcggacg gaccggacgg 1320 ctcggaccac ggggacggct cagaccgtcc cgtgtgtccc cgtccggctc ccgtccgccc 1380 catcccgccc ctccaccggc aaggaaggac acgacgccat gcgcgtcctg ctgacctcgt 1440 tcgcacatca cacgcactac tacggcctgg tgcccctggc ctgggcgctg ctcgccgccg 1500 ggcacgaggt gcgggtcgcc agccagcccg cgctcacgga caccatcacc gggtccgggc 1560 tcgccgcggt gccggtcggc accgaccacc tcatccacga gtaccgggtg cggatggcgg 1620 gcgagccgcg cccgaaccat ccggcgatcg ccttcgacga ggcccgtccc gagccgctgg 1680 actgggacca cgccctcggc atcgaggcga tcctcgcccc gtacttccat ctgctcgcca 1740 acaacgactc gatggtcgac gacctcgtcg acttcgcccg gtcctggcag ccggacctgg 1800 tgctgtggga gccgacgacc tacgcgggcg ccgtcgccgc ccaggtcacc ggtgccgcgc 1860 acgcccgggt cctgtggggg cccgacgtga tgggcagcgc ccgccgcaag ttcgtcgcgc 1920 tgcgggaccg gcagccgccc gagcaccgcg aggaccccac cgcggagtgg ctgacgtgga 1980 cgctcgaccg gtacggcgcc tccttcgaag aggagctgct caccggccag ttcacgatcg 2040 acccgacccc gccgagcctg cgcctcgaca cgggcctgcc gaccgtcggg atgcgttatg 2100 ttccgtacaa cggcacgtcg gtcgtgccgg actggctgag tgagccgccc gcgcggcccc 2160 gggtctgcct gaccctcggc gtctccgcgc gtgaggtcct cggcggcgac ggcgtctcgc 2220 agggcgacat cctggaggcg ctcgccgacc tcgacatcga gctcgtcgcc acgctcgacg 2280 cgagtcagcg cgccgagatc cgcaactacc cgaagcacac ccggttcacg gacttcgtgc 2340 cgatgcacgc gctcctgccg agctgctcgg cgatcatcca ccacggcggg gcgggcacct 2400 acgcgaccgc cgtgatcaac gcggtgccgc aggtcatgct cgccgagctg tgggacgcgc 2460 cggtcaaggc gcgggccgtc gccgagcagg gggcggggtt cttcctgccg ccggccgagc 2520 tcacgccgca ggccgtgcgg gacgccgtcg tccgcatcct cgacgacccc tcggtcgcca 2580 ccgccgcgca ccggctgcgc gaggagacct tcggcgaccc caccccggcc gggatcgtcc 2640 ccgagctgga gcggctcgcc gcgcagcacc gccgcccgcc ggccgacgcc cggcactgag 2700 ccgcacccct cgccccaggc ctcacccctg tatctcatat gtctagttaa ctcgccacgc 2760 cgaccgttat caccggcgcc ctgctgctag tttccgagaa tgaagggaat agtcctggcc 2820 ggcgggagcg gaactcggct gcatccggcg acctcggtca tttcgaagca gattcttccg 2880 gtctacaaca aaccgatgat ctactatccg ctgtcggttc tcatgctcgg cggtattcgc 2940 gagattcaaa tcatctcgac cccccagcac atcgaactct tccagtcgct tctcggaaac 3000 ggcaggcacc tgggaataga actcgactat gcggtccaga aagagcccgc aggaatcgcg 3060 gacgcacttc tcgtcggagc cgagcacatc ggcgacgaca cctgcgccct gatcctgggc 3120 gacaacatct tccacgggcc cggcctctac acgctcctgc gggacagcat cgcgcgcctc 3180 gacggctgcg tgctcttcgg ctacccggtc aaggaccccg agcggtacgg cgtcgccgag 3240 gtggacgcga cgggccggct gaccgacctc gtcgagaagc ccgtcaagcc gcgctccaac 3300 ctcgccgtca ccggcctcta cctctacgac aacgacgtcg tcgacatcgc caagaacatc 3360 cggccctcgc cgcgcggcga gctggagatc accgacgtca accgcgtcta cctggagcgg 3420 ggccgggccg aactcgtcaa cctgggccgc ggcttcgcct ggctggacac cggcacccac 3480 gactcgctcc tgcgggccgc ccagtacgtc caggtcctgg aggagcggca gggcgtctgg 3540 atcgcgggcc ttgaggagat cgccttccgc atgggcttca tcgacgccga ggcctgtcac 3600 ggcctgggag aaggcctctc ccgcaccgag tacggcagct atctgatgga gatcgccggc 3660 cgcgagggag ccccgtgagg gcacctcgcg gccgacgcgt tcccacgacc gacagcgcca 3720 ccgacagtgc gacccacacc gcgacccgca ccgccaccga cagtgcgacc cacaccgcga 3780 cctacagcgc gaccgaaagg aagacggcag tgcggcttct ggtgaccgga ggtgcgggct 3840 tcatcggctc gcacttcgtg cggcagctcc tcgccggggc gtaccccgac gtgcccgccg 3900 atgaggtgat cgtcctggac agcctcacct acgcgggcaa ccgcgccaac ctcgccccgg 3960 tggacgcgga cccgcgactg cgcttcgtcc acggcgacat ccgcgacgcc ggcctcctcg 4020 cccgggaact gcgcggcgtg gacgccatcg tccacttcgc ggccgagagc cacgtggacc 4080 gctccatcgc gggcgcgtcc gtgttcaccg agaccaacgt gcagggcacg cagacgctgc 4140 tccagtgcgc cgtcgacgcc ggcgtcggcc gggtcgtgca cgtctccacc gacgaggtgt 4200 acgggtcgat cgactccggc tcctggaccg agagcagccc gctggagccc aactcgccct 4260 acgcggcgtc caaggccggc tccgacctcg ttgcccgcgc ctaccaccgg acgtacggcc 4320 tcgacgtacg gatcacccgc tgctgcaaca actacgggcc gtaccagcac cccgagaagc 4380 tcatccccct cttcgtgacg aacctcctcg acggcgggac gctcccgctg tacggcgacg 4440 gcgcgaacgt ccgcgagtgg gtgcacaccg acgaccactg ccggggcatc gcgctcgtcc 4500 tcgcgggcgg ccgggccggc gagatctacc acatcggcgg cggcctggag ctgaccaacc 4560 gcgaactcac cggcatcctc ctggactcgc tcggcgccga ctggtcctcg gtccggaagg 4620 tcgccgaccg caagggccac gacctgcgct actccctcga cggcggcgag atcgagcgcg 4680 agctcggcta ccgcccgcag gtctccttcg cggacggcct cgcgcggacc gtccgctggt 4740 accgggagaa ccgcggctgg tgggagccgc tcaaggcgac cgccccgcag ctgcccgcca 4800 ccgccgtgga ggtgtccgcg tgagcagccg cgccgagacc ccccgcgtcc ccttcctcga 4860 cctcaaggcc gcctacgagg agctctctag tgctagcgac ggtggcccgg agggaacatc 4920 cgtgaaaagc gccttatccg acctcgcatt cttcggcggc cccgccgctt tcgaccagcc 4980 gctcctcgtg gggcggccca accgcatcga ccgcgccagg ctgtacgagc ggctcgaccg 5040 ggccctcgac agccagtggc tgtccaacgg cggcccgctc gtccgcgagt tcgaggagcg 5100 cgtcgccggg ctcgccgggg tccggcatgc cgtggccacc tgcaacgcca cggccgggct 5160 ccagctcctc gcgcacgccg ccggcctcac cggcgaagtg atcatgccgt cgatgacgtt 5220 cgccgccacc ccgcacgcac tgcgctggat cggcctcacc ccggtcttcg ccgacatcga 5280 cccggacacc ggcaacctcg acccggacca ggtggccgcc gcggtcacac cccgcacctc 5340 ggccgtcgtc ggcgtccacc tctggggccg cccctgcgcc gccgaccagc tgcggaaggt 5400 cgccgacgag cacggcctgc ggctgtactt cgacgccgcg cacgccctcg gctgcgcggt 5460 cgacggccgg cccgccggca gcctcggcga cgccgaggtc ttcagcttcc acgccaccaa 5520 ggccgtcaac gccttcgagg gcggcgccgt cgtcaccgac gacgccgacc tcgccgcccg 5580 gatccgcgcc ctccacaact tcggcttcga cctgcccggc ggcagccccg ccggcgggac 5640 caacgccaag atgagcgagg ccgccgccgc catgggcctc acctccctcg acgcgtttcc 5700 cgaggtcatc gaccggaacc ggcgcaacca cgccgcctac cgcgagcacc tcgcggacct 5760 ccccggcgtc ctcgtcgccg accacgaccg ccacggcctc aacaaccacc agtacgtgat 5820 cgtcgagatc gacgaggcca ccaccggcat ccaccgcgac ctcgtcatgg aggtcctgaa 5880 ggccgaaggc gtgcacaccc gcgcctactt ctcgccgggc tgccacgagc tggagccgta 5940 ccgcgggcag ccgcacgccc cgctgccgca caccgaacgc ctcgccgcgc gcgtgctgtc 6000 cctgccgacc ggcaccgcca tcggcgacga cgacatccgc cgggtcgccg acctgctgcg 6060 tctctgcgcg acccgcggcc gcgaactgac cgcgcgccac cgcgacacgg cccccgcccc 6120 gctcgcggcc ccccagacat ccacgcccac gattggacgc tcccgatgac cgcccccgcc 6180 ctttccgcca ccgccccggc cgaacgctgc gcgcaccccg gagccgatct gggggcggcg 6240 gtccacgccg tcggccagac cctcgccgcc ggcggcctcg tgccgcccga cgaggccgga 6300 acgaccgccc gccacctcgt ccggctcgcc gtgcgctacg gcaacagccc cttcaccccg 6360 ctggaggagg cccgccacga cctgggcgtc gaccgggacg ccttccggcg cctcctcgcc 6420 ctgttcgggc aggtcccgga gctccgcacc gcggtcgaga ccggccccgc cggggcgtac 6480 tggaagaaca ccctgctccc gctcgaacag cgcggcgtct tcgacgcggc gctcgccagg 6540 aagcccgtct tcccgtacag cgtcggcctc taccccggcc cgacctgcat gttccgctgc 6600 cacttctgcg tccgtgtgac cggcgcccgc tacgacccgt ccgccctcga cgccggcaac 6660 gccatgttcc ggtcggtcat cgacgagata cccgcgggca acccctcggc gatgtacttc 6720 tccggcggcc tggagccgct caccaacccc ggcctcggga gcctggccgc gcacgccacc 6780 gaccacggcc tgcggcccac cgtctacacg aactccttcg cgctcaccga gcgcaccctg 6840 gagcgccagc ccggcctctg gggcctgcac gccatccgca cctcgctcta cggcctcaac 6900 gacgaggagt acgagcagac caccggcaag aaggccgcct tccgccgcgt ccgcgagaac 6960 ctgcgccgct tccagcagct gcgcgccgag cgcgagtcgc cgatcaacct cggcttcgcc 7020 tacatcgtgc tcccgggccg tgcctcccgc ctgctcgacc tggtcgactt catcgccgac 7080 ctcaacgacg ccgggcaggg caggacgatc gacttcgtca acattcgcga ggactacagc 7140 ggccgtgacg acggcaagct gccgcaggag gagcgggccg agctccagga ggccctcaac 7200 gccttcgagg agcgggtccg cgagcgcacc cccggactcc acatcgacta cggctacgcc 7260 ctgaacagcc tgcgcaccgg ggccgacgcc gaactgctgc ggatcaagcc cgccaccatg 7320 cggcccaccg cgcacccgca ggtcgcggtg caggtcgatc tcctcggcga cgtgtacctg 7380 taccgcgagg ccggcttccc cgacctggac ggcgcgaccc gctacatcgc gggccgcgtg 7440 acccccgaca cctccctcac cgaggtcgtc agggacttcg tcgagcgcgg cggcgaggtg 7500 gcggccgtcg acggcgacga gtacttcatg gacggcttcg atcaggtcgt caccgcccgc 7560 ctgaaccagc tggagcgcga cgccgcggac ggctgggagg aggcccgcgg cttcctgcgc 7620 tgacccgcat ctagtcaggt ctccttcgcg gacggcctcg cgcggaccgt ccgctggtac 7680 cgggagaacc gcggctggtg ggagccgctc aaggcgaccg ccccgcagct gcccgccacc 7740 gccgtggagg tgtccgcgtg agcagccgcg ccgagacccc ccgcgtcccc ttcctcgacc 7800 tcaaggccgc ctacgaggag ctccgcgcgg agaccgacgc cgcgatcgcc cgcgtcctcg 7860 actcggggcg ctacctcctc ggacccgaac tcgaaggatt cgaggcggag ttcgccgcgt 7920 actgcgagac ggaccacgcc gtcggcgtga acagcgggat ggacgccctc cagctcgccc 7980 tccgcggcct cggcatcgga cccggggacg aggtgatcgt cccctcgcac acgtacatcg 8040 ccagctggct cgcggtgtcc gccaccggcg cgacccccgt gcccgtcgag ccgcacgagg 8100 accaccccac cctggacccg ctgctcgtcg agaaggcgat caccccccgc acccgggcgc 8160 tcctccccgt ccacctctac gggcaccccg ccgacatgga cgccctccgc gagctcgcgg 8220 accggcacgg cctgcacatc gtcgaggacg ccgcgcaggc ccacggcgcc cgctaccggg 8280 gccggcggat cggcgccggg tcgtcggtgg ccgcgttcag cttctacccg ggcaagaacc 8340 tcggctgctt cggcgacggc ggcgccgtcg tcaccggcga ccccgagctc gccgaacggc 8400 tccggatgct ccgcaactac ggctcgcggc agaagtacag ccacgagacg aagggcacca 8460 actcccgcct ggacgagatg caggccgccg tgctgcggat ccggctcgcc cacctggaca 8520 gctggaacgg ccgcaggtcg gcgctggccg cggagtacct ctccgggctc gccggactgc 8580 ccggcatcgg cctgccggtg accgcgcccg acaccgaccc ggtctggcac ctcttcaccg 8640 tgcgcaccga gcgccgcgac gagctgcgca gccacctcga cgcccgcggc atcgacaccc 8700 tcacgcacta cccggtaccc gtgcacctct cgcccgccta cgcgggcgag gcaccgccgg 8760 aaggctcgct cccgcgggcc gagagcttcg cgcggcaggt cctcagcctg ccgatcggcc 8820 cgcacctgga gcgcccgcag gcgctgcggg tgatcgacgc cgtgcgcgaa tgggccgagc 8880 gggtcgacca ggcctagtca ggttctagtc aattgcccca ggcctcaccc ctgtatctgc 8940 gccgggggac gcccccggcc caccctccga aagaccgaaa gcaggagcac cgtgtacgaa 9000 gtcgaccacg ccgacgtcta cgacctcttc tacctgggtc gcggcaagga ctacgccgcc 9060 gaggcctccg acatcgccga cctggtgcgc tcccgtaccc ccgaggcctc ctcgctcctg 9120 gacgtggcct gcggtacggg cacgcatctg gagcacttca ccaaggagtt cggcgacacc 9180 gccggcctgg agctgtccga ggacatgctc acccacgccc gcaagcggct gcccgacgcc 9240 acgctccacc agggcgacat gcgggacttc cggctcggcc ggaagttctc cgccgtggtc 9300 agcatgttca gctccgtcgg ctacctgaag acgaccgagg aactcggcgc ggccgtcgcc 9360 tcgttcgcgg agcacctgga gcccggtggc gtcgtcgtcg tcgagccgtg gtggttcccg 9420 gagaccttcg ccgacggctg ggtcagcgcc gacgtcgtcc gccgtgacgg gcgcaccgtg 9480 gcccgtgtct cgcactcggt gcgggagggg aacgcgacgc gcatggaggt ccacttcacc 9540 gtggccgacc cgggcaaggg cgtgcggcac ttctccgacg tccatctcat caccctgttc 9600 caccaggccg agtacgaggc cgcgttcacg gccgccgggc tgcgcgtcga gtacctggag 9660 ggcggcccgt cgggccgtgg cctcttcgtc ggcgtccccg cctgagtcta gaccc 9715 <210> 2 <211> 292 <212> PRT <213> Artificial Sequence <220> <223> DesIII protein <400> 2 Met Lys Gly Ile Val Leu Ala Gly Gly Ser Gly Thr Arg Leu His Pro   1 5 10 15 Ala Thr Ser Val Ile Ser Lys Gln Ile Leu Pro Val Tyr Asn Lys Pro              20 25 30 Met Ile Tyr Tyr Pro Leu Ser Val Leu Met Leu Gly Gly Ile Arg Glu          35 40 45 Ile Gln Ile Ile Ser Thr Pro Gln His Ile Glu Leu Phe Gln Ser Leu      50 55 60 Leu Gly Asn Gly Arg His Leu Gly Ile Glu Leu Asp Tyr Ala Val Gln  65 70 75 80 Lys Glu Pro Ala Gly Ile Ala Asp Ala Leu Leu Val Gly Ala Glu His                  85 90 95 Ile Gly Asp Asp Thr Cys Ala Leu Ile Leu Gly Asp Asn Ile Phe His             100 105 110 Gly Pro Gly Leu Tyr Thr Leu Leu Arg Asp Ser Ile Ala Arg Leu Asp         115 120 125 Gly Cys Val Leu Phe Gly Tyr Pro Val Lys Asp Pro Glu Arg Tyr Gly     130 135 140 Val Ala Glu Val Asp Ala Thr Gly Arg Leu Thr Asp Leu Val Glu Lys 145 150 155 160 Pro Val Lys Pro Arg Ser Asn Leu Ala Val Thr Gly Leu Tyr Leu Tyr                 165 170 175 Asp Asn Asp Val Val Asp Ile Ala Lys Asn Ile Arg Pro Ser Pro Arg             180 185 190 Gly Glu Leu Glu Ile Thr Asp Val Asn Arg Val Tyr Leu Glu Arg Gly         195 200 205 Arg Ala Glu Leu Val Asn Leu Gly Arg Gly Phe Ala Trp Leu Asp Thr     210 215 220 Gly Thr His Asp Ser Leu Leu Arg Ala Ala Gln Tyr Val Gln Val Leu 225 230 235 240 Glu Glu Arg Gln Gly Val Trp Ile Ala Gly Leu Glu Glu Ile Ala Phe                 245 250 255 Arg Met Gly Phe Ile Asp Ala Glu Ala Cys His Gly Leu Gly Glu Gly             260 265 270 Leu Ser Arg Thr Glu Tyr Gly Ser Tyr Leu Met Glu Ile Ala Gly Arg         275 280 285 Glu Gly Ala Pro     290 <210> 3 <211> 337 <212> PRT <213> Artificial Sequence <220> <223> DesIV protein <400> 3 Met Arg Leu Leu Val Thr Gly Gly Ala Gly Phe Ile Gly Ser His Phe   1 5 10 15 Val Arg Gln Leu Leu Ala Gly Ala Tyr Pro Asp Val Pro Ala Asp Glu              20 25 30 Val Ile Val Leu Asp Ser Leu Thr Tyr Ala Gly Asn Arg Ala Asn Leu          35 40 45 Ala Pro Val Asp Ala Asp Pro Arg Leu Arg Phe Val His Gly Asp Ile      50 55 60 Arg Asp Ala Gly Leu Leu Ala Arg Glu Leu Arg Gly Val Asp Ala Ile  65 70 75 80 Val His Phe Ala Ala Glu Ser His Val Asp Arg Ser Ile Ala Gly Ala                  85 90 95 Ser Val Phe Thr Glu Thr Asn Val Gln Gly Thr Gln Thr Leu Leu Gln             100 105 110 Cys Ala Val Asp Ala Gly Val Gly Arg Val Val His Val Ser Thr Asp         115 120 125 Glu Val Tyr Gly Ser Ile Asp Ser Gly Ser Trp Thr Glu Ser Ser Pro     130 135 140 Leu Glu Pro Asn Ser Pro Tyr Ala Ala Ser Lys Ala Gly Ser Asp Leu 145 150 155 160 Val Ala Arg Ala Tyr His Arg Thr Tyr Gly Leu Asp Val Arg Ile Thr                 165 170 175 Arg Cys Cys Asn Asn Tyr Gly Pro Tyr Gln His Pro Glu Lys Leu Ile             180 185 190 Pro Leu Phe Val Thr Asn Leu Leu Asp Gly Gly Thr Leu Pro Leu Tyr         195 200 205 Gly Asp Gly Ala Asn Val Arg Glu Trp Val His Thr Asp Asp His Cys     210 215 220 Arg Gly Ile Ala Leu Val Leu Ala Gly Gly Arg Ala Gly Glu Ile Tyr 225 230 235 240 His Ile Gly Gly Gly Leu Glu Leu Thr Asn Arg Glu Leu Thr Gly Ile                 245 250 255 Leu Leu Asp Ser Leu Gly Ala Asp Trp Ser Ser Val Arg Lys Val Ala             260 265 270 Asp Arg Lys Gly His Asp Leu Arg Tyr Ser Leu Asp Gly Gly Glu Ile         275 280 285 Glu Arg Glu Leu Gly Tyr Arg Pro Gln Val Ser Phe Ala Asp Gly Leu     290 295 300 Ala Arg Thr Val Arg Trp Tyr Arg Glu Asn Arg Gly Trp Trp Glu Pro 305 310 315 320 Leu Lys Ala Thr Ala Pro Gln Leu Pro Ala Thr Ala Val Glu Val Ser                 325 330 335 Ala     <210> 4 <211> 415 <212> PRT <213> Artificial Sequence <220> <223> DesI protein <400> 4 Met Lys Ser Ala Leu Ser Asp Leu Ala Phe Phe Gly Gly Pro Ala Ala   1 5 10 15 Phe Asp Gln Pro Leu Leu Val Gly Arg Pro Asn Arg Ile Asp Arg Ala              20 25 30 Arg Leu Tyr Glu Arg Leu Asp Arg Ala Leu Asp Ser Gln Trp Leu Ser          35 40 45 Asn Gly Gly Pro Leu Val Arg Glu Phe Glu Glu Arg Val Ala Gly Leu      50 55 60 Ala Gly Val Arg His Ala Val Ala Thr Cys Asn Ala Thr Ala Gly Leu  65 70 75 80 Gln Leu Leu Ala His Ala Ala Gly Leu Thr Gly Glu Val Ile Met Pro                  85 90 95 Ser Met Thr Phe Ala Ala Thr Pro His Ala Leu Arg Trp Ile Gly Leu             100 105 110 Thr Pro Val Phe Ala Asp Ile Asp Pro Asp Thr Gly Asn Leu Asp Pro         115 120 125 Asp Gln Val Ala Ala Ala Val Thr Pro Arg Thr Ser Ala Val Val Gly     130 135 140 Val His Leu Trp Gly Arg Pro Cys Ala Ala Asp Gln Leu Arg Lys Val 145 150 155 160 Ala Asp Glu His Gly Leu Arg Leu Tyr Phe Asp Ala Ala His Ala Leu                 165 170 175 Gly Cys Ala Val Asp Gly Arg Pro Ala Gly Ser Leu Gly Asp Ala Glu             180 185 190 Val Phe Ser Phe His Ala Thr Lys Ala Val Asn Ala Phe Glu Gly Gly         195 200 205 Ala Val Val Thr Asp Asp Ala Asp Leu Ala Ala Arg Ile Arg Ala Leu     210 215 220 His Asn Phe Gly Phe Asp Leu Pro Gly Gly Ser Pro Ala Gly Gly Thr 225 230 235 240 Asn Ala Lys Met Ser Glu Ala Ala Ala Ala Met Gly Leu Thr Ser Leu                 245 250 255 Asp Ala Phe Pro Glu Val Ile Asp Arg Asn Arg Arg Asn His Ala Ala             260 265 270 Tyr Arg Glu His Leu Ala Asp Leu Pro Gly Val Leu Val Ala Asp His         275 280 285 Asp Arg His Gly Leu Asn Asn His Gln Tyr Val Ile Val Glu Ile Asp     290 295 300 Glu Ala Thr Thr Gly Ile His Arg Asp Leu Val Met Glu Val Leu Lys 305 310 315 320 Ala Glu Gly Val His Thr Arg Ala Tyr Phe Ser Pro Gly Cys His Glu                 325 330 335 Leu Glu Pro Tyr Arg Gly Gln Pro His Ala Pro Leu Pro His Thr Glu             340 345 350 Arg Leu Ala Ala Arg Val Leu Ser Leu Pro Thr Gly Thr Ala Ile Gly         355 360 365 Asp Asp Asp Ile Arg Arg Val Ala Asp Leu Leu Arg Leu Cys Ala Thr     370 375 380 Arg Gly Arg Glu Leu Thr Ala Arg His Arg Asp Thr Ala Pro Ala Pro 385 390 395 400 Leu Ala Ala Pro Gln Thr Ser Thr Pro Thr Ile Gly Arg Ser Arg                 405 410 415 <210> 5 <211> 485 <212> PRT <213> Artificial Sequence <220> <223> DesII protein <400> 5 Met Thr Ala Pro Ala Leu Ser Ala Thr Ala Pro Ala Glu Arg Cys Ala   1 5 10 15 His Pro Gly Ala Asp Leu Gly Ala Ala Val His Ala Val Gly Gln Thr              20 25 30 Leu Ala Ala Gly Gly Leu Val Pro Pro Asp Glu Ala Gly Thr Thr Ala          35 40 45 Arg His Leu Val Arg Leu Ala Val Arg Tyr Gly Asn Ser Pro Phe Thr      50 55 60 Pro Leu Glu Glu Ala Arg His Asp Leu Gly Val Asp Arg Asp Ala Phe  65 70 75 80 Arg Arg Leu Leu Ala Leu Phe Gly Gln Val Pro Glu Leu Arg Thr Ala                  85 90 95 Val Glu Thr Gly Pro Ala Gly Ala Tyr Trp Lys Asn Thr Leu Leu Pro             100 105 110 Leu Glu Gln Arg Gly Val Phe Asp Ala Ala Leu Ala Arg Lys Pro Val         115 120 125 Phe Pro Tyr Ser Val Gly Leu Tyr Pro Gly Pro Thr Cys Met Phe Arg     130 135 140 Cys His Phe Cys Val Arg Val Thr Gly Ala Arg Tyr Asp Pro Ser Ala 145 150 155 160 Leu Asp Ala Gly Asn Ala Met Phe Arg Ser Val Ile Asp Glu Ile Pro                 165 170 175 Ala Gly Asn Pro Ser Ala Met Tyr Phe Ser Gly Gly Leu Glu Pro Leu             180 185 190 Thr Asn Pro Gly Leu Gly Ser Leu Ala Ala His Ala Thr Asp His Gly         195 200 205 Leu Arg Pro Thr Val Tyr Thr Asn Ser Phe Ala Leu Thr Glu Arg Thr     210 215 220 Leu Glu Arg Gln Pro Gly Leu Trp Gly Leu His Ala Ile Arg Thr Ser 225 230 235 240 Leu Tyr Gly Leu Asn Asp Glu Glu Tyr Glu Gln Thr Thr Gly Lys Lys                 245 250 255 Ala Ala Phe Arg Arg Val Arg Glu Asn Leu Arg Arg Phe Gln Gln Leu             260 265 270 Arg Ala Glu Arg Glu Ser Pro Ile Asn Leu Gly Phe Ala Tyr Ile Val         275 280 285 Leu Pro Gly Arg Ala Ser Arg Leu Leu Asp Leu Val Asp Phe Ile Ala     290 295 300 Asp Leu Asn Asp Ala Gly Gln Gly Arg Thr Ile Asp Phe Val Asn Ile 305 310 315 320 Arg Glu Asp Tyr Ser Gly Arg Asp Asp Gly Lys Leu Pro Gln Glu Glu                 325 330 335 Arg Ala Glu Leu Gln Glu Ala Leu Asn Ala Phe Glu Glu Arg Val Arg             340 345 350 Glu Arg Thr Pro Gly Leu His Ile Asp Tyr Gly Tyr Ala Leu Asn Ser         355 360 365 Leu Arg Thr Gly Ala Asp Ala Glu Leu Leu Arg Ile Lys Pro Ala Thr     370 375 380 Met Arg Pro Thr Ala His Pro Gln Val Ala Val Gln Val Asp Leu Leu 385 390 395 400 Gly Asp Val Tyr Leu Tyr Arg Glu Ala Gly Phe Pro Asp Leu Asp Gly                 405 410 415 Ala Thr Arg Tyr Ile Ala Gly Arg Val Thr Pro Asp Thr Ser Leu Thr             420 425 430 Glu Val Val Arg Asp Phe Val Glu Arg Gly Gly Glu Val Ala Ala Val         435 440 445 Asp Gly Asp Glu Tyr Phe Met Asp Gly Phe Asp Gln Val Val Thr Ala     450 455 460 Arg Leu Asn Gln Leu Glu Arg Asp Ala Ala Asp Gly Trp Glu Glu Ala 465 470 475 480 Arg Gly Phe Leu Arg                 485 <210> 6 <211> 379 <212> PRT <213> Artificial Sequence <220> <223> DesV protein <400> 6 Met Ser Ser Arg Ala Glu Thr Pro Arg Val Pro Phe Leu Asp Leu Lys   1 5 10 15 Ala Ala Tyr Glu Glu Leu Arg Ala Glu Thr Asp Ala Ala Ile Ala Arg              20 25 30 Val Leu Asp Ser Gly Arg Tyr Leu Leu Gly Pro Glu Leu Glu Gly Phe          35 40 45 Glu Ala Glu Phe Ala Ala Tyr Cys Glu Thr Asp His Ala Val Gly Val      50 55 60 Asn Ser Gly Met Asp Ala Leu Gln Leu Ala Leu Arg Gly Leu Gly Ile  65 70 75 80 Gly Pro Gly Asp Glu Val Ile Val Pro Ser His Thr Tyr Ile Ala Ser                  85 90 95 Trp Leu Ala Val Ser Ala Thr Gly Ala Thr Pro Val Pro Val Glu Pro             100 105 110 His Glu Asp His Pro Thr Leu Asp Pro Leu Leu Val Glu Lys Ala Ile         115 120 125 Thr Pro Arg Thr Arg Ala Leu Leu Pro Val His Leu Tyr Gly His Pro     130 135 140 Ala Asp Met Asp Ala Leu Arg Glu Leu Ala Asp Arg His Gly Leu His 145 150 155 160 Ile Val Glu Asp Ala Ala Gln Ala His Gly Ala Arg Tyr Arg Gly Arg                 165 170 175 Arg Ile Gly Ala Gly Ser Ser Val Ala Ala Phe Ser Phe Tyr Pro Gly             180 185 190 Lys Asn Leu Gly Cys Phe Gly Asp Gly Gly Ala Val Val Thr Gly Asp         195 200 205 Pro Glu Leu Ala Glu Arg Leu Arg Met Leu Arg Asn Tyr Gly Ser Arg     210 215 220 Gln Lys Tyr Ser His Glu Thr Lys Gly Thr Asn Ser Arg Leu Asp Glu 225 230 235 240 Met Gln Ala Ala Val Leu Arg Ile Arg Leu Ala His Leu Asp Ser Trp                 245 250 255 Asn Gly Arg Arg Ser Ala Leu Ala Ala Glu Tyr Leu Ser Gly Leu Ala             260 265 270 Gly Leu Pro Gly Ile Gly Leu Pro Val Thr Ala Pro Asp Thr Asp Pro         275 280 285 Val Trp His Leu Phe Thr Val Arg Thr Glu Arg Arg Asp Glu Leu Arg     290 295 300 Ser His Leu Asp Ala Arg Gly Ile Asp Thr Leu Thr His Tyr Pro Val 305 310 315 320 Pro Val His Leu Ser Pro Ala Tyr Ala Gly Glu Ala Pro Pro Glu Gly                 325 330 335 Ser Leu Pro Arg Ala Glu Ser Phe Ala Arg Gln Val Leu Ser Leu Pro             340 345 350 Ile Gly Pro His Leu Glu Arg Pro Gln Ala Leu Arg Val Ile Asp Ala         355 360 365 Val Arg Glu Trp Ala Glu Arg Val Asp Gln Ala     370 375 <210> 7 <211> 237 <212> PRT <213> Artificial Sequence <220> <223> DesVI protein <400> 7 Met Tyr Glu Val Asp His Ala Asp Val Tyr Asp Leu Phe Tyr Leu Gly   1 5 10 15 Arg Gly Lys Asp Tyr Ala Ala Glu Ala Ser Asp Ile Ala Asp Leu Val              20 25 30 Arg Ser Arg Thr Pro Glu Ala Ser Ser Leu Leu Asp Val Ala Cys Gly          35 40 45 Thr Gly Thr His Leu Glu His Phe Thr Lys Glu Phe Gly Asp Thr Ala      50 55 60 Gly Leu Glu Leu Ser Glu Asp Met Leu Thr His Ala Arg Lys Arg Leu  65 70 75 80 Pro Asp Ala Thr Leu His Gln Gly Asp Met Arg Asp Phe Arg Leu Gly                  85 90 95 Arg Lys Phe Ser Ala Val Val Ser Met Phe Ser Ser Val Gly Tyr Leu             100 105 110 Lys Thr Thr Glu Glu Leu Gly Ala Ala Val Ala Ser Phe Ala Glu His         115 120 125 Leu Glu Pro Gly Gly Val Val Val Glu Pro Trp Trp Phe Pro Glu     130 135 140 Thr Phe Ala Asp Gly Trp Val Ser Ala Asp Val Val Arg Arg Asp Gly 145 150 155 160 Arg Thr Val Ala Arg Val Ser His Ser Val Arg Glu Gly Asn Ala Thr                 165 170 175 Arg Met Glu Val His Phe Thr Val Ala Asp Pro Gly Lys Gly Val Arg             180 185 190 His Phe Ser Asp Val His Leu Ile Thr Leu Phe His Gln Ala Glu Tyr         195 200 205 Glu Ala Ala Phe Thr Ala Ala Gly Leu Arg Val Glu Tyr Leu Glu Gly     210 215 220 Gly Pro Ser Gly Arg Gly Leu Phe Val Gly Val Pro Ala 225 230 235 <210> 8 <211> 204 <212> PRT <213> Artificial Sequence <220> <223> OleL <400> 8 Met Glu Leu Leu Asp Val Asp Gly Ala Trp Leu Tyr Thr Pro Glu Ile   1 5 10 15 Met Arg Asp Glu Arg Gly Glu Phe Leu Glu Trp Phe Arg Gly Arg Thr              20 25 30 Phe Gln Glu Lys Ile Gly His Pro Leu Ser Leu Ala Gln Ala Asn Cys          35 40 45 Ser Val Ser Arg Lys Ala Phe Cys Ala Ala Ser Thr Ser Pro Thr Pro      50 55 60 Pro Pro Gly Gln Ala Lys Tyr Val Thr Cys Ala Ser Gly Thr Val Leu  65 70 75 80 Asp Val Val Val Asp Val Arg Arg Gly Ser Pro Thr Phe Gly Arg Trp                  85 90 95 Ala Ala Val Arg Leu Asp Ala Ala Arg His Gln Gly Leu Tyr Leu Ala             100 105 110 Glu Gly Leu Gly His Ala Phe Met Ala Leu Thr Asp Asp Ala Thr Val         115 120 125 Val Tyr Leu Cys Ser Gln Pro Tyr Val Ala Glu Ala Glu Arg Ala Val     130 135 140 Asp Pro Leu Asp Pro Ala Ile Gly Ile Glu Trp Pro Thr Asp Ile Asp 145 150 155 160 Ile Val Pro Val Gly Glu Gly Thr Pro Thr His Arg Pro Trp Arg Arg                 165 170 175 Pro Arg Arg Pro Gly Ile Leu Pro Asp Tyr Glu Gly Val Pro Gly Ala             180 185 190 Leu His Arg Gly Gly Gly Arg Arg Gly Thr Gly Pro         195 200 <210> 9 <211> 295 <212> PRT <213> Artificial Sequence <220> <223> OleU protein <400> 9 Met Arg Trp Leu Ile Thr Gly Ala Ala Gly Met Leu Gly Arg Glu Leu   1 5 10 15 Val Arg Arg Leu Ala Glu Asn Glu Glu Asp Val Ala Ala Leu Gly His              20 25 30 Asp His Leu Asp Val Thr Arg Pro Ser Ala Val Arg Ala Ala Leu Ala          35 40 45 Glu His Arg Pro Gly Ile Val Val Asn Cys Ala Ala Tyr Thr Ala Val      50 55 60 Asp Asp Ala Glu Thr Asp Glu Ala Ala Ala Ala Leu Leu Asn Ala Glu  65 70 75 80 Ala Pro Arg Leu Leu Ala Glu Gly Leu Arg Pro His Arg Arg His Gly                  85 90 95 Leu Val His Leu Ser Thr Asp Tyr Val Phe Pro Gly Asp Ala Arg Thr             100 105 110 Pro Tyr Ala Glu Asp His Pro Thr Ala Pro Arg Ser Ala Tyr Gly Arg         115 120 125 Thr Lys Arg Asp Gly Glu Gln Ala Val Leu Thr Ala Leu Pro Thr Ala     130 135 140 Thr Val Leu Arg Thr Ala Trp Leu Tyr Gly Arg Thr Gly Arg Ser Phe 145 150 155 160 Val Arg Thr Met Ile Glu Arg Glu Ala Arg Gly Gly Ala Ile Asp Val                 165 170 175 Val Ala Asp Gln Arg Gly Gln Pro Thr Trp Thr Gly Asp Leu Ala Asp             180 185 190 Arg Ile Ile Ala Val Gly Arg His Pro Gly Val His Gly Ile Leu His         195 200 205 Ala Thr Asn Ala Gly Ser Ala Thr Trp Tyr Asp Leu Ala Gln Glu Val     210 215 220 Phe Arg Leu Leu Asp Ala Asp Pro Gly Arg Val Arg Pro Thr Thr Gly 225 230 235 240 Ala Ala Phe Arg Arg Pro Ala Pro Arg Pro Ala Tyr Ser Val Leu Gly                 245 250 255 His Asp Arg Trp Arg Gly Thr Gly Leu Ala Pro Leu Arg Asp Trp Arg             260 265 270 Ser Ala Leu Arg Glu Ala Phe Pro Asp Ile Leu Ala Ala Glu His Pro         275 280 285 Pro Thr Arg Arg Gly Ala Ala     290 295 <210> 10 <211> 474 <212> PRT <213> Artificial Sequence <220> <223> OleV protein <400> 10 Met Ile Trp Gly Ile Pro Ala Met Ser Glu Ala Met Gly Ser Val Pro   1 5 10 15 Thr Ala Gly Ser Glu Val Ser Ser Thr Cys Ala Phe Leu Ser Trp Leu              20 25 30 Asp Ala Arg Arg Arg Ala Asn Arg Leu Thr Val Glu His Val Pro Phe          35 40 45 Arg Glu Leu Ser Gly Trp Gln Phe Asp Glu Asn Thr Gly Asn Leu Arg      50 55 60 His Thr Ser Gly Arg Phe Phe Ser Ile Glu Gly Leu Arg Val Arg Thr  65 70 75 80 Asp His Cys Trp Phe Gly Ser Trp Thr Gln Pro Ile Ile Val Gln Pro                  85 90 95 Glu Ile Gly Ile Leu Gly Leu Leu Val Lys Arg Phe Asp Gly Ile Leu             100 105 110 His Val Leu Val Gln Ala Lys Asn Glu Pro Gly Asn Ile Gly Gly Leu         115 120 125 Gln Leu Ser Pro Thr Val Gln Ala Thr Arg Ser Asn Tyr Thr Arg Val     130 135 140 His Arg Gly Gly Gly Val Arg Tyr Leu Glu Tyr Phe Ala Ser Pro Arg 145 150 155 160 Gly Arg Gly Arg Val Leu Ala Asp Val Leu Gln Ser Glu Gln Gly Ser                 165 170 175 Trp Phe Leu His Lys Arg Asn Arg Asn Met Val Val Glu Ala Leu Asp             180 185 190 Asp Val Pro Leu Asp Asp Asp Phe His Trp Ile Ser Leu Gly Gly Leu         195 200 205 Arg Lys Leu Leu Leu Arg Pro His Leu Val Asn Met Asp Thr Arg Thr     210 215 220 Val Leu Ser Cys Leu Pro Pro Asp Pro Ala Pro Asp Gly Arg Gln Pro 225 230 235 240 Pro Ala Pro Ala Ala Pro Phe Ala Ala Ala Val Thr Arg Ser Leu Thr                 245 250 255 Arg Gly Ala Thr Ala Leu His Thr Met Gly Glu Ile Leu Gly Trp Leu             260 265 270 Thr Asp Glu Arg Ser Arg Arg Glu Leu Val Gln Gln Arg Val Pro Leu         275 280 285 Glu Glu Thr Ala Phe Ser Gly Trp Arg Arg Asp Asp His Ala Ile Ala     290 295 300 His Lys Asp Gly Asp Tyr Phe Arg Val Ile Gly Val Ser Val Arg Ala 305 310 315 320 Ser Ser Arg Glu Val Ser Ser Trp Ser Gln Pro Leu Leu Ala Pro Val                 325 330 335 Gly Pro Gly Leu Ala Ala Phe Val Thr Arg Arg Ile Arg Gly Val Leu             340 345 350 His Val Leu Leu His Ala Arg Thr Glu Ala Gly Leu Leu Asn Gly Pro         355 360 365 Glu Met Ala Pro Thr Val Gln Cys Arg Pro Leu Asn Tyr Arg Ala Val     370 375 380 Pro Ala Glu Tyr Arg Pro Ala Tyr Leu Asp Tyr Val Leu Ser Ala Asp 385 390 395 400 Pro Gly Arg Ile Arg Tyr Asp Thr Leu Gln Ser Glu Glu Gly Gly Arg                 405 410 415 Phe His His Ala Glu Asn Arg Tyr Val Val Val Glu Ala Glu Asp Asp             420 425 430 Phe Pro Val Glu Val Pro Arg Asp Phe Arg Trp Leu Thr Leu His Gln         435 440 445 Ile Leu Ala Leu Leu His His Ser Asn Tyr Val Asn Val Glu Ala Arg     450 455 460 Ser Leu Val Ala Cys Ile Gln Ala Leu Ser 465 470 <210> 11 <211> 333 <212> PRT <213> Artificial Sequence <220> <223> EryBII protein <400> 11 Met Thr Thr Asp Ala Ala Thr His Val Arg Leu Gly Arg Ser Ala Leu   1 5 10 15 Leu Thr Ser Arg Leu Trp Leu Gly Thr Val Asn Phe Ser Gly Arg Val              20 25 30 Glu Asp Asp Asp Ala Leu Arg Leu Met Asp His Ala Arg Asp Arg Gly          35 40 45 Ile Asn Cys Leu Asp Thr Ala Asp Met Tyr Gly Trp Arg Leu Tyr Lys      50 55 60 Gly His Thr Glu Glu Leu Val Gly Arg Trp Leu Ala Gln Gly Gly Gly  65 70 75 80 Arg Arg Glu Asp Thr Val Leu Ala Thr Lys Val Gly Gly Glu Met Ser                  85 90 95 Glu Arg Val Asn Asp Ser Gly Leu Ser Ala Arg His Ile Ile Ala Ser             100 105 110 Cys Glu Gly Ser Leu Arg Arg Leu Gly Val Asp His Ile Asp Val Tyr         115 120 125 Gln Met His His Ile Asp Arg Ser Ala Pro Trp Asp Glu Val Trp Gln     130 135 140 Ala Met Asp Ser Leu Val Ala Ser Gly Lys Val Ser Tyr Val Gly Ser 145 150 155 160 Ser Asn Phe Ala Gly Trp His Ile Ala Ala Ala Gln Glu Asn Ala Ala                 165 170 175 Arg Arg His Ser Leu Gly Met Val Ser His Gln Cys Leu Tyr Asn Leu             180 185 190 Ala Val Arg His Ala Glu Leu Glu Val Leu Pro Ala Ala Gln Ala Tyr         195 200 205 Gly Leu Gly Val Phe Ala Trp Ser Pro Leu His Gly Gly Leu Leu Ser     210 215 220 Gly Ala Leu Glu Lys Leu Ala Gla Thr Ala Val Lys Ser Ala Gln 225 230 235 240 Gly Arg Ala Gln Val Leu Leu Pro Ser Leu Arg Pro Ala Ile Glu Ala                 245 250 255 Tyr Glu Lys Phe Cys Arg Asn Leu Gly Glu Asp Pro Ala Glu Val Gly             260 265 270 Leu Ala Trp Val Leu Ser Arg Pro Gly Ile Ala Gly Ala Val Ile Gly         275 280 285 Pro Arg Thr Pro Glu Gln Leu Asp Ser Ala Leu Lys Ala Ser Ala Met     290 295 300 Thr Leu Asp Glu Gln Ala Leu Ser Glu Leu Asp Glu Ile Phe Pro Ala 305 310 315 320 Val Ala Ser Gly Gly Ala Ala Pro Glu Ala Trp Leu Gln                 325 330 <210> 12 <211> 247 <212> PRT <213> Artificial Sequence <220> <223> UrdR protein <400> 12 Met Asp Ile Val Gly Asn Gly Phe Leu Ala Arg Asn Leu Arg Pro Leu   1 5 10 15 Ala Glu Arg His Pro Asp Thr Val Ala Leu Ala Ala Gly Val Ser Trp              20 25 30 Ala Ser Gly Thr Ser Asp Ala Asp Phe Ala Arg Glu Ala Ala Leu Leu          35 40 45 Arg Asp Thr Ala Lys Gln Cys Ala Ala Thr Gly Arg Arg Leu Leu Phe      50 55 60 Phe Ser Thr Ala Ala Thr Gly Met Tyr Gly Leu Ala Glu Gly Pro Gly  65 70 75 80 Arg Glu Asp Thr Pro Val Thr Pro Cys Thr Pro Tyr Gly Ala His Lys                  85 90 95 Leu Ala Leu Glu Glu Leu Leu Arg Asp Ser Gly Ala Asp His Val Ile             100 105 110 Leu Arg Leu Gly His Leu Val Gly Pro Asp Gln Pro Glu His Gln Leu         115 120 125 Leu Pro Thr Leu Val Arg His Leu Arg Glu Gly Ala Val Arg Ile His     130 135 140 Arg Gly Ala Ala Arg Asp Leu Ile Asp Val Ser Asp Val Val Thr Ile 145 150 155 160 Val Asp Cys Leu Leu Gly Leu Asp Leu Lys Ala Glu Thr Val Asn Val                 165 170 175 Ala Ser Gly Tyr Ala Val Pro Val Lys Asp Ile Val Glu Leu Leu Arg             180 185 190 Arg Arg Leu Gly Val Glu Ala Arg Tyr Glu Phe Gln Asp Ala Gly Gly         195 200 205 Gln His Val Ile Ser Ile Glu Lys Leu Arg Ala Leu Val Pro Gln Val     210 215 220 Gln Asp Met Gly Phe Gly Pro Asp Tyr Tyr Arg Arg Ile Leu Ser Asp 225 230 235 240 Phe Thr Ser Ala Val Arg Ile                 245 <210> 13 <211> 328 <212> PRT <213> Artificial Sequence <220> <223> OleW protein <400> 13 Met Pro Ser Pro Arg Leu Arg Phe Gly Val Leu Gly Ala Ala Asp Ile   1 5 10 15 Ala Leu Arg Arg Thr Val Pro Ala Leu Leu Ala His Pro Asp Val Thr              20 25 30 Val Val Ala Val Ser Ser Ar Ar Asp Thr Ala Arg Ala Ala Arg Phe Ala          35 40 45 Ala Ala Phe Gly Cys Glu Ala Val Pro Gly His Gln Ala Leu Leu Asp      50 55 60 Arg Asp Asp Ile Asp Ala Leu Tyr Val Pro Leu Pro Val Met Val His  65 70 75 80 Thr Pro Trp Val Glu Ala Ala Leu Leu Arg Gly Arg His Val Leu Val                  85 90 95 Glu Lys Pro Leu Thr Ala Thr Arg Ser Gly Ala Glu Asp Leu Ile Ala             100 105 110 Leu Ala Arg Ser Arg Gly Leu Val Leu Met Glu Asn Phe Thr Ser Leu         115 120 125 His His Ala Gln His Gly Thr Val Thr Asp Leu Leu Arg Asp Gly Thr     130 135 140 Ile Gly Glu Leu Arg Ser Leu Ser Ala Ala Phe Thr Ile Pro Pro Lys 145 150 155 160 Pro Glu Gly Asp Ile Arg Tyr Gln Pro Asp Val Gly Gly Gly Ala Leu                 165 170 175 Leu Asp Ile Gly Ile Tyr Pro Leu Arg Ala Ala Leu His Phe Leu Gly             180 185 190 Pro Asp Leu His Ala Ala Gly Ala Val Leu Arg Arg Glu Arg Arg Arg         195 200 205 Asn Val Val Val Ser Gly His Val Leu Leu Thr Thr Pro His Gly Val     210 215 220 Val Ala Glu Leu Ala Phe Gly Met Glu His Ala Tyr Arg Ser Glu Tyr 225 230 235 240 Thr Leu Phe Gly Thr Ala Gly Arg Leu Arg Leu Asp Arg Ala Phe Thr                 245 250 255 Pro Pro Glu Thr His Arg Pro Arg Val Glu Ile His Arg Gln Asp Ala             260 265 270 Leu Asp Ile Val Asp Leu Pro Pro Asp Ala Gln Phe Ala Asn Leu Val         275 280 285 Arg Asp Phe Val Leu Ala Val Arg Glu Gly Pro Gly Arg Leu Thr Gln     290 295 300 His His Ala Asp Ala Val Arg Gln Ala Asp Leu Val Glu Arg Val Met 305 310 315 320 Ala Val Ala Arg Val Arg Trp Cys                 325 <210> 14 <211> 402 <212> PRT <213> Artificial Sequence <220> <223> DesVIII protein <400> 14 Met Thr Asp Asp Leu Thr Gly Ala Leu Thr Gln Pro Pro Leu Gly Arg   1 5 10 15 Thr Val Arg Ala Val Ala Asp Arg Glu Leu Gly Thr His Leu Leu Glu              20 25 30 Thr Arg Gly Ile His Trp Ile His Ala Ala Asn Gly Asp Pro Tyr Ala          35 40 45 Thr Val Leu Arg Gly Gln Ala Asp Asp Pro Tyr Pro Ala Tyr Glu Arg      50 55 60 Val Arg Ala Arg Gly Ala Leu Ser Phe Ser Pro Thr Gly Ser Trp Val  65 70 75 80 Thr Ala Asp His Ala Leu Ala Ala Ser Ile Leu Cys Ser Thr Asp Phe                  85 90 95 Gly Val Ser Gly Ala Asp Gly Val Pro Val Pro Gln Gln Val Leu Ser             100 105 110 Tyr Gly Glu Gly Cys Pro Leu Glu Arg Glu Gln Val Leu Pro Ala Ala         115 120 125 Gly Asp Val Pro Glu Gly Gly Gln Arg Ala Val Val Glu Gly Ile His     130 135 140 Arg Glu Thr Leu Glu Gly Leu Ala Pro Asp Pro Ser Ala Ser Tyr Ala 145 150 155 160 Phe Glu Leu Leu Gly Gly Phe Val Arg Pro Ala Val Thr Ala Ala Ala                 165 170 175 Ala Ala Val Leu Gly Val Pro Ala Asp Arg Arg Ala Asp Phe Ala Asp             180 185 190 Leu Leu Glu Arg Leu Arg Pro Leu Ser Asp Ser Leu Leu Ala Pro Gln         195 200 205 Ser Leu Arg Thr Val Arg Ala Ala Asp Gly Ala Leu Ala Glu Leu Thr     210 215 220 Ala Leu Leu Ala Asp Ser Asp Asp Ser Pro Gly Ala Leu Leu Ser Ala 225 230 235 240 Leu Gly Val Thr Ala Ala Val Gln Leu Thr Gly Asn Ala Val Leu Ala                 245 250 255 Leu Leu Ala His Pro Glu Gln Trp Arg Glu Leu Cys Asp Arg Pro Gly             260 265 270 Leu Ala Ala Ala Ala Val Glu Glu Thr Leu Arg Tyr Asp Pro Pro Val         275 280 285 Gln Leu Asp Ala Arg Val Val Arg Gly Glu Thr Glu Leu Ala Gly Arg     290 295 300 Arg Leu Pro Ala Gly Ala His Val Val Val Leu Thr Ala Ala Thr Gly 305 310 315 320 Arg Asp Pro Glu Val Phe Thr Asp Pro Glu Arg Phe Asp Leu Ala Arg                 325 330 335 Pro Asp Ala Ala Ala His Leu Ala Leu His Pro Ala Gly Pro Tyr Gly             340 345 350 Pro Val Ala Ser Leu Val Arg Leu Gln Ala Glu Val Ala Leu Arg Thr         355 360 365 Leu Ala Gly Arg Phe Pro Gly Leu Arg Gln Ala Gly Asp Val Leu Arg     370 375 380 Pro Arg Arg Ala Pro Val Gly Arg Gly Pro Leu Ser Val Pro Val Ser 385 390 395 400 Ser Ser         <210> 15 <211> 426 <212> PRT <213> Artificial Sequence <220> <223> DesVII protein <400> 15 Met Arg Val Leu Leu Thr Ser Phe Ala His His Thr His Tyr Tyr Gly   1 5 10 15 Leu Val Pro Leu Ala Trp Ala Leu Leu Ala Ala Gly His Glu Val Arg              20 25 30 Val Ala Ser Gln Pro Ala Leu Thr Asp Thr Ile Thr Gly Ser Gly Leu          35 40 45 Ala Ala Val Pro Val Gly Thr Asp His Leu Ile His Glu Tyr Arg Val      50 55 60 Arg Met Ala Gly Glu Pro Arg Pro Asn His Pro Ala Ile Ala Phe Asp  65 70 75 80 Glu Ala Arg Pro Glu Pro Leu Asp Trp Asp His Ala Leu Gly Ile Glu                  85 90 95 Ala Ile Leu Ala Pro Tyr Phe His Leu Leu Ala Asn Asn Asp Ser Met             100 105 110 Val Asp Asp Leu Val Asp Phe Ala Arg Ser Trp Gln Pro Asp Leu Val         115 120 125 Leu Trp Glu Pro Thr Thr Tyr Ala Gly Ala Val Ala Ala Gln Val Thr     130 135 140 Gly Ala Ala His Ala Arg Val Leu Trp Gly Pro Asp Val Met Gly Ser 145 150 155 160 Ala Arg Arg Lys Phe Val Ala Leu Arg Asp Arg Gln Pro Pro Glu His                 165 170 175 Arg Glu Asp Pro Thr Ala Glu Trp Leu Thr Trp Thr Leu Asp Arg Tyr             180 185 190 Gly Ala Ser Phe Glu Glu Glu Leu Leu Thr Gly Gln Phe Thr Ile Asp         195 200 205 Pro Thr Pro Pro Ser Leu Arg Leu Asp Thr Gly Leu Pro Thr Val Gly     210 215 220 Met Arg Tyr Val Pro Tyr Asn Gly Thr Ser Val Val Pro Asp Trp Leu 225 230 235 240 Ser Glu Pro Pro Ala Arg Pro Arg Val Cys Leu Thr Leu Gly Val Ser                 245 250 255 Ala Arg Glu Val Leu Gly Gly Asp Gly Val Ser Gln Gly Asp Ile Leu             260 265 270 Glu Ala Leu Ala Asp Leu Asp Ile Glu Leu Val Ala Thr Leu Asp Ala         275 280 285 Ser Gln Arg Ala Glu Ile Arg Asn Tyr Pro Lys His Thr Arg Phe Thr     290 295 300 Asp Phe Val Pro Met His Ala Leu Leu Pro Ser Cys Ser Ala Ile Ile 305 310 315 320 His His Gly Gly Ala Gly Thr Tyr Ala Thr Ala Val Ile Asn Ala Val                 325 330 335 Pro Gln Val Met Leu Ala Glu Leu Trp Asp Ala Pro Val Lys Ala Arg             340 345 350 Ala Val Ala Glu Gln Gly Ala Gly Phe Phe Leu Pro Pro Ala Glu Leu         355 360 365 Thr Pro Gln Ala Val Arg Asp Ala Val Val Arg Ile Leu Asp Asp Pro     370 375 380 Ser Val Ala Thr Ala Ala His Arg Leu Arg Glu Glu Thr Phe Gly Asp 385 390 395 400 Pro Thr Pro Ala Gly Ile Val Pro Glu Leu Glu Arg Leu Ala Ala Gln                 405 410 415 His Arg Arg Pro Pro Ala Asp Ala Arg His             420 425 <210> 16 <211> 4891 <212> DNA <213> Artificial Sequence <220> <223> desVIII-des VIII-desIII-desIV <400> 16 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tcctggagac ccgcggcatc cactggatcc 180 acgccgcgaa cggcgacccg tacgccaccg tgctgcgcgg ccaggcggac gacccgtatc 240 ccgcgtacga gcgggtgcgt gcccgcggcg cgctctcctt cagcccgacg ggcagctggg 300 tcaccgccga tcacgccctg gcggcgagca tcctctgctc gacggacttc ggggtctccg 360 gcgccgacgg cgtcccggtg ccgcagcagg tcctctcgta cggggagggc tgtccgctgg 420 agcgcgagca ggtgctgccg gcggccggtg acgtgccgga gggcgggcag cgtgccgtgg 480 tcgaggggat ccaccgggag acgctggagg gtctcgcgcc ggacccgtcg gcgtcgtacg 540 ccttcgagct gctgggcggt ttcgtccgcc cggcggtgac ggccgctgcc gccgccgtgc 600 tgggtgttcc cgcggaccgg cgcgcggact tcgcggatct gctggagcgg ctccggccgc 660 tgtccgacag cctgctggcc ccgcagtccc tgcggacggt acgggcggcg gacggcgcgc 720 tggccgagct cacggcgctg ctcgccgatt cggacgactc ccccggggcc ctgctgtcgg 780 cgctcggggt caccgcagcc gtccagctca ccgggaacgc ggtgctcgcg ctcctcgcgc 840 atcccgagca gtggcgggag ctgtgcgacc ggcccgggct cgcggcggcc gcggtggagg 900 agaccctccg ctacgacccg ccggtgcagc tcgacgcccg ggtggtccgc ggggagacgg 960 agctggcggg ccggcggctg ccggccgggg cgcatgtcgt cgtcctgacc gccgcgaccg 1020 gccgggaccc ggaggtcttc acggacccgg agcgcttcga cctcgcgcgc cccgacgccg 1080 ccgcgcacct cgcgctgcac cccgccggtc cgtacggccc ggtggcgtcc ctggtccggc 1140 ttcaggcgga ggtcgcgctg cggaccctgg ccgggcgttt ccccgggctg cggcaggcgg 1200 gggacgtgct ccgcccccgc cgcgcgcctg tcggccgcgg gccgctgagc gtcccggtca 1260 gcagctcctg agacaccggg gccccggtcc gcccggcccc ccttcggacg gaccggacgg 1320 ctcggaccac ggggacggct cagaccgtcc cgtgtgtccc cgtccggctc ccgtccgccc 1380 catcccgccc ctccaccggc aaggaaggac acgacgccat gcgcgtcctg ctgacctcgt 1440 tcgcacatca cacgcactac tacggcctgg tgcccctggc ctgggcgctg ctcgccgccg 1500 ggcacgaggt gcgggtcgcc agccagcccg cgctcacgga caccatcacc gggtccgggc 1560 tcgccgcggt gccggtcggc accgaccacc tcatccacga gtaccgggtg cggatggcgg 1620 gcgagccgcg cccgaaccat ccggcgatcg ccttcgacga ggcccgtccc gagccgctgg 1680 actgggacca cgccctcggc atcgaggcga tcctcgcccc gtacttccat ctgctcgcca 1740 acaacgactc gatggtcgac gacctcgtcg acttcgcccg gtcctggcag ccggacctgg 1800 tgctgtggga gccgacgacc tacgcgggcg ccgtcgccgc ccaggtcacc ggtgccgcgc 1860 acgcccgggt cctgtggggg cccgacgtga tgggcagcgc ccgccgcaag ttcgtcgcgc 1920 tgcgggaccg gcagccgccc gagcaccgcg aggaccccac cgcggagtgg ctgacgtgga 1980 cgctcgaccg gtacggcgcc tccttcgaag aggagctgct caccggccag ttcacgatcg 2040 acccgacccc gccgagcctg cgcctcgaca cgggcctgcc gaccgtcggg atgcgttatg 2100 ttccgtacaa cggcacgtcg gtcgtgccgg actggctgag tgagccgccc gcgcggcccc 2160 gggtctgcct gaccctcggc gtctccgcgc gtgaggtcct cggcggcgac ggcgtctcgc 2220 agggcgacat cctggaggcg ctcgccgacc tcgacatcga gctcgtcgcc acgctcgacg 2280 cgagtcagcg cgccgagatc cgcaactacc cgaagcacac ccggttcacg gacttcgtgc 2340 cgatgcacgc gctcctgccg agctgctcgg cgatcatcca ccacggcggg gcgggcacct 2400 acgcgaccgc cgtgatcaac gcggtgccgc aggtcatgct cgccgagctg tgggacgcgc 2460 cggtcaaggc gcgggccgtc gccgagcagg gggcggggtt cttcctgccg ccggccgagc 2520 tcacgccgca ggccgtgcgg gacgccgtcg tccgcatcct cgacgacccc tcggtcgcca 2580 ccgccgcgca ccggctgcgc gaggagacct tcggcgaccc caccccggcc gggatcgtcc 2640 ccgagctgga gcggctcgcc gcgcagcacc gccgcccgcc ggccgacgcc cggcactgag 2700 ccgcacccct cgccccaggc ctcacccctg tatctcatat gtctagttaa ctcgccacgc 2760 cgaccgttat caccggcgcc ctgctgctag tttccgagaa tgaagggaat agtcctggcc 2820 ggcgggagcg gaactcggct gcatccggcg acctcggtca tttcgaagca gattcttccg 2880 gtctacaaca aaccgatgat ctactatccg ctgtcggttc tcatgctcgg cggtattcgc 2940 gagattcaaa tcatctcgac cccccagcac atcgaactct tccagtcgct tctcggaaac 3000 ggcaggcacc tgggaataga actcgactat gcggtccaga aagagcccgc aggaatcgcg 3060 gacgcacttc tcgtcggagc cgagcacatc ggcgacgaca cctgcgccct gatcctgggc 3120 gacaacatct tccacgggcc cggcctctac acgctcctgc gggacagcat cgcgcgcctc 3180 gacggctgcg tgctcttcgg ctacccggtc aaggaccccg agcggtacgg cgtcgccgag 3240 gtggacgcga cgggccggct gaccgacctc gtcgagaagc ccgtcaagcc gcgctccaac 3300 ctcgccgtca ccggcctcta cctctacgac aacgacgtcg tcgacatcgc caagaacatc 3360 cggccctcgc cgcgcggcga gctggagatc accgacgtca accgcgtcta cctggagcgg 3420 ggccgggccg aactcgtcaa cctgggccgc ggcttcgcct ggctggacac cggcacccac 3480 gactcgctcc tgcgggccgc ccagtacgtc caggtcctgg aggagcggca gggcgtctgg 3540 atcgcgggcc ttgaggagat cgccttccgc atgggcttca tcgacgccga ggcctgtcac 3600 ggcctgggag aaggcctctc ccgcaccgag tacggcagct atctgatgga gatcgccggc 3660 cgcgagggag ccccgtgagg gcacctcgcg gccgacgcgt tcccacgacc gacagcgcca 3720 ccgacagtgc gacccacacc gcgacccgca ccgccaccga cagtgcgacc cacaccgcga 3780 cctacagcgc gaccgaaagg aagacggcag tgcggcttct ggtgaccgga ggtgcgggct 3840 tcatcggctc gcacttcgtg cggcagctcc tcgccggggc gtaccccgac gtgcccgccg 3900 atgaggtgat cgtcctggac agcctcacct acgcgggcaa ccgcgccaac ctcgccccgg 3960 tggacgcgga cccgcgactg cgcttcgtcc acggcgacat ccgcgacgcc ggcctcctcg 4020 cccgggaact gcgcggcgtg gacgccatcg tccacttcgc ggccgagagc cacgtggacc 4080 gctccatcgc gggcgcgtcc gtgttcaccg agaccaacgt gcagggcacg cagacgctgc 4140 tccagtgcgc cgtcgacgcc ggcgtcggcc gggtcgtgca cgtctccacc gacgaggtgt 4200 acgggtcgat cgactccggc tcctggaccg agagcagccc gctggagccc aactcgccct 4260 acgcggcgtc caaggccggc tccgacctcg ttgcccgcgc ctaccaccgg acgtacggcc 4320 tcgacgtacg gatcacccgc tgctgcaaca actacgggcc gtaccagcac cccgagaagc 4380 tcatccccct cttcgtgacg aacctcctcg acggcgggac gctcccgctg tacggcgacg 4440 gcgcgaacgt ccgcgagtgg gtgcacaccg acgaccactg ccggggcatc gcgctcgtcc 4500 tcgcgggcgg ccgggccggc gagatctacc acatcggcgg cggcctggag ctgaccaacc 4560 gcgaactcac cggcatcctc ctggactcgc tcggcgccga ctggtcctcg gtccggaagg 4620 tcgccgaccg caagggccac gacctgcgct actccctcga cggcggcgag atcgagcgcg 4680 agctcggcta ccgcccgcag gtctccttcg cggacggcct cgcgcggacc gtccgctggt 4740 accgggagaa ccgcggctgg tgggagccgc tcaaggcgac cgccccgcag ctgcccgcca 4800 ccgccgtgga ggtgtccgcg tgagcagccg cgccgagacc ccccgcgtcc ccttcctcga 4860 cctcaaggcc gcctacgagg agctctctag a 4891 <210> 17 <211> 6603 <212> DNA <213> Artificial Sequence <220> <223> desVIII-desVII-desIII-desIV-oleL-oleU <400> 17 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tcctggagac ccgcggcatc cactggatcc 180 acgccgcgaa cggcgacccg tacgccaccg tgctgcgcgg ccaggcggac gacccgtatc 240 ccgcgtacga gcgggtgcgt gcccgcggcg cgctctcctt cagcccgacg ggcagctggg 300 tcaccgccga tcacgccctg gcggcgagca tcctctgctc gacggacttc ggggtctccg 360 gcgccgacgg cgtcccggtg ccgcagcagg tcctctcgta cggggagggc tgtccgctgg 420 agcgcgagca ggtgctgccg gcggccggtg acgtgccgga gggcgggcag cgtgccgtgg 480 tcgaggggat ccaccgggag acgctggagg gtctcgcgcc ggacccgtcg gcgtcgtacg 540 ccttcgagct gctgggcggt ttcgtccgcc cggcggtgac ggccgctgcc gccgccgtgc 600 tgggtgttcc cgcggaccgg cgcgcggact tcgcggatct gctggagcgg ctccggccgc 660 tgtccgacag cctgctggcc ccgcagtccc tgcggacggt acgggcggcg gacggcgcgc 720 tggccgagct cacggcgctg ctcgccgatt cggacgactc ccccggggcc ctgctgtcgg 780 cgctcggggt caccgcagcc gtccagctca ccgggaacgc ggtgctcgcg ctcctcgcgc 840 atcccgagca gtggcgggag ctgtgcgacc ggcccgggct cgcggcggcc gcggtggagg 900 agaccctccg ctacgacccg ccggtgcagc tcgacgcccg ggtggtccgc ggggagacgg 960 agctggcggg ccggcggctg ccggccgggg cgcatgtcgt cgtcctgacc gccgcgaccg 1020 gccgggaccc ggaggtcttc acggacccgg agcgcttcga cctcgcgcgc cccgacgccg 1080 ccgcgcacct cgcgctgcac cccgccggtc cgtacggccc ggtggcgtcc ctggtccggc 1140 ttcaggcgga ggtcgcgctg cggaccctgg ccgggcgttt ccccgggctg cggcaggcgg 1200 gggacgtgct ccgcccccgc cgcgcgcctg tcggccgcgg gccgctgagc gtcccggtca 1260 gcagctcctg agacaccggg gccccggtcc gcccggcccc ccttcggacg gaccggacgg 1320 ctcggaccac ggggacggct cagaccgtcc cgtgtgtccc cgtccggctc ccgtccgccc 1380 catcccgccc ctccaccggc aaggaaggac acgacgccat gcgcgtcctg ctgacctcgt 1440 tcgcacatca cacgcactac tacggcctgg tgcccctggc ctgggcgctg ctcgccgccg 1500 ggcacgaggt gcgggtcgcc agccagcccg cgctcacgga caccatcacc gggtccgggc 1560 tcgccgcggt gccggtcggc accgaccacc tcatccacga gtaccgggtg cggatggcgg 1620 gcgagccgcg cccgaaccat ccggcgatcg ccttcgacga ggcccgtccc gagccgctgg 1680 actgggacca cgccctcggc atcgaggcga tcctcgcccc gtacttccat ctgctcgcca 1740 acaacgactc gatggtcgac gacctcgtcg acttcgcccg gtcctggcag ccggacctgg 1800 tgctgtggga gccgacgacc tacgcgggcg ccgtcgccgc ccaggtcacc ggtgccgcgc 1860 acgcccgggt cctgtggggg cccgacgtga tgggcagcgc ccgccgcaag ttcgtcgcgc 1920 tgcgggaccg gcagccgccc gagcaccgcg aggaccccac cgcggagtgg ctgacgtgga 1980 cgctcgaccg gtacggcgcc tccttcgaag aggagctgct caccggccag ttcacgatcg 2040 acccgacccc gccgagcctg cgcctcgaca cgggcctgcc gaccgtcggg atgcgttatg 2100 ttccgtacaa cggcacgtcg gtcgtgccgg actggctgag tgagccgccc gcgcggcccc 2160 gggtctgcct gaccctcggc gtctccgcgc gtgaggtcct cggcggcgac ggcgtctcgc 2220 agggcgacat cctggaggcg ctcgccgacc tcgacatcga gctcgtcgcc acgctcgacg 2280 cgagtcagcg cgccgagatc cgcaactacc cgaagcacac ccggttcacg gacttcgtgc 2340 cgatgcacgc gctcctgccg agctgctcgg cgatcatcca ccacggcggg gcgggcacct 2400 acgcgaccgc cgtgatcaac gcggtgccgc aggtcatgct cgccgagctg tgggacgcgc 2460 cggtcaaggc gcgggccgtc gccgagcagg gggcggggtt cttcctgccg ccggccgagc 2520 tcacgccgca ggccgtgcgg gacgccgtcg tccgcatcct cgacgacccc tcggtcgcca 2580 ccgccgcgca ccggctgcgc gaggagacct tcggcgaccc caccccggcc gggatcgtcc 2640 ccgagctgga gcggctcgcc gcgcagcacc gccgcccgcc ggccgacgcc cggcactgag 2700 ccgcacccct cgccccaggc ctcacccctg tatctcatat gtctagttaa ctcgccacgc 2760 cgaccgttat caccggcgcc ctgctgctag tttccgagaa tgaagggaat agtcctggcc 2820 ggcgggagcg gaactcggct gcatccggcg acctcggtca tttcgaagca gattcttccg 2880 gtctacaaca aaccgatgat ctactatccg ctgtcggttc tcatgctcgg cggtattcgc 2940 gagattcaaa tcatctcgac cccccagcac atcgaactct tccagtcgct tctcggaaac 3000 ggcaggcacc tgggaataga actcgactat gcggtccaga aagagcccgc aggaatcgcg 3060 gacgcacttc tcgtcggagc cgagcacatc ggcgacgaca cctgcgccct gatcctgggc 3120 gacaacatct tccacgggcc cggcctctac acgctcctgc gggacagcat cgcgcgcctc 3180 gacggctgcg tgctcttcgg ctacccggtc aaggaccccg agcggtacgg cgtcgccgag 3240 gtggacgcga cgggccggct gaccgacctc gtcgagaagc ccgtcaagcc gcgctccaac 3300 ctcgccgtca ccggcctcta cctctacgac aacgacgtcg tcgacatcgc caagaacatc 3360 cggccctcgc cgcgcggcga gctggagatc accgacgtca accgcgtcta cctggagcgg 3420 ggccgggccg aactcgtcaa cctgggccgc ggcttcgcct ggctggacac cggcacccac 3480 gactcgctcc tgcgggccgc ccagtacgtc caggtcctgg aggagcggca gggcgtctgg 3540 atcgcgggcc ttgaggagat cgccttccgc atgggcttca tcgacgccga ggcctgtcac 3600 ggcctgggag aaggcctctc ccgcaccgag tacggcagct atctgatgga gatcgccggc 3660 cgcgagggag ccccgtgagg gcacctcgcg gccgacgcgt tcccacgacc gacagcgcca 3720 ccgacagtgc gacccacacc gcgacccgca ccgccaccga cagtgcgacc cacaccgcga 3780 cctacagcgc gaccgaaagg aagacggcag tgcggcttct ggtgaccgga ggtgcgggct 3840 tcatcggctc gcacttcgtg cggcagctcc tcgccggggc gtaccccgac gtgcccgccg 3900 atgaggtgat cgtcctggac agcctcacct acgcgggcaa ccgcgccaac ctcgccccgg 3960 tggacgcgga cccgcgactg cgcttcgtcc acggcgacat ccgcgacgcc ggcctcctcg 4020 cccgggaact gcgcggcgtg gacgccatcg tccacttcgc ggccgagagc cacgtggacc 4080 gctccatcgc gggcgcgtcc gtgttcaccg agaccaacgt gcagggcacg cagacgctgc 4140 tccagtgcgc cgtcgacgcc ggcgtcggcc gggtcgtgca cgtctccacc gacgaggtgt 4200 acgggtcgat cgactccggc tcctggaccg agagcagccc gctggagccc aactcgccct 4260 acgcggcgtc caaggccggc tccgacctcg ttgcccgcgc ctaccaccgg acgtacggcc 4320 tcgacgtacg gatcacccgc tgctgcaaca actacgggcc gtaccagcac cccgagaagc 4380 tcatccccct cttcgtgacg aacctcctcg acggcgggac gctcccgctg tacggcgacg 4440 gcgcgaacgt ccgcgagtgg gtgcacaccg acgaccactg ccggggcatc gcgctcgtcc 4500 tcgcgggcgg ccgggccggc gagatctacc acatcggcgg cggcctggag ctgaccaacc 4560 gcgaactcac cggcatcctc ctggactcgc tcggcgccga ctggtcctcg gtccggaagg 4620 tcgccgaccg caagggccac gacctgcgct actccctcga cggcggcgag atcgagcgcg 4680 agctcggcta ccgcccgcag gtctccttcg cggacggcct cgcgcggacc gtccgctggt 4740 accgggagaa ccgcggctgg tgggagccgc tcaaggcgac cgccccgcag ctgcccgcca 4800 ccgccgtgga ggtgtccgcg tgagcagccg cgccgagacc ccccgcgtcc ccttcctcga 4860 cctcaaggcc gcctacgagg agctctctag tatcgctccg agcccgaagg gaaaatcgag 4920 tgcccaattc ggcagaatcg ggatcgatgg agttactcga cgtcgacggg gcctggttat 4980 acaccccgga aatcatgcgg gacgaacggg gagaattcct cgaatggttc cggggtcgga 5040 cattccagga gaagatcggc caccccctct cgctggccca ggccaactgc tcggtgtccc 5100 gcaaggcgtt ctgcgcggca tccacttcgc cgacgccccc gcccggccag gccaagtacg 5160 tcacctgcgc ctccggcacc gtgctcgacg tggtcgtcga cgtacgccgg ggctcgccca 5220 ccttcggccg atgggccgcc gtccgactcg acgcggcccg ccaccagggg ctctacctgg 5280 ccgaaggact cggccacgcg ttcatggccc tcaccgacga cgccacggtc gtctacctct 5340 gctcacagcc ctacgtggcc gaggccgagc gggccgtaga ccctctcgac ccggcgatcg 5400 gcatcgaatg gccgacggac atcgacatcg tccctgtcgg cgaagggaca cccacgcacc 5460 gtccctggcg caggccgcgg agacccggca tcctgccgga ctacgaggga gtgcccggcg 5520 ccttacatcg cggaggcggc cggcgtggga ccggcccgtg aaggccctcg tactggccgg 5580 ctctagttac gtagtaccgc gacaaccgcg cctggtggga acccctgaag aagcggccgg 5640 ccggtcccgc cgcccccccg agaggcagcg gcccatgaga tggctgatca ccggcgccgc 5700 cggaatgctg ggccgggaac tcgtccggcg cctcgccgag aacgaggagg acgtcgcggc 5760 cctcggccac gaccacctcg acgtcacccg accctccgcc gtgcgggcgg cactcgccga 5820 gcaccgtccc gggatcgtcg tcaactgcgc cgcctacacg gccgtcgacg acgccgagac 5880 ggacgaggcc gccgctgccc tcctcaacgc cgaggcgccc cggctgctgg ccgagggcct 5940 gcgcccccac cggcggcacg gcctcgtcca cctgtccacc gactacgtct ttcccggcga 6000 cgcccgcacc ccctacgccg aggaccaccc cacggctccc cgcagcgcct acggacgcac 6060 caaacgggac ggcgagcaag cggtgctgac ggcactgccc accgccaccg tgctgcgcac 6120 cgcctggctg tacgggcgca ccggccgcag cttcgtccgc acgatgatcg aacgggaggc 6180 gcgcggcgga gccatcgacg tcgtcgccga ccagcgcggc cagcccacct ggaccggcga 6240 cctcgccgac cgcatcatcg ccgtcggccg gcaccccggc gtccacggca tcctgcacgc 6300 caccaacgcc ggctccgcca cctggtacga cctggcacaa gaggtcttcc ggctcctcga 6360 cgccgacccc gggcgggtcc ggcccaccac cggcgccgcc ttccgcagac ccgccccccg 6420 ccccgcctac agcgtcctcg gccacgaccg ctggcgcggg accggcctgg cacccctgcg 6480 tgactggcgc tcggccctgc gcgaggcgtt ccccgacatc ctcgccgcgg aacacccacc 6540 gacccggcga ggagcagcat gaaacgaggc gtgcacgacc tggccctctt ccctaggtct 6600 aga 6603 <210> 18 <211> 7635 <212> DNA <213> Artificial Sequence <220> <223> desVIII-desVII-desIII-desIV-desI-desII <400> 18 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tcctggagac ccgcggcatc cactggatcc 180 acgccgcgaa cggcgacccg tacgccaccg tgctgcgcgg ccaggcggac gacccgtatc 240 ccgcgtacga gcgggtgcgt gcccgcggcg cgctctcctt cagcccgacg ggcagctggg 300 tcaccgccga tcacgccctg gcggcgagca tcctctgctc gacggacttc ggggtctccg 360 gcgccgacgg cgtcccggtg ccgcagcagg tcctctcgta cggggagggc tgtccgctgg 420 agcgcgagca ggtgctgccg gcggccggtg acgtgccgga gggcgggcag cgtgccgtgg 480 tcgaggggat ccaccgggag acgctggagg gtctcgcgcc ggacccgtcg gcgtcgtacg 540 ccttcgagct gctgggcggt ttcgtccgcc cggcggtgac ggccgctgcc gccgccgtgc 600 tgggtgttcc cgcggaccgg cgcgcggact tcgcggatct gctggagcgg ctccggccgc 660 tgtccgacag cctgctggcc ccgcagtccc tgcggacggt acgggcggcg gacggcgcgc 720 tggccgagct cacggcgctg ctcgccgatt cggacgactc ccccggggcc ctgctgtcgg 780 cgctcggggt caccgcagcc gtccagctca ccgggaacgc ggtgctcgcg ctcctcgcgc 840 atcccgagca gtggcgggag ctgtgcgacc ggcccgggct cgcggcggcc gcggtggagg 900 agaccctccg ctacgacccg ccggtgcagc tcgacgcccg ggtggtccgc ggggagacgg 960 agctggcggg ccggcggctg ccggccgggg cgcatgtcgt cgtcctgacc gccgcgaccg 1020 gccgggaccc ggaggtcttc acggacccgg agcgcttcga cctcgcgcgc cccgacgccg 1080 ccgcgcacct cgcgctgcac cccgccggtc cgtacggccc ggtggcgtcc ctggtccggc 1140 ttcaggcgga ggtcgcgctg cggaccctgg ccgggcgttt ccccgggctg cggcaggcgg 1200 gggacgtgct ccgcccccgc cgcgcgcctg tcggccgcgg gccgctgagc gtcccggtca 1260 gcagctcctg agacaccggg gccccggtcc gcccggcccc ccttcggacg gaccggacgg 1320 ctcggaccac ggggacggct cagaccgtcc cgtgtgtccc cgtccggctc ccgtccgccc 1380 catcccgccc ctccaccggc aaggaaggac acgacgccat gcgcgtcctg ctgacctcgt 1440 tcgcacatca cacgcactac tacggcctgg tgcccctggc ctgggcgctg ctcgccgccg 1500 ggcacgaggt gcgggtcgcc agccagcccg cgctcacgga caccatcacc gggtccgggc 1560 tcgccgcggt gccggtcggc accgaccacc tcatccacga gtaccgggtg cggatggcgg 1620 gcgagccgcg cccgaaccat ccggcgatcg ccttcgacga ggcccgtccc gagccgctgg 1680 actgggacca cgccctcggc atcgaggcga tcctcgcccc gtacttccat ctgctcgcca 1740 acaacgactc gatggtcgac gacctcgtcg acttcgcccg gtcctggcag ccggacctgg 1800 tgctgtggga gccgacgacc tacgcgggcg ccgtcgccgc ccaggtcacc ggtgccgcgc 1860 acgcccgggt cctgtggggg cccgacgtga tgggcagcgc ccgccgcaag ttcgtcgcgc 1920 tgcgggaccg gcagccgccc gagcaccgcg aggaccccac cgcggagtgg ctgacgtgga 1980 cgctcgaccg gtacggcgcc tccttcgaag aggagctgct caccggccag ttcacgatcg 2040 acccgacccc gccgagcctg cgcctcgaca cgggcctgcc gaccgtcggg atgcgttatg 2100 ttccgtacaa cggcacgtcg gtcgtgccgg actggctgag tgagccgccc gcgcggcccc 2160 gggtctgcct gaccctcggc gtctccgcgc gtgaggtcct cggcggcgac ggcgtctcgc 2220 agggcgacat cctggaggcg ctcgccgacc tcgacatcga gctcgtcgcc acgctcgacg 2280 cgagtcagcg cgccgagatc cgcaactacc cgaagcacac ccggttcacg gacttcgtgc 2340 cgatgcacgc gctcctgccg agctgctcgg cgatcatcca ccacggcggg gcgggcacct 2400 acgcgaccgc cgtgatcaac gcggtgccgc aggtcatgct cgccgagctg tgggacgcgc 2460 cggtcaaggc gcgggccgtc gccgagcagg gggcggggtt cttcctgccg ccggccgagc 2520 tcacgccgca ggccgtgcgg gacgccgtcg tccgcatcct cgacgacccc tcggtcgcca 2580 ccgccgcgca ccggctgcgc gaggagacct tcggcgaccc caccccggcc gggatcgtcc 2640 ccgagctgga gcggctcgcc gcgcagcacc gccgcccgcc ggccgacgcc cggcactgag 2700 ccgcacccct cgccccaggc ctcacccctg tatctcatat gtctagttaa ctcgccacgc 2760 cgaccgttat caccggcgcc ctgctgctag tttccgagaa tgaagggaat agtcctggcc 2820 ggcgggagcg gaactcggct gcatccggcg acctcggtca tttcgaagca gattcttccg 2880 gtctacaaca aaccgatgat ctactatccg ctgtcggttc tcatgctcgg cggtattcgc 2940 gagattcaaa tcatctcgac cccccagcac atcgaactct tccagtcgct tctcggaaac 3000 ggcaggcacc tgggaataga actcgactat gcggtccaga aagagcccgc aggaatcgcg 3060 gacgcacttc tcgtcggagc cgagcacatc ggcgacgaca cctgcgccct gatcctgggc 3120 gacaacatct tccacgggcc cggcctctac acgctcctgc gggacagcat cgcgcgcctc 3180 gacggctgcg tgctcttcgg ctacccggtc aaggaccccg agcggtacgg cgtcgccgag 3240 gtggacgcga cgggccggct gaccgacctc gtcgagaagc ccgtcaagcc gcgctccaac 3300 ctcgccgtca ccggcctcta cctctacgac aacgacgtcg tcgacatcgc caagaacatc 3360 cggccctcgc cgcgcggcga gctggagatc accgacgtca accgcgtcta cctggagcgg 3420 ggccgggccg aactcgtcaa cctgggccgc ggcttcgcct ggctggacac cggcacccac 3480 gactcgctcc tgcgggccgc ccagtacgtc caggtcctgg aggagcggca gggcgtctgg 3540 atcgcgggcc ttgaggagat cgccttccgc atgggcttca tcgacgccga ggcctgtcac 3600 ggcctgggag aaggcctctc ccgcaccgag tacggcagct atctgatgga gatcgccggc 3660 cgcgagggag ccccgtgagg gcacctcgcg gccgacgcgt tcccacgacc gacagcgcca 3720 ccgacagtgc gacccacacc gcgacccgca ccgccaccga cagtgcgacc cacaccgcga 3780 cctacagcgc gaccgaaagg aagacggcag tgcggcttct ggtgaccgga ggtgcgggct 3840 tcatcggctc gcacttcgtg cggcagctcc tcgccggggc gtaccccgac gtgcccgccg 3900 atgaggtgat cgtcctggac agcctcacct acgcgggcaa ccgcgccaac ctcgccccgg 3960 tggacgcgga cccgcgactg cgcttcgtcc acggcgacat ccgcgacgcc ggcctcctcg 4020 cccgggaact gcgcggcgtg gacgccatcg tccacttcgc ggccgagagc cacgtggacc 4080 gctccatcgc gggcgcgtcc gtgttcaccg agaccaacgt gcagggcacg cagacgctgc 4140 tccagtgcgc cgtcgacgcc ggcgtcggcc gggtcgtgca cgtctccacc gacgaggtgt 4200 acgggtcgat cgactccggc tcctggaccg agagcagccc gctggagccc aactcgccct 4260 acgcggcgtc caaggccggc tccgacctcg ttgcccgcgc ctaccaccgg acgtacggcc 4320 tcgacgtacg gatcacccgc tgctgcaaca actacgggcc gtaccagcac cccgagaagc 4380 tcatccccct cttcgtgacg aacctcctcg acggcgggac gctcccgctg tacggcgacg 4440 gcgcgaacgt ccgcgagtgg gtgcacaccg acgaccactg ccggggcatc gcgctcgtcc 4500 tcgcgggcgg ccgggccggc gagatctacc acatcggcgg cggcctggag ctgaccaacc 4560 gcgaactcac cggcatcctc ctggactcgc tcggcgccga ctggtcctcg gtccggaagg 4620 tcgccgaccg caagggccac gacctgcgct actccctcga cggcggcgag atcgagcgcg 4680 agctcggcta ccgcccgcag gtctccttcg cggacggcct cgcgcggacc gtccgctggt 4740 accgggagaa ccgcggctgg tgggagccgc tcaaggcgac cgccccgcag ctgcccgcca 4800 ccgccgtgga ggtgtccgcg tgagcagccg cgccgagacc ccccgcgtcc ccttcctcga 4860 cctcaaggcc gcctacgagg agctctctag tgctagcgac ggtggcccgg agggaacatc 4920 cgtgaaaagc gccttatccg acctcgcatt cttcggcggc cccgccgctt tcgaccagcc 4980 gctcctcgtg gggcggccca accgcatcga ccgcgccagg ctgtacgagc ggctcgaccg 5040 ggccctcgac agccagtggc tgtccaacgg cggcccgctc gtccgcgagt tcgaggagcg 5100 cgtcgccggg ctcgccgggg tccggcatgc cgtggccacc tgcaacgcca cggccgggct 5160 ccagctcctc gcgcacgccg ccggcctcac cggcgaagtg atcatgccgt cgatgacgtt 5220 cgccgccacc ccgcacgcac tgcgctggat cggcctcacc ccggtcttcg ccgacatcga 5280 cccggacacc ggcaacctcg acccggacca ggtggccgcc gcggtcacac cccgcacctc 5340 ggccgtcgtc ggcgtccacc tctggggccg cccctgcgcc gccgaccagc tgcggaaggt 5400 cgccgacgag cacggcctgc ggctgtactt cgacgccgcg cacgccctcg gctgcgcggt 5460 cgacggccgg cccgccggca gcctcggcga cgccgaggtc ttcagcttcc acgccaccaa 5520 ggccgtcaac gccttcgagg gcggcgccgt cgtcaccgac gacgccgacc tcgccgcccg 5580 gatccgcgcc ctccacaact tcggcttcga cctgcccggc ggcagccccg ccggcgggac 5640 caacgccaag atgagcgagg ccgccgccgc catgggcctc acctccctcg acgcgtttcc 5700 cgaggtcatc gaccggaacc ggcgcaacca cgccgcctac cgcgagcacc tcgcggacct 5760 ccccggcgtc ctcgtcgccg accacgaccg ccacggcctc aacaaccacc agtacgtgat 5820 cgtcgagatc gacgaggcca ccaccggcat ccaccgcgac ctcgtcatgg aggtcctgaa 5880 ggccgaaggc gtgcacaccc gcgcctactt ctcgccgggc tgccacgagc tggagccgta 5940 ccgcgggcag ccgcacgccc cgctgccgca caccgaacgc ctcgccgcgc gcgtgctgtc 6000 cctgccgacc ggcaccgcca tcggcgacga cgacatccgc cgggtcgccg acctgctgcg 6060 tctctgcgcg acccgcggcc gcgaactgac cgcgcgccac cgcgacacgg cccccgcccc 6120 gctcgcggcc ccccagacat ccacgcccac gattggacgc tcccgatgac cgcccccgcc 6180 ctttccgcca ccgccccggc cgaacgctgc gcgcaccccg gagccgatct gggggcggcg 6240 gtccacgccg tcggccagac cctcgccgcc ggcggcctcg tgccgcccga cgaggccgga 6300 acgaccgccc gccacctcgt ccggctcgcc gtgcgctacg gcaacagccc cttcaccccg 6360 ctggaggagg cccgccacga cctgggcgtc gaccgggacg ccttccggcg cctcctcgcc 6420 ctgttcgggc aggtcccgga gctccgcacc gcggtcgaga ccggccccgc cggggcgtac 6480 tggaagaaca ccctgctccc gctcgaacag cgcggcgtct tcgacgcggc gctcgccagg 6540 aagcccgtct tcccgtacag cgtcggcctc taccccggcc cgacctgcat gttccgctgc 6600 cacttctgcg tccgtgtgac cggcgcccgc tacgacccgt ccgccctcga cgccggcaac 6660 gccatgttcc ggtcggtcat cgacgagata cccgcgggca acccctcggc gatgtacttc 6720 tccggcggcc tggagccgct caccaacccc ggcctcggga gcctggccgc gcacgccacc 6780 gaccacggcc tgcggcccac cgtctacacg aactccttcg cgctcaccga gcgcaccctg 6840 gagcgccagc ccggcctctg gggcctgcac gccatccgca cctcgctcta cggcctcaac 6900 gacgaggagt acgagcagac caccggcaag aaggccgcct tccgccgcgt ccgcgagaac 6960 ctgcgccgct tccagcagct gcgcgccgag cgcgagtcgc cgatcaacct cggcttcgcc 7020 tacatcgtgc tcccgggccg tgcctcccgc ctgctcgacc tggtcgactt catcgccgac 7080 ctcaacgacg ccgggcaggg caggacgatc gacttcgtca acattcgcga ggactacagc 7140 ggccgtgacg acggcaagct gccgcaggag gagcgggccg agctccagga ggccctcaac 7200 gccttcgagg agcgggtccg cgagcgcacc cccggactcc acatcgacta cggctacgcc 7260 ctgaacagcc tgcgcaccgg ggccgacgcc gaactgctgc ggatcaagcc cgccaccatg 7320 cggcccaccg cgcacccgca ggtcgcggtg caggtcgatc tcctcggcga cgtgtacctg 7380 taccgcgagg ccggcttccc cgacctggac ggcgcgaccc gctacatcgc gggccgcgtg 7440 acccccgaca cctccctcac cgaggtcgtc agggacttcg tcgagcgcgg cggcgaggtg 7500 gcggccgtcg acggcgacga gtacttcatg gacggcttcg atcaggtcgt caccgcccgc 7560 ctgaaccagc tggagcgcga cgccgcggac ggctgggagg aggcccgcgg cttcctgcgc 7620 tgacccgcat ctaga 7635 <210> 19 <211> 8375 <212> DNA <213> Artificial Sequence <220> <223> desVIII-desVII-desIII-desIV-oleV-eryBII-urdR <400> 19 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tttaattaag atatccccga ccagccttat 180 cgaaggagcg gcgaagagat ggcagaaccc acggtgaccg acgacctgac gggggccctc 240 acgcagcccc cgctgggccg caccgtccgc gcggtggccg accgtgaact cggcacccac 300 ctcctggaga cccgcggcat ccactggatc cacgccgcga acggcgaccc gtacgccacc 360 gtgctgcgcg gccaggcgga cgacccgtat cccgcgtacg agcgggtgcg tgcccgcggc 420 gcgctctcct tcagcccgac gggcagctgg gtcaccgccg atcacgccct ggcggcgagc 480 atcctctgct cgacggactt cggggtctcc ggcgccgacg gcgtcccggt gccgcagcag 540 gtcctctcgt acggggaggg ctgtccgctg gagcgcgagc aggtgctgcc ggcggccggt 600 gacgtgccgg agggcgggca gcgtgccgtg gtcgagggga tccaccggga gacgctggag 660 ggtctcgcgc cggacccgtc ggcgtcgtac gccttcgagc tgctgggcgg tttcgtccgc 720 ccggcggtga cggccgctgc cgccgccgtg ctgggtgttc ccgcggaccg gcgcgcggac 780 ttcgcggatc tgctggagcg gctccggccg ctgtccgaca gcctgctggc cccgcagtcc 840 ctgcggacgg tacgggcggc ggacggcgcg ctggccgagc tcacggcgct gctcgccgat 900 tcggacgact cccccggggc cctgctgtcg gcgctcgggg tcaccgcagc cgtccagctc 960 accgggaacg cggtgctcgc gctcctcgcg catcccgagc agtggcggga gctgtgcgac 1020 cggcccgggc tcgcggcggc cgcggtggag gagaccctcc gctacgaccc gccggtgcag 1080 ctcgacgccc gggtggtccg cggggagacg gagctggcgg gccggcggct gccggccggg 1140 gcgcatgtcg tcgtcctgac cgccgcgacc ggccgggacc cggaggtctt cacggacccg 1200 gagcgcttcg acctcgcgcg ccccgacgcc gccgcgcacc tcgcgctgca ccccgccggt 1260 ccgtacggcc cggtggcgtc cctggtccgg cttcaggcgg aggtcgcgct gcggaccctg 1320 gccgggcgtt tccccgggct gcggcaggcg ggggacgtgc tccgcccccg ccgcgcgcct 1380 gtcggccgcg ggccgctgag cgtcccggtc agcagctcct gagacaccgg ggccccggtc 1440 cgcccggccc cccttcggac ggaccggacg gctcggacca cggggacggc tcagaccgtc 1500 ccgtgtgtcc ccgtccggct cccgtccgcc ccatcccgcc cctccaccgg caaggaagga 1560 cacgacgcca tgcgcgtcct gctgacctcg ttcgcacatc acacgcacta ctacggcctg 1620 gtgcccctgg cctgggcgct gctcgccgcc gggcacgagg tgcgggtcgc cagccagccc 1680 gcgctcacgg acaccatcac cgggtccggg ctcgccgcgg tgccggtcgg caccgaccac 1740 ctcatccacg agtaccgggt gcggatggcg ggcgagccgc gcccgaacca tccggcgatc 1800 gccttcgacg aggcccgtcc cgagccgctg gactgggacc acgccctcgg catcgaggcg 1860 atcctcgccc cgtacttcca tctgctcgcc aacaacgact cgatggtcga cgacctcgtc 1920 gacttcgccc ggtcctggca gccggacctg gtgctgtggg agccgacgac ctacgcgggc 1980 gccgtcgccg cccaggtcac cggtgccgcg cacgcccggg tcctgtgggg gcccgacgtg 2040 atgggcagcg cccgccgcaa gttcgtcgcg ctgcgggacc ggcagccgcc cgagcaccgc 2100 gaggacccca ccgcggagtg gctgacgtgg acgctcgacc ggtacggcgc ctccttcgaa 2160 gaggagctgc tcaccggcca gttcacgatc gacccgaccc cgccgagcct gcgcctcgac 2220 acgggcctgc cgaccgtcgg gatgcgttat gttccgtaca acggcacgtc ggtcgtgccg 2280 gactggctga gtgagccgcc cgcgcggccc cgggtctgcc tgaccctcgg cgtctccgcg 2340 cgtgaggtcc tcggcggcga cggcgtctcg cagggcgaca tcctggaggc gctcgccgac 2400 ctcgacatcg agctcgtcgc cacgctcgac gcgagtcagc gcgccgagat ccgcaactac 2460 ccgaagcaca cccggttcac ggacttcgtg ccgatgcacg cgctcctgcc gagctgctcg 2520 gcgatcatcc accacggcgg ggcgggcacc tacgcgaccg ccgtgatcaa cgcggtgccg 2580 caggtcatgc tcgccgagct gtgggacgcg ccggtcaagg cgcgggccgt cgccgagcag 2640 ggggcggggt tcttcctgcc gccggccgag ctcacgccgc aggccgtgcg ggacgccgtc 2700 gtccgcatcc tcgacgaccc ctcggtcgcc accgccgcgc accggctgcg cgaggagacc 2760 ttcggcgacc ccaccccggc cgggatcgtc cccgagctgg agcggctcgc cgcgcagcac 2820 cgccgcccgc cggccgacgc ccggcactga gccgcacccc tcgccccagg cctcacccct 2880 gtatctcata tgtctagtta actcgccacg ccgaccgtta tcaccggcgc cctgctgcta 2940 gtttccgaga atgaagggaa tagtcctggc cggcgggagc ggaactcggc tgcatccggc 3000 gacctcggtc atttcgaagc agattcttcc ggtctacaac aaaccgatga tctactatcc 3060 gctgtcggtt ctcatgctcg gcggtattcg cgagattcaa atcatctcga ccccccagca 3120 catcgaactc ttccagtcgc ttctcggaaa cggcaggcac ctgggaatag aactcgacta 3180 tgcggtccag aaagagcccg caggaatcgc ggacgcactt ctcgtcggag ccgagcacat 3240 cggcgacgac acctgcgccc tgatcctggg cgacaacatc ttccacgggc ccggcctcta 3300 cacgctcctg cgggacagca tcgcgcgcct cgacggctgc gtgctcttcg gctacccggt 3360 caaggacccc gagcggtacg gcgtcgccga ggtggacgcg acgggccggc tgaccgacct 3420 cgtcgagaag cccgtcaagc cgcgctccaa cctcgccgtc accggcctct acctctacga 3480 caacgacgtc gtcgacatcg ccaagaacat ccggccctcg ccgcgcggcg agctggagat 3540 caccgacgtc aaccgcgtct acctggagcg gggccgggcc gaactcgtca acctgggccg 3600 cggcttcgcc tggctggaca ccggcaccca cgactcgctc ctgcgggccg cccagtacgt 3660 ccaggtcctg gaggagcggc agggcgtctg gatcgcgggc cttgaggaga tcgccttccg 3720 catgggcttc atcgacgccg aggcctgtca cggcctggga gaaggcctct cccgcaccga 3780 gtacggcagc tatctgatgg agatcgccgg ccgcgaggga gccccgtgag ggcacctcgc 3840 ggccgacgcg ttcccacgac cgacagcgcc accgacagtg cgacccacac cgcgacccgc 3900 accgccaccg acagtgcgac ccacaccgcg acctacagcg cgaccgaaag gaagacggca 3960 gtgcggcttc tggtgaccgg aggtgcgggc ttcatcggct cgcacttcgt gcggcagctc 4020 ctcgccgggg cgtaccccga cgtgcccgcc gatgaggtga tcgtcctgga cagcctcacc 4080 tacgcgggca accgcgccaa cctcgccccg gtggacgcgg acccgcgact gcgcttcgtc 4140 cacggcgaca tccgcgacgc cggcctcctc gcccgggaac tgcgcggcgt ggacgccatc 4200 gtccacttcg cggccgagag ccacgtggac cgctccatcg cgggcgcgtc cgtgttcacc 4260 gagaccaacg tgcagggcac gcagacgctg ctccagtgcg ccgtcgacgc cggcgtcggc 4320 cgggtcgtgc acgtctccac cgacgaggtg tacgggtcga tcgactccgg ctcctggacc 4380 gagagcagcc cgctggagcc caactcgccc tacgcggcgt ccaaggccgg ctccgacctc 4440 gttgcccgcg cctaccaccg gacgtacggc ctcgacgtac ggatcacccg ctgctgcaac 4500 aactacgggc cgtaccagca ccccgagaag ctcatccccc tcttcgtgac gaacctcctc 4560 gacggcggga cgctcccgct gtacggcgac ggcgcgaacg tccgcgagtg ggtgcacacc 4620 gacgaccact gccggggcat cgcgctcgtc ctcgcgggcg gccgggccgg cgagatctac 4680 cacatcggcg gcggcctgga gctgaccaac cgcgaactca ccggcatcct cctggactcg 4740 ctcggcgccg actggtcctc ggtccggaag gtcgccgacc gcaagggcca cgacctgcgc 4800 tactccctcg acggcggcga gatcgagcgc gagctcggct accgcccgca ggtctccttc 4860 gcggacggcc tcgcgcggac cgtccgctgg taccgggaga accgcggctg gtgggagccg 4920 ctcaaggcga ccgccccgca gctgcccgcc accgccgtgg aggtgtccgc gtgagcagcc 4980 gcgccgagac cccccgcgtc cccttcctcg acctcaaggc cgcctacgag gagctctcta 5040 gtgggaatcg cggaagcggc cgggttcggc gccgtcctgg atcacaatga tatggggaat 5100 tcccgcgatg agcgaagcaa tgggatcggt accgacggcc ggcagtgaag tctcctcgac 5160 ctgcgcgttt ctgtcctggt tggacgcgcg ccgccgggcc aatcgcctga cggtggaaca 5220 cgtaccgttc agggagttat cggggtggca attcgacgag aacacgggga acctccgaca 5280 taccagcggt cgtttcttct ccatcgaagg actccgggta cgcacggacc actgctggtt 5340 cggaagctgg acccagccca ttatcgtgca accggagata ggcattctcg gcctcctggt 5400 caagaggttc gacggcatcc tgcacgtcct ggtgcaggca aagaacgaac cgggtaatat 5460 cggcggcctt cagctctccc ccaccgtcca ggccactcgc agcaattaca cccgcgtcca 5520 ccgcggcggc ggtgtcagat acctggagta cttcgcgtcc ccccgcgggc gcggtcgggt 5580 cctcgcggac gtcctccaat ccgagcaggg ctcctggttc ctgcacaagc ggaaccggaa 5640 catggtggtc gaggccctgg acgacgtgcc cctcgacgac gacttccact ggatcagcct 5700 cggcgggctg cggaagctgc tgctgaggcc gcatctggtg aacatggaca cccgcacggt 5760 gctgtcctgc cttcccccgg atccggcacc ggacggccgg cagccgccgg cgcccgcggc 5820 tcccttcgcc gccgcggtca cgcggtccct cacccggggt gccaccgcct tgcacaccat 5880 gggcgagatc ctcggctggc tgaccgacga gcggtcccgg cgggaactgg tgcagcagcg 5940 ggtgccgctg gaggagaccg cgttcagcgg ctggcggcgt gacgaccacg ccatcgcgca 6000 caaggacggc gactacttcc gggtcatcgg ggtgagcgtc cgggccagca gccgggaggt 6060 gtcctcgtgg agccagccgt tgctggcccc cgtcggcccc ggtctggccg ccttcgtcac 6120 caggcggatc cgcggcgtcc tccacgtcct gctgcacgcc cgcaccgaag ccggcctgct 6180 caacggcccg gagatggcac cgaccgtgca gtgccgcccg ctcaactacc gtgcggtgcc 6240 cgccgagtac cggcccgcct acctcgacta cgtgctgtcg gccgatcccg gacgcatccg 6300 ctacgacacc ctccagtcgg aggagggcgg ccgcttccac cacgcggaga accgctacgt 6360 cgtggtggag gccgaggacg acttcccggt cgaggtgccc cgcgacttcc gctggctcac 6420 cctgcaccag atcctcgccc tgctgcacca cagcaactat gtcaacgtgg aggcgcgcag 6480 cctcgtcgcc tgcatccagc ctgagctgat ctagtggtcg tcggcatctg cgaggaactg 6540 gccgcaggaa ggagagaacc acgatgacca ccgacgccgc gacgcacgtg cggctcgggc 6600 gttccgcgct gctcaccagc aggctctggc tcggcacggt gaacttcagc ggacgcgtcg 6660 aggacgacga cgcgctgcgc ctgatggacc acgcccggga ccgcggcatc aactgcctcg 6720 acaccgccga catgtacggc tggcggctct acaagggcca caccgaggag ctggtgggca 6780 ggtggctggc ccagggcggc ggacggcgcg aggacaccgt gctggcgacc aaggtcggcg 6840 gcgagatgag cgagcgcgtc aacgacagcg ggctgtcggc gcggcacatc atcgcctcct 6900 gcgagggatc gctgcgcagg ctgggcgtcg accacatcga cgtctaccag atgcaccaca 6960 tcgaccggtc cgcgccgtgg gacgaggtgt ggcaggccat ggacagcctc gtcgccagcg 7020 gcaaggtctc ctacgtcggc tcgtcgaact tcgcgggctg gcacatcgcc gccgcgcagg 7080 agaacgccgc ccgccgccac tccctgggca tggtctccca ccagtgcctg tacaacctgg 7140 cggtccggca cgccgagctg gaggtgctgc ccgccgcgca ggcctacggg ctcggcgtct 7200 tcgcctggtc gccgctgcac ggcggcctgc tcagcggagc gctggagaag ctggccgcgg 7260 gcaccgcggt gaagtcggcg cagggccgtg cgcaggtgct gttgccgtcc ctgcgcccgg 7320 cgatcgaggc ctacgagaag ttctgccgca acctcggcga agacccggcc gaggtggggc 7380 tcgcatgggt gctgtcccgg cccggcatcg ccggcgccgt catcggcccg cgaacccccg 7440 agcagctcga ctccgcgctg aaggcgtccg cgatgaccct ggacgagcag gcgctgtccg 7500 aactggacga gatcttcccc gcggtggcct ccggcggcgc ggcgccggaa gcctggttgc 7560 agtgagcaca agaggaaccg agtacgtatc tagtgatatc acagagatca ggacgacgca 7620 tggacattgt gggaaatgga ttcctggcgc ggaacctgcg gccgctggcc gaacggcatc 7680 ccgataccgt ggccctcgcc gccggtgtct catgggcgag cggtacctcc gatgccgact 7740 tcgcccggga agccgcactc ctgcgagaca ccgccaagca gtgcgcggcc accggacgac 7800 gactgctgtt cttctcgacc gctgccacgg gcatgtacgg cctggcggag ggacccggcc 7860 gagaggacac gccagtgacg ccgtgcaccc cgtacggcgc gcacaagctg gcgctggagg 7920 aactgctgcg ggactccggt gccgaccatg tgattctcag gctcgggcac ctcgtggggc 7980 ccgaccagcc cgagcaccaa ctgctgccca cgctggtgcg tcacctacgc gaaggcgcgg 8040 tgcgcattca ccgaggcgcg gcccgtgacc tcatcgacgt cagcgacgtc gtcaccattg 8100 tcgactgcct tctcggcctt gacctcaagg ccgagacggt caacgtggcc tccggctacg 8160 ccgttccggt gaaggacatc gtcgaactcc tgcgccgcag gctcggggtc gaggcgcggt 8220 acgagttcca ggatgccggt ggtcagcacg tcatctccat cgagaagctg cgcgcactcg 8280 ttccgcaggt ccaggacatg ggcttcgggc ccgactacta ccggcggatc ctcagtgact 8340 tcacctccgc cgtccgtatc tgacctaggt ctaga 8375 <210> 20 <211> 9085 <212> DNA <213> Artificial Sequence <220> <223> desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU <400> 20 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tcctggagac ccgcggcatc cactggatcc 180 acgccgcgaa cggcgacccg tacgccaccg tgctgcgcgg ccaggcggac gacccgtatc 240 ccgcgtacga gcgggtgcgt gcccgcggcg cgctctcctt cagcccgacg ggcagctggg 300 tcaccgccga tcacgccctg gcggcgagca tcctctgctc gacggacttc ggggtctccg 360 gcgccgacgg cgtcccggtg ccgcagcagg tcctctcgta cggggagggc tgtccgctgg 420 agcgcgagca ggtgctgccg gcggccggtg acgtgccgga gggcgggcag cgtgccgtgg 480 tcgaggggat ccaccgggag acgctggagg gtctcgcgcc ggacccgtcg gcgtcgtacg 540 ccttcgagct gctgggcggt ttcgtccgcc cggcggtgac ggccgctgcc gccgccgtgc 600 tgggtgttcc cgcggaccgg cgcgcggact tcgcggatct gctggagcgg ctccggccgc 660 tgtccgacag cctgctggcc ccgcagtccc tgcggacggt acgggcggcg gacggcgcgc 720 tggccgagct cacggcgctg ctcgccgatt cggacgactc ccccggggcc ctgctgtcgg 780 cgctcggggt caccgcagcc gtccagctca ccgggaacgc ggtgctcgcg ctcctcgcgc 840 atcccgagca gtggcgggag ctgtgcgacc ggcccgggct cgcggcggcc gcggtggagg 900 agaccctccg ctacgacccg ccggtgcagc tcgacgcccg ggtggtccgc ggggagacgg 960 agctggcggg ccggcggctg ccggccgggg cgcatgtcgt cgtcctgacc gccgcgaccg 1020 gccgggaccc ggaggtcttc acggacccgg agcgcttcga cctcgcgcgc cccgacgccg 1080 ccgcgcacct cgcgctgcac cccgccggtc cgtacggccc ggtggcgtcc ctggtccggc 1140 ttcaggcgga ggtcgcgctg cggaccctgg ccgggcgttt ccccgggctg cggcaggcgg 1200 gggacgtgct ccgcccccgc cgcgcgcctg tcggccgcgg gccgctgagc gtcccggtca 1260 gcagctcctg agacaccggg gccccggtcc gcccggcccc ccttcggacg gaccggacgg 1320 ctcggaccac ggggacggct cagaccgtcc cgtgtgtccc cgtccggctc ccgtccgccc 1380 catcccgccc ctccaccggc aaggaaggac acgacgccat gcgcgtcctg ctgacctcgt 1440 tcgcacatca cacgcactac tacggcctgg tgcccctggc ctgggcgctg ctcgccgccg 1500 ggcacgaggt gcgggtcgcc agccagcccg cgctcacgga caccatcacc gggtccgggc 1560 tcgccgcggt gccggtcggc accgaccacc tcatccacga gtaccgggtg cggatggcgg 1620 gcgagccgcg cccgaaccat ccggcgatcg ccttcgacga ggcccgtccc gagccgctgg 1680 actgggacca cgccctcggc atcgaggcga tcctcgcccc gtacttccat ctgctcgcca 1740 acaacgactc gatggtcgac gacctcgtcg acttcgcccg gtcctggcag ccggacctgg 1800 tgctgtggga gccgacgacc tacgcgggcg ccgtcgccgc ccaggtcacc ggtgccgcgc 1860 acgcccgggt cctgtggggg cccgacgtga tgggcagcgc ccgccgcaag ttcgtcgcgc 1920 tgcgggaccg gcagccgccc gagcaccgcg aggaccccac cgcggagtgg ctgacgtgga 1980 cgctcgaccg gtacggcgcc tccttcgaag aggagctgct caccggccag ttcacgatcg 2040 acccgacccc gccgagcctg cgcctcgaca cgggcctgcc gaccgtcggg atgcgttatg 2100 ttccgtacaa cggcacgtcg gtcgtgccgg actggctgag tgagccgccc gcgcggcccc 2160 gggtctgcct gaccctcggc gtctccgcgc gtgaggtcct cggcggcgac ggcgtctcgc 2220 agggcgacat cctggaggcg ctcgccgacc tcgacatcga gctcgtcgcc acgctcgacg 2280 cgagtcagcg cgccgagatc cgcaactacc cgaagcacac ccggttcacg gacttcgtgc 2340 cgatgcacgc gctcctgccg agctgctcgg cgatcatcca ccacggcggg gcgggcacct 2400 acgcgaccgc cgtgatcaac gcggtgccgc aggtcatgct cgccgagctg tgggacgcgc 2460 cggtcaaggc gcgggccgtc gccgagcagg gggcggggtt cttcctgccg ccggccgagc 2520 tcacgccgca ggccgtgcgg gacgccgtcg tccgcatcct cgacgacccc tcggtcgcca 2580 ccgccgcgca ccggctgcgc gaggagacct tcggcgaccc caccccggcc gggatcgtcc 2640 ccgagctgga gcggctcgcc gcgcagcacc gccgcccgcc ggccgacgcc cggcactgag 2700 ccgcacccct cgccccaggc ctcacccctg tatctcatat gtctagttaa ctcgccacgc 2760 cgaccgttat caccggcgcc ctgctgctag tttccgagaa tgaagggaat agtcctggcc 2820 ggcgggagcg gaactcggct gcatccggcg acctcggtca tttcgaagca gattcttccg 2880 gtctacaaca aaccgatgat ctactatccg ctgtcggttc tcatgctcgg cggtattcgc 2940 gagattcaaa tcatctcgac cccccagcac atcgaactct tccagtcgct tctcggaaac 3000 ggcaggcacc tgggaataga actcgactat gcggtccaga aagagcccgc aggaatcgcg 3060 gacgcacttc tcgtcggagc cgagcacatc ggcgacgaca cctgcgccct gatcctgggc 3120 gacaacatct tccacgggcc cggcctctac acgctcctgc gggacagcat cgcgcgcctc 3180 gacggctgcg tgctcttcgg ctacccggtc aaggaccccg agcggtacgg cgtcgccgag 3240 gtggacgcga cgggccggct gaccgacctc gtcgagaagc ccgtcaagcc gcgctccaac 3300 ctcgccgtca ccggcctcta cctctacgac aacgacgtcg tcgacatcgc caagaacatc 3360 cggccctcgc cgcgcggcga gctggagatc accgacgtca accgcgtcta cctggagcgg 3420 ggccgggccg aactcgtcaa cctgggccgc ggcttcgcct ggctggacac cggcacccac 3480 gactcgctcc tgcgggccgc ccagtacgtc caggtcctgg aggagcggca gggcgtctgg 3540 atcgcgggcc ttgaggagat cgccttccgc atgggcttca tcgacgccga ggcctgtcac 3600 ggcctgggag aaggcctctc ccgcaccgag tacggcagct atctgatgga gatcgccggc 3660 cgcgagggag ccccgtgagg gcacctcgcg gccgacgcgt tcccacgacc gacagcgcca 3720 ccgacagtgc gacccacacc gcgacccgca ccgccaccga cagtgcgacc cacaccgcga 3780 cctacagcgc gaccgaaagg aagacggcag tgcggcttct ggtgaccgga ggtgcgggct 3840 tcatcggctc gcacttcgtg cggcagctcc tcgccggggc gtaccccgac gtgcccgccg 3900 atgaggtgat cgtcctggac agcctcacct acgcgggcaa ccgcgccaac ctcgccccgg 3960 tggacgcgga cccgcgactg cgcttcgtcc acggcgacat ccgcgacgcc ggcctcctcg 4020 cccgggaact gcgcggcgtg gacgccatcg tccacttcgc ggccgagagc cacgtggacc 4080 gctccatcgc gggcgcgtcc gtgttcaccg agaccaacgt gcagggcacg cagacgctgc 4140 tccagtgcgc cgtcgacgcc ggcgtcggcc gggtcgtgca cgtctccacc gacgaggtgt 4200 acgggtcgat cgactccggc tcctggaccg agagcagccc gctggagccc aactcgccct 4260 acgcggcgtc caaggccggc tccgacctcg ttgcccgcgc ctaccaccgg acgtacggcc 4320 tcgacgtacg gatcacccgc tgctgcaaca actacgggcc gtaccagcac cccgagaagc 4380 tcatccccct cttcgtgacg aacctcctcg acggcgggac gctcccgctg tacggcgacg 4440 gcgcgaacgt ccgcgagtgg gtgcacaccg acgaccactg ccggggcatc gcgctcgtcc 4500 tcgcgggcgg ccgggccggc gagatctacc acatcggcgg cggcctggag ctgaccaacc 4560 gcgaactcac cggcatcctc ctggactcgc tcggcgccga ctggtcctcg gtccggaagg 4620 tcgccgaccg caagggccac gacctgcgct actccctcga cggcggcgag atcgagcgcg 4680 agctcggcta ccgcccgcag gtctccttcg cggacggcct cgcgcggacc gtccgctggt 4740 accgggagaa ccgcggctgg tgggagccgc tcaaggcgac cgccccgcag ctgcccgcca 4800 ccgccgtgga ggtgtccgcg tgagcagccg cgccgagacc ccccgcgtcc ccttcctcga 4860 cctcaaggcc gcctacgagg agctctctag tgggaatcgc ggaagcggcc gggttcggcg 4920 ccgtcctgga tcacaatgat atggggaatt cccgcgatga gcgaagcaat gggatcggta 4980 ccgacggccg gcagtgaagt ctcctcgacc tgcgcgtttc tgtcctggtt ggacgcgcgc 5040 cgccgggcca atcgcctgac ggtggaacac gtaccgttca gggagttatc ggggtggcaa 5100 ttcgacgaga acacggggaa cctccgacat accagcggtc gtttcttctc catcgaagga 5160 ctccgggtac gcacggacca ctgctggttc ggaagctgga cccagcccat tatcgtgcaa 5220 ccggagatag gcattctcgg cctcctggtc aagaggttcg acggcatcct gcacgtcctg 5280 gtgcaggcaa agaacgaacc gggtaatatc ggcggccttc agctctcccc caccgtccag 5340 gccactcgca gcaattacac ccgcgtccac cgcggcggcg gtgtcagata cctggagtac 5400 ttcgcgtccc cccgcgggcg cggtcgggtc ctcgcggacg tcctccaatc cgagcagggc 5460 tcctggttcc tgcacaagcg gaaccggaac atggtggtcg aggccctgga cgacgtgccc 5520 ctcgacgacg acttccactg gatcagcctc ggcgggctgc ggaagctgct gctgaggccg 5580 catctggtga acatggacac ccgcacggtg ctgtcctgcc ttcccccgga tccggcaccg 5640 gacggccggc agccgccggc gcccgcggct cccttcgccg ccgcggtcac gcggtccctc 5700 acccggggtg ccaccgcctt gcacaccatg ggcgagatcc tcggctggct gaccgacgag 5760 cggtcccggc gggaactggt gcagcagcgg gtgccgctgg aggagaccgc gttcagcggc 5820 tggcggcgtg acgaccacgc catcgcgcac aaggacggcg actacttccg ggtcatcggg 5880 gtgagcgtcc gggccagcag ccgggaggtg tcctcgtgga gccagccgtt gctggccccc 5940 gtcggccccg gtctggccgc cttcgtcacc aggcggatcc gcggcgtcct ccacgtcctg 6000 ctgcacgccc gcaccgaagc cggcctgctc aacggcccgg agatggcacc gaccgtgcag 6060 tgccgcccgc tcaactaccg tgcggtgccc gccgagtacc ggcccgccta cctcgactac 6120 gtgctgtcgg ccgatcccgg acgcatccgc tacgacaccc tccagtcgga ggagggcggc 6180 cgcttccacc acgcggagaa ccgctacgtc gtggtggagg ccgaggacga cttcccggtc 6240 gaggtgcccc gcgacttccg ctggctcacc ctgcaccaga tcctcgccct gctgcaccac 6300 agcaactatg tcaacgtgga ggcgcgcagc ctcgtcgcct gcatccagcc tgagctgatc 6360 tagtgctagc aagggaaccc catgccctcc ccccgtctgc gcttcggtgt gctgggtgcc 6420 gccgacatcg ccctgcgccg caccgtgccc gcgctgctcg cccacccgga cgtcaccgtg 6480 gtcgcggtct ccagccggga cacggcccgc gccgcccgtt tcgccgcggc gttcgggtgc 6540 gaggcggtcc cgggccacca ggcgctgctg gaccgcgacg acatcgacgc gctgtacgtc 6600 ccgctgccgg tgatggtgca cacgccctgg gtggaggcgg cgctgctgcg gggcaggcac 6660 gtcctggtgg agaagccgct gaccgcgacc cgctccggag ccgaggacct gatcgccctg 6720 gcacgctccc gcggcctggt cctgatggag aacttcacgt cgctgcacca cgcacagcac 6780 ggcaccgtca cggacctcct gcgggacggg acgatcggcg aactgcgctc gctgtccgcg 6840 gcgttcacga tcccgccgaa gccggagggc gacatccggt accagcccga cgtgggcgga 6900 ggcgccctgc tcgacatcgg gatctacccc ctgcgggcgg cactgcactt cctgggcccc 6960 gacctgcacg cggccggcgc ggtcctgcgt cgggagcggc gccggaacgt ggtggtctcc 7020 ggccacgtgc tgctcaccac accgcacggc gtcgtggccg agctggcctt cggcatggag 7080 cacgcctacc gctcggagta caccctcttc ggcacggccg gccgcctgcg cctggaccgt 7140 gccttcaccc cgcccgagac ccaccggcca cgtgtggaga tccaccggca ggacgccctg 7200 gacatcgtcg acctgccgcc ggacgcgcaa ttcgccaacc tcgtccggga cttcgtactg 7260 gctgtccgcg agggtcccgg ccggctcaca cagcaccacg ccgacgccgt acgccaagcc 7320 gatctcgtcg agcgcgtcat ggcggtggcg cgggtgcgct ggtgctgtct agtatcgctc 7380 cgagcccgaa gggaaaatcg agtgcccaat tcggcagaat cgggatcgat ggagttactc 7440 gacgtcgacg gggcctggtt atacaccccg gaaatcatgc gggacgaacg gggagaattc 7500 ctcgaatggt tccggggtcg gacattccag gagaagatcg gccaccccct ctcgctggcc 7560 caggccaact gctcggtgtc ccgcaaggcg ttctgcgcgg catccacttc gccgacgccc 7620 ccgcccggcc aggccaagta cgtcacctgc gcctccggca ccgtgctcga cgtggtcgtc 7680 gacgtacgcc ggggctcgcc caccttcggc cgatgggccg ccgtccgact cgacgcggcc 7740 cgccaccagg ggctctacct ggccgaagga ctcggccacg cgttcatggc cctcaccgac 7800 gacgccacgg tcgtctacct ctgctcacag ccctacgtgg ccgaggccga gcgggccgta 7860 gaccctctcg acccggcgat cggcatcgaa tggccgacgg acatcgacat cgtccctgtc 7920 ggcgaaggga cacccacgca ccgtccctgg cgcaggccgc ggagacccgg catcctgccg 7980 gactacgagg gagtgcccgg cgccttacat cgcggaggcg gccggcgtgg gaccggcccg 8040 tgaaggccct cgtactggcc ggctctagtt acgtagtacc gcgacaaccg cgcctggtgg 8100 gaacccctga agaagcggcc ggccggtccc gccgcccccc cgagaggcag cggcccatga 8160 gatggctgat caccggcgcc gccggaatgc tgggccggga actcgtccgg cgcctcgccg 8220 agaacgagga ggacgtcgcg gccctcggcc acgaccacct cgacgtcacc cgaccctccg 8280 ccgtgcgggc ggcactcgcc gagcaccgtc ccgggatcgt cgtcaactgc gccgcctaca 8340 cggccgtcga cgacgccgag acggacgagg ccgccgctgc cctcctcaac gccgaggcgc 8400 cccggctgct ggccgagggc ctgcgccccc accggcggca cggcctcgtc cacctgtcca 8460 ccgactacgt ctttcccggc gacgcccgca ccccctacgc cgaggaccac cccacggctc 8520 cccgcagcgc ctacggacgc accaaacggg acggcgagca agcggtgctg acggcactgc 8580 ccaccgccac cgtgctgcgc accgcctggc tgtacgggcg caccggccgc agcttcgtcc 8640 gcacgatgat cgaacgggag gcgcgcggcg gagccatcga cgtcgtcgcc gaccagcgcg 8700 gccagcccac ctggaccggc gacctcgccg accgcatcat cgccgtcggc cggcaccccg 8760 gcgtccacgg catcctgcac gccaccaacg ccggctccgc cacctggtac gacctggcac 8820 aagaggtctt ccggctcctc gacgccgacc ccgggcgggt ccggcccacc accggcgccg 8880 ccttccgcag acccgccccc cgccccgcct acagcgtcct cggccacgac cgctggcgcg 8940 ggaccggcct ggcacccctg cgtgactggc gctcggccct gcgcgaggcg ttccccgaca 9000 tcctcgccgc ggaacaccca ccgacccggc gaggagcagc atgaaacgag gcgtgcacga 9060 cctggccctc ttccctaggt ctaga 9085 <210> 21 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 ggcaagctta gcggggcgac tggcgtgccc act 33 <210> 22 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 ggtctgcagt caccgtgggt tctgccatct ctt 33 <210> 23 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 gctggtaccg gatgttccct ccgggccacc gtc 33 <210> 24 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 tgagaattcc ctcgccgtcc tgcccgcgct tgg 33 <210> 25 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 ttaattaaga tatcaccggc aaggaaggac acgacgcc 38 <210> 26 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 tctagacata tggcgcagat acaggggtga ggcctg 36 <210> 27 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 ttaattaaac tagtatcgat gacggtggcc cggaggg 37 <210> 28 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 tctagatgcg ggtcagcgca ggaagccgcg 30 <210> 29 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 ttaattaaac tagttaactc gccacgccga ccgtt 35 <210> 30 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 tctagagagc tcctcgtagg cggcctt 27 <210> 31 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 ttaattaaac tagtcaggtc tccttcgcgg acggcctc 38 <210> 32 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 tctagaacct gactaggcct ggtcgacccg 30 <210> 33 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 ttaattaaac tagtccccag gcctcacccc tgtatctg 38 <210> 34 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 tctagagaat tcgctcaggc ggggacgccg acgaag 36 <210> 35 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 ttaattaaac tagtatcgat atcgctccga gcccgaaggg a 41 <210> 36 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 tctagagccg gccagtacga gggcctt 27 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 ttaattaaac tagtgtaccg cgacaaccgc 30 <210> 38 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 tctagagaag agggccaggt cgtgcacgc 29 <210> 39 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 ttaattaaac tagtatcgat gggaatcgcg gaagcg 36 <210> 40 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 tctagaatca gctcagggcc tggatgc 27 <210> 41 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 ttaattaaac tagtggtcgt cggcatctgc g 31 <210> 42 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 tctagactcg gttcctcttg tgctcactgc 30 <210> 43 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 ttaattaaac tagtacagag atccaggacg acgca 35 <210> 44 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 tctagatcag atacggacgg cggaggt 27 <210> 45 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 ttaattaaac tagtaaggga accccatgcc ctccc 35 <210> 46 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 tctagaatca gcaccagcgc acccgcgcca 30

Claims (16)

Microorganisms of the genus Streptomyces, desVIII, desVII, desIII, and desVIII, desVII, desIII, desIV, desI, desII, desV, desVI, oleL, oleU, oleV, eryBII, urdR and oleW in a combination of proteins selected from the group consisting of A recombinant microorganism producing a narcamycin derivative, wherein a nucleic acid encoding a combination of proteins comprising a desIV protein is introduced. The combination of claim 1, wherein the combination of proteins is desVIII-desVII-desIII-desIV, desVIII-desVII-desIII-desIV-oleL-oleU, desVIII-desVII-desIII-desIV-desI-desII, desVIII-desVII-desIII-desIV A recombinant microorganism, which is a combination of a protein of -oleV-eryBII-urdR or desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU. The recombinant microorganism of claim 1, wherein the Streptomyces genus microorganism is Streptomyces venezuelan. The microorganism of claim 1, wherein the microorganism of the genus Streptomyces is a gene encoding a protein that biosynthesizes and transfers D-desamine, which is a sugar portion of narcamycin, in a microorganism of Streptomyces sp. The recombinant microorganism, wherein the cluster is deleted from the genome. The recombinant microorganism of claim 4, wherein the gene cluster is desVIII-desVII-desIII-desIV-desI-desII-desV-desVI. The recombinant microorganism of claim 5, wherein the desVIII-desVII-desIII-desIV-desI-desII-desV-desVI has a sequence of SEQ ID NO: 1. The recombinant microorganism of claim 1, wherein the recombinant microorganism is an expression vector comprising a nucleic acid sequence of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 20. The recombinant microorganism of claim 1, wherein the recombinant microorganism is deposited with accession number KFCC11507P or KFCC11508P. desVIII-desVII-desIII-desIV, desVIII-desVII-desIII-desIV-oleL-oleU, desVIII-desVII-desIII-desIV-desI-desII, desVIII-desVII-desIII-desIV-oleV-eryBII-urdR or desVIII-desVII- An expression vector comprising a nucleic acid encoding a combination of proteins of desIII-desIV-oleV-oleW-oleL-oleU. The nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV according to claim 9, wherein SEQ ID NO: 16; Nucleic acids encoding protein combinations of desVIII-desVII-desIII-desIV-oleL-oleU include SEQ ID NO: 17; The nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-desI-desII is SEQ ID NO: 18; Nucleic acids encoding protein combinations of desVIII-desVII-desIII-desIV-oleV-eryBII-urdR include SEQ ID NO: 19; Or the nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU is SEQ ID NO: 20. The method of claim 9, wherein the expression vector comprising a nucleic acid encoding a combination of proteins of desVIII-desVII-desIII-desIV is represented by the cleavage map of FIG. 7; an expression vector comprising a nucleic acid encoding a combination of proteins of desVIII-desVII-desIII-desIV-oleL-oleU is represented by the cleavage map of FIG. 8; an expression vector comprising a nucleic acid encoding a combination of proteins of desVIII-desVII-desIII-desIV-desI-desII is represented by the cleavage map of FIG. 9; An expression vector comprising a nucleic acid encoding a combination of proteins of desVIII-desVII-desIII-desIV-oleV-eryBII-urdR is shown in the cleavage map of FIG. 10; Or an expression vector comprising a nucleic acid encoding a combination of proteins of desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU, which is represented by the cleavage map of FIG. 11. Culturing the recombinant microorganism of any one of claims 1 to 8; And
A method for producing a narcamycin derivative, comprising recovering a narcamycin derivative from the cultured cells or culture medium. Narvomycin derivative compound represented by the following formula (1), a pharmaceutically acceptable salt thereof.
[Formula 1]

In which R is

,

,

or

to be. An antimicrobial composition comprising a compound of Formula 1 or a pharmaceutically acceptable salt.
[Formula 1]

In which R is

,

,

or

to be. The composition of claim 14, wherein the composition has antimicrobial activity against erythromycin-sensitive strains and erythromycin-resistant strains. The composition of claim 14, wherein the composition is E. paesium ATCC 19434, E. paella City Stadium P00558, S. aureus ATCC 25923 and S. aureus The composition having antimicrobial activity against a microorganism selected from the group consisting of P00740.

Images