KR101451037B1 - Novel narbomycin derivatives compounds, antibacterial composition comprising the same and manufacturing method of the same - Google Patents

Abstract

The present invention relates to a novel narbomycin derivative compound, an antimicrobial composition comprising the compound, and a method for producing the compound. In carrying beam azithromycin by means of in vivo combination of biosynthesis by the producing method of the present invention can be synthesized by carrying beam erythromycin derivatives containing a variety of sugar moiety, in particular, to a novel and synthesized a variety of carrying beam mitomycin derivatives having excellent antibacterial activity .

Description

Novel narbomycin derivatives compounds, antibacterial composition comprising the same and manufacturing method of the same}

The present invention relates to a novel narbomycin derivative compound, an antimicrobial composition comprising the compound, and a method for producing the compound.

As infectious bacteria acquire resistance to most antibiotics, efforts to obtain new types of antibiotics are continuing to treat bacteria, fungi, viruses, and cancer cells that are resistant to existing antibiotics. To this end, up to now, it has mainly searched for microorganisms existing in nature to find strains that produce new antibiotics, but the process of searching for these new antibiotics requires enormous time, effort, and cost, and pharmacological action and toxicity tests must be completed. It is a very tricky and difficult task because it can be recognized as a usable antibiotic. Therefore, many pharmaceutical companies, universities, and research institutes are expecting a breakthrough different from the existing methods.

Accordingly, attempts have been made to obtain various physiologically active substances of a new structure by manipulating the genes of strains that produce antibiotics. This method is mainly introduced for structural modification of polyketide-based antibiotics, and since various structures can be generated through a combination of various biosynthetic genes, this is called combinatorial biosynthesis. Compared to the conventional chemical synthesis method or enzyme synthesis method, this method saves time and cost in the search process, and is designed by applying the relationship between the structure and activity of existing antibiotics, so that the biological activity can be predicted. And cost can be reduced.

Polyketide-based compounds are compounds with complex structures produced from microorganisms, and more than about 10,000 compounds are known to date. Polyketide-based compounds are biosynthesized by a multifunctional protein complex called polyketide synthase (PKS). This PKS complex consists of several modules (a group of catalytic domains responsible for one condensation reaction) involved in a continuous condensation reaction. Since the structure of the polyketide is biosynthesized in a one-to-one correspondence according to the configuration of the catalytic domains constituting the module, the structure of the polyketide can be modified by modification of the PKS gene.

On the other hand, macrolide is composed of a polyketide macrolactone ring and one or more deoxysaccharides attached thereto. The macrolides mainly exhibit antimicrobial activity against Gram-positive bacteria such as Staphylococcus and Enterococcus. Of macrolides, the structure of the deoxy sugar moiety is important because the deoxy sugar moiety in specific contact with the target molecule greatly affects the biological activity of the molecule, and therefore, the above-mentioned PKS gene modification In addition to the modification of the polyketide structure, a post-PKS tailoring step such as glycosylation is required. Due to the advent of macrolide family antibiotic-resistant pathogens, research to discover new macrolide derivatives is ongoing. Conventionally, many studies have been conducted using chemical and enzymatic synthesis, but there is a problem in that it is difficult to chemically modify the deoxy sugar moiety or enzymatically synthesize nucleotide-activated deoxy sugars in vitro.

Narbomycin is Streptomyces As a macrolide-based material formed in Venezuela, it is converted into neo-, nova-, and picromycin by PikC (Fig. 1). Narbomycin is Staphylococcus Aureus , streptococcus Piogenes , Corynebacterium Terry deep cliff, gram - have been reported to have excellent activity toward such resistant strains - erythromycin positive Rhodococcus. Natural narbomycin contains the deoxysugar D-desosamine as a sugar moiety. Streptomyces Venetian state glycosyl transferase azepin the DesVII and its counterpart auxiliary DevVIII the aglycon (bidang (非糖) component) of the carrying beam of azithromycin elrae the carry beam surprised Jethro TDP- and to transfer a sugar-oxy, six open reading It is assumed that the open reading frame desI to desVI are involved in desosamin biosynthesis. It was thought that the protein could induce glycosyl diversity of narbomycin derivatives in vitro and in vivo , but narbomycin derivatives containing various sugar moieties in narbomycin as a method of combinatorial biosynthesis in vivo There is no example of synthesizing and reporting its antibacterial activity.

Against this background, the present inventors produced a cassette containing a nucleic acid encoding a combination of various sugar biosynthesis related proteins to accumulate narbonolides. The present invention was completed by discovering that various novel narbomycin derivatives can be produced by heterologous expression in Venezuela.

The present invention is a microorganism of the genus Streptomyces, desVIII, desVII among combinations of proteins selected from the group consisting of desVIII, desVII, desIII, desIV, desI, desII, desV, desVI, oleL, oleU, oleV, eryBII, urdR and oleW. , desIII and desIV proteins to provide a recombinant microorganism producing a narbomycin derivative into which a nucleic acid encoding a combination of proteins including the protein has been introduced.

In addition, the present invention desVIII-desVII-desIII-desIV, desVIII-desVII-desIII-desIV-oleL-oleU, desVIII-desVII-desIII-desIV-desI-desII, desVIII-desVII-desIII-desIV-oleV-eryBII-urdR Or to provide an expression vector comprising a nucleic acid encoding a combination of proteins of desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU.

In addition, the present invention comprises the steps of culturing the recombinant microorganism; And recovering the narbomycin derivative from the cultured cells or culture medium.

In addition, the present invention is to provide a narbomycin derivative compound represented by the following formula (1), and a pharmaceutically acceptable salt thereof.

,

,

또는

이다.In the above formula, R is

,

,

or

to be.

In addition, the present invention is to provide an antibacterial composition comprising the compound of Formula 1 or a pharmaceutically acceptable salt.

In one embodiment, the present invention is a microorganism of the genus Streptomyces, of a protein selected from the group consisting of desVIII, desVII, desIII, desIV, desI, desII, desV, desVI, oleL, oleU, oleV, eryBII, urdR and oleW Among the combinations, there is provided a recombinant microorganism producing a narbomycin derivative into which a nucleic acid encoding a combination of proteins including desVIII, desVII, desIII and desIV proteins is introduced. The combination of these proteins is desVIII-desVII-desIII-desIV, desVIII-desVII-desIII-desIV-oleL-oleU, desVIII-desVII-desIII-desIV-desI-desII, desVIII-desVII-desIII-desIV-oleV-eryBII-urdR Or it may be a combination of proteins of desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU.

In the present invention, the microorganism of the genus Streptomyces refers to a microorganism of the genus Streptomyces that can inherently biosynthesize narbomycin. The term "a microorganism capable of internally biosynthesizing narbomycin" refers to a microorganism that internally expresses all enzymes necessary for narbomycin biosynthesis. The "intrinsic" refers to the activity that wild-type microorganisms have in their natural state. In the present invention, narbomycin is a macrolide-based material and has a structure as shown in FIG. 1.

Genus Streptomyces microorganism of the present invention is Streptomyces Venezuelan days However, it is not limited thereto, and includes all microorganisms of the genus Streptomyces capable of producing narbomycin. Streptomyces Bene share elrae is so easy to have a relatively fast growth rate genetically modified (doubling time, ca. 1 h ), the shorter the incubation period necessary for the production of metabolites. The microorganism is a single polyketide synthase (PKS) and a number of post-PKS modifying enzymes (glycosylation by des clusters involved in biosynthesis and transfer of desosamin sugars and hydroxylation by PikC P450 monooxygenase). Through the action, it is possible to produce both 12- and 14-membered cyclic macrolides, methymycin, and picromycin (FIG. 1). In a specific embodiment of the present invention, Streptomyces Venezuela ATCC 15439 can be used.

Preferably, the microorganism of the genus Streptomyces is a gene encoding a protein that biosynthesizes and transfers D-desosamine, a sugar portion of narbomycin, in a microorganism of the genus Streptomyces that can inherently biosynthesize narbomycin. The cluster may have been deleted from the genome. The microorganism of the genus Streptomyces, in which a gene cluster that codes for a protein that biosynthesizes and transfers the sugar part of narbomycin, has been deleted from the genome, accumulates narbonolide, aglycone (non-sugar component) of narbomycin. do. The gene cluster is desVIII-desVII-desIII-desIV-desI-desII-desV-desVI (SEQ ID NO: 1) as a gene cluster (GenBank: AF079762.1) encoding a group of proteins required for biosynthesis and transfer of D-desosamine. It can be composed of. The microorganism may be a gene cluster consisting of the nucleotide sequence of SEQ ID NO: 1 has been deleted from the genome.

The specific deletion of only the desired gene in the genome can be performed through a method established in the art, and the method is not particularly limited, and a homologous recombination method may be used. It is possible to induce recombination between the genome and the vector by transforming a strain of the genus Streptomyces with a vector containing a selection marker between a nucleic acid encoding the N-terminus and the C-terminus of the desired protein. The selection marker to be used is not particularly limited, and markers that confer a selectable phenotype such as drug resistance, nutritional demand, resistance to cytotoxic agents, or expression of surface proteins may be used.

Preferably Streptomyces Venezuela YJ003 can be used. The strain can be prepared by the method described in the examples of the present invention.

In the present invention, as can be seen in Figure 2, the function of the proteins in the narbomycin derivative production pathway was revealed. In addition, novel narbomycin derivatives having modified sugar moieties were biosynthesized by preparing recombinant microorganisms expressing various and novel combinations of the above proteins, and their antimicrobial activity was also evaluated.

Protein sequence information required for the production of the narbomycin derivative of the present invention can be found in GenBank: AF079762.1, AF055579.2, U77454.1, AF269227.1. Specifically, in the present invention, DesIII is a protein having a Nucleotidylyl transferase (NT) function using glucose-1-phosphate as a substrate, and has an amino acid sequence of SEQ ID NO: 2. In the present invention, DesIV is a protein that functions as a 4,6-dehydratase (4,6-DH) and has an amino acid sequence of SEQ ID NO: 3. In the present invention, DesI is a protein that functions as an aminotransferase (AT) and has an amino acid sequence of SEQ ID NO: 4. In the present invention, DesII is a protein that functions as a deaminase (DA) and has an amino acid sequence of SEQ ID NO: 5. In the present invention, DesV is a protein that functions as an aminotransferase (AT), and has an amino acid sequence of SEQ ID NO: 6. In the present invention DesVI is N - as the methyl transferase protein kinase (N -methyltransferase, N-MT) function, and has an amino acid sequence of SEQ ID NO: 7. In the present invention, OleL is a protein that functions as an epimerase (EP) and has an amino acid sequence of SEQ ID NO: 8. In the present invention, OleU is a protein that functions as a 4-ketoreductase (4-KR) and has an amino acid sequence of SEQ ID NO: 9. In the present invention, OleV is a protein that functions as a 2,3-dehydratase (2,3-DH) and has an amino acid sequence of SEQ ID NO: 10. In the present invention, EryBII is a protein that functions as a 3-ketoreductase (3-KR) and has an amino acid sequence of SEQ ID NO: 11. In the present invention, UrdR is a protein that functions as a 4-ketoreductase (4-KR) and has an amino acid sequence of SEQ ID NO: 12. In the present invention, OleW is a protein that functions as a 3-ketoreductase (3-KR) and has an amino acid sequence of SEQ ID NO: 13. In the present invention, DesVIII is a protein that functions as an auxiliary counterpart to DesVII, and has an amino acid sequence of SEQ ID NO: 14. In the present invention, DesVII is a protein that functions as a glycosyltransferase, and has an amino acid sequence of SEQ ID NO: 15.

Introducing a nucleic acid encoding a combination of the proteins may further introduce the nucleic acid onto a chromosome, or introduce the nucleic acid onto a vector together with an autologous promoter or an enhanced separate promoter. Preferably, the microorganism of the genus Streptomyces can be transformed using an expression vector. As a method for producing a transformed recombinant microorganism using an expression vector, literature (Sambrook, J., et al., Molecular Cloning, A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory, 1. 74, 1989) The calcium phosphate method described above, or the calcium chloride/rubidium chloride method, the electroporation method, the electroinjection method, a chemical treatment method such as PEG, a method using a gene gun, and the like.

In a specific embodiment of the invention, the recombinant microorganism YJ003 / pDDSS (glycosyl transferase dehydratase gene desVIII / desVII D- to Sosa with min [DDSS] biosynthetic gene combinations (desIII - the desVI) - desIV - desI - desII - desV plasmid expression), YJ003 / pDQNV (desVIII / desVII and D- quinolyl Novo agarose with [DQNV] biosynthetic gene combinations (desIII - desIV) plasmid expressing), and YJ003 / pODDC (3'- O with desVIII / desVII -Demethyl-D-chalcose [ODDC] biosynthetic gene combination ( desIII - desIV - desI - desII ) is a plasmid expressing narbomycin, D-quinovoosyl- narbonolide (DQNVNB), and 3' -O -demethyl-D-chalcosyl-narbonolide (ODDCNB) was produced, respectively (FIGS. 2 to 4). However, recombinant YJ003 / pLRHM2 L- ramno the two derivative from the fermentation of (desVIII / desVII and L- ramno OSU [LRHM] biosynthetic gene combinations (with desIII-desIV - - oleL plasmid expressing oleU)) coming-carrying beam Norlide (LRHMNB) and DQNVNB were produced simultaneously (FIGS. 3 and 4 ). The simultaneous production of DQNVNB in the strain is Streptomyces Venezuela This is because 4-keto-6-deoxy-D-glucose, a biosynthetic intermediate of LRHM, was reduced to DQNV by pathway-independent 4-ketoriductase (SvRed) (FIG. 2). Recombinant YJ003 / pDDGT2 (desVIII / with desVII D- digital Messenger source [DDGT] combination biosynthetic gene (desIII-desIV-oleV-eryBII-urdR) plasmid expressing) is D- digital Toxoplasma coming-carrying beam surprised Id (DDGTNB ) And D-boybinosyl-narbonolide (DBVNNB) were produced, and recombinant YJ003/pLOLV2 ( desVIII / desVII together with L-oliboose [LOLV] and L-digitoxose [LDGT] biosynthetic gene combination ( desIII) - desIV-oleV-oleW-oleL-plasmid expressing oleU)) is L- Olivo coming-produced the carry beam surprised Id (LDGTNB), and DBVNNB (-carrying beam surprised Id (LOLVNB), L- coming digital Toxoplasma 3 and 4). Natural Streptomyces produced DBVNNB from both strains Venezuela 3-ketoriductase recognizes 2,6-dideoxy-3,4-diketo-D-glucose as an intermediate of D-digitoxose, L-oliboose and L-digitoxose, and other Unidentified Streptomyces Venezuela It is thought that D-boybinose was produced by combining with 4-keto reduction by 4-ketoriductase and reducing at C3. The simultaneous production of LOLVNB and LDGTNB in YJ003/pLOLV2 is TDP-4-keto-LOLV and TDP-4-keto formed due to tautomerization of OleU 4-ketoriductase from C-3 to C-4. It is believed that LOLV and LDGT were synthesized respectively by acting on -LDGT (Fig. 2).

Among the recombinant microorganisms prepared in a specific example of the present invention, pDDGT2 (a plasmid expressing a D - digitoxose [DDGT] biosynthetic gene combination ( desIII - desIV - oleV - eryBII-urdR) together with desVIII / desVII) was introduced. The recombinant microorganism and pLOLV2 (a plasmid expressing the biosynthetic gene combination of L-oliboose [LOLV] and L-digitoxose [LDGT] together with desVIII / desVII (desIII - desIV - oleV - oleW - oleL - oleU )) was introduced. The resulting recombinant microorganisms were deposited with the Korean Culture Center of Microorganisms (KCCM) on March 10, 2011 under the accession numbers KFCC11507P and KFCC11508P, respectively.

In another aspect, the present invention provides desVIII-desVII-desIII-desIV, desVIII-desVII-desIII-desIV-oleL-oleU, desVIII-desVII-desIII-desIV-desI-desII, desVIII-desVII-desIII-desIV-oleV It provides an expression vector comprising a nucleic acid encoding a combination of proteins of -eryBII-urdR or desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU.

In the present invention, the term "expression vector" is a recombinant vector capable of expressing a protein of interest in a suitable host cell, as a gene construct comprising essential regulatory elements operably linked to express a gene insert, and to prepare such a gene construct For this, standard recombinant DNA techniques can be used. In the present invention, the term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a protein of interest to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein can be operably linked to affect the expression of the encoding nucleic acid sequence. The type of expression vector is not particularly limited as long as it has a function of expressing a gene of interest in various host cells of a prokaryotic cell and producing a protein of interest, but a form similar to the natural state while retaining a strong promoter and strong expression power. A vector capable of producing a large amount of foreign protein of is preferred. It is preferable that the expression vector contains at least a promoter, a start codon, a gene encoding a protein of interest, and a stop codon terminator. In addition, DNA encoding a signal peptide, an operator sequence, an untranslated region on the 5th and 3rd sides of the gene of interest, a selection marker region, or a replicable unit may be appropriately included. The start and stop codons can generally be considered part of the nucleic acid sequence encoding the protein of interest, and must exhibit an action when the genetic construct is introduced and must be in frame with the coding sequence. The promoter of the vector can be constitutive or inducible.

In a specific embodiment of the present invention, the nucleic acid encoding the protein combination of desVIII-desVII-desIII-desIV is SEQ ID NO: 16, the nucleic acid encoding the protein combination of desVIII-desVII-desIII-desIV-oleL-oleU is SEQ ID NO: 17, The nucleic acid encoding the protein combination of desVIII-desVII-desIII-desIV-desI-desII is SEQ ID NO: 18, the nucleic acid encoding the protein combination of desVIII-desVII-desIII-desIV-oleV-eryBII-urdR is SEQ ID NO: 19, desVIII- The nucleic acid encoding the protein combination of desVII-desIII-desIV-oleV-oleW-oleL-oleU may be SEQ ID NO: 20.

In addition, in a specific embodiment of the present invention, pDQNV (an expression vector comprising a nucleic acid of SEQ ID NO: 16 encoding a protein combination of desVIII-desVII-desIII-desIV) is a cleavage map of FIG. 7, pLRHM2 (desVIII-desVII-desIII The expression vector containing the nucleic acid of SEQ ID NO: 17 encoding the protein combination of -desIV-oleL-oleU) is the cleavage map of FIG. 8, the sequence encoding the protein combination of pODDC (desVIII-desVII-desIII-desIV-desI-desII). The expression vector containing the nucleic acid of number 18) is the cleavage map of FIG. 9, pDDGT2 (an expression vector containing the nucleic acid of SEQ ID NO: 19 encoding the protein combination of desVIII-desVII-desIII-desIV-oleV-eryBII-urdR) The cleavage map of FIG. 10, pLOLV2 (expression vector including the nucleic acid of SEQ ID NO: 20 encoding the protein combination of desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU) is the cleavage map of FIG. 11, pDDSS (desVIII -desVII-desIII-desIV-desI-desII-desV-desVI (an expression vector including the nucleic acid of SEQ ID NO: 1) encoding the protein combination may have a cleavage map of FIG. 12.

In another aspect, the present invention comprises the steps of culturing the recombinant microorganism; And it provides a method for producing a narbomycin derivative comprising the step of recovering the narbomycin derivative from the cultured cells or culture medium.

In the present invention, the term "culture" means to grow microorganisms under appropriately artificially controlled environmental conditions. Microbial culture for producing the novel narbomycin derivative of the present invention can be cultured in a medium containing a nutrient source that can be used by ordinary microorganisms. As a nutrient source for microorganisms, a nutrient source commonly used in the art may be used without limitation, and a known nutrient source conventionally used for culturing bacteria of the genus Streptomyces may be used. For example, it is preferably made in a medium containing malonic acid, ethanol, methionine, a carbon source and a nitrogen source. At this time, the carbon source is preferably at least one selected from the group consisting of starch, glucose, corn oil, glycerol, maltose, mannose and inositol, and most preferably starch, glucose and corn oil. In addition, the nitrogen source is preferably at least one selected from the group consisting of cottonseed wheat, corn steep liquor, corn steep liquor, soybean meal, peptone and yeast extract, and most preferably cottonseed wheat and corn steep liquor. The seed culture was inoculated and cultured in a fermentation tank containing the culture medium. As a culture method, shaking culture or stationary culture is possible under aerobic conditions. The culture temperature is slightly different depending on the conditions when cultured under each of the above conditions, but it is usually appropriate to culture at 20-37°C, preferably at 26-30°C. In addition, the culture period may also be cultured for a known period used in the art, and the period may be adjusted as necessary. Preferably, in the case of shaking culture and stationary culture, it can be cultured for 4 to 7 days.

The method of recovering the narbomycin derivative from the cultured cells or the culture medium may be performed according to a method well known in the art. The method for recovering the narbomycin derivative may include filtration, anion exchange chromatography, crystallization and HPLC, but is not limited to these examples.

인 경우는 D-보이비노오실-나르보놀라이드(DBVNNB), R이

인 경우는 D-디지톡소오실-나르보놀라이드 (DDGTNB), R이

인 경우는 L-올리보오실-나르보놀라이드 (LOLVNB), R이

인 경우는 L-디지톡소오실-나르보놀라이드 (LDGTNB)이다.In another aspect, the present invention provides a narbomycin derivative compound represented by Formula 1, and a pharmaceutically acceptable salt thereof. In the narbomycin derivative represented by Formula 1, R is

In the case of D-boybinosyl-narbonolide (DBVNNB), R is

In the case of D-digitoxosyl-narbonolide (DDGTNB), R is

In the case of L-oliboosyl-narbonolide (LOLVNB), R is

In the case of, it is L-digitoxosyl-narbonolide (LDGTNB).

As a result of identification using a nuclear magnetic resonance spectrum, it was confirmed that the compound of Formula 1 is a novel narbomycin derivative.

The compounds of the present invention may be in the form of solvates or pro-drugs, which are included within the scope of the present invention. Solvates preferably include hydrates and ethanolates.

The term "pharmaceutically acceptable salt" in the present invention may be a relatively non-toxic inorganic and organic acid addition salt of a compound. As the salt, an acid addition salt formed by a pharmaceutically acceptable free acid is useful. Any and all organic or inorganic addition salts in which the side effects due to this salt do not degrade the beneficial efficacy of the compound of formula 1 as a concentration that is relatively non-toxic and harmless to the patient and has an effective action.

Acid addition salts are prepared by conventional methods, for example by dissolving a compound in an excess aqueous acid solution, and precipitating this salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. The same molar amount of the compound and an acid or alcohol (eg glycol monomethyl ether) in water may be heated, and then the mixture may be evaporated to dryness, or the precipitated salt may be suction filtered.

At this time, organic acids and inorganic acids can be used as the free acid, hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. can be used as inorganic acids, and methanesulfonic acid, p-toluenesulfonic acid, acetic acid, and trifluoroacetic acid can be used as organic acids. , Maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid , Gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillic acid, hydroiodic acid, etc. Can be used, but is not limited to these.

In addition, a pharmaceutically acceptable metal salt can be made using a base. The alkali metal salt or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate. At this time, the metal salt is particularly suitable for preparing sodium, potassium or calcium salts, but is not limited thereto. In addition, the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).

Pharmaceutically acceptable salts of the compound represented by Formula 1, unless otherwise indicated, include salts of acidic or basic groups that may be present in the compound. For example, pharmaceutically acceptable salts may include sodium, calcium and potassium salts of the hydroxy group, and other pharmaceutically acceptable salts of the amino group include hydrobromide, sulfate, hydrogen sulfate, phosphate, Hydrogen phosphate, dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate) and p-toluenesulfonate (tosylate) salts, and the like, and known in the art. It can be prepared through a method of preparing a salt.

The compound of the present invention can be synthesized according to a method commonly used in the art, and preferably can be produced from a recombinant microorganism using the method of the present invention.

In another aspect, the present invention provides an antibacterial composition comprising the compound of Formula 1 or a pharmaceutically acceptable salt. In the present invention, the "antibacterial composition" refers to a composition that acts to inhibit the survival and/or proliferation of microorganisms. The composition may have antimicrobial activity against erythromycin-sensitive strains and erythromycin-resistant strains, specifically, E. paesium ATCC 19434, E. paella City Stadium P00558, S. aureus ATCC 25923 and S. aureus It may have antimicrobial activity against microorganisms selected from the group consisting of P00740. In addition, the composition can treat infectious diseases caused by the microorganisms.

The composition may further include a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" in the present invention refers to a liquid or solid filler that is involved in the transport or transport of any subject composition or component from one organ, or part of the body to another organ, or part of the body. , A pharmaceutically acceptable material, composition or vehicle such as a diluent, excipient, solvent or encapsulating material, and the composition of the present invention comprises a pharmaceutically acceptable carrier, excipient, or diluent in addition to the above-described active ingredients for administration. It may contain more. Examples of the carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

In addition, the compositions of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injectable solutions according to a conventional method. have. Specifically, when formulated, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are commonly used. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like. Such a solid preparation may be prepared by mixing the compound of Formula 1 or a pharmaceutically acceptable salt thereof with at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, and the like. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid formulations for oral use include, but are not limited to, suspensions, liquid formulations, emulsions, syrups, etc., and various excipients other than water and liquid paraffin, which are commonly used simple diluents, such as wetting agents, sweeteners, fragrances, It can be prepared by adding a preservative or the like. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyloleate, and the like can be used. As a base for suppositories, Witepsol, Macrogol, Tween 61, cacao butter, laurin paper, glycerogelatin, and the like can be used.

In addition, the present invention provides a method for treating a microbial infectious disease comprising administering the compound of Formula 1 or a pharmaceutically acceptable salt thereof to a subject. In addition, the present invention provides a method of inhibiting the survival and/or proliferation of microorganisms including erythromycin-sensitive strains and erythromycin-resistant strains by using the compound of Formula 1 or a pharmaceutically acceptable salt thereof.

The term "treatment" in the present invention refers to any action that inhibits or delays the onset of a disease, in particular local or systemic in animals, especially mammals, and more particularly in humans caused by pharmacologically active substances. Refers to the effect.

In a specific embodiment of the present invention, DQNVNB is S. aureus It was more effective than narbomycin in inhibiting the growth of P00740. LOLVNB is S. aureus It showed a selective activity against ATCC 25923, which means that the 3'-equatorial-hydroxyl group of LOLVNB has a positive effect on the antimicrobial activity. LRHMNB showed potent activity (1.25-2.50 μM). The antimicrobial activity of ODDCNB (2.5-5.0 μM) was superior to narbomycin (10-20 μM) and DQNVNB (≦ 10 μM). DBVNNB (≤ 10 μM) is helpful when par E. ATCC 19434, P00558, and S. aureus It showed high antimicrobial activity against ATCC 25923, which means that the 4'-axial-hydroxyl group of DBVNNB reduces MIC.

The composition of the present invention can be administered through any general route as long as it can reach the target tissue. Therefore, the composition of the present invention can be administered topically, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal, etc., and formulated as solutions, suspensions, tablets, pills, capsules, sustained-release preparations, etc. can do.

The composition of the present invention can be administered in a therapeutically effective amount. The dosage may vary depending on various factors such as the type and severity of the patient's disease, age, sex, administration method, target cell, and expression level, and can be easily determined by experts in the field.

Through the production method of the present invention , narbomycin derivatives containing various sugar moieties in narbomycin can be synthesized by a method of in vivo combination biosynthesis, and in particular, various narbomycin derivatives that are novel and excellent in antibacterial activity can be synthesized. I can.

1 is Streptomyces Narbomycin is biosynthesized from Venezuela. It is a diagram showing the structure of the pathway and narbomycin.
Figure 2 shows a pathway for biosynthesis of a narbomycin derivative containing a modified sugar moiety by the method of the present invention. The functions of proteins involved in the biosynthesis are indicated in parentheses. NT, nucleotidylyl transferase; 4,6-DH, 4,6-dehydratase; 2,3-DH, 2,3-dehydratase; AT, aminotransferase; DA, deaminase; EP, epimerase; 4-KR, 4-ketoriductase; N-MT, N -methyltransferase; 3-KR, 3-ketoriductase; SvRed, Streptomyces Venezuela Pathway independent reductase.
3 shows the structure of narbomycin and its derivatives.
Figure 4 is Streptomyces Venezuela The HPLC-ESI-MS chromatogram from the culture medium of the strain is shown. (A) Narbomycin detected from YJ003/pDDSS ([M + H] ⁺ = 510). (B) DQNVNB detected from YJ003/pDQNV ([M + NH ₄ ] ⁺ = 516). (C) LRHMNB ([M + NH ₄ ] ⁺ = 516) and DQNVNB ([M + NH ₄ ] ⁺ = 516) detected from YJ003/pLRHM2. (D) ODDCNB detected from YJ003/pODDC ([M + NH ₄ ] ⁺ = 500). (E) DBVNNB ([M + NH ₄ ] ⁺ = 500) and DDGTNB ([M + NH ₄ ] ⁺ = 500) detected from YJ003/pDDGT2. (F) DBVNNB ([M + NH ₄ ] ⁺ = 500), LOLVNB ([M + NH ₄ ] ⁺ = 500), and LDGTNB ([M + NH ₄ ] ⁺ = 500) detected from YJ003/pLOLV2.
Figure 5 shows the NOE (Nuclear Overhauser effect) correlation of the sugar portion of narbomycin.
Figure 6 is a des cluster is deleted Streptomyces It is a schematic diagram showing the structure of a gene construct for producing a Venezuelan deletion mutant.
7 is a cleavage map of pDQNV (an expression vector containing a nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV).
8 is a cleavage map of pLRHM2 (an expression vector containing a nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-oleL-oleU).
9 is a cleavage map of pODDC (an expression vector containing a nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-desI-desII).
10 is a cleavage map of pDDGT2 (an expression vector containing a nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-oleV-eryBII-urdR).
11 is a cleavage map of pLOLV2 (an expression vector containing a nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU).
12 is a cleavage map of pDDSS (an expression vector containing a nucleic acid encoding a protein combination of desVIII-desVII-desIII-desIV-desI-desII-desV-desVI).

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.

Bacterial strains, culture conditions, and genetic manipulation

Streptomyces Venezuelan protoplast preparation and transformation were performed according to the method of Kieser, T. et al. (Kieser, T. et al., 2000, Practical Streptomyces. genetics. John Innes Centre, Norwich, United Kingdom). Streptomyces Venezuelan transformants were selected on R2YE agar plates supplemented with thiostrepton. Streptomyces Venezuela Recombinant strains were grown on SPA agar (1 g of yeast extract, 1 g of beef extract, 2 g of tryptose, 10 g of glucose, trace amounts of iron sulfate, and 15 g/liter of agar). Streptomyces Venezuela ATCC 15439, Streptomyces Antibioticus ATCC 11891, and Saccharopolispora Eritrea Genomic DNA was obtained using NRRL 2338.

E. coli General subcloning was performed using DH5α and plasmid Litmus28 (New England Biolabs). Constituent ermE * promoter (Schmitt-John, T. et al., 1992. Appl. Microbiol. Biotechnol. 36:493-498) and high-copy-number E. coli- streptomy Seth The shuttle vector pSE34 (Yoon, YJ et al., 2002. Chem. Biol. 9:203-214) was used to express genes involved in the biosynthesis of deoxysaccharides and their attachments.

des Preparation of cluster-deleted mutants

Streptomyces in which desosamin biosynthesis is deleted through a replicative plasmid-mediated homologous recombination method (Xue et al., PNAS USA, 95:12111, 1998) Venezuelan deletion mutants (YJ003) were prepared.

The plasmid has a kanamycin resistance gene, aphII (Ward et al., Mol. Gen. Genet., 203:468, 1986), and instead of the entire des cluster, both upstream and downstream sides of the des cluster It was prepared to have a DNA fragment (flanking DNA fragment) located in (Fig. 6). The construct for gene replacement is Streptomyces through protoplast transformation. It was prepared using pKC1139 (Bierman, M. et al., Gene, 116:43-9, 1992) inserted into Venezuela. Streptomyces Venezuelan ATCC 15439 was transformed with a plasmid containing the gene. Spores obtained from each transformant were cultured on a kanamycin selection agar plate, and the cycle was repeated 3 times to increase the possibility of recombination. In order to obtain kanamycin-resistant and apramycin-sensitive phenotypes, a crossover in which the target gene was replaced with aphII was selected and screened, and the mutant genotype was confirmed by genomic DNA Southern blot hybridization.

To prepare the des deletion plasmid (pYJ003), a Streptomyces Venezuelan genomic DNA cut with SphI was used as a template, and a 1kb HindIII-PstI fragment having a portion located on the side of the 5'-des cluster used was SEQ ID NO: 21 and 22 were used as primers, and the 1kb KpnI-EcoRI fragment having a portion located on the side of the 3'-des cluster was PCR performed using SEQ ID NOs: 23 and 24 as primers. Reactive components used in PCR were template DNA 100ng, each primer 30pmol, pfu DNA polymerase 2.5unit, each dNTP 2mM, Tris-HCl 20mM, (NH ₄ ) ₂ SO ₄ 10mM, KCl 10mM, Triton X-100 1%, BSA 1mg/ml, MgSO ₄ 20mM and DMSO 10%, these were mixed so that the total volume was 50µl.

SEQ ID NO: 21 (forward): 5'-GGCAAGCTTAGCGGGGCGACTGGCGTGCCCACT-3'

SEQ ID NO: 22 (reverse): 5'-GGTCTGCAGTCACCGTGGGTTCTGCCATCTCTT-3'

SEQ ID NO: 23 (forward): 5'-GCTGGTACCGGATGTTCCCTCCGGGCCACCGTC-3'

SEQ ID NO: 24 (reverse): 5'-TGAGAATTCCCTCGCCGTCCTGCCCGCGCTTGG-3'

Expression plasmid and Streptomyces Venezuela Preparation of recombinant strains

DNA fragments containing a plurality of deoxysaccharide biosynthetic genes were amplified by PCR using specific deoxyoligonucleotide primers and template DNA (Table 1). PCR, Pfu under the conditions recommended by the manufacturer It was carried out using polymerase (Fermentas).

primer Sequence (5'-3') Restriction enzyme DNA origin
(GenBank accession No.) desVIII - VII F TTAATTAAGATATCACCGGCAAGGAAGGACACGACGCC (SEQ ID NO: 25) PacI-EcoRV Streptomyces venezuelae ATCC 15439
(GenBank AF079762.1) desVIII - VII R TCTAGACATATGGCGCAGATACAGGGGTGAGGCCTG (SEQ ID NO: 26) NdeI-XbaI desI - II F TTAATTAAACTAGTATCGATGACGGTGGCCCGGAGGG (SEQ ID NO: 27) PacI-SpeI-ClaI Streptomyces venezuelae ATCC 15439
(GenBank AF079762.1) desI - II R TCTAGATGCGGGTCAGCGCAGGAAGCCGCG (SEQ ID NO: 28) XbaI desIII - IV F TTAATTAAACTAGTTAACTCGCCACGCCGACCGTT (SEQ ID NO: 29) PacI-SpeI Streptomyces venezuelae ATCC 15439
(GenBank AF079762.1) desIII - IV R TCTAGAGAGCTCCTCGTAGGCGGCCTT (SEQ ID NO: 30) XbaI desV F TTAATTAAACTAGTCAGGTCTCCTTCGCGGACGGCCTC (SEQ ID NO: 31) PacI-SpeI Streptomyces venezuelae ATCC 15439
(GenBank AF079762.1) desV R TCTAGAACCTGACTAGGCCTGGTCGACCCG (SEQ ID NO: 32) XbaI desVI F TTAATTAAACTAGTCCCCAGGCCTCACCCCTGTATCTG (SEQ ID NO: 33) PacI-SpeI Streptomyces venezuelae ATCC 15439
(GenBank AF079762.1) desVI R TCTAGAGAATTCGCTCAGGCGGGGACGCCGACGAAG (SEQ ID NO: 34) XbaI-EcoRI oleL F TTAATTAAACTAGTATCGATATCGCTCCGAGCCCGAAGGGA (SEQ ID NO: 35) PacI/ SpeI/ClaI Streptomyces antibioticus ATCC 11891
(GenBank AF055579.2) oleL R TCTAGAGCCGGCCAGTACGAGGGCCTT (SEQ ID NO: 36) XbaI oleU F TTAATTAAACTAGTGTACCGCGACAACCGC (SEQ ID NO: 37) PacI/ SpeI S. antibioticus ATCC 11891
(GenBank AF055579.2) oleU R TCTAGAGAAGAGGGCCAGGTCGTGCACGC (SEQ ID NO: 38) XbaI oleV F TTAATTAAACTAGTATCGATGGGAATCGCGGAAGCG (SEQ ID NO: 39) PacI/SpeI/ClaI S. antibioticus ATCC 11891
(GenBank AF055579.2) oleV R TCTAGAATCAGCTCAGGGCCTGGATGC (SEQ ID NO: 40) XbaI eryBII F TTAATTAAACTAGTGGTCGTCGGCATCTGCG (SEQ ID NO: 41) PacI/SpeI Saccharopolyspora erythraea NRRL 2338
(GenBank U77454.1) eryBII R TCTAGACTCGGTTCCTCTTGTGCTCACTGC (SEQ ID NO: 42) XbaI urdR F TTAATTAAACTAGTACAGAGATCCAGGACGACGCA (SEQ ID NO: 43) PacI/ SpeI pYJ146
urdR R TCTAGATCAGATACGGACGGCGGAGGT (SEQ ID NO: 44) XbaI oleW F TTAATTAAACTAGTAAGGGAACCCCATGCCCTCCC (SEQ ID NO: 45) PacI/SpeI S. antibioticus ATCC 11891
(GenBank AF055579.2) oleW R TCTAGAATCAGCACCAGCGCACCCGCGCCA (SEQ ID NO: 46) XbaI

pYJ146 is Hong, JS et al., 2004. FEMS Microbiol. Lett. 238:291-299.

The genes involved in the glycosylation of narbonolide having various deoxysaccharides were cloned into the replication plasmid pSE34. In order to efficiently construct a plasmid containing various genes, a PacI/XbaI fragment containing one gene was ligated to PacI/SpeI-cleaved Litmus28 containing another gene. The procedure was repeated regressively until all genes necessary for the conversion of narbonolides to glycosylated narbonolides were combined in Litmus28 and transferred into pSE34, which was cleaved with PacI/XbaI. The combined gene sequences are summarized in Table 2.

Plasmid Gene combination product pDDSS desIII - desIV - desI - desII - desV - desVI Narbomycin pDQNV desIII - desIV DQNVNB pLRHM2 desIII - desIV - oleL - oleU DQNVNB
LRHMNB pODDC desIII - desIV - desI - desII ODDCNB pDDGT2 desIII - desIV - oleV - eryBII - urdR DDGTNB
DBVNNB pLOLV2 desIII - desIV - oleV - oleW - oleL - oleU LOLVNB
LDGTNB
DBVNNB

In order to construct pDDSS, the gene encoding the DesVII/DesVIII glycosyltransferase/complementary protein pair and the TDP-D-desosamine biosynthetic enzyme was sequentially cloned into Litmus28 to prepare pDDSS_lit28. The inserted DNA of pDDSS_lit28 was digested with PacI/XbaI and ligated to pSE34 to prepare pDDSS.

In order to produce a pDQNV, to the ClaI / EcoRI- pDDSS_lit28 to be cut by using a Klenow fragment to create a connection dundan desVIII - it was cloned into the PacI / XbaI fragment containing the desIV as pSE34 - desVII - desIII.

In order to construct a plurality of plasmids (pLRHM2, pODDC, pDDGT2, and pLOLV2) instructing the biosynthesis and their transfer of various deoxysaccharides, ClaI/XbaI fragments containing various sugar gene cassettes are independently ClaI/XbaI-cleaving pDDSS_lit28 Cloned into. Each PacI/XbaI fragment of the prepared plasmid was cloned into pSE34, and the plasmid was Streptomyces It was introduced into the Venezuelan deletion mutant (YJ003). Specifically, pDDSS by introducing a (glycosyl transferase dehydratase gene having D- Sosa Min [DDSS] biosynthetic gene combinations (desIII with desVIII / desVII - desIV - desI - desII - - desV plasmid expressing desVI)) recombinant microorganism Preparation of YJ003/pDDSS (production of narbomycin); Recombinant microorganism YJ003/pDQNV was prepared by introducing pDQNV (a plasmid expressing the D-quinobose [DQNV] biosynthetic gene combination ( desIII - desIV) together with desVIII / desVII ) to produce a recombinant microorganism YJ003/pDQNV (D-quinovoosyl-narbonolide ( DQNVNB) production); pODDC producing a recombinant microorganism YJ003 / pODDC by introducing (3'- O with desVIII / desVII - having methyl -D- coarse DISCUSSION [ODDC] biosynthetic gene combinations (desIII - desII) plasmid expressing desIV - - desI) ( 3'- O -demethyl-D-chalcosyl-narbonolide (ODDCNB) production); pLRHM2 (desVIII / desVII and L- ramno OSU [LRHM] combined with biosynthesis genes (desIII-desIV-oleL-oleU) the introduction of a plasmid expressing a recombinant microorganism prepared by YJ003 / pLRHM2 (L- ramno coming-carrying beam surprised Id (LRHMNB) and DQNVNB production); pDDGT2 ( desVIII / desVII together with D-digitoxose [DDGT] biosynthetic gene combination ( desIII - desIV - oleV - eryBII - urdR ) by introducing a plasmid expressing the recombinant microorganism YJ003 / pDDGT2 Preparation (production of D-digitoxosyl-narbonolide (DDGTNB) and D-boybinosyl-narbonolide (DBVNNB)); pLOLV2 (L-oliboose [LOLV] and L-Digi with desVIII / desVII) Toxose [LDGT] biosynthetic gene combination ( desIII - desIV - oleV - oleW - oleL - oleU ) was introduced to prepare a recombinant microorganism YJ003/pLOLV2 (L-oliboosyl-narbonolide (LOLVNB), L -Digitoxosyl-narbonolide (LDGTNB), and DBVNNB production).

Among the prepared recombinant microorganisms, pDDGT2 ( plasmid expressing the D - digitoxose [DDGT] biosynthetic gene combination ( desIII - desIV - oleV - eryBII-urdR) together with desVIII / desVII ) was introduced into the recombinant microorganism and pLOLV2 ( desVIII / plasmid expressing L-oliboose [LOLV] and L-digitoxose [LDGT] biosynthetic gene combination ( desIII - desIV - oleV - oleW -oleW -oleL-oleU ) with desVII) was introduced into Korean microbial preservation As of March 10, 2011, it was deposited with the Center (Korean Culture Center of Microorganisms, KCCM) under the accession numbers KFCC11507P and KFCC11508P, respectively.

HPLC - ESI - MS analysis Narbomycin And his Glycosylation derivative

Streptomyces Venezuela Macrolides produced in culture were extracted using SPE and metabolites were analyzed by high-performance liquid chromatography-electrospray ionization-mass spectrometry (HPLC-ESI-MS). I did. Each culture was centrifuged (for 10 minutes, 5,000 xg). The supernatant was passed through an OASIS HLB (Waters, Milford, MA) SPE column previously treated with 5 ml methanol and 5 ml water. Washing the column with 5 ml 20% (vol / vol ) methanol and ca. Air dried for 30 seconds. The column was eluted three times with 1 ml 0.5% (vol/vol) methanol acetic acid. Analytical HPLC-ESI-MS was performed on a Waters/Micromass Quattro micro/MS interface using a Waters Nova-Pak C18 column (150 x 3.9 mm, 5 μm) in cationic mode. Using a concentration gradient of 5 mM (wt/vol) ammonium acetate at a flow rate of 250 μl/min, the analyte was -0.05% (vol/vol) acetic acid aqueous solution (solution A) and 80% (vol/vol/ vol) 20 to 70% solution B for 25 minutes as acetonitrile (ACN) (solution B), up to 90% solution B for 15 minutes, 90% solution B hold for 9 minutes, and for column re-equilibration for 11 minutes Solution B up to 20%-eluted. 6 Streptomyces containing various expression plasmids Venezuela As a result of HPLC-ESI-MS analysis of the SPE extract of the recombinant microorganism, narbomycin and seven glycosylated derivatives of narbomycin were detected (FIG. 4).

Narbomycin And his Glycosylation Extraction, separation and identification of derivatives

Chromatographic separation was performed using reverse phase HPLC on a preparative Spherisorb S5 ODS2 (Waters, 250 x 20 mm, 5 μm) or semi-preparative Watchers 120 ODS-BP (250 x 10 mm, 5 μm, Daiso, Osaka, Japan) column. Performed. ¹ H, correlation spectroscopy (COSY), heteronuclear multiple bond correlation (HMBC), heteronuclear single quantum correlation (HSQC), and nuclear Oberhauser effect spectroscopy (NOESY) NMR spectra on a Varian INOVA 500 spectrometer (Varian, Inc., Palo Alto, CA) was used to record at 500 MHz. ^{The 13} C NMR spectrum was recorded at 125 MHz on the same machine. Chemical shifts were reported with respect to each solvent peak (δ _H 7.27 and δc 77.0 for _{CDCl 3} ; δ _H 3.30 and δc 49.0 for _{CD 3 OD).}

Narbomycin-producing strain Streptomyces Venezuela The entire culture solution (0.5 L) of YJ003/pDDSS was centrifuged, and the supernatant layer was subjected to solvent-solvent distribution using _{ethyl acetate (Et 2 OAc).} The brown residue produced as a result of evaporation of the obtained extract was fractionated using preparative HPLC using gradient elution. Analyte the analyte from 0 to 15 minutes using a gradient of 0.1% aqueous acetic acid (solution C) and acetonitrile-acetic acid (99.9:0.1, v/v) (solution D) to 15% of solution D, at 53 minutes. It was eluted at a flow rate of 5 ml/min with 15% solution D again for 63-73 minutes, up to 35% of solution D, from 58 minutes to 60% of solution D. The narbomycin-containing fraction was further purified using semi-preparative HPLC using 3 ml/min 30% aqueous CAN as a mobile phase to yield a pure compound as an amorphous white solid (0.67 mg; retention time (Rt), 37.6 min. ; Formula; ESI-MS [M + H] ⁺ 510; NMR data is shown in Table 3 below).

The entire culture (1.0 L) of the D-quinovoosyl-narbonolide (DQNVNB)-producing strain YJ003/pDQNV was similarly treated to obtain a brown material. 2 ml/min using semi-preparative HPLC using gradient elution (30% aqueous ACN up to 30 min, 50% aqueous ACN for 40-80 min, and 30% aqueous ACN again for 81-90 min) It was separated by the flow rate of. Fractions containing DQNVNB were further purified using semi-preparative HPLC using 2 ml/min 30% aqueous ACN as mobile phase to give pure compound as an amorphous white solid (4.25 mg; retention time (Rt), 25.8 min; ; ESI-MS [M + NH ₄ ] ⁺ 516; NMR data is shown in Table 4 below).

The residue obtained from the entire culture (0.5 L) of L-rhamnosyl-narbonolide (LRHMNB)-producing strain YJ003/pLRHM2 was subjected to gradient elution (35% aqueous ACN up to 55 min, 60% aqueous for 55-65 min. Fractionation was performed at a flow rate of 6 ml/min using preparative HPLC using ACN, and 35% aqueous ACN again for 70-80 min). The fraction containing LRHMNB was purified using semi-preparative HPLC using 30% aqueous ACN as mobile phase to give pure compound (0.54 mg; retention time (Rt), 25.2 min; formula; ESI-MS [M + NH ₄ ]) ⁺ 516; NMR data is to Table 5).

a: Values based on HSQC and HMBC spectra

The entire culture (1.0 L) of the 3'- O -demethyl-D-chalcosyl-narbonolide (ODDCNB)-producing strain YJ003/pODDC was treated in the same manner. The residue was fractionated using preparative HPLC using 45% aqueous ACN as the mobile phase at a flow rate of 5 ml/min. The fraction containing ODDCNB was purified using semi-preparative HPLC using 30% aqueous ACN as the mobile phase at a flow rate of 2 ml/min to give pure compound (2.44 mg; retention time (Rt), 29.6 min; formula; ESI- MS [M + NH ₄ ] ⁺ 500; NMR data is shown in Table 6 below).

The entire culture (14.6 L) of D-Digitoxyl-narbonolide (DDGTNB) and D-Boibinosyl-narbonolide (DBVNNB)-producing strain YJ003/pDDGT2 was similarly treated and the final residue was gradient Fractionation was performed at a flow rate of 6 ml/min using preparative HPLC using elution (40% aqueous ACN up to 45 minutes, 45% aqueous ACN for 50-60 minutes, and 40% aqueous ACN again for 65-75 minutes). The fractions containing DBVNNB and DDGTNB were each passed through a semi-preparative HPLC column using 35% aqueous ACN at a flow rate of 2 ml/min, respectively, and pure DBVNNB (9.16 mg; retention time (Rt), 29.3 min; formula; ESI-MS [M]) + NH ₄ ] ⁺ 500; NMR data is shown in Table 7 below) and DDGTNB (4.18 mg; retention time (Rt), 31.2 min; chemical formula; ESI-MS [M + NH ₄ ] ⁺ 500; NMR data is shown in Table 8) Were produced respectively.

a: Values based on HSQC and HMBC spectra

Gradient elution of the residue obtained from the entire culture (2.5 L) of L-oliboosyl-narbonolide (LOLVNB) and L-digitoxosyl-narbonolide (LDGTNB)-producing strain YJ003/pLOLV2 (30 min. Fractionation was performed using semi-preparative HPLC using 30% aqueous ACN, 40% aqueous ACN for 40-80 min, and 30% aqueous ACN again for 81-90 min) at a flow rate of 2 ml/min. The fraction containing LOLVNB was passed through a semi-preparative HPLC column using 35% aqueous ACN as mobile phase at a flow rate of 2 ml/min and pure compound (0.55 mg; retention time (Rt), 28.7 min; formula; ESI-MS [M + NH ₄ ] ⁺ 500; NMR data were produced in Table 9 below.

a: Values based on HSQC and HMBC spectra

The entire culture (21.6 L) of LOLVNB and LDGTNB-producing strain YJ003/pLOLV2 was treated in the same manner as the previous strain, and the resulting residue was subjected to gradient elution (38% aqueous ACN up to 50 min, 42% aqueous ACN for 55-75 min. , And for 76-85 min again 38% aqueous ACN) using preparative HPLC using a flow rate of 6 ml/min. The LDGTNB-containing fraction was passed through a semi-preparative HPLC column using 35% aqueous ACN as a mobile phase at a flow rate of 2 ml/min and pure compound (1.81 mg; retention time (Rt), 31.0 min; formula; ESI-MS [M + NH ₄ ] ⁺ 500; NMR data were produced in Table 10 below.

a: Values based on HSQC and HMBC spectra

Narbomycin And the structure of its derivatives

The structure of the separated metabolites was _{inferred using NMR spectroscopy (1} H, ₁₃ C, COSY, HSQC, and HMBC). Through the ¹³ C NMR data of DQNVNB, the presence of 26 carbons, which can be confirmed in 14-membered macrolide glycosides such as narbomycin, was confirmed. As a result of analysis of 2D NMR data including COSY, HSQC, and HMBC spectra, the entire structure of DQNVNB was conceived. ^{Through 1} H NMR spectrum, 7 methyl groups (δ _H 1.35/ H ₃ -16, 1.30/ H ₃ -6', 1.30/H ₃ -17, 1.10/H ₃ -19, 1.08/H ₃ -20, 0.98/ H ₃ -18, and 0.89/H ₃ -15), 2 methylene groups (δ _H 1.48, 1.19/H ₂ -7 and 1.61, 1.52/H ₂ -14), 5 methine protons (δ _H 3.82/H-2, 2.89/H-4, 2.81/H-8, 2.72/H-12, and 1.80/H-6), 7 oxygenated _{metaine protons (δ H} 4.94/H-13, 4.34/H-1', 4.16/H-5, 3.46/H-3', 3.34/H-5', 3.33/H-2', and 3.16/H-4'), and two olefin protons (δ _H 6.65/H-11 and 6.05/H-10) were confirmed. The COSY spectrum identified five spin systems including those for 6-deoxyhexose from anomer protons (δ _H 4.34/H-1') to H-6' (δ _{H 1.30).} The presence of 6-deoxyhexose sugar was determined through ¹³ C NMR and HSQC spectra, along with the anomer carbon at δc 103.1/C-1', and four oxygenated carbons (δc 76.9/C-3', 75.5/C- 4', 74.7/C-2', 72.0/C-5') and δc 17.8/C-6' were confirmed again by detecting methyl signals. In the HMBC spectrum, the anomeric proton (δ _H 4.34/H-1') was associated with carbon C-5 (δc 78.8), indicating that the sugar was attached to C-5. Moreover, the major HMBC correlation of each carbon and methyl proton confirmed their location.

If the mechanism of glycosylation is known (stereochemistry is reversed or conserved), the conformation of the sugar can be determined from the coupling constant of the anomeric proton. The glycosyltransferase DesVII transfers sugars by reversing the stereochemistry at the anomer carbon of the activated sugar. Accordingly, a large coupling constant (ca. 7 Hz) having a glycopeptide seed ⁴ C ₁ conformation in a sense that it includes a transverse direction of the (equatorial) β- glycoside-linked sugar and D-, a small couple to the anomeric protons The ring constant (< 5 Hz) refers to an L-sugar having a ¹ C _{4 stereostructure having an axial α-glycosidic bond.} The correct conformation ( ⁴ C ₁ ) can be confirmed again through the NOE cross peak between H-1' and H-5'. As a result, the sugar was identified as D-quinobose ^{having a 4} C _{1 stereostructure.} The longitudinal position was confirmed through the large coupling constant ( J _{1' , 2'} = 7.0 Hz) of the anomer proton, and thus, it was identified as a β-glycosidic-linked D-sugar according to Klyne's law. Large coupling constants ( J _{2' ,3'} = 9.0 Hz, J _{3' ,4'} = 9.0 Hz, and J _{4' ,5'} = 9.0 Hz) are H-2', H-3', H-4 It means that the', and H-5' protons are located in the longitudinal direction. Moreover, the NOE correlation between H-1' and H-5' (FIG. 5) supports the ⁴ C ₁ stereostructure.

The 1D and 2D NMR data of ODDCNB were similar to DQNVNB. This means that the substance is also a narbomycin derivative. The only difference is the presence of an additional methylene group in the sugar, which means it is dideoxyhexose. In the COSY spectrum, it was confirmed that the proton H-1' (δ _H 4.31) is coupled to H-2' (δ _H 3.25) coupled to H-3' (δ _{H 3.70).} Proton H-3' was coupled to methylene H-4' protons (δ _H 1.95 and 1.42) and in turn to H-5' protons (δ _H 3.62) _{coupled to H3-6' protons (δ H 1.25).} It was confirmed that it was coupled. This means the presence of a 4,6-dideoxyhexose moiety. According to the coupling constant, it was confirmed that the protons H-2', H-3', and H-5' are in the longitudinal direction. This means that the sugar is 3- O demethyl-chalcose. Large coupling constants ( J _{1' ,2'} = 7.5 Hz) generally mean β-glycosidic bonds to D-sugars in the ⁴ C _{1 conformation.} This is supported by the NOE cross peak between H-1' and H-5' (Figure 5). In this way, the 1D and 2D NMR data obtained above indicate that the sugar moiety is 3- O -demethyl-D-chalcose attached to C-5.

The NMR data of DBVNNB was similar to that of ODDCNB. This means the presence of a narbomycin derivative containing a dideoxyhexose sugar. In the COSY spectrum, the anomeric proton H-1' (δ _H 4.81, dd, J = 8, 4.5 Hz) is the methylene proton coupled to _{H-3' (δ H 4.11) (H 2} -2': δ _H 1.78/1.80). Is coupled to the proton H-3'H-4' (δ _H 3.26), and also to H-5' (δ _H 4.05), which in turn is coupled to the H3-6' proton (δ _{H 1.24).} Confirmed. This means that the sugar moiety is 2,6-dideoxyhexose. The large coupling constant (δ _H 4.81, dd, J _{1' , 2'} = 8.0, 4.5 Hz) of the anomeric proton means a β-glycosidic bond in the transverse direction, and therefore, stereochemistry in the ⁴ C _{1 stereostructure} It was determined as a D-sugar. The small coupling constants of H-3' ( J = 3 Hz) and H-4' (brs) mean that both protons are located in the transverse direction and each hydroxyl group is in the longitudinal direction. Thus, the sugar was identified as D-boybinose, and the data fit well with known reports. In addition, the ⁴ C ₁ stereostructure was confirmed through the NOE cross peak (FIG. 5) between H-1' and H-5'.

The NMR data of DDGTNB were similar to DBVNNB except for the difference in the coupling constant of sugar protons. Based on the NMR data, dideoxy sugar was identified as D-digitoxose, and the large coupling constant ( J _{1' , 2'} = 9.5 Hz) of the anomer proton was β-glycosidic linked with a longitudinal proton. D represents sugar. ^{The 1} H NMR spectrum confirms the longitudinal direction of the 3'-OH group through the small coupling constant of H-3' (δ _H 4.11, m, J = 3 Hz), which is common for e,a and e,e couplings. And, therefore, it was useful to distinguish between digitoxose and oligoose sugars. Biaxial coupling ( J _{4' ,5'} = 9.5 Hz) was observed between H-4' and H-5', meaning 5'-CH ₃ and 4'-OH in the transverse direction. The ⁴ C ₁ conformation of the digitoxose sugar (common to D-sugar) was confirmed using the NOE correlation between H-1' and H-5' (FIG. 5).

The NMR data of LOLVNB were similar to DDGTNB except for the major change in the split pattern and the coupling constant for H-3' (δ _H 3.90, ddd, J =12.0, 9.0, 5.0 Hz). Coupling constant J _{3' ,2' ax} = 12.0 Hz and J _{3' ,4'} = 9.0 Hz mean that the H-3' proton is located in the longitudinal direction while the 3'-OH is located in the transverse direction. Therefore, unlike digitoxose in DDGTNB, the sugar moiety was identified as oligoose. The configuration of the sugar was determined as L-oliboose through the coupling constant of the anomeric proton ( J = 3 Hz) and the NOE cross peak (FIG. 5).

The ¹ H NMR spectrum of LDGTNB was similar to DDGTNB except for a slight difference in the chemical shift of the sugar moiety. The most notable difference is the anomeric proton signal (δ _H 5.03, brs, J _{1' ,2'} = 3 Hz), which, unlike in DDGTNB (δ _H 4.84, J _{1' , 2'} = 9.5 Hz), is the longitudinal direction Means the presence of a glycosidic linkage. 1D and 2D NMR data supported the structure of LDGTNB. In addition, ¹ H NMR spectrum is through the coupling constant ( J _{3' , 4'} = 3.0 Hz and J _{4' , 5'} = 10.0 Hz), H-3' in the horizontal direction and H-4' in the vertical direction, and H-5' was identified, and it was identified as a digitoxose sugar. In the NOESY spectrum, instead of the NOE correlation between H-1' and H-5' observed in DDGTNB, H-2'ax (δ _H 1.91, dt, J = 15.0, 3.5 Hz) and H-4' ( δ _H 3.15, dd, J = 10.0, 3.0 Hz) A correlation between protons was observed (Fig. 5). Therefore, as measured by the HMBC cross peak from H-1' to C-5, the sugar was identified as L-digitoxose attached _{to C-5 (δ C 78.5).} The data fit well with the data reported for L-digitoxose.

Narbomycin and LRHMNB were identified through HPLC-ESI-MS and 1D ( ¹ H and ¹³ C) and 2D (COSY, HMBC, HSQC, and NOESY) NMR data. In the compound, the configuration and conformation of sugars were determined through the coupling constant and the NOE cross peak.

Isolation of clinical strains and measurement of antibacterial agent

Erythromycin-resistant strain E. faecium P00558 and S. aureus P00740 was isolated from the tertiary university hospital in Daegu, Korea. The isolates were treated using a MicroScan WalkAway 96 system (Dade Behring, West Sacramento, CA) to identify genus and species and measure antimicrobial susceptibility. Antimicrobial agents using MicroScan Gram-positive MIC/combo (PC1A) panel (Dade Behring), Gram-negative MIC/combo (NC44) panel (Dade Behring), and Gram-negative breakpoint combo (NBC39) panel (Dade Behring) Sensitivity and species levels of E. paesium and S. aureus were identified, respectively. The inoculum suspension for testing was processed on the same day using the same clean 18- to 24-hour-passage plate. The inoculum was standardized using Prompt Inoculation System-D (Dade Behring) for the microdilution antimicrobial susceptibility test. All antimicrobial susceptibility tests were performed according to the latest Clinical and Laboratory Standards Institute method. Quality control is S. aureus It was observed using ATCC 25923.

Antibacterial activity Assay

Erythromycin-sensitive strain E. faecium ATCC 19434 and S. aureus ATCC 25923, and erythromycin-resistant strains E. par when Titanium P00558 and S. aureus Using P00740, the antibacterial activity of narbomycin and its derivatives containing neutral deoxysaccharides was measured. Erythromycin was used as a control. Bacterial cells (2 x 10 ⁷ /ml) were inoculated into LB or Mueller-Hinton medium and divided into 96-well microtiter plates by 0.1 ml/well. MIC was measured using serial 2-fold dilutions of antibiotics according to the National Committee for Clinical Laboratory Standards. After 24 hours of inoculation at 37° C., the minimum antibiotic concentration that interferes with the growth of the test subject was determined as MIC. Growth was assayed by observing the absorbance at 620 nm using a microtiter ELISA Reader (Molecular Devices Emax, CA). The results are shown in Table 11 below.

matter
MIC (μM) ATCC
19434 P00558 ATCC
25923 P00740 Narbomycin 10 10 10 20 DQNVNB 10 10 10 <10 LRHMNB 2.5 2.5 <2.5 1.25 ODDCNB 5 5 2.5 5 DBVNNB <10 10 10 20 DDGTNB 10 <20 <20 20 LOLVNB 10 20 5 10 LDGTNB 10 20 10 20 Erythromycin 10 >20 10 >40

Narbomycin including D-desosamine showed antibacterial activity similar to erythromycin (10 μM) against erythromycin-sensitive strains. On the other hand, for the erythromycin-resistant strain, higher activity (10-20 μM) than erythromycin (> 20 μM) was observed. DQNVNB is helpful when par E. ATCC 19434, E. paella City Stadium P00558, and S. aureus Did not show improved activity against ATCC 25923, but S. aureus It was more effective than narbomycin in inhibiting the growth of P00740. LOLVNB is S. aureus It showed selective activity against ATCC 25923. In this experimental example, LRHMNB showed strong activity (1.25-2.50 μM). ODDCNB also showed significant activity (2.5-5.0 μM) against all strains. As a result of comparing the in vitro antimicrobial activity of LRHMNB (1.25-2.50 μM) with that of LOLVNB (5-20 μM), the structure-activity information of the 2'-hydroxyl group of LRHMNB was confirmed, which is the most important antimicrobial activity. It can be a determining factor. The antimicrobial activity of ODDCNB (2.5-5.0 μM) was superior to narbomycin (10-20 μM) and DQNVNB (≦ 10 μM). This confirmed that the replacement of the 3'-dimethylamino group of narbomycin with the 3'-hydroxyl group and the absence of the 4'-hydroxyl group in DQNVNB improved the antibacterial activity of ODDCNB. S. aureus Comparison of the MIC of LOLVNB (5-10 μM) and LDGTNB (10-20 μM) against ATCC 25923 and P00740 showed that the 3'-equatorial-hydroxyl group of LOLVNB positively affects the antimicrobial activity. Means that. DBVNNB (≤ 10 μM) is helpful when par E. ATCC 19434, P00558, and S. aureus It showed higher antimicrobial activity against ATCC 25923 than DDGTNB (< 20 μM), which means that the 4'-axial-hydroxyl group of DBVNNB reduces MIC.

Korea Microorganism Conservation Center (domestic) KFCC11507P 20110310 Korea Microorganism Conservation Center (domestic) KFCC11508P 20110310

<110> Ewha University-Industry Collaboration Foundation <120> Novel narbomycin derivatives compounds, antibacterial composition comprising the same and manufacturing method of the same <130> PA110076/KR-DIV <160> 46 <170> KopatentIn 1.71 <210> 1 <211> 9715 <212> DNA <213> Artificial Sequence <220> <223> desVIII-desVII-desIII-desIV-desI-desII-desV-desVI <400> 1 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tcctggagac ccgcggcatc cactggatcc 180 acgccgcgaa cggcgacccg tacgccaccg tgctgcgcgg ccaggcggac gacccgtatc 240 ccgcgtacga gcgggtgcgt gcccgcggcg cgctctcctt cagcccgacg ggcagctggg 300 tcaccgccga tcacgccctg gcggcgagca tcctctgctc gacggacttc ggggtctccg 360 gcgccgacgg cgtcccggtg ccgcagcagg tcctctcgta cggggagggc tgtccgctgg 420 agcgcgagca ggtgctgccg gcggccggtg acgtgccgga gggcgggcag cgtgccgtgg 480 tcgaggggat ccaccgggag acgctggagg gtctcgcgcc ggacccgtcg gcgtcgtacg 540 ccttcgagct gctgggcggt ttcgtccgcc cggcggtgac ggccgctgcc gccgccgtgc 600 tgggtgttcc cgcggaccgg cgcgcggact tcgcggatct gctggagcgg ctccggccgc 660 tgtccgacag cctgctggcc ccgcagtccc tgcggacggt acgggcggcg gacggcgcgc 720 tggccgagct cacggcgctg ctcgccgatt cggacgactc ccccggggcc ctgctgtcgg 780 cgctcggggt caccgcagcc gtccagctca ccgggaacgc ggtgctcgcg ctcctcgcgc 840 atcccgagca gtggcgggag ctgtgcgacc ggcccgggct cgcggcggcc gcggtggagg 900 agaccctccg ctacgacccg ccggtgcagc tcgacgcccg ggtggtccgc ggggagacgg 960 agctggcggg ccggcggctg ccggccgggg cgcatgtcgt cgtcctgacc gccgcgaccg 1020 gccgggaccc ggaggtcttc acggacccgg agcgcttcga cctcgcgcgc cccgacgccg 1080 ccgcgcacct cgcgctgcac cccgccggtc cgtacggccc ggtggcgtcc ctggtccggc 1140 ttcaggcgga ggtcgcgctg cggaccctgg ccgggcgttt ccccgggctg cggcaggcgg 1200 gggacgtgct ccgcccccgc cgcgcgcctg tcggccgcgg gccgctgagc gtcccggtca 1260 gcagctcctg agacaccggg gccccggtcc gcccggcccc ccttcggacg gaccggacgg 1320 ctcggaccac ggggacggct cagaccgtcc cgtgtgtccc cgtccggctc ccgtccgccc 1380 catcccgccc ctccaccggc aaggaaggac acgacgccat gcgcgtcctg ctgacctcgt 1440 tcgcacatca cacgcactac tacggcctgg tgcccctggc ctgggcgctg ctcgccgccg 1500 ggcacgaggt gcgggtcgcc agccagcccg cgctcacgga caccatcacc gggtccgggc 1560 tcgccgcggt gccggtcggc accgaccacc tcatccacga gtaccgggtg cggatggcgg 1620 gcgagccgcg cccgaaccat ccggcgatcg ccttcgacga ggcccgtccc gagccgctgg 1680 actgggacca cgccctcggc atcgaggcga tcctcgcccc gtacttccat ctgctcgcca 1740 acaacgactc gatggtcgac gacctcgtcg acttcgcccg gtcctggcag ccggacctgg 1800 tgctgtggga gccgacgacc tacgcgggcg ccgtcgccgc ccaggtcacc ggtgccgcgc 1860 acgcccgggt cctgtggggg cccgacgtga tgggcagcgc ccgccgcaag ttcgtcgcgc 1920 tgcgggaccg gcagccgccc gagcaccgcg aggaccccac cgcggagtgg ctgacgtgga 1980 cgctcgaccg gtacggcgcc tccttcgaag aggagctgct caccggccag ttcacgatcg 2040 acccgacccc gccgagcctg cgcctcgaca cgggcctgcc gaccgtcggg atgcgttatg 2100 ttccgtacaa cggcacgtcg gtcgtgccgg actggctgag tgagccgccc gcgcggcccc 2160 gggtctgcct gaccctcggc gtctccgcgc gtgaggtcct cggcggcgac ggcgtctcgc 2220 agggcgacat cctggaggcg ctcgccgacc tcgacatcga gctcgtcgcc acgctcgacg 2280 cgagtcagcg cgccgagatc cgcaactacc cgaagcacac ccggttcacg gacttcgtgc 2340 cgatgcacgc gctcctgccg agctgctcgg cgatcatcca ccacggcggg gcgggcacct 2400 acgcgaccgc cgtgatcaac gcggtgccgc aggtcatgct cgccgagctg tgggacgcgc 2460 cggtcaaggc gcgggccgtc gccgagcagg gggcggggtt cttcctgccg ccggccgagc 2520 tcacgccgca ggccgtgcgg gacgccgtcg tccgcatcct cgacgacccc tcggtcgcca 2580 ccgccgcgca ccggctgcgc gaggagacct tcggcgaccc caccccggcc gggatcgtcc 2640 ccgagctgga gcggctcgcc gcgcagcacc gccgcccgcc ggccgacgcc cggcactgag 2700 ccgcacccct cgccccaggc ctcacccctg tatctcatat gtctagttaa ctcgccacgc 2760 cgaccgttat caccggcgcc ctgctgctag tttccgagaa tgaagggaat agtcctggcc 2820 ggcgggagcg gaactcggct gcatccggcg acctcggtca tttcgaagca gattcttccg 2880 gtctacaaca aaccgatgat ctactatccg ctgtcggttc tcatgctcgg cggtattcgc 2940 gagattcaaa tcatctcgac cccccagcac atcgaactct tccagtcgct tctcggaaac 3000 ggcaggcacc tgggaataga actcgactat gcggtccaga aagagcccgc aggaatcgcg 3060 gacgcacttc tcgtcggagc cgagcacatc ggcgacgaca cctgcgccct gatcctgggc 3120 gacaacatct tccacgggcc cggcctctac acgctcctgc gggacagcat cgcgcgcctc 3180 gacggctgcg tgctcttcgg ctacccggtc aaggaccccg agcggtacgg cgtcgccgag 3240 gtggacgcga cgggccggct gaccgacctc gtcgagaagc ccgtcaagcc gcgctccaac 3300 ctcgccgtca ccggcctcta cctctacgac aacgacgtcg tcgacatcgc caagaacatc 3360 cggccctcgc cgcgcggcga gctggagatc accgacgtca accgcgtcta cctggagcgg 3420 ggccgggccg aactcgtcaa cctgggccgc ggcttcgcct ggctggacac cggcacccac 3480 gactcgctcc tgcgggccgc ccagtacgtc caggtcctgg aggagcggca gggcgtctgg 3540 atcgcgggcc ttgaggagat cgccttccgc atgggcttca tcgacgccga ggcctgtcac 3600 ggcctgggag aaggcctctc ccgcaccgag tacggcagct atctgatgga gatcgccggc 3660 cgcgagggag ccccgtgagg gcacctcgcg gccgacgcgt tcccacgacc gacagcgcca 3720 ccgacagtgc gacccacacc gcgacccgca ccgccaccga cagtgcgacc cacaccgcga 3780 cctacagcgc gaccgaaagg aagacggcag tgcggcttct ggtgaccgga ggtgcgggct 3840 tcatcggctc gcacttcgtg cggcagctcc tcgccggggc gtaccccgac gtgcccgccg 3900 atgaggtgat cgtcctggac agcctcacct acgcgggcaa ccgcgccaac ctcgccccgg 3960 tggacgcgga cccgcgactg cgcttcgtcc acggcgacat ccgcgacgcc ggcctcctcg 4020 cccgggaact gcgcggcgtg gacgccatcg tccacttcgc ggccgagagc cacgtggacc 4080 gctccatcgc gggcgcgtcc gtgttcaccg agaccaacgt gcagggcacg cagacgctgc 4140 tccagtgcgc cgtcgacgcc ggcgtcggcc gggtcgtgca cgtctccacc gacgaggtgt 4200 acgggtcgat cgactccggc tcctggaccg agagcagccc gctggagccc aactcgccct 4260 acgcggcgtc caaggccggc tccgacctcg ttgcccgcgc ctaccaccgg acgtacggcc 4320 tcgacgtacg gatcacccgc tgctgcaaca actacgggcc gtaccagcac cccgagaagc 4380 tcatccccct cttcgtgacg aacctcctcg acggcgggac gctcccgctg tacggcgacg 4440 gcgcgaacgt ccgcgagtgg gtgcacaccg acgaccactg ccggggcatc gcgctcgtcc 4500 tcgcgggcgg ccgggccggc gagatctacc acatcggcgg cggcctggag ctgaccaacc 4560 gcgaactcac cggcatcctc ctggactcgc tcggcgccga ctggtcctcg gtccggaagg 4620 tcgccgaccg caagggccac gacctgcgct actccctcga cggcggcgag atcgagcgcg 4680 agctcggcta ccgcccgcag gtctccttcg cggacggcct cgcgcggacc gtccgctggt 4740 accgggagaa ccgcggctgg tgggagccgc tcaaggcgac cgccccgcag ctgcccgcca 4800 ccgccgtgga ggtgtccgcg tgagcagccg cgccgagacc ccccgcgtcc ccttcctcga 4860 cctcaaggcc gcctacgagg agctctctag tgctagcgac ggtggcccgg agggaacatc 4920 cgtgaaaagc gccttatccg acctcgcatt cttcggcggc cccgccgctt tcgaccagcc 4980 gctcctcgtg gggcggccca accgcatcga ccgcgccagg ctgtacgagc ggctcgaccg 5040 ggccctcgac agccagtggc tgtccaacgg cggcccgctc gtccgcgagt tcgaggagcg 5100 cgtcgccggg ctcgccgggg tccggcatgc cgtggccacc tgcaacgcca cggccgggct 5160 ccagctcctc gcgcacgccg ccggcctcac cggcgaagtg atcatgccgt cgatgacgtt 5220 cgccgccacc ccgcacgcac tgcgctggat cggcctcacc ccggtcttcg ccgacatcga 5280 cccggacacc ggcaacctcg acccggacca ggtggccgcc gcggtcacac cccgcacctc 5340 ggccgtcgtc ggcgtccacc tctggggccg cccctgcgcc gccgaccagc tgcggaaggt 5400 cgccgacgag cacggcctgc ggctgtactt cgacgccgcg cacgccctcg gctgcgcggt 5460 cgacggccgg cccgccggca gcctcggcga cgccgaggtc ttcagcttcc acgccaccaa 5520 ggccgtcaac gccttcgagg gcggcgccgt cgtcaccgac gacgccgacc tcgccgcccg 5580 gatccgcgcc ctccacaact tcggcttcga cctgcccggc ggcagccccg ccggcgggac 5640 caacgccaag atgagcgagg ccgccgccgc catgggcctc acctccctcg acgcgtttcc 5700 cgaggtcatc gaccggaacc ggcgcaacca cgccgcctac cgcgagcacc tcgcggacct 5760 ccccggcgtc ctcgtcgccg accacgaccg ccacggcctc aacaaccacc agtacgtgat 5820 cgtcgagatc gacgaggcca ccaccggcat ccaccgcgac ctcgtcatgg aggtcctgaa 5880 ggccgaaggc gtgcacaccc gcgcctactt ctcgccgggc tgccacgagc tggagccgta 5940 ccgcgggcag ccgcacgccc cgctgccgca caccgaacgc ctcgccgcgc gcgtgctgtc 6000 cctgccgacc ggcaccgcca tcggcgacga cgacatccgc cgggtcgccg acctgctgcg 6060 tctctgcgcg acccgcggcc gcgaactgac cgcgcgccac cgcgacacgg cccccgcccc 6120 gctcgcggcc ccccagacat ccacgcccac gattggacgc tcccgatgac cgcccccgcc 6180 ctttccgcca ccgccccggc cgaacgctgc gcgcaccccg gagccgatct gggggcggcg 6240 gtccacgccg tcggccagac cctcgccgcc ggcggcctcg tgccgcccga cgaggccgga 6300 acgaccgccc gccacctcgt ccggctcgcc gtgcgctacg gcaacagccc cttcaccccg 6360 ctggaggagg cccgccacga cctgggcgtc gaccgggacg ccttccggcg cctcctcgcc 6420 ctgttcgggc aggtcccgga gctccgcacc gcggtcgaga ccggccccgc cggggcgtac 6480 tggaagaaca ccctgctccc gctcgaacag cgcggcgtct tcgacgcggc gctcgccagg 6540 aagcccgtct tcccgtacag cgtcggcctc taccccggcc cgacctgcat gttccgctgc 6600 cacttctgcg tccgtgtgac cggcgcccgc tacgacccgt ccgccctcga cgccggcaac 6660 gccatgttcc ggtcggtcat cgacgagata cccgcgggca acccctcggc gatgtacttc 6720 tccggcggcc tggagccgct caccaacccc ggcctcggga gcctggccgc gcacgccacc 6780 gaccacggcc tgcggcccac cgtctacacg aactccttcg cgctcaccga gcgcaccctg 6840 gagcgccagc ccggcctctg gggcctgcac gccatccgca cctcgctcta cggcctcaac 6900 gacgaggagt acgagcagac caccggcaag aaggccgcct tccgccgcgt ccgcgagaac 6960 ctgcgccgct tccagcagct gcgcgccgag cgcgagtcgc cgatcaacct cggcttcgcc 7020 tacatcgtgc tcccgggccg tgcctcccgc ctgctcgacc tggtcgactt catcgccgac 7080 ctcaacgacg ccgggcaggg caggacgatc gacttcgtca acattcgcga ggactacagc 7140 ggccgtgacg acggcaagct gccgcaggag gagcgggccg agctccagga ggccctcaac 7200 gccttcgagg agcgggtccg cgagcgcacc cccggactcc acatcgacta cggctacgcc 7260 ctgaacagcc tgcgcaccgg ggccgacgcc gaactgctgc ggatcaagcc cgccaccatg 7320 cggcccaccg cgcacccgca ggtcgcggtg caggtcgatc tcctcggcga cgtgtacctg 7380 taccgcgagg ccggcttccc cgacctggac ggcgcgaccc gctacatcgc gggccgcgtg 7440 acccccgaca cctccctcac cgaggtcgtc agggacttcg tcgagcgcgg cggcgaggtg 7500 gcggccgtcg acggcgacga gtacttcatg gacggcttcg atcaggtcgt caccgcccgc 7560 ctgaaccagc tggagcgcga cgccgcggac ggctgggagg aggcccgcgg cttcctgcgc 7620 tgacccgcat ctagtcaggt ctccttcgcg gacggcctcg cgcggaccgt ccgctggtac 7680 cgggagaacc gcggctggtg ggagccgctc aaggcgaccg ccccgcagct gcccgccacc 7740 gccgtggagg tgtccgcgtg agcagccgcg ccgagacccc ccgcgtcccc ttcctcgacc 7800 tcaaggccgc ctacgaggag ctccgcgcgg agaccgacgc cgcgatcgcc cgcgtcctcg 7860 actcggggcg ctacctcctc ggacccgaac tcgaaggatt cgaggcggag ttcgccgcgt 7920 actgcgagac ggaccacgcc gtcggcgtga acagcgggat ggacgccctc cagctcgccc 7980 tccgcggcct cggcatcgga cccggggacg aggtgatcgt cccctcgcac acgtacatcg 8040 ccagctggct cgcggtgtcc gccaccggcg cgacccccgt gcccgtcgag ccgcacgagg 8100 accaccccac cctggacccg ctgctcgtcg agaaggcgat caccccccgc acccgggcgc 8160 tcctccccgt ccacctctac gggcaccccg ccgacatgga cgccctccgc gagctcgcgg 8220 accggcacgg cctgcacatc gtcgaggacg ccgcgcaggc ccacggcgcc cgctaccggg 8280 gccggcggat cggcgccggg tcgtcggtgg ccgcgttcag cttctacccg ggcaagaacc 8340 tcggctgctt cggcgacggc ggcgccgtcg tcaccggcga ccccgagctc gccgaacggc 8400 tccggatgct ccgcaactac ggctcgcggc agaagtacag ccacgagacg aagggcacca 8460 actcccgcct ggacgagatg caggccgccg tgctgcggat ccggctcgcc cacctggaca 8520 gctggaacgg ccgcaggtcg gcgctggccg cggagtacct ctccgggctc gccggactgc 8580 ccggcatcgg cctgccggtg accgcgcccg acaccgaccc ggtctggcac ctcttcaccg 8640 tgcgcaccga gcgccgcgac gagctgcgca gccacctcga cgcccgcggc atcgacaccc 8700 tcacgcacta cccggtaccc gtgcacctct cgcccgccta cgcgggcgag gcaccgccgg 8760 aaggctcgct cccgcgggcc gagagcttcg cgcggcaggt cctcagcctg ccgatcggcc 8820 cgcacctgga gcgcccgcag gcgctgcggg tgatcgacgc cgtgcgcgaa tgggccgagc 8880 gggtcgacca ggcctagtca ggttctagtc aattgcccca ggcctcaccc ctgtatctgc 8940 gccgggggac gcccccggcc caccctccga aagaccgaaa gcaggagcac cgtgtacgaa 9000 gtcgaccacg ccgacgtcta cgacctcttc tacctgggtc gcggcaagga ctacgccgcc 9060 gaggcctccg acatcgccga cctggtgcgc tcccgtaccc ccgaggcctc ctcgctcctg 9120 gacgtggcct gcggtacggg cacgcatctg gagcacttca ccaaggagtt cggcgacacc 9180 gccggcctgg agctgtccga ggacatgctc acccacgccc gcaagcggct gcccgacgcc 9240 acgctccacc agggcgacat gcgggacttc cggctcggcc ggaagttctc cgccgtggtc 9300 agcatgttca gctccgtcgg ctacctgaag acgaccgagg aactcggcgc ggccgtcgcc 9360 tcgttcgcgg agcacctgga gcccggtggc gtcgtcgtcg tcgagccgtg gtggttcccg 9420 gagaccttcg ccgacggctg ggtcagcgcc gacgtcgtcc gccgtgacgg gcgcaccgtg 9480 gcccgtgtct cgcactcggt gcgggagggg aacgcgacgc gcatggaggt ccacttcacc 9540 gtggccgacc cgggcaaggg cgtgcggcac ttctccgacg tccatctcat caccctgttc 9600 caccaggccg agtacgaggc cgcgttcacg gccgccgggc tgcgcgtcga gtacctggag 9660 ggcggcccgt cgggccgtgg cctcttcgtc ggcgtccccg cctgagtcta gaccc 9715 <210> 2 <211> 292 <212> PRT <213> Artificial Sequence <220> <223> DesIII protein <400> 2 Met Lys Gly Ile Val Leu Ala Gly Gly Ser Gly Thr Arg Leu His Pro 1 5 10 15 Ala Thr Ser Val Ile Ser Lys Gln Ile Leu Pro Val Tyr Asn Lys Pro 20 25 30 Met Ile Tyr Tyr Pro Leu Ser Val Leu Met Leu Gly Gly Ile Arg Glu 35 40 45 Ile Gln Ile Ile Ser Thr Pro Gln His Ile Glu Leu Phe Gln Ser Leu 50 55 60 Leu Gly Asn Gly Arg His Leu Gly Ile Glu Leu Asp Tyr Ala Val Gln 65 70 75 80 Lys Glu Pro Ala Gly Ile Ala Asp Ala Leu Leu Val Gly Ala Glu His 85 90 95 Ile Gly Asp Asp Thr Cys Ala Leu Ile Leu Gly Asp Asn Ile Phe His 100 105 110 Gly Pro Gly Leu Tyr Thr Leu Leu Arg Asp Ser Ile Ala Arg Leu Asp 115 120 125 Gly Cys Val Leu Phe Gly Tyr Pro Val Lys Asp Pro Glu Arg Tyr Gly 130 135 140 Val Ala Glu Val Asp Ala Thr Gly Arg Leu Thr Asp Leu Val Glu Lys 145 150 155 160 Pro Val Lys Pro Arg Ser Asn Leu Ala Val Thr Gly Leu Tyr Leu Tyr 165 170 175 Asp Asn Asp Val Val Asp Ile Ala Lys Asn Ile Arg Pro Ser Pro Arg 180 185 190 Gly Glu Leu Glu Ile Thr Asp Val Asn Arg Val Tyr Leu Glu Arg Gly 195 200 205 Arg Ala Glu Leu Val Asn Leu Gly Arg Gly Phe Ala Trp Leu Asp Thr 210 215 220 Gly Thr His Asp Ser Leu Leu Arg Ala Ala Gln Tyr Val Gln Val Leu 225 230 235 240 Glu Glu Arg Gln Gly Val Trp Ile Ala Gly Leu Glu Glu Ile Ala Phe 245 250 255 Arg Met Gly Phe Ile Asp Ala Glu Ala Cys His Gly Leu Gly Glu Gly 260 265 270 Leu Ser Arg Thr Glu Tyr Gly Ser Tyr Leu Met Glu Ile Ala Gly Arg 275 280 285 Glu Gly Ala Pro 290 <210> 3 <211> 337 <212> PRT <213> Artificial Sequence <220> <223> DesIV protein <400> 3 Met Arg Leu Leu Val Thr Gly Gly Ala Gly Phe Ile Gly Ser His Phe 1 5 10 15 Val Arg Gln Leu Leu Ala Gly Ala Tyr Pro Asp Val Pro Ala Asp Glu 20 25 30 Val Ile Val Leu Asp Ser Leu Thr Tyr Ala Gly Asn Arg Ala Asn Leu 35 40 45 Ala Pro Val Asp Ala Asp Pro Arg Leu Arg Phe Val His Gly Asp Ile 50 55 60 Arg Asp Ala Gly Leu Leu Ala Arg Glu Leu Arg Gly Val Asp Ala Ile 65 70 75 80 Val His Phe Ala Ala Glu Ser His Val Asp Arg Ser Ile Ala Gly Ala 85 90 95 Ser Val Phe Thr Glu Thr Asn Val Gln Gly Thr Gln Thr Leu Leu Gln 100 105 110 Cys Ala Val Asp Ala Gly Val Gly Arg Val Val His Val Ser Thr Asp 115 120 125 Glu Val Tyr Gly Ser Ile Asp Ser Gly Ser Trp Thr Glu Ser Ser Pro 130 135 140 Leu Glu Pro Asn Ser Pro Tyr Ala Ala Ser Lys Ala Gly Ser Asp Leu 145 150 155 160 Val Ala Arg Ala Tyr His Arg Thr Tyr Gly Leu Asp Val Arg Ile Thr 165 170 175 Arg Cys Cys Asn Asn Tyr Gly Pro Tyr Gln His Pro Glu Lys Leu Ile 180 185 190 Pro Leu Phe Val Thr Asn Leu Leu Asp Gly Gly Thr Leu Pro Leu Tyr 195 200 205 Gly Asp Gly Ala Asn Val Arg Glu Trp Val His Thr Asp Asp His Cys 210 215 220 Arg Gly Ile Ala Leu Val Leu Ala Gly Gly Arg Ala Gly Glu Ile Tyr 225 230 235 240 His Ile Gly Gly Gly Leu Glu Leu Thr Asn Arg Glu Leu Thr Gly Ile 245 250 255 Leu Leu Asp Ser Leu Gly Ala Asp Trp Ser Ser Val Arg Lys Val Ala 260 265 270 Asp Arg Lys Gly His Asp Leu Arg Tyr Ser Leu Asp Gly Gly Glu Ile 275 280 285 Glu Arg Glu Leu Gly Tyr Arg Pro Gln Val Ser Phe Ala Asp Gly Leu 290 295 300 Ala Arg Thr Val Arg Trp Tyr Arg Glu Asn Arg Gly Trp Trp Glu Pro 305 310 315 320 Leu Lys Ala Thr Ala Pro Gln Leu Pro Ala Thr Ala Val Glu Val Ser 325 330 335 Ala <210> 4 <211> 415 <212> PRT <213> Artificial Sequence <220> <223> DesI protein <400> 4 Met Lys Ser Ala Leu Ser Asp Leu Ala Phe Phe Gly Gly Pro Ala Ala 1 5 10 15 Phe Asp Gln Pro Leu Leu Val Gly Arg Pro Asn Arg Ile Asp Arg Ala 20 25 30 Arg Leu Tyr Glu Arg Leu Asp Arg Ala Leu Asp Ser Gln Trp Leu Ser 35 40 45 Asn Gly Gly Pro Leu Val Arg Glu Phe Glu Glu Arg Val Ala Gly Leu 50 55 60 Ala Gly Val Arg His Ala Val Ala Thr Cys Asn Ala Thr Ala Gly Leu 65 70 75 80 Gln Leu Leu Ala His Ala Ala Gly Leu Thr Gly Glu Val Ile Met Pro 85 90 95 Ser Met Thr Phe Ala Ala Thr Pro His Ala Leu Arg Trp Ile Gly Leu 100 105 110 Thr Pro Val Phe Ala Asp Ile Asp Pro Asp Thr Gly Asn Leu Asp Pro 115 120 125 Asp Gln Val Ala Ala Ala Val Thr Pro Arg Thr Ser Ala Val Val Gly 130 135 140 Val His Leu Trp Gly Arg Pro Cys Ala Ala Asp Gln Leu Arg Lys Val 145 150 155 160 Ala Asp Glu His Gly Leu Arg Leu Tyr Phe Asp Ala Ala His Ala Leu 165 170 175 Gly Cys Ala Val Asp Gly Arg Pro Ala Gly Ser Leu Gly Asp Ala Glu 180 185 190 Val Phe Ser Phe His Ala Thr Lys Ala Val Asn Ala Phe Glu Gly Gly 195 200 205 Ala Val Val Thr Asp Asp Ala Asp Leu Ala Ala Arg Ile Arg Ala Leu 210 215 220 His Asn Phe Gly Phe Asp Leu Pro Gly Gly Ser Pro Ala Gly Gly Thr 225 230 235 240 Asn Ala Lys Met Ser Glu Ala Ala Ala Ala Met Gly Leu Thr Ser Leu 245 250 255 Asp Ala Phe Pro Glu Val Ile Asp Arg Asn Arg Arg Asn His Ala Ala 260 265 270 Tyr Arg Glu His Leu Ala Asp Leu Pro Gly Val Leu Val Ala Asp His 275 280 285 Asp Arg His Gly Leu Asn Asn His Gln Tyr Val Ile Val Glu Ile Asp 290 295 300 Glu Ala Thr Thr Gly Ile His Arg Asp Leu Val Met Glu Val Leu Lys 305 310 315 320 Ala Glu Gly Val His Thr Arg Ala Tyr Phe Ser Pro Gly Cys His Glu 325 330 335 Leu Glu Pro Tyr Arg Gly Gln Pro His Ala Pro Leu Pro His Thr Glu 340 345 350 Arg Leu Ala Ala Arg Val Leu Ser Leu Pro Thr Gly Thr Ala Ile Gly 355 360 365 Asp Asp Asp Ile Arg Arg Val Ala Asp Leu Leu Arg Leu Cys Ala Thr 370 375 380 Arg Gly Arg Glu Leu Thr Ala Arg His Arg Asp Thr Ala Pro Ala Pro 385 390 395 400 Leu Ala Ala Pro Gln Thr Ser Thr Pro Thr Ile Gly Arg Ser Arg 405 410 415 <210> 5 <211> 485 <212> PRT <213> Artificial Sequence <220> <223> DesII protein <400> 5 Met Thr Ala Pro Ala Leu Ser Ala Thr Ala Pro Ala Glu Arg Cys Ala 1 5 10 15 His Pro Gly Ala Asp Leu Gly Ala Ala Val His Ala Val Gly Gln Thr 20 25 30 Leu Ala Ala Gly Gly Leu Val Pro Pro Asp Glu Ala Gly Thr Thr Ala 35 40 45 Arg His Leu Val Arg Leu Ala Val Arg Tyr Gly Asn Ser Pro Phe Thr 50 55 60 Pro Leu Glu Glu Ala Arg His Asp Leu Gly Val Asp Arg Asp Ala Phe 65 70 75 80 Arg Arg Leu Leu Ala Leu Phe Gly Gln Val Pro Glu Leu Arg Thr Ala 85 90 95 Val Glu Thr Gly Pro Ala Gly Ala Tyr Trp Lys Asn Thr Leu Leu Pro 100 105 110 Leu Glu Gln Arg Gly Val Phe Asp Ala Ala Leu Ala Arg Lys Pro Val 115 120 125 Phe Pro Tyr Ser Val Gly Leu Tyr Pro Gly Pro Thr Cys Met Phe Arg 130 135 140 Cys His Phe Cys Val Arg Val Thr Gly Ala Arg Tyr Asp Pro Ser Ala 145 150 155 160 Leu Asp Ala Gly Asn Ala Met Phe Arg Ser Val Ile Asp Glu Ile Pro 165 170 175 Ala Gly Asn Pro Ser Ala Met Tyr Phe Ser Gly Gly Leu Glu Pro Leu 180 185 190 Thr Asn Pro Gly Leu Gly Ser Leu Ala Ala His Ala Thr Asp His Gly 195 200 205 Leu Arg Pro Thr Val Tyr Thr Asn Ser Phe Ala Leu Thr Glu Arg Thr 210 215 220 Leu Glu Arg Gln Pro Gly Leu Trp Gly Leu His Ala Ile Arg Thr Ser 225 230 235 240 Leu Tyr Gly Leu Asn Asp Glu Glu Tyr Glu Gln Thr Thr Gly Lys Lys 245 250 255 Ala Ala Phe Arg Arg Val Arg Glu Asn Leu Arg Arg Phe Gln Gln Leu 260 265 270 Arg Ala Glu Arg Glu Ser Pro Ile Asn Leu Gly Phe Ala Tyr Ile Val 275 280 285 Leu Pro Gly Arg Ala Ser Arg Leu Leu Asp Leu Val Asp Phe Ile Ala 290 295 300 Asp Leu Asn Asp Ala Gly Gln Gly Arg Thr Ile Asp Phe Val Asn Ile 305 310 315 320 Arg Glu Asp Tyr Ser Gly Arg Asp Asp Gly Lys Leu Pro Gln Glu Glu 325 330 335 Arg Ala Glu Leu Gln Glu Ala Leu Asn Ala Phe Glu Glu Arg Val Arg 340 345 350 Glu Arg Thr Pro Gly Leu His Ile Asp Tyr Gly Tyr Ala Leu Asn Ser 355 360 365 Leu Arg Thr Gly Ala Asp Ala Glu Leu Leu Arg Ile Lys Pro Ala Thr 370 375 380 Met Arg Pro Thr Ala His Pro Gln Val Ala Val Gln Val Asp Leu Leu 385 390 395 400 Gly Asp Val Tyr Leu Tyr Arg Glu Ala Gly Phe Pro Asp Leu Asp Gly 405 410 415 Ala Thr Arg Tyr Ile Ala Gly Arg Val Thr Pro Asp Thr Ser Leu Thr 420 425 430 Glu Val Val Arg Asp Phe Val Glu Arg Gly Gly Glu Val Ala Ala Val 435 440 445 Asp Gly Asp Glu Tyr Phe Met Asp Gly Phe Asp Gln Val Val Thr Ala 450 455 460 Arg Leu Asn Gln Leu Glu Arg Asp Ala Ala Asp Gly Trp Glu Glu Ala 465 470 475 480 Arg Gly Phe Leu Arg 485 <210> 6 <211> 379 <212> PRT <213> Artificial Sequence <220> <223> DesV protein <400> 6 Met Ser Ser Arg Ala Glu Thr Pro Arg Val Pro Phe Leu Asp Leu Lys 1 5 10 15 Ala Ala Tyr Glu Glu Leu Arg Ala Glu Thr Asp Ala Ala Ile Ala Arg 20 25 30 Val Leu Asp Ser Gly Arg Tyr Leu Leu Gly Pro Glu Leu Glu Gly Phe 35 40 45 Glu Ala Glu Phe Ala Ala Tyr Cys Glu Thr Asp His Ala Val Gly Val 50 55 60 Asn Ser Gly Met Asp Ala Leu Gln Leu Ala Leu Arg Gly Leu Gly Ile 65 70 75 80 Gly Pro Gly Asp Glu Val Ile Val Pro Ser His Thr Tyr Ile Ala Ser 85 90 95 Trp Leu Ala Val Ser Ala Thr Gly Ala Thr Pro Val Pro Val Glu Pro 100 105 110 His Glu Asp His Pro Thr Leu Asp Pro Leu Leu Val Glu Lys Ala Ile 115 120 125 Thr Pro Arg Thr Arg Ala Leu Leu Pro Val His Leu Tyr Gly His Pro 130 135 140 Ala Asp Met Asp Ala Leu Arg Glu Leu Ala Asp Arg His Gly Leu His 145 150 155 160 Ile Val Glu Asp Ala Ala Gln Ala His Gly Ala Arg Tyr Arg Gly Arg 165 170 175 Arg Ile Gly Ala Gly Ser Ser Val Ala Ala Phe Ser Phe Tyr Pro Gly 180 185 190 Lys Asn Leu Gly Cys Phe Gly Asp Gly Gly Ala Val Val Thr Gly Asp 195 200 205 Pro Glu Leu Ala Glu Arg Leu Arg Met Leu Arg Asn Tyr Gly Ser Arg 210 215 220 Gln Lys Tyr Ser His Glu Thr Lys Gly Thr Asn Ser Arg Leu Asp Glu 225 230 235 240 Met Gln Ala Ala Val Leu Arg Ile Arg Leu Ala His Leu Asp Ser Trp 245 250 255 Asn Gly Arg Arg Ser Ala Leu Ala Ala Glu Tyr Leu Ser Gly Leu Ala 260 265 270 Gly Leu Pro Gly Ile Gly Leu Pro Val Thr Ala Pro Asp Thr Asp Pro 275 280 285 Val Trp His Leu Phe Thr Val Arg Thr Glu Arg Arg Asp Glu Leu Arg 290 295 300 Ser His Leu Asp Ala Arg Gly Ile Asp Thr Leu Thr His Tyr Pro Val 305 310 315 320 Pro Val His Leu Ser Pro Ala Tyr Ala Gly Glu Ala Pro Pro Glu Gly 325 330 335 Ser Leu Pro Arg Ala Glu Ser Phe Ala Arg Gln Val Leu Ser Leu Pro 340 345 350 Ile Gly Pro His Leu Glu Arg Pro Gln Ala Leu Arg Val Ile Asp Ala 355 360 365 Val Arg Glu Trp Ala Glu Arg Val Asp Gln Ala 370 375 <210> 7 <211> 237 <212> PRT <213> Artificial Sequence <220> <223> DesVI protein <400> 7 Met Tyr Glu Val Asp His Ala Asp Val Tyr Asp Leu Phe Tyr Leu Gly 1 5 10 15 Arg Gly Lys Asp Tyr Ala Ala Glu Ala Ser Asp Ile Ala Asp Leu Val 20 25 30 Arg Ser Arg Thr Pro Glu Ala Ser Ser Leu Leu Asp Val Ala Cys Gly 35 40 45 Thr Gly Thr His Leu Glu His Phe Thr Lys Glu Phe Gly Asp Thr Ala 50 55 60 Gly Leu Glu Leu Ser Glu Asp Met Leu Thr His Ala Arg Lys Arg Leu 65 70 75 80 Pro Asp Ala Thr Leu His Gln Gly Asp Met Arg Asp Phe Arg Leu Gly 85 90 95 Arg Lys Phe Ser Ala Val Val Ser Met Phe Ser Ser Val Gly Tyr Leu 100 105 110 Lys Thr Thr Glu Glu Leu Gly Ala Ala Val Ala Ser Phe Ala Glu His 115 120 125 Leu Glu Pro Gly Gly Val Val Val Val Glu Pro Trp Trp Phe Pro Glu 130 135 140 Thr Phe Ala Asp Gly Trp Val Ser Ala Asp Val Val Arg Arg Asp Gly 145 150 155 160 Arg Thr Val Ala Arg Val Ser His Ser Val Arg Glu Gly Asn Ala Thr 165 170 175 Arg Met Glu Val His Phe Thr Val Ala Asp Pro Gly Lys Gly Val Arg 180 185 190 His Phe Ser Asp Val His Leu Ile Thr Leu Phe His Gln Ala Glu Tyr 195 200 205 Glu Ala Ala Phe Thr Ala Ala Gly Leu Arg Val Glu Tyr Leu Glu Gly 210 215 220 Gly Pro Ser Gly Arg Gly Leu Phe Val Gly Val Pro Ala 225 230 235 <210> 8 <211> 204 <212> PRT <213> Artificial Sequence <220> <223> OleL <400> 8 Met Glu Leu Leu Asp Val Asp Gly Ala Trp Leu Tyr Thr Pro Glu Ile 1 5 10 15 Met Arg Asp Glu Arg Gly Glu Phe Leu Glu Trp Phe Arg Gly Arg Thr 20 25 30 Phe Gln Glu Lys Ile Gly His Pro Leu Ser Leu Ala Gln Ala Asn Cys 35 40 45 Ser Val Ser Arg Lys Ala Phe Cys Ala Ala Ser Thr Ser Pro Thr Pro 50 55 60 Pro Pro Gly Gln Ala Lys Tyr Val Thr Cys Ala Ser Gly Thr Val Leu 65 70 75 80 Asp Val Val Val Asp Val Arg Arg Gly Ser Pro Thr Phe Gly Arg Trp 85 90 95 Ala Ala Val Arg Leu Asp Ala Ala Arg His Gln Gly Leu Tyr Leu Ala 100 105 110 Glu Gly Leu Gly His Ala Phe Met Ala Leu Thr Asp Asp Ala Thr Val 115 120 125 Val Tyr Leu Cys Ser Gln Pro Tyr Val Ala Glu Ala Glu Arg Ala Val 130 135 140 Asp Pro Leu Asp Pro Ala Ile Gly Ile Glu Trp Pro Thr Asp Ile Asp 145 150 155 160 Ile Val Pro Val Gly Glu Gly Thr Pro Thr His Arg Pro Trp Arg Arg 165 170 175 Pro Arg Arg Pro Gly Ile Leu Pro Asp Tyr Glu Gly Val Pro Gly Ala 180 185 190 Leu His Arg Gly Gly Gly Arg Arg Gly Thr Gly Pro 195 200 <210> 9 <211> 295 <212> PRT <213> Artificial Sequence <220> <223> OleU protein <400> 9 Met Arg Trp Leu Ile Thr Gly Ala Ala Gly Met Leu Gly Arg Glu Leu 1 5 10 15 Val Arg Arg Leu Ala Glu Asn Glu Glu Asp Val Ala Ala Leu Gly His 20 25 30 Asp His Leu Asp Val Thr Arg Pro Ser Ala Val Arg Ala Ala Leu Ala 35 40 45 Glu His Arg Pro Gly Ile Val Val Asn Cys Ala Ala Tyr Thr Ala Val 50 55 60 Asp Asp Ala Glu Thr Asp Glu Ala Ala Ala Ala Leu Leu Asn Ala Glu 65 70 75 80 Ala Pro Arg Leu Leu Ala Glu Gly Leu Arg Pro His Arg Arg His Gly 85 90 95 Leu Val His Leu Ser Thr Asp Tyr Val Phe Pro Gly Asp Ala Arg Thr 100 105 110 Pro Tyr Ala Glu Asp His Pro Thr Ala Pro Arg Ser Ala Tyr Gly Arg 115 120 125 Thr Lys Arg Asp Gly Glu Gln Ala Val Leu Thr Ala Leu Pro Thr Ala 130 135 140 Thr Val Leu Arg Thr Ala Trp Leu Tyr Gly Arg Thr Gly Arg Ser Phe 145 150 155 160 Val Arg Thr Met Ile Glu Arg Glu Ala Arg Gly Gly Ala Ile Asp Val 165 170 175 Val Ala Asp Gln Arg Gly Gln Pro Thr Trp Thr Gly Asp Leu Ala Asp 180 185 190 Arg Ile Ile Ala Val Gly Arg His Pro Gly Val His Gly Ile Leu His 195 200 205 Ala Thr Asn Ala Gly Ser Ala Thr Trp Tyr Asp Leu Ala Gln Glu Val 210 215 220 Phe Arg Leu Leu Asp Ala Asp Pro Gly Arg Val Arg Pro Thr Thr Gly 225 230 235 240 Ala Ala Phe Arg Arg Pro Ala Pro Arg Pro Ala Tyr Ser Val Leu Gly 245 250 255 His Asp Arg Trp Arg Gly Thr Gly Leu Ala Pro Leu Arg Asp Trp Arg 260 265 270 Ser Ala Leu Arg Glu Ala Phe Pro Asp Ile Leu Ala Ala Glu His Pro 275 280 285 Pro Thr Arg Arg Gly Ala Ala 290 295 <210> 10 <211> 474 <212> PRT <213> Artificial Sequence <220> <223> OleV protein <400> 10 Met Ile Trp Gly Ile Pro Ala Met Ser Glu Ala Met Gly Ser Val Pro 1 5 10 15 Thr Ala Gly Ser Glu Val Ser Ser Thr Cys Ala Phe Leu Ser Trp Leu 20 25 30 Asp Ala Arg Arg Arg Ala Asn Arg Leu Thr Val Glu His Val Pro Phe 35 40 45 Arg Glu Leu Ser Gly Trp Gln Phe Asp Glu Asn Thr Gly Asn Leu Arg 50 55 60 His Thr Ser Gly Arg Phe Phe Ser Ile Glu Gly Leu Arg Val Arg Thr 65 70 75 80 Asp His Cys Trp Phe Gly Ser Trp Thr Gln Pro Ile Ile Val Gln Pro 85 90 95 Glu Ile Gly Ile Leu Gly Leu Leu Val Lys Arg Phe Asp Gly Ile Leu 100 105 110 His Val Leu Val Gln Ala Lys Asn Glu Pro Gly Asn Ile Gly Gly Leu 115 120 125 Gln Leu Ser Pro Thr Val Gln Ala Thr Arg Ser Asn Tyr Thr Arg Val 130 135 140 His Arg Gly Gly Gly Val Arg Tyr Leu Glu Tyr Phe Ala Ser Pro Arg 145 150 155 160 Gly Arg Gly Arg Val Leu Ala Asp Val Leu Gln Ser Glu Gln Gly Ser 165 170 175 Trp Phe Leu His Lys Arg Asn Arg Asn Met Val Val Glu Ala Leu Asp 180 185 190 Asp Val Pro Leu Asp Asp Asp Phe His Trp Ile Ser Leu Gly Gly Leu 195 200 205 Arg Lys Leu Leu Leu Arg Pro His Leu Val Asn Met Asp Thr Arg Thr 210 215 220 Val Leu Ser Cys Leu Pro Pro Asp Pro Ala Pro Asp Gly Arg Gln Pro 225 230 235 240 Pro Ala Pro Ala Ala Pro Phe Ala Ala Ala Val Thr Arg Ser Leu Thr 245 250 255 Arg Gly Ala Thr Ala Leu His Thr Met Gly Glu Ile Leu Gly Trp Leu 260 265 270 Thr Asp Glu Arg Ser Arg Arg Glu Leu Val Gln Gln Arg Val Pro Leu 275 280 285 Glu Glu Thr Ala Phe Ser Gly Trp Arg Arg Asp Asp His Ala Ile Ala 290 295 300 His Lys Asp Gly Asp Tyr Phe Arg Val Ile Gly Val Ser Val Arg Ala 305 310 315 320 Ser Ser Arg Glu Val Ser Ser Trp Ser Gln Pro Leu Leu Ala Pro Val 325 330 335 Gly Pro Gly Leu Ala Ala Phe Val Thr Arg Arg Ile Arg Gly Val Leu 340 345 350 His Val Leu Leu His Ala Arg Thr Glu Ala Gly Leu Leu Asn Gly Pro 355 360 365 Glu Met Ala Pro Thr Val Gln Cys Arg Pro Leu Asn Tyr Arg Ala Val 370 375 380 Pro Ala Glu Tyr Arg Pro Ala Tyr Leu Asp Tyr Val Leu Ser Ala Asp 385 390 395 400 Pro Gly Arg Ile Arg Tyr Asp Thr Leu Gln Ser Glu Glu Gly Gly Arg 405 410 415 Phe His His Ala Glu Asn Arg Tyr Val Val Val Glu Ala Glu Asp Asp 420 425 430 Phe Pro Val Glu Val Pro Arg Asp Phe Arg Trp Leu Thr Leu His Gln 435 440 445 Ile Leu Ala Leu Leu His His Ser Asn Tyr Val Asn Val Glu Ala Arg 450 455 460 Ser Leu Val Ala Cys Ile Gln Ala Leu Ser 465 470 <210> 11 <211> 333 <212> PRT <213> Artificial Sequence <220> <223> EryBII protein <400> 11 Met Thr Thr Asp Ala Ala Thr His Val Arg Leu Gly Arg Ser Ala Leu 1 5 10 15 Leu Thr Ser Arg Leu Trp Leu Gly Thr Val Asn Phe Ser Gly Arg Val 20 25 30 Glu Asp Asp Asp Ala Leu Arg Leu Met Asp His Ala Arg Asp Arg Gly 35 40 45 Ile Asn Cys Leu Asp Thr Ala Asp Met Tyr Gly Trp Arg Leu Tyr Lys 50 55 60 Gly His Thr Glu Glu Leu Val Gly Arg Trp Leu Ala Gln Gly Gly Gly 65 70 75 80 Arg Arg Glu Asp Thr Val Leu Ala Thr Lys Val Gly Gly Glu Met Ser 85 90 95 Glu Arg Val Asn Asp Ser Gly Leu Ser Ala Arg His Ile Ile Ala Ser 100 105 110 Cys Glu Gly Ser Leu Arg Arg Leu Gly Val Asp His Ile Asp Val Tyr 115 120 125 Gln Met His His Ile Asp Arg Ser Ala Pro Trp Asp Glu Val Trp Gln 130 135 140 Ala Met Asp Ser Leu Val Ala Ser Gly Lys Val Ser Tyr Val Gly Ser 145 150 155 160 Ser Asn Phe Ala Gly Trp His Ile Ala Ala Ala Gln Glu Asn Ala Ala 165 170 175 Arg Arg His Ser Leu Gly Met Val Ser His Gln Cys Leu Tyr Asn Leu 180 185 190 Ala Val Arg His Ala Glu Leu Glu Val Leu Pro Ala Ala Gln Ala Tyr 195 200 205 Gly Leu Gly Val Phe Ala Trp Ser Pro Leu His Gly Gly Leu Leu Ser 210 215 220 Gly Ala Leu Glu Lys Leu Ala Ala Gly Thr Ala Val Lys Ser Ala Gln 225 230 235 240 Gly Arg Ala Gln Val Leu Leu Pro Ser Leu Arg Pro Ala Ile Glu Ala 245 250 255 Tyr Glu Lys Phe Cys Arg Asn Leu Gly Glu Asp Pro Ala Glu Val Gly 260 265 270 Leu Ala Trp Val Leu Ser Arg Pro Gly Ile Ala Gly Ala Val Ile Gly 275 280 285 Pro Arg Thr Pro Glu Gln Leu Asp Ser Ala Leu Lys Ala Ser Ala Met 290 295 300 Thr Leu Asp Glu Gln Ala Leu Ser Glu Leu Asp Glu Ile Phe Pro Ala 305 310 315 320 Val Ala Ser Gly Gly Ala Ala Pro Glu Ala Trp Leu Gln 325 330 <210> 12 <211> 247 <212> PRT <213> Artificial Sequence <220> <223> UrdR protein <400> 12 Met Asp Ile Val Gly Asn Gly Phe Leu Ala Arg Asn Leu Arg Pro Leu 1 5 10 15 Ala Glu Arg His Pro Asp Thr Val Ala Leu Ala Ala Gly Val Ser Trp 20 25 30 Ala Ser Gly Thr Ser Asp Ala Asp Phe Ala Arg Glu Ala Ala Leu Leu 35 40 45 Arg Asp Thr Ala Lys Gln Cys Ala Ala Thr Gly Arg Arg Leu Leu Phe 50 55 60 Phe Ser Thr Ala Ala Thr Gly Met Tyr Gly Leu Ala Glu Gly Pro Gly 65 70 75 80 Arg Glu Asp Thr Pro Val Thr Pro Cys Thr Pro Tyr Gly Ala His Lys 85 90 95 Leu Ala Leu Glu Glu Leu Leu Arg Asp Ser Gly Ala Asp His Val Ile 100 105 110 Leu Arg Leu Gly His Leu Val Gly Pro Asp Gln Pro Glu His Gln Leu 115 120 125 Leu Pro Thr Leu Val Arg His Leu Arg Glu Gly Ala Val Arg Ile His 130 135 140 Arg Gly Ala Ala Arg Asp Leu Ile Asp Val Ser Asp Val Val Thr Ile 145 150 155 160 Val Asp Cys Leu Leu Gly Leu Asp Leu Lys Ala Glu Thr Val Asn Val 165 170 175 Ala Ser Gly Tyr Ala Val Pro Val Lys Asp Ile Val Glu Leu Leu Arg 180 185 190 Arg Arg Leu Gly Val Glu Ala Arg Tyr Glu Phe Gln Asp Ala Gly Gly 195 200 205 Gln His Val Ile Ser Ile Glu Lys Leu Arg Ala Leu Val Pro Gln Val 210 215 220 Gln Asp Met Gly Phe Gly Pro Asp Tyr Tyr Arg Arg Ile Leu Ser Asp 225 230 235 240 Phe Thr Ser Ala Val Arg Ile 245 <210> 13 <211> 328 <212> PRT <213> Artificial Sequence <220> <223> OleW protein <400> 13 Met Pro Ser Pro Arg Leu Arg Phe Gly Val Leu Gly Ala Ala Asp Ile 1 5 10 15 Ala Leu Arg Arg Thr Val Pro Ala Leu Leu Ala His Pro Asp Val Thr 20 25 30 Val Val Ala Val Ser Ser Arg Asp Thr Ala Arg Ala Ala Arg Phe Ala 35 40 45 Ala Ala Phe Gly Cys Glu Ala Val Pro Gly His Gln Ala Leu Leu Asp 50 55 60 Arg Asp Asp Ile Asp Ala Leu Tyr Val Pro Leu Pro Val Met Val His 65 70 75 80 Thr Pro Trp Val Glu Ala Ala Leu Leu Arg Gly Arg His Val Leu Val 85 90 95 Glu Lys Pro Leu Thr Ala Thr Arg Ser Gly Ala Glu Asp Leu Ile Ala 100 105 110 Leu Ala Arg Ser Arg Gly Leu Val Leu Met Glu Asn Phe Thr Ser Leu 115 120 125 His His Ala Gln His Gly Thr Val Thr Asp Leu Leu Arg Asp Gly Thr 130 135 140 Ile Gly Glu Leu Arg Ser Leu Ser Ala Ala Phe Thr Ile Pro Pro Lys 145 150 155 160 Pro Glu Gly Asp Ile Arg Tyr Gln Pro Asp Val Gly Gly Gly Ala Leu 165 170 175 Leu Asp Ile Gly Ile Tyr Pro Leu Arg Ala Ala Leu His Phe Leu Gly 180 185 190 Pro Asp Leu His Ala Ala Gly Ala Val Leu Arg Arg Glu Arg Arg Arg 195 200 205 Asn Val Val Val Ser Gly His Val Leu Leu Thr Thr Pro His Gly Val 210 215 220 Val Ala Glu Leu Ala Phe Gly Met Glu His Ala Tyr Arg Ser Glu Tyr 225 230 235 240 Thr Leu Phe Gly Thr Ala Gly Arg Leu Arg Leu Asp Arg Ala Phe Thr 245 250 255 Pro Pro Glu Thr His Arg Pro Arg Val Glu Ile His Arg Gln Asp Ala 260 265 270 Leu Asp Ile Val Asp Leu Pro Pro Asp Ala Gln Phe Ala Asn Leu Val 275 280 285 Arg Asp Phe Val Leu Ala Val Arg Glu Gly Pro Gly Arg Leu Thr Gln 290 295 300 His His Ala Asp Ala Val Arg Gln Ala Asp Leu Val Glu Arg Val Met 305 310 315 320 Ala Val Ala Arg Val Arg Trp Cys 325 <210> 14 <211> 402 <212> PRT <213> Artificial Sequence <220> <223> DesVIII protein <400> 14 Met Thr Asp Asp Leu Thr Gly Ala Leu Thr Gln Pro Pro Leu Gly Arg 1 5 10 15 Thr Val Arg Ala Val Ala Asp Arg Glu Leu Gly Thr His Leu Leu Glu 20 25 30 Thr Arg Gly Ile His Trp Ile His Ala Ala Asn Gly Asp Pro Tyr Ala 35 40 45 Thr Val Leu Arg Gly Gln Ala Asp Asp Pro Tyr Pro Ala Tyr Glu Arg 50 55 60 Val Arg Ala Arg Gly Ala Leu Ser Phe Ser Pro Thr Gly Ser Trp Val 65 70 75 80 Thr Ala Asp His Ala Leu Ala Ala Ser Ile Leu Cys Ser Thr Asp Phe 85 90 95 Gly Val Ser Gly Ala Asp Gly Val Pro Val Pro Gln Gln Val Leu Ser 100 105 110 Tyr Gly Glu Gly Cys Pro Leu Glu Arg Glu Gln Val Leu Pro Ala Ala 115 120 125 Gly Asp Val Pro Glu Gly Gly Gln Arg Ala Val Val Glu Gly Ile His 130 135 140 Arg Glu Thr Leu Glu Gly Leu Ala Pro Asp Pro Ser Ala Ser Tyr Ala 145 150 155 160 Phe Glu Leu Leu Gly Gly Phe Val Arg Pro Ala Val Thr Ala Ala Ala 165 170 175 Ala Ala Val Leu Gly Val Pro Ala Asp Arg Arg Ala Asp Phe Ala Asp 180 185 190 Leu Leu Glu Arg Leu Arg Pro Leu Ser Asp Ser Leu Leu Ala Pro Gln 195 200 205 Ser Leu Arg Thr Val Arg Ala Ala Asp Gly Ala Leu Ala Glu Leu Thr 210 215 220 Ala Leu Leu Ala Asp Ser Asp Asp Ser Pro Gly Ala Leu Leu Ser Ala 225 230 235 240 Leu Gly Val Thr Ala Ala Val Gln Leu Thr Gly Asn Ala Val Leu Ala 245 250 255 Leu Leu Ala His Pro Glu Gln Trp Arg Glu Leu Cys Asp Arg Pro Gly 260 265 270 Leu Ala Ala Ala Ala Val Glu Glu Thr Leu Arg Tyr Asp Pro Pro Val 275 280 285 Gln Leu Asp Ala Arg Val Val Arg Gly Glu Thr Glu Leu Ala Gly Arg 290 295 300 Arg Leu Pro Ala Gly Ala His Val Val Val Leu Thr Ala Ala Thr Gly 305 310 315 320 Arg Asp Pro Glu Val Phe Thr Asp Pro Glu Arg Phe Asp Leu Ala Arg 325 330 335 Pro Asp Ala Ala Ala His Leu Ala Leu His Pro Ala Gly Pro Tyr Gly 340 345 350 Pro Val Ala Ser Leu Val Arg Leu Gln Ala Glu Val Ala Leu Arg Thr 355 360 365 Leu Ala Gly Arg Phe Pro Gly Leu Arg Gln Ala Gly Asp Val Leu Arg 370 375 380 Pro Arg Arg Ala Pro Val Gly Arg Gly Pro Leu Ser Val Pro Val Ser 385 390 395 400 Ser Ser <210> 15 <211> 426 <212> PRT <213> Artificial Sequence <220> <223> DesVII protein <400> 15 Met Arg Val Leu Leu Thr Ser Phe Ala His His Thr His Tyr Tyr Gly 1 5 10 15 Leu Val Pro Leu Ala Trp Ala Leu Leu Ala Ala Gly His Glu Val Arg 20 25 30 Val Ala Ser Gln Pro Ala Leu Thr Asp Thr Ile Thr Gly Ser Gly Leu 35 40 45 Ala Ala Val Pro Val Gly Thr Asp His Leu Ile His Glu Tyr Arg Val 50 55 60 Arg Met Ala Gly Glu Pro Arg Pro Asn His Pro Ala Ile Ala Phe Asp 65 70 75 80 Glu Ala Arg Pro Glu Pro Leu Asp Trp Asp His Ala Leu Gly Ile Glu 85 90 95 Ala Ile Leu Ala Pro Tyr Phe His Leu Leu Ala Asn Asn Asp Ser Met 100 105 110 Val Asp Asp Leu Val Asp Phe Ala Arg Ser Trp Gln Pro Asp Leu Val 115 120 125 Leu Trp Glu Pro Thr Thr Tyr Ala Gly Ala Val Ala Ala Gln Val Thr 130 135 140 Gly Ala Ala His Ala Arg Val Leu Trp Gly Pro Asp Val Met Gly Ser 145 150 155 160 Ala Arg Arg Lys Phe Val Ala Leu Arg Asp Arg Gln Pro Pro Glu His 165 170 175 Arg Glu Asp Pro Thr Ala Glu Trp Leu Thr Trp Thr Leu Asp Arg Tyr 180 185 190 Gly Ala Ser Phe Glu Glu Glu Leu Leu Thr Gly Gln Phe Thr Ile Asp 195 200 205 Pro Thr Pro Pro Ser Leu Arg Leu Asp Thr Gly Leu Pro Thr Val Gly 210 215 220 Met Arg Tyr Val Pro Tyr Asn Gly Thr Ser Val Val Pro Asp Trp Leu 225 230 235 240 Ser Glu Pro Pro Ala Arg Pro Arg Val Cys Leu Thr Leu Gly Val Ser 245 250 255 Ala Arg Glu Val Leu Gly Gly Asp Gly Val Ser Gln Gly Asp Ile Leu 260 265 270 Glu Ala Leu Ala Asp Leu Asp Ile Glu Leu Val Ala Thr Leu Asp Ala 275 280 285 Ser Gln Arg Ala Glu Ile Arg Asn Tyr Pro Lys His Thr Arg Phe Thr 290 295 300 Asp Phe Val Pro Met His Ala Leu Leu Pro Ser Cys Ser Ala Ile Ile 305 310 315 320 His His Gly Gly Ala Gly Thr Tyr Ala Thr Ala Val Ile Asn Ala Val 325 330 335 Pro Gln Val Met Leu Ala Glu Leu Trp Asp Ala Pro Val Lys Ala Arg 340 345 350 Ala Val Ala Glu Gln Gly Ala Gly Phe Phe Leu Pro Pro Ala Glu Leu 355 360 365 Thr Pro Gln Ala Val Arg Asp Ala Val Val Arg Ile Leu Asp Asp Pro 370 375 380 Ser Val Ala Thr Ala Ala His Arg Leu Arg Glu Glu Thr Phe Gly Asp 385 390 395 400 Pro Thr Pro Ala Gly Ile Val Pro Glu Leu Glu Arg Leu Ala Ala Gln 405 410 415 His Arg Arg Pro Pro Ala Asp Ala Arg His 420 425 <210> 16 <211> 4891 <212> DNA <213> Artificial Sequence <220> <223> desVIII-desVII-desIII-desIV <400> 16 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tcctggagac ccgcggcatc cactggatcc 180 acgccgcgaa cggcgacccg tacgccaccg tgctgcgcgg ccaggcggac gacccgtatc 240 ccgcgtacga gcgggtgcgt gcccgcggcg cgctctcctt cagcccgacg ggcagctggg 300 tcaccgccga tcacgccctg gcggcgagca tcctctgctc gacggacttc ggggtctccg 360 gcgccgacgg cgtcccggtg ccgcagcagg tcctctcgta cggggagggc tgtccgctgg 420 agcgcgagca ggtgctgccg gcggccggtg acgtgccgga gggcgggcag cgtgccgtgg 480 tcgaggggat ccaccgggag acgctggagg gtctcgcgcc ggacccgtcg gcgtcgtacg 540 ccttcgagct gctgggcggt ttcgtccgcc cggcggtgac ggccgctgcc gccgccgtgc 600 tgggtgttcc cgcggaccgg cgcgcggact tcgcggatct gctggagcgg ctccggccgc 660 tgtccgacag cctgctggcc ccgcagtccc tgcggacggt acgggcggcg gacggcgcgc 720 tggccgagct cacggcgctg ctcgccgatt cggacgactc ccccggggcc ctgctgtcgg 780 cgctcggggt caccgcagcc gtccagctca ccgggaacgc ggtgctcgcg ctcctcgcgc 840 atcccgagca gtggcgggag ctgtgcgacc ggcccgggct cgcggcggcc gcggtggagg 900 agaccctccg ctacgacccg ccggtgcagc tcgacgcccg ggtggtccgc ggggagacgg 960 agctggcggg ccggcggctg ccggccgggg cgcatgtcgt cgtcctgacc gccgcgaccg 1020 gccgggaccc ggaggtcttc acggacccgg agcgcttcga cctcgcgcgc cccgacgccg 1080 ccgcgcacct cgcgctgcac cccgccggtc cgtacggccc ggtggcgtcc ctggtccggc 1140 ttcaggcgga ggtcgcgctg cggaccctgg ccgggcgttt ccccgggctg cggcaggcgg 1200 gggacgtgct ccgcccccgc cgcgcgcctg tcggccgcgg gccgctgagc gtcccggtca 1260 gcagctcctg agacaccggg gccccggtcc gcccggcccc ccttcggacg gaccggacgg 1320 ctcggaccac ggggacggct cagaccgtcc cgtgtgtccc cgtccggctc ccgtccgccc 1380 catcccgccc ctccaccggc aaggaaggac acgacgccat gcgcgtcctg ctgacctcgt 1440 tcgcacatca cacgcactac tacggcctgg tgcccctggc ctgggcgctg ctcgccgccg 1500 ggcacgaggt gcgggtcgcc agccagcccg cgctcacgga caccatcacc gggtccgggc 1560 tcgccgcggt gccggtcggc accgaccacc tcatccacga gtaccgggtg cggatggcgg 1620 gcgagccgcg cccgaaccat ccggcgatcg ccttcgacga ggcccgtccc gagccgctgg 1680 actgggacca cgccctcggc atcgaggcga tcctcgcccc gtacttccat ctgctcgcca 1740 acaacgactc gatggtcgac gacctcgtcg acttcgcccg gtcctggcag ccggacctgg 1800 tgctgtggga gccgacgacc tacgcgggcg ccgtcgccgc ccaggtcacc ggtgccgcgc 1860 acgcccgggt cctgtggggg cccgacgtga tgggcagcgc ccgccgcaag ttcgtcgcgc 1920 tgcgggaccg gcagccgccc gagcaccgcg aggaccccac cgcggagtgg ctgacgtgga 1980 cgctcgaccg gtacggcgcc tccttcgaag aggagctgct caccggccag ttcacgatcg 2040 acccgacccc gccgagcctg cgcctcgaca cgggcctgcc gaccgtcggg atgcgttatg 2100 ttccgtacaa cggcacgtcg gtcgtgccgg actggctgag tgagccgccc gcgcggcccc 2160 gggtctgcct gaccctcggc gtctccgcgc gtgaggtcct cggcggcgac ggcgtctcgc 2220 agggcgacat cctggaggcg ctcgccgacc tcgacatcga gctcgtcgcc acgctcgacg 2280 cgagtcagcg cgccgagatc cgcaactacc cgaagcacac ccggttcacg gacttcgtgc 2340 cgatgcacgc gctcctgccg agctgctcgg cgatcatcca ccacggcggg gcgggcacct 2400 acgcgaccgc cgtgatcaac gcggtgccgc aggtcatgct cgccgagctg tgggacgcgc 2460 cggtcaaggc gcgggccgtc gccgagcagg gggcggggtt cttcctgccg ccggccgagc 2520 tcacgccgca ggccgtgcgg gacgccgtcg tccgcatcct cgacgacccc tcggtcgcca 2580 ccgccgcgca ccggctgcgc gaggagacct tcggcgaccc caccccggcc gggatcgtcc 2640 ccgagctgga gcggctcgcc gcgcagcacc gccgcccgcc ggccgacgcc cggcactgag 2700 ccgcacccct cgccccaggc ctcacccctg tatctcatat gtctagttaa ctcgccacgc 2760 cgaccgttat caccggcgcc ctgctgctag tttccgagaa tgaagggaat agtcctggcc 2820 ggcgggagcg gaactcggct gcatccggcg acctcggtca tttcgaagca gattcttccg 2880 gtctacaaca aaccgatgat ctactatccg ctgtcggttc tcatgctcgg cggtattcgc 2940 gagattcaaa tcatctcgac cccccagcac atcgaactct tccagtcgct tctcggaaac 3000 ggcaggcacc tgggaataga actcgactat gcggtccaga aagagcccgc aggaatcgcg 3060 gacgcacttc tcgtcggagc cgagcacatc ggcgacgaca cctgcgccct gatcctgggc 3120 gacaacatct tccacgggcc cggcctctac acgctcctgc gggacagcat cgcgcgcctc 3180 gacggctgcg tgctcttcgg ctacccggtc aaggaccccg agcggtacgg cgtcgccgag 3240 gtggacgcga cgggccggct gaccgacctc gtcgagaagc ccgtcaagcc gcgctccaac 3300 ctcgccgtca ccggcctcta cctctacgac aacgacgtcg tcgacatcgc caagaacatc 3360 cggccctcgc cgcgcggcga gctggagatc accgacgtca accgcgtcta cctggagcgg 3420 ggccgggccg aactcgtcaa cctgggccgc ggcttcgcct ggctggacac cggcacccac 3480 gactcgctcc tgcgggccgc ccagtacgtc caggtcctgg aggagcggca gggcgtctgg 3540 atcgcgggcc ttgaggagat cgccttccgc atgggcttca tcgacgccga ggcctgtcac 3600 ggcctgggag aaggcctctc ccgcaccgag tacggcagct atctgatgga gatcgccggc 3660 cgcgagggag ccccgtgagg gcacctcgcg gccgacgcgt tcccacgacc gacagcgcca 3720 ccgacagtgc gacccacacc gcgacccgca ccgccaccga cagtgcgacc cacaccgcga 3780 cctacagcgc gaccgaaagg aagacggcag tgcggcttct ggtgaccgga ggtgcgggct 3840 tcatcggctc gcacttcgtg cggcagctcc tcgccggggc gtaccccgac gtgcccgccg 3900 atgaggtgat cgtcctggac agcctcacct acgcgggcaa ccgcgccaac ctcgccccgg 3960 tggacgcgga cccgcgactg cgcttcgtcc acggcgacat ccgcgacgcc ggcctcctcg 4020 cccgggaact gcgcggcgtg gacgccatcg tccacttcgc ggccgagagc cacgtggacc 4080 gctccatcgc gggcgcgtcc gtgttcaccg agaccaacgt gcagggcacg cagacgctgc 4140 tccagtgcgc cgtcgacgcc ggcgtcggcc gggtcgtgca cgtctccacc gacgaggtgt 4200 acgggtcgat cgactccggc tcctggaccg agagcagccc gctggagccc aactcgccct 4260 acgcggcgtc caaggccggc tccgacctcg ttgcccgcgc ctaccaccgg acgtacggcc 4320 tcgacgtacg gatcacccgc tgctgcaaca actacgggcc gtaccagcac cccgagaagc 4380 tcatccccct cttcgtgacg aacctcctcg acggcgggac gctcccgctg tacggcgacg 4440 gcgcgaacgt ccgcgagtgg gtgcacaccg acgaccactg ccggggcatc gcgctcgtcc 4500 tcgcgggcgg ccgggccggc gagatctacc acatcggcgg cggcctggag ctgaccaacc 4560 gcgaactcac cggcatcctc ctggactcgc tcggcgccga ctggtcctcg gtccggaagg 4620 tcgccgaccg caagggccac gacctgcgct actccctcga cggcggcgag atcgagcgcg 4680 agctcggcta ccgcccgcag gtctccttcg cggacggcct cgcgcggacc gtccgctggt 4740 accgggagaa ccgcggctgg tgggagccgc tcaaggcgac cgccccgcag ctgcccgcca 4800 ccgccgtgga ggtgtccgcg tgagcagccg cgccgagacc ccccgcgtcc ccttcctcga 4860 cctcaaggcc gcctacgagg agctctctag a 4891 <210> 17 <211> 6603 <212> DNA <213> Artificial Sequence <220> <223> desVIII-desVII-desIII-desIV-oleL-oleU <400> 17 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tcctggagac ccgcggcatc cactggatcc 180 acgccgcgaa cggcgacccg tacgccaccg tgctgcgcgg ccaggcggac gacccgtatc 240 ccgcgtacga gcgggtgcgt gcccgcggcg cgctctcctt cagcccgacg ggcagctggg 300 tcaccgccga tcacgccctg gcggcgagca tcctctgctc gacggacttc ggggtctccg 360 gcgccgacgg cgtcccggtg ccgcagcagg tcctctcgta cggggagggc tgtccgctgg 420 agcgcgagca ggtgctgccg gcggccggtg acgtgccgga gggcgggcag cgtgccgtgg 480 tcgaggggat ccaccgggag acgctggagg gtctcgcgcc ggacccgtcg gcgtcgtacg 540 ccttcgagct gctgggcggt ttcgtccgcc cggcggtgac ggccgctgcc gccgccgtgc 600 tgggtgttcc cgcggaccgg cgcgcggact tcgcggatct gctggagcgg ctccggccgc 660 tgtccgacag cctgctggcc ccgcagtccc tgcggacggt acgggcggcg gacggcgcgc 720 tggccgagct cacggcgctg ctcgccgatt cggacgactc ccccggggcc ctgctgtcgg 780 cgctcggggt caccgcagcc gtccagctca ccgggaacgc ggtgctcgcg ctcctcgcgc 840 atcccgagca gtggcgggag ctgtgcgacc ggcccgggct cgcggcggcc gcggtggagg 900 agaccctccg ctacgacccg ccggtgcagc tcgacgcccg ggtggtccgc ggggagacgg 960 agctggcggg ccggcggctg ccggccgggg cgcatgtcgt cgtcctgacc gccgcgaccg 1020 gccgggaccc ggaggtcttc acggacccgg agcgcttcga cctcgcgcgc cccgacgccg 1080 ccgcgcacct cgcgctgcac cccgccggtc cgtacggccc ggtggcgtcc ctggtccggc 1140 ttcaggcgga ggtcgcgctg cggaccctgg ccgggcgttt ccccgggctg cggcaggcgg 1200 gggacgtgct ccgcccccgc cgcgcgcctg tcggccgcgg gccgctgagc gtcccggtca 1260 gcagctcctg agacaccggg gccccggtcc gcccggcccc ccttcggacg gaccggacgg 1320 ctcggaccac ggggacggct cagaccgtcc cgtgtgtccc cgtccggctc ccgtccgccc 1380 catcccgccc ctccaccggc aaggaaggac acgacgccat gcgcgtcctg ctgacctcgt 1440 tcgcacatca cacgcactac tacggcctgg tgcccctggc ctgggcgctg ctcgccgccg 1500 ggcacgaggt gcgggtcgcc agccagcccg cgctcacgga caccatcacc gggtccgggc 1560 tcgccgcggt gccggtcggc accgaccacc tcatccacga gtaccgggtg cggatggcgg 1620 gcgagccgcg cccgaaccat ccggcgatcg ccttcgacga ggcccgtccc gagccgctgg 1680 actgggacca cgccctcggc atcgaggcga tcctcgcccc gtacttccat ctgctcgcca 1740 acaacgactc gatggtcgac gacctcgtcg acttcgcccg gtcctggcag ccggacctgg 1800 tgctgtggga gccgacgacc tacgcgggcg ccgtcgccgc ccaggtcacc ggtgccgcgc 1860 acgcccgggt cctgtggggg cccgacgtga tgggcagcgc ccgccgcaag ttcgtcgcgc 1920 tgcgggaccg gcagccgccc gagcaccgcg aggaccccac cgcggagtgg ctgacgtgga 1980 cgctcgaccg gtacggcgcc tccttcgaag aggagctgct caccggccag ttcacgatcg 2040 acccgacccc gccgagcctg cgcctcgaca cgggcctgcc gaccgtcggg atgcgttatg 2100 ttccgtacaa cggcacgtcg gtcgtgccgg actggctgag tgagccgccc gcgcggcccc 2160 gggtctgcct gaccctcggc gtctccgcgc gtgaggtcct cggcggcgac ggcgtctcgc 2220 agggcgacat cctggaggcg ctcgccgacc tcgacatcga gctcgtcgcc acgctcgacg 2280 cgagtcagcg cgccgagatc cgcaactacc cgaagcacac ccggttcacg gacttcgtgc 2340 cgatgcacgc gctcctgccg agctgctcgg cgatcatcca ccacggcggg gcgggcacct 2400 acgcgaccgc cgtgatcaac gcggtgccgc aggtcatgct cgccgagctg tgggacgcgc 2460 cggtcaaggc gcgggccgtc gccgagcagg gggcggggtt cttcctgccg ccggccgagc 2520 tcacgccgca ggccgtgcgg gacgccgtcg tccgcatcct cgacgacccc tcggtcgcca 2580 ccgccgcgca ccggctgcgc gaggagacct tcggcgaccc caccccggcc gggatcgtcc 2640 ccgagctgga gcggctcgcc gcgcagcacc gccgcccgcc ggccgacgcc cggcactgag 2700 ccgcacccct cgccccaggc ctcacccctg tatctcatat gtctagttaa ctcgccacgc 2760 cgaccgttat caccggcgcc ctgctgctag tttccgagaa tgaagggaat agtcctggcc 2820 ggcgggagcg gaactcggct gcatccggcg acctcggtca tttcgaagca gattcttccg 2880 gtctacaaca aaccgatgat ctactatccg ctgtcggttc tcatgctcgg cggtattcgc 2940 gagattcaaa tcatctcgac cccccagcac atcgaactct tccagtcgct tctcggaaac 3000 ggcaggcacc tgggaataga actcgactat gcggtccaga aagagcccgc aggaatcgcg 3060 gacgcacttc tcgtcggagc cgagcacatc ggcgacgaca cctgcgccct gatcctgggc 3120 gacaacatct tccacgggcc cggcctctac acgctcctgc gggacagcat cgcgcgcctc 3180 gacggctgcg tgctcttcgg ctacccggtc aaggaccccg agcggtacgg cgtcgccgag 3240 gtggacgcga cgggccggct gaccgacctc gtcgagaagc ccgtcaagcc gcgctccaac 3300 ctcgccgtca ccggcctcta cctctacgac aacgacgtcg tcgacatcgc caagaacatc 3360 cggccctcgc cgcgcggcga gctggagatc accgacgtca accgcgtcta cctggagcgg 3420 ggccgggccg aactcgtcaa cctgggccgc ggcttcgcct ggctggacac cggcacccac 3480 gactcgctcc tgcgggccgc ccagtacgtc caggtcctgg aggagcggca gggcgtctgg 3540 atcgcgggcc ttgaggagat cgccttccgc atgggcttca tcgacgccga ggcctgtcac 3600 ggcctgggag aaggcctctc ccgcaccgag tacggcagct atctgatgga gatcgccggc 3660 cgcgagggag ccccgtgagg gcacctcgcg gccgacgcgt tcccacgacc gacagcgcca 3720 ccgacagtgc gacccacacc gcgacccgca ccgccaccga cagtgcgacc cacaccgcga 3780 cctacagcgc gaccgaaagg aagacggcag tgcggcttct ggtgaccgga ggtgcgggct 3840 tcatcggctc gcacttcgtg cggcagctcc tcgccggggc gtaccccgac gtgcccgccg 3900 atgaggtgat cgtcctggac agcctcacct acgcgggcaa ccgcgccaac ctcgccccgg 3960 tggacgcgga cccgcgactg cgcttcgtcc acggcgacat ccgcgacgcc ggcctcctcg 4020 cccgggaact gcgcggcgtg gacgccatcg tccacttcgc ggccgagagc cacgtggacc 4080 gctccatcgc gggcgcgtcc gtgttcaccg agaccaacgt gcagggcacg cagacgctgc 4140 tccagtgcgc cgtcgacgcc ggcgtcggcc gggtcgtgca cgtctccacc gacgaggtgt 4200 acgggtcgat cgactccggc tcctggaccg agagcagccc gctggagccc aactcgccct 4260 acgcggcgtc caaggccggc tccgacctcg ttgcccgcgc ctaccaccgg acgtacggcc 4320 tcgacgtacg gatcacccgc tgctgcaaca actacgggcc gtaccagcac cccgagaagc 4380 tcatccccct cttcgtgacg aacctcctcg acggcgggac gctcccgctg tacggcgacg 4440 gcgcgaacgt ccgcgagtgg gtgcacaccg acgaccactg ccggggcatc gcgctcgtcc 4500 tcgcgggcgg ccgggccggc gagatctacc acatcggcgg cggcctggag ctgaccaacc 4560 gcgaactcac cggcatcctc ctggactcgc tcggcgccga ctggtcctcg gtccggaagg 4620 tcgccgaccg caagggccac gacctgcgct actccctcga cggcggcgag atcgagcgcg 4680 agctcggcta ccgcccgcag gtctccttcg cggacggcct cgcgcggacc gtccgctggt 4740 accgggagaa ccgcggctgg tgggagccgc tcaaggcgac cgccccgcag ctgcccgcca 4800 ccgccgtgga ggtgtccgcg tgagcagccg cgccgagacc ccccgcgtcc ccttcctcga 4860 cctcaaggcc gcctacgagg agctctctag tatcgctccg agcccgaagg gaaaatcgag 4920 tgcccaattc ggcagaatcg ggatcgatgg agttactcga cgtcgacggg gcctggttat 4980 acaccccgga aatcatgcgg gacgaacggg gagaattcct cgaatggttc cggggtcgga 5040 cattccagga gaagatcggc caccccctct cgctggccca ggccaactgc tcggtgtccc 5100 gcaaggcgtt ctgcgcggca tccacttcgc cgacgccccc gcccggccag gccaagtacg 5160 tcacctgcgc ctccggcacc gtgctcgacg tggtcgtcga cgtacgccgg ggctcgccca 5220 ccttcggccg atgggccgcc gtccgactcg acgcggcccg ccaccagggg ctctacctgg 5280 ccgaaggact cggccacgcg ttcatggccc tcaccgacga cgccacggtc gtctacctct 5340 gctcacagcc ctacgtggcc gaggccgagc gggccgtaga ccctctcgac ccggcgatcg 5400 gcatcgaatg gccgacggac atcgacatcg tccctgtcgg cgaagggaca cccacgcacc 5460 gtccctggcg caggccgcgg agacccggca tcctgccgga ctacgaggga gtgcccggcg 5520 ccttacatcg cggaggcggc cggcgtggga ccggcccgtg aaggccctcg tactggccgg 5580 ctctagttac gtagtaccgc gacaaccgcg cctggtggga acccctgaag aagcggccgg 5640 ccggtcccgc cgcccccccg agaggcagcg gcccatgaga tggctgatca ccggcgccgc 5700 cggaatgctg ggccgggaac tcgtccggcg cctcgccgag aacgaggagg acgtcgcggc 5760 cctcggccac gaccacctcg acgtcacccg accctccgcc gtgcgggcgg cactcgccga 5820 gcaccgtccc gggatcgtcg tcaactgcgc cgcctacacg gccgtcgacg acgccgagac 5880 ggacgaggcc gccgctgccc tcctcaacgc cgaggcgccc cggctgctgg ccgagggcct 5940 gcgcccccac cggcggcacg gcctcgtcca cctgtccacc gactacgtct ttcccggcga 6000 cgcccgcacc ccctacgccg aggaccaccc cacggctccc cgcagcgcct acggacgcac 6060 caaacgggac ggcgagcaag cggtgctgac ggcactgccc accgccaccg tgctgcgcac 6120 cgcctggctg tacgggcgca ccggccgcag cttcgtccgc acgatgatcg aacgggaggc 6180 gcgcggcgga gccatcgacg tcgtcgccga ccagcgcggc cagcccacct ggaccggcga 6240 cctcgccgac cgcatcatcg ccgtcggccg gcaccccggc gtccacggca tcctgcacgc 6300 caccaacgcc ggctccgcca cctggtacga cctggcacaa gaggtcttcc ggctcctcga 6360 cgccgacccc gggcgggtcc ggcccaccac cggcgccgcc ttccgcagac ccgccccccg 6420 ccccgcctac agcgtcctcg gccacgaccg ctggcgcggg accggcctgg cacccctgcg 6480 tgactggcgc tcggccctgc gcgaggcgtt ccccgacatc ctcgccgcgg aacacccacc 6540 gacccggcga ggagcagcat gaaacgaggc gtgcacgacc tggccctctt ccctaggtct 6600 aga 6603 <210> 18 <211> 7635 <212> DNA <213> Artificial Sequence <220> <223> desVIII-desVII-desIII-desIV-desI-desII <400> 18 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tcctggagac ccgcggcatc cactggatcc 180 acgccgcgaa cggcgacccg tacgccaccg tgctgcgcgg ccaggcggac gacccgtatc 240 ccgcgtacga gcgggtgcgt gcccgcggcg cgctctcctt cagcccgacg ggcagctggg 300 tcaccgccga tcacgccctg gcggcgagca tcctctgctc gacggacttc ggggtctccg 360 gcgccgacgg cgtcccggtg ccgcagcagg tcctctcgta cggggagggc tgtccgctgg 420 agcgcgagca ggtgctgccg gcggccggtg acgtgccgga gggcgggcag cgtgccgtgg 480 tcgaggggat ccaccgggag acgctggagg gtctcgcgcc ggacccgtcg gcgtcgtacg 540 ccttcgagct gctgggcggt ttcgtccgcc cggcggtgac ggccgctgcc gccgccgtgc 600 tgggtgttcc cgcggaccgg cgcgcggact tcgcggatct gctggagcgg ctccggccgc 660 tgtccgacag cctgctggcc ccgcagtccc tgcggacggt acgggcggcg gacggcgcgc 720 tggccgagct cacggcgctg ctcgccgatt cggacgactc ccccggggcc ctgctgtcgg 780 cgctcggggt caccgcagcc gtccagctca ccgggaacgc ggtgctcgcg ctcctcgcgc 840 atcccgagca gtggcgggag ctgtgcgacc ggcccgggct cgcggcggcc gcggtggagg 900 agaccctccg ctacgacccg ccggtgcagc tcgacgcccg ggtggtccgc ggggagacgg 960 agctggcggg ccggcggctg ccggccgggg cgcatgtcgt cgtcctgacc gccgcgaccg 1020 gccgggaccc ggaggtcttc acggacccgg agcgcttcga cctcgcgcgc cccgacgccg 1080 ccgcgcacct cgcgctgcac cccgccggtc cgtacggccc ggtggcgtcc ctggtccggc 1140 ttcaggcgga ggtcgcgctg cggaccctgg ccgggcgttt ccccgggctg cggcaggcgg 1200 gggacgtgct ccgcccccgc cgcgcgcctg tcggccgcgg gccgctgagc gtcccggtca 1260 gcagctcctg agacaccggg gccccggtcc gcccggcccc ccttcggacg gaccggacgg 1320 ctcggaccac ggggacggct cagaccgtcc cgtgtgtccc cgtccggctc ccgtccgccc 1380 catcccgccc ctccaccggc aaggaaggac acgacgccat gcgcgtcctg ctgacctcgt 1440 tcgcacatca cacgcactac tacggcctgg tgcccctggc ctgggcgctg ctcgccgccg 1500 ggcacgaggt gcgggtcgcc agccagcccg cgctcacgga caccatcacc gggtccgggc 1560 tcgccgcggt gccggtcggc accgaccacc tcatccacga gtaccgggtg cggatggcgg 1620 gcgagccgcg cccgaaccat ccggcgatcg ccttcgacga ggcccgtccc gagccgctgg 1680 actgggacca cgccctcggc atcgaggcga tcctcgcccc gtacttccat ctgctcgcca 1740 acaacgactc gatggtcgac gacctcgtcg acttcgcccg gtcctggcag ccggacctgg 1800 tgctgtggga gccgacgacc tacgcgggcg ccgtcgccgc ccaggtcacc ggtgccgcgc 1860 acgcccgggt cctgtggggg cccgacgtga tgggcagcgc ccgccgcaag ttcgtcgcgc 1920 tgcgggaccg gcagccgccc gagcaccgcg aggaccccac cgcggagtgg ctgacgtgga 1980 cgctcgaccg gtacggcgcc tccttcgaag aggagctgct caccggccag ttcacgatcg 2040 acccgacccc gccgagcctg cgcctcgaca cgggcctgcc gaccgtcggg atgcgttatg 2100 ttccgtacaa cggcacgtcg gtcgtgccgg actggctgag tgagccgccc gcgcggcccc 2160 gggtctgcct gaccctcggc gtctccgcgc gtgaggtcct cggcggcgac ggcgtctcgc 2220 agggcgacat cctggaggcg ctcgccgacc tcgacatcga gctcgtcgcc acgctcgacg 2280 cgagtcagcg cgccgagatc cgcaactacc cgaagcacac ccggttcacg gacttcgtgc 2340 cgatgcacgc gctcctgccg agctgctcgg cgatcatcca ccacggcggg gcgggcacct 2400 acgcgaccgc cgtgatcaac gcggtgccgc aggtcatgct cgccgagctg tgggacgcgc 2460 cggtcaaggc gcgggccgtc gccgagcagg gggcggggtt cttcctgccg ccggccgagc 2520 tcacgccgca ggccgtgcgg gacgccgtcg tccgcatcct cgacgacccc tcggtcgcca 2580 ccgccgcgca ccggctgcgc gaggagacct tcggcgaccc caccccggcc gggatcgtcc 2640 ccgagctgga gcggctcgcc gcgcagcacc gccgcccgcc ggccgacgcc cggcactgag 2700 ccgcacccct cgccccaggc ctcacccctg tatctcatat gtctagttaa ctcgccacgc 2760 cgaccgttat caccggcgcc ctgctgctag tttccgagaa tgaagggaat agtcctggcc 2820 ggcgggagcg gaactcggct gcatccggcg acctcggtca tttcgaagca gattcttccg 2880 gtctacaaca aaccgatgat ctactatccg ctgtcggttc tcatgctcgg cggtattcgc 2940 gagattcaaa tcatctcgac cccccagcac atcgaactct tccagtcgct tctcggaaac 3000 ggcaggcacc tgggaataga actcgactat gcggtccaga aagagcccgc aggaatcgcg 3060 gacgcacttc tcgtcggagc cgagcacatc ggcgacgaca cctgcgccct gatcctgggc 3120 gacaacatct tccacgggcc cggcctctac acgctcctgc gggacagcat cgcgcgcctc 3180 gacggctgcg tgctcttcgg ctacccggtc aaggaccccg agcggtacgg cgtcgccgag 3240 gtggacgcga cgggccggct gaccgacctc gtcgagaagc ccgtcaagcc gcgctccaac 3300 ctcgccgtca ccggcctcta cctctacgac aacgacgtcg tcgacatcgc caagaacatc 3360 cggccctcgc cgcgcggcga gctggagatc accgacgtca accgcgtcta cctggagcgg 3420 ggccgggccg aactcgtcaa cctgggccgc ggcttcgcct ggctggacac cggcacccac 3480 gactcgctcc tgcgggccgc ccagtacgtc caggtcctgg aggagcggca gggcgtctgg 3540 atcgcgggcc ttgaggagat cgccttccgc atgggcttca tcgacgccga ggcctgtcac 3600 ggcctgggag aaggcctctc ccgcaccgag tacggcagct atctgatgga gatcgccggc 3660 cgcgagggag ccccgtgagg gcacctcgcg gccgacgcgt tcccacgacc gacagcgcca 3720 ccgacagtgc gacccacacc gcgacccgca ccgccaccga cagtgcgacc cacaccgcga 3780 cctacagcgc gaccgaaagg aagacggcag tgcggcttct ggtgaccgga ggtgcgggct 3840 tcatcggctc gcacttcgtg cggcagctcc tcgccggggc gtaccccgac gtgcccgccg 3900 atgaggtgat cgtcctggac agcctcacct acgcgggcaa ccgcgccaac ctcgccccgg 3960 tggacgcgga cccgcgactg cgcttcgtcc acggcgacat ccgcgacgcc ggcctcctcg 4020 cccgggaact gcgcggcgtg gacgccatcg tccacttcgc ggccgagagc cacgtggacc 4080 gctccatcgc gggcgcgtcc gtgttcaccg agaccaacgt gcagggcacg cagacgctgc 4140 tccagtgcgc cgtcgacgcc ggcgtcggcc gggtcgtgca cgtctccacc gacgaggtgt 4200 acgggtcgat cgactccggc tcctggaccg agagcagccc gctggagccc aactcgccct 4260 acgcggcgtc caaggccggc tccgacctcg ttgcccgcgc ctaccaccgg acgtacggcc 4320 tcgacgtacg gatcacccgc tgctgcaaca actacgggcc gtaccagcac cccgagaagc 4380 tcatccccct cttcgtgacg aacctcctcg acggcgggac gctcccgctg tacggcgacg 4440 gcgcgaacgt ccgcgagtgg gtgcacaccg acgaccactg ccggggcatc gcgctcgtcc 4500 tcgcgggcgg ccgggccggc gagatctacc acatcggcgg cggcctggag ctgaccaacc 4560 gcgaactcac cggcatcctc ctggactcgc tcggcgccga ctggtcctcg gtccggaagg 4620 tcgccgaccg caagggccac gacctgcgct actccctcga cggcggcgag atcgagcgcg 4680 agctcggcta ccgcccgcag gtctccttcg cggacggcct cgcgcggacc gtccgctggt 4740 accgggagaa ccgcggctgg tgggagccgc tcaaggcgac cgccccgcag ctgcccgcca 4800 ccgccgtgga ggtgtccgcg tgagcagccg cgccgagacc ccccgcgtcc ccttcctcga 4860 cctcaaggcc gcctacgagg agctctctag tgctagcgac ggtggcccgg agggaacatc 4920 cgtgaaaagc gccttatccg acctcgcatt cttcggcggc cccgccgctt tcgaccagcc 4980 gctcctcgtg gggcggccca accgcatcga ccgcgccagg ctgtacgagc ggctcgaccg 5040 ggccctcgac agccagtggc tgtccaacgg cggcccgctc gtccgcgagt tcgaggagcg 5100 cgtcgccggg ctcgccgggg tccggcatgc cgtggccacc tgcaacgcca cggccgggct 5160 ccagctcctc gcgcacgccg ccggcctcac cggcgaagtg atcatgccgt cgatgacgtt 5220 cgccgccacc ccgcacgcac tgcgctggat cggcctcacc ccggtcttcg ccgacatcga 5280 cccggacacc ggcaacctcg acccggacca ggtggccgcc gcggtcacac cccgcacctc 5340 ggccgtcgtc ggcgtccacc tctggggccg cccctgcgcc gccgaccagc tgcggaaggt 5400 cgccgacgag cacggcctgc ggctgtactt cgacgccgcg cacgccctcg gctgcgcggt 5460 cgacggccgg cccgccggca gcctcggcga cgccgaggtc ttcagcttcc acgccaccaa 5520 ggccgtcaac gccttcgagg gcggcgccgt cgtcaccgac gacgccgacc tcgccgcccg 5580 gatccgcgcc ctccacaact tcggcttcga cctgcccggc ggcagccccg ccggcgggac 5640 caacgccaag atgagcgagg ccgccgccgc catgggcctc acctccctcg acgcgtttcc 5700 cgaggtcatc gaccggaacc ggcgcaacca cgccgcctac cgcgagcacc tcgcggacct 5760 ccccggcgtc ctcgtcgccg accacgaccg ccacggcctc aacaaccacc agtacgtgat 5820 cgtcgagatc gacgaggcca ccaccggcat ccaccgcgac ctcgtcatgg aggtcctgaa 5880 ggccgaaggc gtgcacaccc gcgcctactt ctcgccgggc tgccacgagc tggagccgta 5940 ccgcgggcag ccgcacgccc cgctgccgca caccgaacgc ctcgccgcgc gcgtgctgtc 6000 cctgccgacc ggcaccgcca tcggcgacga cgacatccgc cgggtcgccg acctgctgcg 6060 tctctgcgcg acccgcggcc gcgaactgac cgcgcgccac cgcgacacgg cccccgcccc 6120 gctcgcggcc ccccagacat ccacgcccac gattggacgc tcccgatgac cgcccccgcc 6180 ctttccgcca ccgccccggc cgaacgctgc gcgcaccccg gagccgatct gggggcggcg 6240 gtccacgccg tcggccagac cctcgccgcc ggcggcctcg tgccgcccga cgaggccgga 6300 acgaccgccc gccacctcgt ccggctcgcc gtgcgctacg gcaacagccc cttcaccccg 6360 ctggaggagg cccgccacga cctgggcgtc gaccgggacg ccttccggcg cctcctcgcc 6420 ctgttcgggc aggtcccgga gctccgcacc gcggtcgaga ccggccccgc cggggcgtac 6480 tggaagaaca ccctgctccc gctcgaacag cgcggcgtct tcgacgcggc gctcgccagg 6540 aagcccgtct tcccgtacag cgtcggcctc taccccggcc cgacctgcat gttccgctgc 6600 cacttctgcg tccgtgtgac cggcgcccgc tacgacccgt ccgccctcga cgccggcaac 6660 gccatgttcc ggtcggtcat cgacgagata cccgcgggca acccctcggc gatgtacttc 6720 tccggcggcc tggagccgct caccaacccc ggcctcggga gcctggccgc gcacgccacc 6780 gaccacggcc tgcggcccac cgtctacacg aactccttcg cgctcaccga gcgcaccctg 6840 gagcgccagc ccggcctctg gggcctgcac gccatccgca cctcgctcta cggcctcaac 6900 gacgaggagt acgagcagac caccggcaag aaggccgcct tccgccgcgt ccgcgagaac 6960 ctgcgccgct tccagcagct gcgcgccgag cgcgagtcgc cgatcaacct cggcttcgcc 7020 tacatcgtgc tcccgggccg tgcctcccgc ctgctcgacc tggtcgactt catcgccgac 7080 ctcaacgacg ccgggcaggg caggacgatc gacttcgtca acattcgcga ggactacagc 7140 ggccgtgacg acggcaagct gccgcaggag gagcgggccg agctccagga ggccctcaac 7200 gccttcgagg agcgggtccg cgagcgcacc cccggactcc acatcgacta cggctacgcc 7260 ctgaacagcc tgcgcaccgg ggccgacgcc gaactgctgc ggatcaagcc cgccaccatg 7320 cggcccaccg cgcacccgca ggtcgcggtg caggtcgatc tcctcggcga cgtgtacctg 7380 taccgcgagg ccggcttccc cgacctggac ggcgcgaccc gctacatcgc gggccgcgtg 7440 acccccgaca cctccctcac cgaggtcgtc agggacttcg tcgagcgcgg cggcgaggtg 7500 gcggccgtcg acggcgacga gtacttcatg gacggcttcg atcaggtcgt caccgcccgc 7560 ctgaaccagc tggagcgcga cgccgcggac ggctgggagg aggcccgcgg cttcctgcgc 7620 tgacccgcat ctaga 7635 <210> 19 <211> 8375 <212> DNA <213> Artificial Sequence <220> <223> desVIII-desVII-desIII-desIV-oleV-eryBII-urdR <400> 19 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tttaattaag atatccccga ccagccttat 180 cgaaggagcg gcgaagagat ggcagaaccc acggtgaccg acgacctgac gggggccctc 240 acgcagcccc cgctgggccg caccgtccgc gcggtggccg accgtgaact cggcacccac 300 ctcctggaga cccgcggcat ccactggatc cacgccgcga acggcgaccc gtacgccacc 360 gtgctgcgcg gccaggcgga cgacccgtat cccgcgtacg agcgggtgcg tgcccgcggc 420 gcgctctcct tcagcccgac gggcagctgg gtcaccgccg atcacgccct ggcggcgagc 480 atcctctgct cgacggactt cggggtctcc ggcgccgacg gcgtcccggt gccgcagcag 540 gtcctctcgt acggggaggg ctgtccgctg gagcgcgagc aggtgctgcc ggcggccggt 600 gacgtgccgg agggcgggca gcgtgccgtg gtcgagggga tccaccggga gacgctggag 660 ggtctcgcgc cggacccgtc ggcgtcgtac gccttcgagc tgctgggcgg tttcgtccgc 720 ccggcggtga cggccgctgc cgccgccgtg ctgggtgttc ccgcggaccg gcgcgcggac 780 ttcgcggatc tgctggagcg gctccggccg ctgtccgaca gcctgctggc cccgcagtcc 840 ctgcggacgg tacgggcggc ggacggcgcg ctggccgagc tcacggcgct gctcgccgat 900 tcggacgact cccccggggc cctgctgtcg gcgctcgggg tcaccgcagc cgtccagctc 960 accgggaacg cggtgctcgc gctcctcgcg catcccgagc agtggcggga gctgtgcgac 1020 cggcccgggc tcgcggcggc cgcggtggag gagaccctcc gctacgaccc gccggtgcag 1080 ctcgacgccc gggtggtccg cggggagacg gagctggcgg gccggcggct gccggccggg 1140 gcgcatgtcg tcgtcctgac cgccgcgacc ggccgggacc cggaggtctt cacggacccg 1200 gagcgcttcg acctcgcgcg ccccgacgcc gccgcgcacc tcgcgctgca ccccgccggt 1260 ccgtacggcc cggtggcgtc cctggtccgg cttcaggcgg aggtcgcgct gcggaccctg 1320 gccgggcgtt tccccgggct gcggcaggcg ggggacgtgc tccgcccccg ccgcgcgcct 1380 gtcggccgcg ggccgctgag cgtcccggtc agcagctcct gagacaccgg ggccccggtc 1440 cgcccggccc cccttcggac ggaccggacg gctcggacca cggggacggc tcagaccgtc 1500 ccgtgtgtcc ccgtccggct cccgtccgcc ccatcccgcc cctccaccgg caaggaagga 1560 cacgacgcca tgcgcgtcct gctgacctcg ttcgcacatc acacgcacta ctacggcctg 1620 gtgcccctgg cctgggcgct gctcgccgcc gggcacgagg tgcgggtcgc cagccagccc 1680 gcgctcacgg acaccatcac cgggtccggg ctcgccgcgg tgccggtcgg caccgaccac 1740 ctcatccacg agtaccgggt gcggatggcg ggcgagccgc gcccgaacca tccggcgatc 1800 gccttcgacg aggcccgtcc cgagccgctg gactgggacc acgccctcgg catcgaggcg 1860 atcctcgccc cgtacttcca tctgctcgcc aacaacgact cgatggtcga cgacctcgtc 1920 gacttcgccc ggtcctggca gccggacctg gtgctgtggg agccgacgac ctacgcgggc 1980 gccgtcgccg cccaggtcac cggtgccgcg cacgcccggg tcctgtgggg gcccgacgtg 2040 atgggcagcg cccgccgcaa gttcgtcgcg ctgcgggacc ggcagccgcc cgagcaccgc 2100 gaggacccca ccgcggagtg gctgacgtgg acgctcgacc ggtacggcgc ctccttcgaa 2160 gaggagctgc tcaccggcca gttcacgatc gacccgaccc cgccgagcct gcgcctcgac 2220 acgggcctgc cgaccgtcgg gatgcgttat gttccgtaca acggcacgtc ggtcgtgccg 2280 gactggctga gtgagccgcc cgcgcggccc cgggtctgcc tgaccctcgg cgtctccgcg 2340 cgtgaggtcc tcggcggcga cggcgtctcg cagggcgaca tcctggaggc gctcgccgac 2400 ctcgacatcg agctcgtcgc cacgctcgac gcgagtcagc gcgccgagat ccgcaactac 2460 ccgaagcaca cccggttcac ggacttcgtg ccgatgcacg cgctcctgcc gagctgctcg 2520 gcgatcatcc accacggcgg ggcgggcacc tacgcgaccg ccgtgatcaa cgcggtgccg 2580 caggtcatgc tcgccgagct gtgggacgcg ccggtcaagg cgcgggccgt cgccgagcag 2640 ggggcggggt tcttcctgcc gccggccgag ctcacgccgc aggccgtgcg ggacgccgtc 2700 gtccgcatcc tcgacgaccc ctcggtcgcc accgccgcgc accggctgcg cgaggagacc 2760 ttcggcgacc ccaccccggc cgggatcgtc cccgagctgg agcggctcgc cgcgcagcac 2820 cgccgcccgc cggccgacgc ccggcactga gccgcacccc tcgccccagg cctcacccct 2880 gtatctcata tgtctagtta actcgccacg ccgaccgtta tcaccggcgc cctgctgcta 2940 gtttccgaga atgaagggaa tagtcctggc cggcgggagc ggaactcggc tgcatccggc 3000 gacctcggtc atttcgaagc agattcttcc ggtctacaac aaaccgatga tctactatcc 3060 gctgtcggtt ctcatgctcg gcggtattcg cgagattcaa atcatctcga ccccccagca 3120 catcgaactc ttccagtcgc ttctcggaaa cggcaggcac ctgggaatag aactcgacta 3180 tgcggtccag aaagagcccg caggaatcgc ggacgcactt ctcgtcggag ccgagcacat 3240 cggcgacgac acctgcgccc tgatcctggg cgacaacatc ttccacgggc ccggcctcta 3300 cacgctcctg cgggacagca tcgcgcgcct cgacggctgc gtgctcttcg gctacccggt 3360 caaggacccc gagcggtacg gcgtcgccga ggtggacgcg acgggccggc tgaccgacct 3420 cgtcgagaag cccgtcaagc cgcgctccaa cctcgccgtc accggcctct acctctacga 3480 caacgacgtc gtcgacatcg ccaagaacat ccggccctcg ccgcgcggcg agctggagat 3540 caccgacgtc aaccgcgtct acctggagcg gggccgggcc gaactcgtca acctgggccg 3600 cggcttcgcc tggctggaca ccggcaccca cgactcgctc ctgcgggccg cccagtacgt 3660 ccaggtcctg gaggagcggc agggcgtctg gatcgcgggc cttgaggaga tcgccttccg 3720 catgggcttc atcgacgccg aggcctgtca cggcctggga gaaggcctct cccgcaccga 3780 gtacggcagc tatctgatgg agatcgccgg ccgcgaggga gccccgtgag ggcacctcgc 3840 ggccgacgcg ttcccacgac cgacagcgcc accgacagtg cgacccacac cgcgacccgc 3900 accgccaccg acagtgcgac ccacaccgcg acctacagcg cgaccgaaag gaagacggca 3960 gtgcggcttc tggtgaccgg aggtgcgggc ttcatcggct cgcacttcgt gcggcagctc 4020 ctcgccgggg cgtaccccga cgtgcccgcc gatgaggtga tcgtcctgga cagcctcacc 4080 tacgcgggca accgcgccaa cctcgccccg gtggacgcgg acccgcgact gcgcttcgtc 4140 cacggcgaca tccgcgacgc cggcctcctc gcccgggaac tgcgcggcgt ggacgccatc 4200 gtccacttcg cggccgagag ccacgtggac cgctccatcg cgggcgcgtc cgtgttcacc 4260 gagaccaacg tgcagggcac gcagacgctg ctccagtgcg ccgtcgacgc cggcgtcggc 4320 cgggtcgtgc acgtctccac cgacgaggtg tacgggtcga tcgactccgg ctcctggacc 4380 gagagcagcc cgctggagcc caactcgccc tacgcggcgt ccaaggccgg ctccgacctc 4440 gttgcccgcg cctaccaccg gacgtacggc ctcgacgtac ggatcacccg ctgctgcaac 4500 aactacgggc cgtaccagca ccccgagaag ctcatccccc tcttcgtgac gaacctcctc 4560 gacggcggga cgctcccgct gtacggcgac ggcgcgaacg tccgcgagtg ggtgcacacc 4620 gacgaccact gccggggcat cgcgctcgtc ctcgcgggcg gccgggccgg cgagatctac 4680 cacatcggcg gcggcctgga gctgaccaac cgcgaactca ccggcatcct cctggactcg 4740 ctcggcgccg actggtcctc ggtccggaag gtcgccgacc gcaagggcca cgacctgcgc 4800 tactccctcg acggcggcga gatcgagcgc gagctcggct accgcccgca ggtctccttc 4860 gcggacggcc tcgcgcggac cgtccgctgg taccgggaga accgcggctg gtgggagccg 4920 ctcaaggcga ccgccccgca gctgcccgcc accgccgtgg aggtgtccgc gtgagcagcc 4980 gcgccgagac cccccgcgtc cccttcctcg acctcaaggc cgcctacgag gagctctcta 5040 gtgggaatcg cggaagcggc cgggttcggc gccgtcctgg atcacaatga tatggggaat 5100 tcccgcgatg agcgaagcaa tgggatcggt accgacggcc ggcagtgaag tctcctcgac 5160 ctgcgcgttt ctgtcctggt tggacgcgcg ccgccgggcc aatcgcctga cggtggaaca 5220 cgtaccgttc agggagttat cggggtggca attcgacgag aacacgggga acctccgaca 5280 taccagcggt cgtttcttct ccatcgaagg actccgggta cgcacggacc actgctggtt 5340 cggaagctgg acccagccca ttatcgtgca accggagata ggcattctcg gcctcctggt 5400 caagaggttc gacggcatcc tgcacgtcct ggtgcaggca aagaacgaac cgggtaatat 5460 cggcggcctt cagctctccc ccaccgtcca ggccactcgc agcaattaca cccgcgtcca 5520 ccgcggcggc ggtgtcagat acctggagta cttcgcgtcc ccccgcgggc gcggtcgggt 5580 cctcgcggac gtcctccaat ccgagcaggg ctcctggttc ctgcacaagc ggaaccggaa 5640 catggtggtc gaggccctgg acgacgtgcc cctcgacgac gacttccact ggatcagcct 5700 cggcgggctg cggaagctgc tgctgaggcc gcatctggtg aacatggaca cccgcacggt 5760 gctgtcctgc cttcccccgg atccggcacc ggacggccgg cagccgccgg cgcccgcggc 5820 tcccttcgcc gccgcggtca cgcggtccct cacccggggt gccaccgcct tgcacaccat 5880 gggcgagatc ctcggctggc tgaccgacga gcggtcccgg cgggaactgg tgcagcagcg 5940 ggtgccgctg gaggagaccg cgttcagcgg ctggcggcgt gacgaccacg ccatcgcgca 6000 caaggacggc gactacttcc gggtcatcgg ggtgagcgtc cgggccagca gccgggaggt 6060 gtcctcgtgg agccagccgt tgctggcccc cgtcggcccc ggtctggccg ccttcgtcac 6120 caggcggatc cgcggcgtcc tccacgtcct gctgcacgcc cgcaccgaag ccggcctgct 6180 caacggcccg gagatggcac cgaccgtgca gtgccgcccg ctcaactacc gtgcggtgcc 6240 cgccgagtac cggcccgcct acctcgacta cgtgctgtcg gccgatcccg gacgcatccg 6300 ctacgacacc ctccagtcgg aggagggcgg ccgcttccac cacgcggaga accgctacgt 6360 cgtggtggag gccgaggacg acttcccggt cgaggtgccc cgcgacttcc gctggctcac 6420 cctgcaccag atcctcgccc tgctgcacca cagcaactat gtcaacgtgg aggcgcgcag 6480 cctcgtcgcc tgcatccagc ctgagctgat ctagtggtcg tcggcatctg cgaggaactg 6540 gccgcaggaa ggagagaacc acgatgacca ccgacgccgc gacgcacgtg cggctcgggc 6600 gttccgcgct gctcaccagc aggctctggc tcggcacggt gaacttcagc ggacgcgtcg 6660 aggacgacga cgcgctgcgc ctgatggacc acgcccggga ccgcggcatc aactgcctcg 6720 acaccgccga catgtacggc tggcggctct acaagggcca caccgaggag ctggtgggca 6780 ggtggctggc ccagggcggc ggacggcgcg aggacaccgt gctggcgacc aaggtcggcg 6840 gcgagatgag cgagcgcgtc aacgacagcg ggctgtcggc gcggcacatc atcgcctcct 6900 gcgagggatc gctgcgcagg ctgggcgtcg accacatcga cgtctaccag atgcaccaca 6960 tcgaccggtc cgcgccgtgg gacgaggtgt ggcaggccat ggacagcctc gtcgccagcg 7020 gcaaggtctc ctacgtcggc tcgtcgaact tcgcgggctg gcacatcgcc gccgcgcagg 7080 agaacgccgc ccgccgccac tccctgggca tggtctccca ccagtgcctg tacaacctgg 7140 cggtccggca cgccgagctg gaggtgctgc ccgccgcgca ggcctacggg ctcggcgtct 7200 tcgcctggtc gccgctgcac ggcggcctgc tcagcggagc gctggagaag ctggccgcgg 7260 gcaccgcggt gaagtcggcg cagggccgtg cgcaggtgct gttgccgtcc ctgcgcccgg 7320 cgatcgaggc ctacgagaag ttctgccgca acctcggcga agacccggcc gaggtggggc 7380 tcgcatgggt gctgtcccgg cccggcatcg ccggcgccgt catcggcccg cgaacccccg 7440 agcagctcga ctccgcgctg aaggcgtccg cgatgaccct ggacgagcag gcgctgtccg 7500 aactggacga gatcttcccc gcggtggcct ccggcggcgc ggcgccggaa gcctggttgc 7560 agtgagcaca agaggaaccg agtacgtatc tagtgatatc acagagatca ggacgacgca 7620 tggacattgt gggaaatgga ttcctggcgc ggaacctgcg gccgctggcc gaacggcatc 7680 ccgataccgt ggccctcgcc gccggtgtct catgggcgag cggtacctcc gatgccgact 7740 tcgcccggga agccgcactc ctgcgagaca ccgccaagca gtgcgcggcc accggacgac 7800 gactgctgtt cttctcgacc gctgccacgg gcatgtacgg cctggcggag ggacccggcc 7860 gagaggacac gccagtgacg ccgtgcaccc cgtacggcgc gcacaagctg gcgctggagg 7920 aactgctgcg ggactccggt gccgaccatg tgattctcag gctcgggcac ctcgtggggc 7980 ccgaccagcc cgagcaccaa ctgctgccca cgctggtgcg tcacctacgc gaaggcgcgg 8040 tgcgcattca ccgaggcgcg gcccgtgacc tcatcgacgt cagcgacgtc gtcaccattg 8100 tcgactgcct tctcggcctt gacctcaagg ccgagacggt caacgtggcc tccggctacg 8160 ccgttccggt gaaggacatc gtcgaactcc tgcgccgcag gctcggggtc gaggcgcggt 8220 acgagttcca ggatgccggt ggtcagcacg tcatctccat cgagaagctg cgcgcactcg 8280 ttccgcaggt ccaggacatg ggcttcgggc ccgactacta ccggcggatc ctcagtgact 8340 tcacctccgc cgtccgtatc tgacctaggt ctaga 8375 <210> 20 <211> 9085 <212> DNA <213> Artificial Sequence <220> <223> desVIII-desVII-desIII-desIV-oleV-oleW-oleL-oleU <400> 20 ttaattaaga tatccccgac cagccttatc gaaggagcgg cgaagagatg gcagaaccca 60 cggtgaccga cgacctgacg ggggccctca cgcagccccc gctgggccgc accgtccgcg 120 cggtggccga ccgtgaactc ggcacccacc tcctggagac ccgcggcatc cactggatcc 180 acgccgcgaa cggcgacccg tacgccaccg tgctgcgcgg ccaggcggac gacccgtatc 240 ccgcgtacga gcgggtgcgt gcccgcggcg cgctctcctt cagcccgacg ggcagctggg 300 tcaccgccga tcacgccctg gcggcgagca tcctctgctc gacggacttc ggggtctccg 360 gcgccgacgg cgtcccggtg ccgcagcagg tcctctcgta cggggagggc tgtccgctgg 420 agcgcgagca ggtgctgccg gcggccggtg acgtgccgga gggcgggcag cgtgccgtgg 480 tcgaggggat ccaccgggag acgctggagg gtctcgcgcc ggacccgtcg gcgtcgtacg 540 ccttcgagct gctgggcggt ttcgtccgcc cggcggtgac ggccgctgcc gccgccgtgc 600 tgggtgttcc cgcggaccgg cgcgcggact tcgcggatct gctggagcgg ctccggccgc 660 tgtccgacag cctgctggcc ccgcagtccc tgcggacggt acgggcggcg gacggcgcgc 720 tggccgagct cacggcgctg ctcgccgatt cggacgactc ccccggggcc ctgctgtcgg 780 cgctcggggt caccgcagcc gtccagctca ccgggaacgc ggtgctcgcg ctcctcgcgc 840 atcccgagca gtggcgggag ctgtgcgacc ggcccgggct cgcggcggcc gcggtggagg 900 agaccctccg ctacgacccg ccggtgcagc tcgacgcccg ggtggtccgc ggggagacgg 960 agctggcggg ccggcggctg ccggccgggg cgcatgtcgt cgtcctgacc gccgcgaccg 1020 gccgggaccc ggaggtcttc acggacccgg agcgcttcga cctcgcgcgc cccgacgccg 1080 ccgcgcacct cgcgctgcac cccgccggtc cgtacggccc ggtggcgtcc ctggtccggc 1140 ttcaggcgga ggtcgcgctg cggaccctgg ccgggcgttt ccccgggctg cggcaggcgg 1200 gggacgtgct ccgcccccgc cgcgcgcctg tcggccgcgg gccgctgagc gtcccggtca 1260 gcagctcctg agacaccggg gccccggtcc gcccggcccc ccttcggacg gaccggacgg 1320 ctcggaccac ggggacggct cagaccgtcc cgtgtgtccc cgtccggctc ccgtccgccc 1380 catcccgccc ctccaccggc aaggaaggac acgacgccat gcgcgtcctg ctgacctcgt 1440 tcgcacatca cacgcactac tacggcctgg tgcccctggc ctgggcgctg ctcgccgccg 1500 ggcacgaggt gcgggtcgcc agccagcccg cgctcacgga caccatcacc gggtccgggc 1560 tcgccgcggt gccggtcggc accgaccacc tcatccacga gtaccgggtg cggatggcgg 1620 gcgagccgcg cccgaaccat ccggcgatcg ccttcgacga ggcccgtccc gagccgctgg 1680 actgggacca cgccctcggc atcgaggcga tcctcgcccc gtacttccat ctgctcgcca 1740 acaacgactc gatggtcgac gacctcgtcg acttcgcccg gtcctggcag ccggacctgg 1800 tgctgtggga gccgacgacc tacgcgggcg ccgtcgccgc ccaggtcacc ggtgccgcgc 1860 acgcccgggt cctgtggggg cccgacgtga tgggcagcgc ccgccgcaag ttcgtcgcgc 1920 tgcgggaccg gcagccgccc gagcaccgcg aggaccccac cgcggagtgg ctgacgtgga 1980 cgctcgaccg gtacggcgcc tccttcgaag aggagctgct caccggccag ttcacgatcg 2040 acccgacccc gccgagcctg cgcctcgaca cgggcctgcc gaccgtcggg atgcgttatg 2100 ttccgtacaa cggcacgtcg gtcgtgccgg actggctgag tgagccgccc gcgcggcccc 2160 gggtctgcct gaccctcggc gtctccgcgc gtgaggtcct cggcggcgac ggcgtctcgc 2220 agggcgacat cctggaggcg ctcgccgacc tcgacatcga gctcgtcgcc acgctcgacg 2280 cgagtcagcg cgccgagatc cgcaactacc cgaagcacac ccggttcacg gacttcgtgc 2340 cgatgcacgc gctcctgccg agctgctcgg cgatcatcca ccacggcggg gcgggcacct 2400 acgcgaccgc cgtgatcaac gcggtgccgc aggtcatgct cgccgagctg tgggacgcgc 2460 cggtcaaggc gcgggccgtc gccgagcagg gggcggggtt cttcctgccg ccggccgagc 2520 tcacgccgca ggccgtgcgg gacgccgtcg tccgcatcct cgacgacccc tcggtcgcca 2580 ccgccgcgca ccggctgcgc gaggagacct tcggcgaccc caccccggcc gggatcgtcc 2640 ccgagctgga gcggctcgcc gcgcagcacc gccgcccgcc ggccgacgcc cggcactgag 2700 ccgcacccct cgccccaggc ctcacccctg tatctcatat gtctagttaa ctcgccacgc 2760 cgaccgttat caccggcgcc ctgctgctag tttccgagaa tgaagggaat agtcctggcc 2820 ggcgggagcg gaactcggct gcatccggcg acctcggtca tttcgaagca gattcttccg 2880 gtctacaaca aaccgatgat ctactatccg ctgtcggttc tcatgctcgg cggtattcgc 2940 gagattcaaa tcatctcgac cccccagcac atcgaactct tccagtcgct tctcggaaac 3000 ggcaggcacc tgggaataga actcgactat gcggtccaga aagagcccgc aggaatcgcg 3060 gacgcacttc tcgtcggagc cgagcacatc ggcgacgaca cctgcgccct gatcctgggc 3120 gacaacatct tccacgggcc cggcctctac acgctcctgc gggacagcat cgcgcgcctc 3180 gacggctgcg tgctcttcgg ctacccggtc aaggaccccg agcggtacgg cgtcgccgag 3240 gtggacgcga cgggccggct gaccgacctc gtcgagaagc ccgtcaagcc gcgctccaac 3300 ctcgccgtca ccggcctcta cctctacgac aacgacgtcg tcgacatcgc caagaacatc 3360 cggccctcgc cgcgcggcga gctggagatc accgacgtca accgcgtcta cctggagcgg 3420 ggccgggccg aactcgtcaa cctgggccgc ggcttcgcct ggctggacac cggcacccac 3480 gactcgctcc tgcgggccgc ccagtacgtc caggtcctgg aggagcggca gggcgtctgg 3540 atcgcgggcc ttgaggagat cgccttccgc atgggcttca tcgacgccga ggcctgtcac 3600 ggcctgggag aaggcctctc ccgcaccgag tacggcagct atctgatgga gatcgccggc 3660 cgcgagggag ccccgtgagg gcacctcgcg gccgacgcgt tcccacgacc gacagcgcca 3720 ccgacagtgc gacccacacc gcgacccgca ccgccaccga cagtgcgacc cacaccgcga 3780 cctacagcgc gaccgaaagg aagacggcag tgcggcttct ggtgaccgga ggtgcgggct 3840 tcatcggctc gcacttcgtg cggcagctcc tcgccggggc gtaccccgac gtgcccgccg 3900 atgaggtgat cgtcctggac agcctcacct acgcgggcaa ccgcgccaac ctcgccccgg 3960 tggacgcgga cccgcgactg cgcttcgtcc acggcgacat ccgcgacgcc ggcctcctcg 4020 cccgggaact gcgcggcgtg gacgccatcg tccacttcgc ggccgagagc cacgtggacc 4080 gctccatcgc gggcgcgtcc gtgttcaccg agaccaacgt gcagggcacg cagacgctgc 4140 tccagtgcgc cgtcgacgcc ggcgtcggcc gggtcgtgca cgtctccacc gacgaggtgt 4200 acgggtcgat cgactccggc tcctggaccg agagcagccc gctggagccc aactcgccct 4260 acgcggcgtc caaggccggc tccgacctcg ttgcccgcgc ctaccaccgg acgtacggcc 4320 tcgacgtacg gatcacccgc tgctgcaaca actacgggcc gtaccagcac cccgagaagc 4380 tcatccccct cttcgtgacg aacctcctcg acggcgggac gctcccgctg tacggcgacg 4440 gcgcgaacgt ccgcgagtgg gtgcacaccg acgaccactg ccggggcatc gcgctcgtcc 4500 tcgcgggcgg ccgggccggc gagatctacc acatcggcgg cggcctggag ctgaccaacc 4560 gcgaactcac cggcatcctc ctggactcgc tcggcgccga ctggtcctcg gtccggaagg 4620 tcgccgaccg caagggccac gacctgcgct actccctcga cggcggcgag atcgagcgcg 4680 agctcggcta ccgcccgcag gtctccttcg cggacggcct cgcgcggacc gtccgctggt 4740 accgggagaa ccgcggctgg tgggagccgc tcaaggcgac cgccccgcag ctgcccgcca 4800 ccgccgtgga ggtgtccgcg tgagcagccg cgccgagacc ccccgcgtcc ccttcctcga 4860 cctcaaggcc gcctacgagg agctctctag tgggaatcgc ggaagcggcc gggttcggcg 4920 ccgtcctgga tcacaatgat atggggaatt cccgcgatga gcgaagcaat gggatcggta 4980 ccgacggccg gcagtgaagt ctcctcgacc tgcgcgtttc tgtcctggtt ggacgcgcgc 5040 cgccgggcca atcgcctgac ggtggaacac gtaccgttca gggagttatc ggggtggcaa 5100 ttcgacgaga acacggggaa cctccgacat accagcggtc gtttcttctc catcgaagga 5160 ctccgggtac gcacggacca ctgctggttc ggaagctgga cccagcccat tatcgtgcaa 5220 ccggagatag gcattctcgg cctcctggtc aagaggttcg acggcatcct gcacgtcctg 5280 gtgcaggcaa agaacgaacc gggtaatatc ggcggccttc agctctcccc caccgtccag 5340 gccactcgca gcaattacac ccgcgtccac cgcggcggcg gtgtcagata cctggagtac 5400 ttcgcgtccc cccgcgggcg cggtcgggtc ctcgcggacg tcctccaatc cgagcagggc 5460 tcctggttcc tgcacaagcg gaaccggaac atggtggtcg aggccctgga cgacgtgccc 5520 ctcgacgacg acttccactg gatcagcctc ggcgggctgc ggaagctgct gctgaggccg 5580 catctggtga acatggacac ccgcacggtg ctgtcctgcc ttcccccgga tccggcaccg 5640 gacggccggc agccgccggc gcccgcggct cccttcgccg ccgcggtcac gcggtccctc 5700 acccggggtg ccaccgcctt gcacaccatg ggcgagatcc tcggctggct gaccgacgag 5760 cggtcccggc gggaactggt gcagcagcgg gtgccgctgg aggagaccgc gttcagcggc 5820 tggcggcgtg acgaccacgc catcgcgcac aaggacggcg actacttccg ggtcatcggg 5880 gtgagcgtcc gggccagcag ccgggaggtg tcctcgtgga gccagccgtt gctggccccc 5940 gtcggccccg gtctggccgc cttcgtcacc aggcggatcc gcggcgtcct ccacgtcctg 6000 ctgcacgccc gcaccgaagc cggcctgctc aacggcccgg agatggcacc gaccgtgcag 6060 tgccgcccgc tcaactaccg tgcggtgccc gccgagtacc ggcccgccta cctcgactac 6120 gtgctgtcgg ccgatcccgg acgcatccgc tacgacaccc tccagtcgga ggagggcggc 6180 cgcttccacc acgcggagaa ccgctacgtc gtggtggagg ccgaggacga cttcccggtc 6240 gaggtgcccc gcgacttccg ctggctcacc ctgcaccaga tcctcgccct gctgcaccac 6300 agcaactatg tcaacgtgga ggcgcgcagc ctcgtcgcct gcatccagcc tgagctgatc 6360 tagtgctagc aagggaaccc catgccctcc ccccgtctgc gcttcggtgt gctgggtgcc 6420 gccgacatcg ccctgcgccg caccgtgccc gcgctgctcg cccacccgga cgtcaccgtg 6480 gtcgcggtct ccagccggga cacggcccgc gccgcccgtt tcgccgcggc gttcgggtgc 6540 gaggcggtcc cgggccacca ggcgctgctg gaccgcgacg acatcgacgc gctgtacgtc 6600 ccgctgccgg tgatggtgca cacgccctgg gtggaggcgg cgctgctgcg gggcaggcac 6660 gtcctggtgg agaagccgct gaccgcgacc cgctccggag ccgaggacct gatcgccctg 6720 gcacgctccc gcggcctggt cctgatggag aacttcacgt cgctgcacca cgcacagcac 6780 ggcaccgtca cggacctcct gcgggacggg acgatcggcg aactgcgctc gctgtccgcg 6840 gcgttcacga tcccgccgaa gccggagggc gacatccggt accagcccga cgtgggcgga 6900 ggcgccctgc tcgacatcgg gatctacccc ctgcgggcgg cactgcactt cctgggcccc 6960 gacctgcacg cggccggcgc ggtcctgcgt cgggagcggc gccggaacgt ggtggtctcc 7020 ggccacgtgc tgctcaccac accgcacggc gtcgtggccg agctggcctt cggcatggag 7080 cacgcctacc gctcggagta caccctcttc ggcacggccg gccgcctgcg cctggaccgt 7140 gccttcaccc cgcccgagac ccaccggcca cgtgtggaga tccaccggca ggacgccctg 7200 gacatcgtcg acctgccgcc ggacgcgcaa ttcgccaacc tcgtccggga cttcgtactg 7260 gctgtccgcg agggtcccgg ccggctcaca cagcaccacg ccgacgccgt acgccaagcc 7320 gatctcgtcg agcgcgtcat ggcggtggcg cgggtgcgct ggtgctgtct agtatcgctc 7380 cgagcccgaa gggaaaatcg agtgcccaat tcggcagaat cgggatcgat ggagttactc 7440 gacgtcgacg gggcctggtt atacaccccg gaaatcatgc gggacgaacg gggagaattc 7500 ctcgaatggt tccggggtcg gacattccag gagaagatcg gccaccccct ctcgctggcc 7560 caggccaact gctcggtgtc ccgcaaggcg ttctgcgcgg catccacttc gccgacgccc 7620 ccgcccggcc aggccaagta cgtcacctgc gcctccggca ccgtgctcga cgtggtcgtc 7680 gacgtacgcc ggggctcgcc caccttcggc cgatgggccg ccgtccgact cgacgcggcc 7740 cgccaccagg ggctctacct ggccgaagga ctcggccacg cgttcatggc cctcaccgac 7800 gacgccacgg tcgtctacct ctgctcacag ccctacgtgg ccgaggccga gcgggccgta 7860 gaccctctcg acccggcgat cggcatcgaa tggccgacgg acatcgacat cgtccctgtc 7920 ggcgaaggga cacccacgca ccgtccctgg cgcaggccgc ggagacccgg catcctgccg 7980 gactacgagg gagtgcccgg cgccttacat cgcggaggcg gccggcgtgg gaccggcccg 8040 tgaaggccct cgtactggcc ggctctagtt acgtagtacc gcgacaaccg cgcctggtgg 8100 gaacccctga agaagcggcc ggccggtccc gccgcccccc cgagaggcag cggcccatga 8160 gatggctgat caccggcgcc gccggaatgc tgggccggga actcgtccgg cgcctcgccg 8220 agaacgagga ggacgtcgcg gccctcggcc acgaccacct cgacgtcacc cgaccctccg 8280 ccgtgcgggc ggcactcgcc gagcaccgtc ccgggatcgt cgtcaactgc gccgcctaca 8340 cggccgtcga cgacgccgag acggacgagg ccgccgctgc cctcctcaac gccgaggcgc 8400 cccggctgct ggccgagggc ctgcgccccc accggcggca cggcctcgtc cacctgtcca 8460 ccgactacgt ctttcccggc gacgcccgca ccccctacgc cgaggaccac cccacggctc 8520 cccgcagcgc ctacggacgc accaaacggg acggcgagca agcggtgctg acggcactgc 8580 ccaccgccac cgtgctgcgc accgcctggc tgtacgggcg caccggccgc agcttcgtcc 8640 gcacgatgat cgaacgggag gcgcgcggcg gagccatcga cgtcgtcgcc gaccagcgcg 8700 gccagcccac ctggaccggc gacctcgccg accgcatcat cgccgtcggc cggcaccccg 8760 gcgtccacgg catcctgcac gccaccaacg ccggctccgc cacctggtac gacctggcac 8820 aagaggtctt ccggctcctc gacgccgacc ccgggcgggt ccggcccacc accggcgccg 8880 ccttccgcag acccgccccc cgccccgcct acagcgtcct cggccacgac cgctggcgcg 8940 ggaccggcct ggcacccctg cgtgactggc gctcggccct gcgcgaggcg ttccccgaca 9000 tcctcgccgc ggaacaccca ccgacccggc gaggagcagc atgaaacgag gcgtgcacga 9060 cctggccctc ttccctaggt ctaga 9085 <210> 21 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 ggcaagctta gcggggcgac tggcgtgccc act 33 <210> 22 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 ggtctgcagt caccgtgggt tctgccatct ctt 33 <210> 23 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 gctggtaccg gatgttccct ccgggccacc gtc 33 <210> 24 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 tgagaattcc ctcgccgtcc tgcccgcgct tgg 33 <210> 25 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 ttaattaaga tatcaccggc aaggaaggac acgacgcc 38 <210> 26 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 tctagacata tggcgcagat acaggggtga ggcctg 36 <210> 27 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 ttaattaaac tagtatcgat gacggtggcc cggaggg 37 <210> 28 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 tctagatgcg ggtcagcgca ggaagccgcg 30 <210> 29 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 ttaattaaac tagttaactc gccacgccga ccgtt 35 <210> 30 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 tctagagagc tcctcgtagg cggcctt 27 <210> 31 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 ttaattaaac tagtcaggtc tccttcgcgg acggcctc 38 <210> 32 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 tctagaacct gactaggcct ggtcgacccg 30 <210> 33 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 ttaattaaac tagtccccag gcctcacccc tgtatctg 38 <210> 34 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 tctagagaat tcgctcaggc ggggacgccg acgaag 36 <210> 35 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 ttaattaaac tagtatcgat atcgctccga gcccgaaggg a 41 <210> 36 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 tctagagccg gccagtacga gggcctt 27 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 ttaattaaac tagtgtaccg cgacaaccgc 30 <210> 38 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 tctagagaag agggccaggt cgtgcacgc 29 <210> 39 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 ttaattaaac tagtatcgat gggaatcgcg gaagcg 36 <210> 40 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 tctagaatca gctcagggcc tggatgc 27 <210> 41 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 ttaattaaac tagtggtcgt cggcatctgc g 31 <210> 42 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 tctagactcg gttcctcttg tgctcactgc 30 <210> 43 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 ttaattaaac tagtacagag atccaggacg acgca 35 <210> 44 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 tctagatcag atacggacgg cggaggt 27 <210> 45 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 ttaattaaac tagtaaggga accccatgcc ctccc 35 <210> 46 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 tctagaatca gcaccagcgc acccgcgcca 30

Claims (4)

A norbomycin derivative compound represented by the following formula (1), or a pharmaceutically acceptable salt thereof.
[Chemical Formula 1]

Wherein R is

,

or

to be. A composition for antimicrobial use comprising a compound of formula (I) or a pharmaceutically acceptable salt thereof.
[Chemical Formula 1]

Wherein R is

,

or

to be. 3. The composition of claim 2, wherein the composition has an antimicrobial activity against an erythromycin-sensitive strain and an erythromycin-resistant strain. 3. The composition of claim 2 wherein the composition is selected from the group consisting of E. faucetum ATCC 19434, E. paella City Stadium P00558, S. Aureus ATCC 25923 and S. aureus 0.0 &gt; P00740. &Lt; / RTI &gt;

Images