KR20120081896A - Primer and kit for diagnosis of erwinia pyrifoliae and diagnosis method of erwinia pyrifoliae using thereof - Google Patents

Primer and kit for diagnosis of erwinia pyrifoliae and diagnosis method of erwinia pyrifoliae using thereof Download PDF

Info

Publication number
KR20120081896A
KR20120081896A KR1020110003280A KR20110003280A KR20120081896A KR 20120081896 A KR20120081896 A KR 20120081896A KR 1020110003280 A KR1020110003280 A KR 1020110003280A KR 20110003280 A KR20110003280 A KR 20110003280A KR 20120081896 A KR20120081896 A KR 20120081896A
Authority
KR
South Korea
Prior art keywords
primer
lane
pyrifoliae
dna
hrpn
Prior art date
Application number
KR1020110003280A
Other languages
Korean (ko)
Inventor
임춘근
박덕환
타파 쉬리
조준모
한준희
Original Assignee
강원대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 강원대학교산학협력단 filed Critical 강원대학교산학협력단
Priority to KR1020110003280A priority Critical patent/KR20120081896A/en
Publication of KR20120081896A publication Critical patent/KR20120081896A/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

PURPOSE: A primer and a method for diagnosing Erwinia pyrifoliae are provided to distinguish the disease from similar diseases and to quickly and accurately detect the disease. CONSTITUTION: A primer for diagnosing Erwinia pyrifoliae contains: a combination of nucleic acid fragments of sequence numbers 1 and 2; a combination of nucleic acid fragments of sequence numbers 3 and 4; or a combination of nucleic acid fragments of sequence numbers 5 and 6. A kit for diagnosing contains the primer.

Description

가지검은마름병 진단용 프라이머, 이를 이용한 가지검은마름병 진단키트 및 가지검은마름병 진단방법{Primer and kit for diagnosis of Erwinia pyrifoliae and diagnosis method of Erwinia pyrifoliae using thereof} Primer for the diagnosis of eggplant blight, primer kit for diagnosis of eggplant blight and diagnosis of eggplant blight by using the same {{Primer and kit for diagnosis of Erwinia pyrifoliae and diagnosis method of Erwinia pyrifoliae using lamb}

본 발명은 PCR(중합효소 연쇄반응)을 이용하여 가지검은마름병(Erwinia pyrifoliae) 세균을 검출하고, 그에 의한 감염을 진단하는 방법 및 이에 필요한 프라이머(primer)에 관한 것이다. 구체적으로, 특이 유전자 표식자(specific genetic markers)를 이용하여 가지검은마름병(Erwinia pyrifoliae)을 진단하기 위한 프라이머 및 이를 이용한 가지검은마름병 진단키트와 이를 이용한 특이적 중합효소연쇄반응 기반(PCR-based)의 가지검은마름병 진단 방법에 관한 것으로, 특히 유사한 병징을 가지는 다른 병과 구별하여 가지검은마름병(Erwinia pyrifoliae)을 매우 특이적이고 민감하게 진단할 수 있는 검출기술에 관한 것이다.
The present invention relates to a method for detecting a branched black blight ( Erwinia pyrifoliae ) bacteria using a PCR (polymerase chain reaction), and diagnosing an infection thereby, and a primer required therefor. Specifically, Erwinia using specific genetic markers pyrifoliae ) is a primer for diagnosing branched black blight and a specific polymerase chain reaction-based (PCR-based) branched black diagnostic kit using the same. Especially, it is distinguished from other diseases with similar symptoms. The present invention relates to a detection technology that can diagnose a very specific and sensitive diagnosis of black blight ( Erwinia pyrifoliae ).

일반적으로 에르비니아속(Erwinia)의 지상부병 원인세균은 배나무를 비롯한 사과나무, 살구나무 등 70여 종의 식물을 침해하는 세균병으로 한국에서는 배나무에 피해가 많다. 꽃, 잎, 가지, 열매, 줄기에 발생하며, 새로운 가지에 특히 발병이 많다. 처음 월동한 부위 또는 화방에서 발생하여 잎맥을 따라 진전하면 잎은 시들고 흑색으로 변하여 마른다. 이후에 1년 안에 나무를 고사시킬 수 있다. 따라서, 이 병을 빠른 시간내에 검출하고 진단하는 기술을 개발하여 미리 방제를 함으로써 경제적 손실을 줄이고 농가의 소득과 과일의 품질을 향상시킬 수 있다.Generally, the terrestrial causative bacteria of the genus Erwinia It is a bacterial disease that invades over 70 species of plants, including pear trees, apple trees, and apricot trees. Occurs on flowers, leaves, branches, fruits and stems, and new branches are particularly susceptible. It occurs in the first winterized area or flower garden, and progresses along the leaf vein. The leaves wither and turn black and dry. The tree can then be killed within a year. Therefore, by developing a technique for detecting and diagnosing the disease in a short time and controlling in advance, it is possible to reduce economic losses and improve farm income and fruit quality.

이와 같은 식물 병원세균을 진단하는 방법은 다양한 방법이 알려져 있다. 일반적으로, ELISA는 세균 감염 식물로부터 병원세균을 간단하고 많은 양을 동시에 확인할 수 있으므로 가장 널리 사용되는 방법 중 하나이다. 그러나 이 방법은 진단하려고 하는 세균의 종류에 따라 각각 특이항체를 생산해야 하는 단점이 있다. 또한, 이 방법은 검출 대상의 세균 농도가 일정 수준 이상이 된 경우에 사용할 수 있으므로, 세균 농도가 낮은 병징 발현 전 단계인 잠재적 감염단계에서는 검출이 용이하지 않다. Various methods of diagnosing such plant pathogens are known. In general, ELISA is one of the most widely used method because it is possible to identify a simple and large amount of pathogens from bacterial plants. However, this method has the disadvantage of producing specific antibodies depending on the type of bacteria to be diagnosed. In addition, since this method can be used when the concentration of bacteria to be detected is above a certain level, detection is not easy at the potential infection stage, which is a stage before the onset of low bacterial concentration.

반면에, PCR 방법은 적은 양의 세균 자체 또는 세균 감염 식물체 시료만으로도 감염 여부를 확인할 수 있어, 계절이나 식물의 조직, 또는 병징의 정도에 관계없이 세균을 검출하는 것이 가능하여 경제적이고, 검사 신속성 및 정확성 면에서 우수하다. 따라서 이와 같은 PCR 방법을 통해 보다 효과적으로 감염세균 검출용 특이적 검출반응을 위한 특정 프라이머 세트가 요구된다.On the other hand, the PCR method can confirm the infection with only a small amount of bacteria or bacterial infected plant samples, which makes it possible to detect bacteria regardless of the season, the tissue of the plant, or the degree of symptom. Excellent in accuracy Therefore, a specific primer set for a specific detection reaction for detecting bacterial infection is required through such a PCR method more effectively.

가지검은마름병 유발균(Erwinia pyrifoliae)에 의한 병징은 배나무 화상병 유발균(E. amylovora)과 Japanese Erwinia species가 일으키는 병징(bacterial shoot blight of pear)과 유사하며, 이들 세 가지 병원세균 및 이들에 의한 병징은 각각 형태적 또는 생화학적인 특징 및 외형적 병징 특성으로는 구분할 수가 없었다.Eggplant black blight-causing bacteria ( Erwinia) the pyrifoliae) Symptoms caused by E. amylovora and Japanese Erwinia Similar to the bacterial shoot blight of pear, these three pathogens and their symptoms were indistinguishable in morphological or biochemical and external features.

한편, 가지검은마름병 유발균(Erwinia pyrifoliae)과 배나무 화상병 유발균(E. amylovora)의 차이점은 16S-23S ITS 복사영역과 DNA-DNA 교잡정보, plasmid DNA patterns, 그리고 RFLP와 기주범위분석을 사용하여 증명되었다. 따라서, 최종적으로 이 두 종의 병원세균은 독립된 종으로 구분되었다.In contrast , the differences between Erwinia pyrifoliae and E. amylovora induced the use of 16S-23S ITS copying region, DNA-DNA hybridization information, plasmid DNA patterns, and RFLP and host range analysis. Proved. Therefore, the two pathogens were finally divided into independent species.

그러나, 가지검은마름병원세균만을 빠른 시간 내에 정확하게 검출하고 진단하는 기술개발은 초기단계에 지나지 않거나, 종래의 진단 방법은 유효성이 현저히 저하되는 문제점이 있었다. 따라서 가지검은마름병(Erwinia pyrifoliae) 진단기술을 개발하여 미리 방제대책을 강구함으로써 경제적 손실을 줄이고 농가의 소득과 과일의 품질을 향상시킬 수 있을 것으로 기대된다.
However, the development of technology for accurately detecting and diagnosing only eggplant black bacterium bacteria within a short time is only an initial stage, or the conventional diagnostic method has a problem that the effectiveness of the conventional method is significantly lowered. Therefore, it is expected to reduce the economic loss and improve the income of farmers and the quality of fruits by developing the diagnosis technology for eggplant black blight ( Erwinia pyrifoliae ).

1. Shrestha R. et al., 2003, Erwinia pyrifoliae , a causal endermic pathogen of shoot blight of Asia pear tree in Korea. Plant Pathol. J. 19;294-300.Shrestha R. et al., 2003, Erwinia pyrifoliae, a causal endermic pathogen of shoot blight of Asia pear tree in Korea. Plant Pathol. J. 19; 294-300. 2. Kim et al., 1999, Erwinia pyrifoliae sp. nov., a novel pathogen that affects Asian pear trees (Pyrus pyrifolia Nakai). Int J Syst Bacteriol 49:899-906.2. Kim et al., 1999, Erwinia pyrifoliae sp. nov., a novel pathogen that affects Asian pear trees (Pyrus pyrifolia Nakai). Int J Syst Bacteriol 49: 899-906.

따라서, 본 발명의 목적은 가지검은마름병을 빠른 시간내에 정확하게 검출하고 진단하기 위하여 유전자 표식자(specific genetic markers)를 이용한 가지검은마름병(Erwinia pyrifoliae) 진단용 프라이머를 제공하는 데 있다.Accordingly, an object of the present invention is to use Erwinia using specific genetic markers to accurately detect and diagnose eggplant blight. pyrifoliae ) to provide a diagnostic primer.

본 발명의 다른 목적은 상기 목적의 가지검은마름병(Erwinia pyrifoliae) 진단용 프라이머를 이용한 가지검은마름병 진단용 키트를 제공하는 데 있다.Another object of the present invention is the black blight of the above object ( Erwinia) pyrifoliae ) to provide a black blight diagnostic kit using a diagnostic primer.

본 발명의 다른 목적은 상기 목적의 가지검은마름병(Erwinia pyrifoliae) 진단용 프라이머를 이용한 특이적 중합효소연쇄반응 기반(PCR-based)의 가지검은마름병 진단 방법을 제공하는 데 있다.
Another object of the present invention is the black blight of the above object ( Erwinia) pyrifoliae ) is to provide a method for diagnosing blight-like blight with specific polymerase chain reaction (PCR-based) using a primer for diagnosis.

상기 목적을 달성하기 위한 본 발명의 일 실시예에 따르면, 서열목록 제1서열로 표시되는 hrpNEPF 핵산단편과 서열목록 제2서열로 표시되는 hrpNEPR 핵산단편의 조합(hrpNEPF/hrpNEPR 프라이머), 서열목록 제3서열로 표시되는 hrcCEPF 핵산단편과 서열목록 제4서열로 표시되는 hrcCEPR 핵산단편의 조합(hrcCEPF/hrcCEPR 프라이머) 및 서열목록 제5서열로 표시되는 EpERF 핵산단편과 서열목록 제6서열로 표시되는 EpERR 핵산단편의 조합(EpERF/EpERR 프라이머)으로 이루어진 군에서 선택된 어느 하나 이상의 조합을 포함하는 가지검은마름병 진단용 프라이머를 제공하는 것을 특징으로 한다.According to an embodiment of the present invention for achieving the above object, a combination of hrpN EP F nucleic acid fragment represented by SEQ ID NO: 1 sequence and hrpN EP R nucleic acid fragment represented by SEQ ID NO: 2 sequence (hrpN EP F / hrpN EP R primer), a combination of hrcC EP F nucleic acid fragment represented by SEQ ID NO: 3 and hrcC EP R nucleic acid fragment represented by SEQ ID NO: 4 (hrcC EP F / hrcC EP R primer) and SEQ ID NO: 5 It is characterized by providing a branched black blight diagnostic primer comprising any one or more combinations selected from the group consisting of a combination of EpERF nucleic acid fragments represented by EpERRF nucleic acid fragments represented by SEQ ID NO: 6 sequence (EpERF / EpERR primers) .

상기 목적을 달성하기 위한 본 발명의 일 실시예에 따르면, 상기 기술한 가지검은마름병 진단용 프라이머를 포함하는 가지검은마름병 진단용 키트를 제공하는 것을 특징으로 한다.According to an embodiment of the present invention for achieving the above object, it is characterized by providing a branch black blight diagnostic kit comprising the above-mentioned black blight diagnostic primer.

상기 목적을 달성하기 위한 본 발명의 일 실시예에 따르면, 상기 기술한 가지검은마름병 진단용 프라이머를 이용하여 중합효소 연쇄반응을 수행하는 단계를 포함하는 가지검은마름병 진단방법를 제공하는 것을 특징으로 한다.
According to an embodiment of the present invention for achieving the above object, it characterized in that it provides a method for diagnosing branched black blight comprising the step of performing a polymerase chain reaction using the primer for diagnosing the branched black blight.

본 발명에 따른 가지검은마름병 진단용 프라이머, 이를 포함하는 가지검은마름병 진단키트 및 이를 이용한 가지검은마름병 진단 방법은 가지검은마름병을 빠른 시간내에 정확하게 검출하고 진단하여 미리 방제를 함으로써 경제적 손실을 줄이고 농가의 소득과 과일의 품질을 향상시킬 수 있는 효과가 있다.
Eggplant black blight diagnostic primer according to the present invention, eggplant black blight diagnostic kit comprising the same, and eggplant black blight disease diagnostic method using the same to accurately detect and diagnose eggplant black blight disease in a short time in advance to reduce the economic loss and income of farmers It has the effect of improving the quality of fruit.

도 1은 본 발명의 프라이머(hrpNEPF/hrpNEPR 프라이머 및 hrcCEPF/hrcCEPR 프라이머)가 E. pyrifoliae에 특이성을 나타내는지의 여부 실험 결과 사진으로서, A는 hrpNEPF/hrpNEPR 프라이머를, B는 hrcCEPF/hrcCEPR 프라이머를 사용하였고, 레인(Lane)1 내지 레인 10은 E. pyrifoliae 균주들(strains : WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16)에 대한 결과이며, 레인 11 내지 레인 30은 표 1에 기재된 균주에 대한 결과이고, 레인 M은 사이즈 마커(size marker : 1kb DNA ladder, Promega™)이다.
도 2는 본 발명의 프라이머(EpERF/EpERR)가 E. pyrifoliae에 특이성을 나타내는지의 여부 실험 결과 사진으로서, A는 EpERF/EpERR를 개발하기 위해 사용된 일반적 ERIC1R/ERIC2 프라이머를, B는 EpERF/EpERR 프라이머를 사용하였고, 레인 1 내지 레인 10은 E. pyrifoliae 균주들(strains : WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16)에 대한 결과이며, 레인 11 내지 레인 30은 표 1에 기재된 균주에 대한 결과이고, 레인 M은 사이즈 마커(size marker : 1kb DNA ladder, Promega™)이다.
도 3은 본 발명에 따른 프라이머(hrpNEPF/hrpNEPR 프라이머와 hrcCEPF/hrcCEPR 프라이머)의 특이성 검출 한계를 측정한 결과를 나타내는 사진이다.
도 3A는 DNA 농도별 결과로서, i은 hrpNEPF/hrpNEPR 프라이머, ii는 hrcCEPF/hrcCEPR 프라이머를 사용하였고, 레인 1 내지 레인 9는 순서대로 50 ng, 5 ng, 0.5 ng, 50 pg, 5 pg, 0.5 pg, 50 fg, 5 fg, 0.5 fg의 농도를 의미하고, 레인 10은 물(대조구)이다.
도 3B는 순수배양 현택액의 농도별 결과로서, i은 hrpNEPF/hrpNEPR 프라이머, ii는 hrcCEPF/hrcCEPR 프라이머를 사용하였고, 레인 1 내지 레인 7은 순서대로 1×106 CFU/ml, 1×105 CFU/ml, 1×104 CFU/ml, 1×103 CFU/ml, 1×102 CFU/ml, 1×101 CFU/ml, 1×100 CFU/ml의 농도를 의미하고, 레인 8은 물(대조구)이며, 레인 M은 사이즈 마커(1kb DNA ladder, Promega™)이다.
도 4는 본 발명에 따른 EpERF/EpERR 프라이머의 특이성 검출 한계를 측정한 결과를 나타내는 사진이다.
도 4A는 EpERF/EpERR 프라이머의 DNA 농도별 결과로서, 레인 1 내지 레인 9는 순서대로 50 ng, 5 ng, 0.5 ng, 50 pg, 5 pg, 0.5 pg, 50 fg, 5 fg, 0.5 fg의 농도를 의미하고, 레인 10은 물(대조구)이다.
도 4B는 EpERF/EpERR 프라이머의 순수배양 현택액의 농도별 결과로서, 레인 1 내지 레인 7은 순서대로 1×106 CFU/ml, 1×105 CFU/ml, 1×104 CFU/ml, 1×103 CFU/ml, 1×102 CFU/ml, 1×101 CFU/ml, 1×100 CFU/ml의 농도를 의미하고, 레인 8은 물(대조구)이며, 레인 M은 사이즈 마커(1kb DNA ladder, Promega™)이다.
도 5는 본 발명에 따른 유전자의 dot blotting 분석 결과 사진으로서, A는 hrpNEPF, B는 hrpNEPR, C는 hrcCEPF를 프로브로 사용하였고, 레인 1 내지 레인 10은 E. pyrifoliae 균주들(strains : WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16)에 대한 결과이며, 레인 11 내지 레인 30은 표 1에 기재된 균주들에 대한 결과이다.
도 6는 본 발명의 프라이머(hrpNEPF/hrpNEPR 프라이머와 hrcCEPF/hrcCEPR 프라이머)를 이용한 가지검은마름병 진단의 유효성을 확인한 실험 결과를 나타낸 사진이다.
도 6A는 혼합 균주 현탁액에 대한 결과로, i은 hrpNEPF/hrpNEPR 프라이머, ii는 hrcCEPF/hrcCEPR 프라이머를 사용하였고, 레인 1은 E. pyrifoliae WT3와 E. amylovora ATCC 15580의 혼합 균주 현탁액, 레인 2는 E. pyrifoliae WT15와 P. stewartii subsp. stewartii LMG 2712의 혼합 균주 현탁액, 레인 3은 E. pyrifoliae Ep1와 B. rubrifaciens LMG 5110의 혼합 균주 현탁액, 레인 4는 E. pyrifoliae Ep16와 P. carotovorum subsp. carotovorum ATCC 15713의 혼합 균주 현탁액, 레인 5는 E. amylovora ATCC 15580 균주 현탁액, 레인 6은 P. stewartii subsp. stewartii LMG 2712 균주 현탁액, 레인 7은 B. rubrifaciens LMG 5110 균주 현탁액, 레인 8은 P. carotovorum subsp. carotovorum ATCC 15713 균주 현탁액에 나타난 결과이다.
도 6B는 접종 3일 후 인공적으로 감염시킨 식물체로부터 얻은 추출물에 대한 결과로, i은 hrpNEPF/hrpNEPR 프라이머, ii는 hrcCEPF/hrcCEPR 프라이머를 사용하였고, 레인 1 내지 레인 5는 E. pyrifoliae strains(WT3, WT15, WT18, Ep1, Ep16)로부터 감염시킨 식물체로부터 얻은 추출물에 대한 결과, 레인 6은 E. amylovora ATCC 15580, 레인 7은 P. stewartii subsp. stewartii LMG 2712, 레인 8은 P. carotovorum subsp. carotovorum ATCC 15713로부터 감염시킨 식물체로부터 얻은 추출물에 대한 결과를 나타내는 것이며, 레인 9는 비감염으로 증상이 없는 대조구, 레인 10은 E. pyrifoliae WT3의 염색체 DNA에 대한 결과를 나타내는 것이고, 레인 M은 사이즈 마커(1Kb DNA ladder, Promega™)이다.
도 7은 본 발명의 프라이머(EpERF/EpERR)를 이용한 가지검은마름병 진단의 유효성을 확인한 실험 결과를 나타낸 사진이다.
도 7A는 혼합 균주 현탁액에 대한 결과로, 레인 1은 E. pyrifoliae WT3와 E. amylovora ATCC 15580의 혼합 균주 현탁액, 레인 2는 E. pyrifoliae WT15와 P. stewartii subsp. stewartii LMG 2712의 혼합 균주 현탁액, 레인 3은 E. pyrifoliae Ep1와 B. rubrifaciens LMG 5110의 혼합 균주 현탁액, 레인 4는 E. pyrifoliae Ep16와 P. carotovorum subsp. carotovorum ATCC 15713의 혼합 균주 현탁액, 레인 5는 E. amylovora ATCC 15580 균주 현탁액, 레인 6은 P. stewartii subsp. stewartii LMG 2712 균주 현탁액, 레인 7은 B. rubrifaciens LMG 5110 균주 현탁액, 레인 8은 P. carotovorum subsp. carotovorum ATCC 15713 균주 현탁액에 나타난 결과이다.
도 7B의 i는 E. pyrifoliae에 감염된 식물체의 증상을 나타낸 사진이다.
도 7B의 ii는 접종 3일 후 인공적으로 감염시킨 식물체로부터 얻은 추출물에 대한 결과로, 레인 1 내지 레인 3은 E. pyrifoliae strains(WT3, Ep1, Ep16)을 감염시킨 미성숙 배로부터 얻은 추출물에 대한 결과, 레인 4 내지 레인 6은 E. pyrifoliae WT3를 감염시킨 미성숙 배, 가지, 잎으로부터 얻은 추출물에 대한 결과이고, 레인 7은 E. amylovora ATCC 15580, 레인 8은 비감염으로 증상이 없는 식물체, 레인 9는 대조군(물), 레인 10은 E. pyrifoliae WT3의 염색체 DNA, 레인 M은 사이즈 마커(1kb DNA ladder, Promega™)이다.1 is a photograph showing whether the primers of the present invention (hrpN EP F / hrpN EP R primer and hrcC EP F / hrcC EP R primer) is specific for E. pyrifoliae , A is a hrpN EP F / hrpN EP R Primers were used for B, hrcC EP F / hrcC EP R primer, lanes 1 to 10 were E. pyrifoliae Results for strains (WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16), lanes 11 to 30 are results for the strains listed in Table 1, and lane M is size Size marker (1kb DNA ladder, Promega ™).
2 is a photograph showing whether the primer (EpERF / EpERR) of the present invention is specific for E. pyrifoliae , A is a general ERIC1R / ERIC2 primer used to develop EpERF / EpERR, B is EpERF / EpERR Primers were used, lanes 1 to 10 were E. pyrifoliae Results for strains (WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16), lanes 11 to 30 are results for the strains listed in Table 1, and lane M is size Size marker (1kb DNA ladder, Promega ™).
Figure 3 is a photograph showing the results of measuring the specificity detection limit of the primer (hrpN EP F / hrpN EP R primer and hrcC EP F / hrcC EP R primer) according to the present invention.
FIG. 3A shows DNA concentration results, i using hrpN EP F / hrpN EP R primer, ii used hrcC EP F / hrcC EP R primer, and lanes 1 to 9 were 50 ng, 5 ng, 0.5 ng in order. , 50 pg, 5 pg, 0.5 pg, 50 fg, 5 fg, 0.5 fg, and lane 10 is water (control).
Figure 3B is the result of the concentration of the pure culture suspension, i was used hrpN EP F / hrpN EP R primer, ii is hrcC EP F / hrcC EP R primer, lanes 1 to lane 7 in order 1 × 10 6 CFU / ml, 1 × 10 5 CFU / ml, 1 × 10 4 CFU / ml, 1 × 10 3 CFU / ml, 1 × 10 2 CFU / ml, 1 × 10 1 CFU / ml, 1 × 10 0 CFU / Mean ml concentration, lane 8 is water (control) and lane M is size marker (1 kb DNA ladder, Promega ™).
Figure 4 is a photograph showing the result of measuring the specificity detection limit of the EpERF / EpERR primer according to the present invention.
4A shows the results of DNA concentrations of EpERF / EpERR primers, and lanes 1 to 9 were 50 ng, 5 ng, 0.5 ng, 50 pg, 5 pg, 0.5 pg, 50 fg, 5 fg, 0.5 fg in sequence. Lane 10 is water (control).
Figure 4B is the result of the concentration of the pure culture suspension of EpERF / EpERR primer, lanes 1 to lane 7 in order 1 × 10 6 CFU / ml, 1 × 10 5 CFU / ml, 1 × 10 4 CFU / ml, Concentrations of 1 × 10 3 CFU / ml, 1 × 10 2 CFU / ml, 1 × 10 1 CFU / ml, 1 × 10 0 CFU / ml, lane 8 is water (control), and lane M is size Marker (1 kb DNA ladder, Promega ™).
5 is a gene of the present invention As a result of dot blotting analysis, A was hrpN EP F, B was hrpN EP R, C was hrcC EP F, and lanes 1 to 10 were E. pyrifoliae. Strains (WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16) and lanes 11 to 30 are the results for the strains listed in Table 1.
Figure 6 is a photograph showing the results of experiments confirming the effectiveness of the diagnosis of black blight disease using the primer of the present invention (hrpN EP F / hrpN EP R primer and hrcC EP F / hrcC EP R primer).
FIG. 6A shows the results for the mixed strain suspension, i using hrpN EP F / hrpN EP R primer, ii using hrcC EP F / hrcC EP R primer, lane 1 E. pyrifoliae Mixed strain suspension of WT3 and E. amylovora ATCC 15580 , lane 2 is E. pyrifoliae WT15 and P. stewartii subsp. stewartii Mixed Strain Suspension of LMG 2712, Lane 3 E. pyrifoliae Ep1 and B. rubrifaciens Mixed strain suspension of LMG 5110, lane 4 is E. pyrifoliae Ep16 and P. carotovorum subsp. carotovorum Mixed strain suspension of ATCC 15713, lane 5 is E. amylovora ATCC 15580 strain suspension, lane 6 is P. stewartii subsp. stewartii LMG 2712 strain suspension, lane 7 B. rubrifaciens LMG 5110 strain suspension, lane 8 is P. carotovorum subsp. carotovorum Results shown in ATCC 15713 strain suspension.
FIG. 6B is a result of extracts from artificially infected plants 3 days after inoculation, i using hrpN EP F / hrpN EP R primers, ii used hrcC EP F / hrcC EP R primers, lanes 1 to 5 E. pyrifoliae Results for extracts from plants infected from strains (WT3, WT15, WT18, Ep1, Ep16), lane 6 for E. amylovora ATCC 15580 , lane 7 for P. stewartii subsp. stewartii LMG 2712, lane 8 shows P. carotovorum subsp. carotovorum Results are shown for extracts from plants infected from ATCC 15713, lane 9 is non-infectious control, lane 10 is for chromosomal DNA of E. pyrifoliae WT3, and lane M is size marker (1Kb). DNA ladder, Promega ™).
Figure 7 is a photograph showing the results of experiments confirming the validity of the diagnosis of black blight blight using the primer of the present invention (EpERF / EpERR).
7A is a result for mixed strain suspension, lane 1 is E. pyrifoliae Mixed strain suspension of WT3 and E. amylovora ATCC 15580 , lane 2 is E. pyrifoliae WT15 and P. stewartii subsp. stewartii Mixed Strain Suspension of LMG 2712, Lane 3 E. pyrifoliae Ep1 and B. rubrifaciens Mixed strain suspension of LMG 5110, lane 4 is E. pyrifoliae Ep16 and P. carotovorum subsp. carotovorum Mixed strain suspension of ATCC 15713, lane 5 is E. amylovora ATCC 15580 strain suspension, lane 6 is P. stewartii subsp. stewartii LMG 2712 strain suspension, lane 7 B. rubrifaciens LMG 5110 strain suspension, lane 8 is P. carotovorum subsp. carotovorum Results shown in ATCC 15713 strain suspension.
7B is a photograph showing symptoms of a plant infected with E. pyrifoliae .
7B is a result of the extract obtained from the artificially infected plants 3 days after inoculation, lanes 1 to 3 are E. pyrifoliae Results for extracts from immature embryos infected with strains (WT3, Ep1, Ep16), lanes 4 to 6 are for extracts from immature embryos, branches and leaves infected with E. pyrifoliae WT3. E. amylovora ATCC 15580 , lane 8 is a non-infectious plant with no symptoms, lane 9 is the control (water), lane 10 is the chromosomal DNA of E. pyrifoliae WT3, and lane M is the size marker (1kb DNA ladder, Promega ™).

상기 목적을 달성하기 위한 가지검은마름병 진단용 프라이머는 서열목록 제1서열로 표시되는 hrpNEPF 핵산단편과 서열목록 제2서열로 표시되는 hrpNEPR 핵산단편의 조합(이하 'hrpNEPF/hrpNEPR 프라이머'라 함), 서열목록 제3서열로 표시되는 hrcCEPF 핵산단편과 서열목록 제4서열로 표시되는 hrcCEPR 핵산단편의 조합(이하 'hrcCEPF/hrcCEPR 프라이머'라 함), 서열목록 제5서열로 표시되는 EpERF 핵산단편과 서열목록 제6서열로 표시되는 EpERR 핵산단편의 조합(이하 'EpERF/EpERR 프라이머'라 함)으로 이루어진 군에서 선택된 어느 하나 이상의 조합을 포함하는 가지검은마름병 진단용 프라이머로 특징지워진다. The branch black blight diagnostic primer for achieving the above object is a combination of hrpN EP F nucleic acid fragment represented by SEQ ID NO: 1 sequence and hrpN EP R nucleic acid fragment represented by SEQ ID NO: 2 sequence (hereinafter 'hrpN EP F / hrpN EP R primer '), a combination of hrcC EP F nucleic acid fragment represented by SEQ ID NO: 3 and hrcC EP R nucleic acid fragment represented by SEQ ID NO: 4 (hereinafter, referred to as' hrcC EP F / hrcC EP R primer' ), A combination of EpERF nucleic acid fragments represented by SEQ ID NO: 5 and EpERR nucleic acid fragments represented by SEQ ID NO: 6 (hereinafter referred to as "EpERF / EpERR primers"). Eggplant black is characterized by a primer for diagnosing blight.

또한 본 발명의 목적을 달성하기 위한 가지검은마름병 진단용 키트 및 가지검은마름병 진단방법은 상기 프라이머를 포함하는 가지검은마름병 진단용 키트 및 상기 프라이머를 이용하여 중합효소 연쇄반응을 수행하는 단계를 포함하는 가지검은마름병 진단방법으로 특징지워진다.In addition, the branch black blight diagnostic kit and branch black blight diagnostic method for achieving the object of the present invention is a branch black bung diagnostic kit comprising the primer and the branched black polymer comprising the step of performing a polymerase chain reaction using the primer Characterized by the diagnosis of blight.

상기에서 제조된 hrpNEPF/hrpNEPR 프라이머, hrcCEPF/hrcCEPR 프라이머 및 EpERF/EpERR 프라이머의 가지검은마름병의 진단 유의성을 실험한 결과, Erwinia pyrifoliae종의 세균들은 증폭이 되었지만, 다른 세균들은 어떠한 밴드도 형성하지 않았다. 또한, 각각의 PCR 산물들을 시퀀스(sequence)하고 실험한 결과, Erwinia pyrifoliae의 DNA는 증폭이 되었지만, 다른 세균들은 안 되었음을 확인하였다. 따라서, hrpNEPF/hrpNEPR 프라이머, hrcCEPF/hrcCEPR 프라이머 및 EpERF/EpERR 프라이머가 가지검은마름병의 진단을 위해 사용될 수 있는 표식자임을 확인하였다.As a result of diagnosing the diagnostic significance of black blight of hrpN EP F / hrpN EP R primer, hrcC EP F / hrcC EP R primer, and EpERF / EpERR primer prepared above, the bacteria of Erwinia pyrifoliae species were amplified, but other bacteria They did not form any bands. In addition, as a result of sequencing and experimenting with each PCR product, Erwinia The DNA of pyrifoliae was amplified but not by other bacteria. Thus, it was confirmed that the hrpN EP F / hrpN EP R primer, the hrcC EP F / hrcC EP R primer, and the EpERF / EpERR primer are markers that can be used for the diagnosis of blight blight.

또한, hrpNEPF/hrpNEPR 프라이머, hrcCEPF/hrcCEPR 프라이머 및 EpERF/EpERR 프라이머의 가지검은마름병에 대한 진단 민감성을 검정하기 위해 DNA를 농도와 배양액으로 검출한계를 측정한 결과, DNA농도는 50pg까지 검출되었고, 배양액으로는 5 × 101 CFU/ml(50 cells per reaction mixture)까지 검출이 되는 것을 확인하였다.In addition, as a result of measuring the detection limits of DNA by concentration and culture medium, the DNA of hrpN EP F / hrpN EP R primer, hrcC EP F / hrcC EP R primer, and EpERF / EpERR primer were measured to detect diagnostic susceptibility to black blight. The concentration was detected up to 50pg, the culture medium was confirmed to be detected up to 5 × 10 1 CFU / ml (50 cells per reaction mixture).

본 발명에서 "프라이머"는 본 발명의 프라이머와 표적 DNA 가닥 간에 하이브리드를 형성하기 위한 핵산 혼성화에 의해 상보적 표적 DNA 가닥으로 어닐링된 다음, 표적 DNA 가닥을 따라 중합효소(폴리머라제, 예: DNA 폴리머라제)에 의해 연장되는 분리된 핵산이다. 본 발명의 프라이머는, 예를 들어 중합효소 연쇄 반응(PCR) 또는 기타 통상적인 핵산 증폭 방법에 의해 표적 핵산 서열을 증폭시키는 데 이들을 사용하는 것을 지칭한다.In the present invention, a "primer" is annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand of the present invention, followed by a polymerase (polymerase such as a DNA polymer) along the target DNA strand. Isolated nucleic acid). Primers of the invention refer to the use of these to amplify target nucleic acid sequences, for example by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

"PCR" 또는 "중합효소 연쇄 반응"은 특이적 DNA 절편을 증폭시키기 위해 사용되는 기술이다. 프라이머는 작동인자에 의해 결정된 혼성화 조건 또는 반응 조건에서 특이적으로 표적 DNA 서열과 결합하는데 충분한 길이의 뉴클레오티드이다. 프라이머의 적합한 길이는 다양한 요소, 예컨데 온도와 프라이머의 용도에 따라 변화가 가능하다. 이러한 프라이머는 고도로 엄격한 혼성화 조건 하에서 표적 서열과 특이적으로 혼성화한다. 본 발명의 양태에 따르는 프라이머는 표적 서열과 인접한 뉴클레오티드의 완성한 DNA서열 유사성을 지닐 수 있지만, 표적 DNA 서열과 상이하고 표적 DNA 서열과 혼성화할 수 있는 능력을 보유하고 있는 프로브가 통상적인 방법에 의해 고안될 수 있다."PCR" or "polymerase chain reaction" is a technique used to amplify specific DNA fragments. A primer is a nucleotide of sufficient length to specifically bind a target DNA sequence in hybridization conditions or reaction conditions determined by an effector. Suitable lengths of the primer can vary depending on various factors, such as temperature and the primer's use. Such primers hybridize specifically with the target sequence under highly stringent hybridization conditions. Although primers according to aspects of the invention may have a complete DNA sequence similarity of a target sequence to adjacent nucleotides, probes that differ from the target DNA sequence and possess the ability to hybridize with the target DNA sequence are designed by conventional methods. Can be.

본 발명의 특이적 프라미어는 통합 단편을 증폭시키는데 사용하여, Erwinia pyrifoliae 를 확인하기 위한 프라이머인 것이 바람직하다.The specific primer of the present invention is preferably a primer for identifying Erwinia pyrifoliae , used to amplify the integrated fragment.

프라이머를 제조 및 사용하는 방법은 통상의 기술자에게 알려진 방법을 사용할 수 있으며, 예를 들어 다음 문헌에 기재되어 있다. (Molecular Cloning: A Labratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al, cold Spring Harbor N.Y. 1989: Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Inteescience, New York, 1992 등). PCR 프라이머 TKd은 상기 목적에 의도한 컴퓨터 프로그램, 예를 들어 PCR 프라이머 분석 도구(Vector NTI 버전 6(공급처: Infomax Inc., Bethesda MD)), 프라이머셀렉트(Primerselect (공급처 DNASTAR Inc., Madison WI) 등을 사용함으로써 공지된 서열로부터 유도시킬 수 있다. 부가적으로, 상기 서열을 가시적으로 스캐닝할 수 있고, 당업자에게 공지된 지침을 이용하여 프라이머를 수동으로 확인할 수 있다.Methods for preparing and using primers may use methods known to those skilled in the art, for example as described in the following documents. (Molecular Cloning: A Labratory Manual, 2nd ed., Vol. 1-3, ed.Sambrook et al, cold Spring Harbor NY 1989: Current Protocols in Molecular Biology, ed.Ausubel et al., Greene Publishing and Wiley-Inteescience, New York, 1992, etc.). PCR primers TKd are computer programs intended for this purpose, such as PCR primer analysis tools (Vector NTI version 6 (Infomax Inc., Bethesda MD)), Primerselect (DNASTAR Inc., Madison WI), etc. In addition, the sequences can be visually scanned and primers can be manually identified using instructions known to those skilled in the art.

본 발명에 사용되는 '키트'는 본 발명의 방법 양태를 수행하기 위하여, 보다 상세하게는 Erwinia pyrifoliae를 확인하기 위한 시약 세트를 지칭한다. 본 발명의 키트는 식물성 재료, 또는 식물성 재료를 포함하거나 또는 PCR에 사용될 효소, PCR 결과를 검출할 수 있는 수단 및/또는 dNTP 및 사용설명서를 포함할 수 있고, Erwinia pyrifoliae 탐지를 위해 사용할 수 있고, 그의 성분들은 이러한 목적을 위해 특이적으로 조정될 수 있다.The 'kit' used in the present invention, in order to carry out the method aspect of the present invention, more specifically Erwinia Refers to a set of reagents for identifying pyrifoliae . The kit of the present invention may include a vegetable material, or an enzyme containing or used in a vegetable material, a means for detecting a PCR result, and / or a dNTP and an instruction manual, and used for detecting Erwinia pyrifoliae , Its components can be specifically adjusted for this purpose.

이하에서는 실시예를 통하여 본 발명에 따른 hrpNEPF/hrpNEPR 프라이머, hrcCEPF/hrcCEPR 프라이머 및 EpERF/EpERR 프라이머의 유의성, 민감성, 특이성, 진단 유의성을 측정 및 평가하는 방법을 좀 더 구체적으로 설명하고자 한다. 다만, 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다 할 것이다.
Hereinafter, a method for measuring and evaluating the significance, sensitivity, specificity, and diagnostic significance of the hrpN EP F / hrpN EP R primer, the hrcC EP F / hrcC EP R primer, and the EpERF / EpERR primer according to the present invention will be described. It will be described in detail. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

본 발명에서 사용된 모든 균주들의 목록은 표 1과 같다. 상기 균주들은 Korean Agricultural Culture collection(KACC, Korea), American Type Culture Collection(ATCC™, USA)과 Belgian Coordinated Collections of Microorganisms/ LMG Bacteria Collection (BCCM™, Belgium)에서 얻었다.The list of all strains used in the present invention is shown in Table 1. The strains were obtained from Korean Agricultural Culture collection (KACC, Korea), American Type Culture Collection (ATCC ™, USA) and Belgian Coordinated Collections of Microorganisms / LMG Bacteria Collection (BCCM ™, Belgium).

또한, 본 발명에서 사용된 Erwinia pyrifoliae와 다른 모든 계열의 균주를 배양하기 위한 적정 배지는 MGY(mannitol glutamic yeast)배지였고, 배양 온도 27℃에서 배양시켰으며, 20% 글리세롤이 포함된 영양 배지(NB)에 넣어 -70℃에 보존했다.In addition, Erwinia used in the present invention The appropriate medium for culturing pyrifoliae and all other strains was MGY (mannitol glutamic yeast) medium, incubated at 27 ° C incubation temperature, and stored in -70 ° C in nutrient medium (NB) containing 20% glycerol. did.

본 발명에 사용된 균주 목록List of strains used in the present invention Bacterial speciesBacterial species Biological originBiological origin Geographic originGeographic origin Source/ReferenceSource / Reference 1One Erwinia pyrifoliae WT3 Erwinia pyrifoliae WT3 PyrusPyrus pyrifoliapyrifolia KoreaKorea KCCM10283 *1KCCM10283 * 1 22 Erwinia pyrifoliae WT15 Erwinia pyrifoliae WT15 PyrusPyrus pyrifoliapyrifolia KoreaKorea KACC13945 *1KACC13945 * 1 33 Erwinia pyrifoliae WT18 Erwinia pyrifoliae WT18 PyrusPyrus pyrifoliapyrifolia KoreaKorea KACC13946 *1KACC13946 * 1 44 Erwinia pyrifoliae WT19 Erwinia pyrifoliae WT19 PyrusPyrus pyrifoliapyrifolia KoreaKorea KACC13947 *1KACC13947 * 1 55 Erwinia pyrifoliae WT20 Erwinia pyrifoliae WT20 PyrusPyrus pyrifoliapyrifolia KoreaKorea KACC13948 *1KACC13948 * 1 66 Erwinia pyrifoliae WT30 Erwinia pyrifoliae WT30 PyrusPyrus pyrifoliapyrifolia KoreaKorea KNUCPB953 *1KNUCPB953 * 1 77 Erwinia pyrifoliae Ep1 Erwinia pyrifoliae Ep1 PyrusPyrus pyrifoliapyrifolia KoreaKorea DSM 12162 *2DSM 12162 * 2 88 Erwinia pyrifoliae Ep4 Erwinia pyrifoliae Ep4 PyrusPyrus pyrifoliapyrifolia KoreaKorea DSM 12394 *2DSM 12394 * 2 99 Erwinia pyrifoliae Ep8 Erwinia pyrifoliae Ep8 PyrusPyrus pyrifoliapyrifolia KoreaKorea DSM 12393 *2DSM 12393 * 2 1010 Erwinia pyrifoliae Ep16 Erwinia pyrifoliae Ep16 PyrusPyrus pyrifoliapyrifolia KoreaKorea DSM 12163 *2DSM 12163 * 2 1111 E. amylovora ATCC 15580 E. amylovora ATCC 15580 PyrusPyrus cummuniscummunis UKUK Dye D.W.Dye D.W. 1212 E. amylovora LMG 1877 E. amylovora LMG 1877 CydoniaCydonia oblongaoblonga DenmarkDenmark Hockenhull, J.Hockenhull, J. 1313 E. amylovora LMG 1946 E. amylovora LMG 1946 Pyrus cummunis cv. durondeau Pyrus cummunis cv. durondeau BelgiumBelgium Vantomme R.Vantomme R. 1414 E. amylovora LMG 2068 E. amylovora LMG 2068 RubusRubus ideaidea USAUSA Hayward A.Hayward A. 1515 Pectobacterium carotovorum subsp. atrosepticum ATCC 33260 Pectobacterium carotovorum subsp. atrosepticum ATCC 33260 SolanumSolanum tuberosumtuberosum UKUK Graham, D.Graham, D. 1616 P. carotovorum subsp. carotovorum ATCC 15713 P. carotovorum subsp. carotovorum ATCC 15713 PotatoPotato DenmarkDenmark Hellmers, E.Hellmers, E. 1717 P. carotovorum subsp. wasabiae ATCC 43316 P. carotovorum subsp. wasabiae ATCC 43316 EutremaEutrema wasabiwasabi JapanJapan Goto, M.Goto, M. 1818 P. chrysanthemi
ATCC 11663 P. chrysanthemi
ATCC 11663 ChrysanthemumChrysanthemum USAUSA Burkholder, W.H.Burkholder, W.H. 1919 E. rhapontici ATCC 29283 E. rhapontici ATCC 29283 RheumRheum rhaponticumrhaponticum UKUK Starr, M.P.Starr, M.P. 2020 Xanthomonas axonopodis pv. glycines8ra Xanthomonas axonopodis pv. glycines 8ra -- E.J. BraunE.J. Braun 2121 X. campestris pv . vesicatoria KNUCPB 07 X. campestris pv . vesicatoria KNUCPB 07 -- KoreaKorea Lim, C.KLim, C.K 2222 Pantoea stewartii subsp. stewartii ATCC 8199 Pantoea stewartii subsp. stewartii ATCC 8199 Sweet cornSweet corn USAUSA Margraert et al.Margraert et al. 2323 P. stewartii subsp. stewartii LMG 2712 P. stewartii subsp. stewartii LMG 2712 Sweet cornSweet corn USAUSA Williams, L.Williams, L. 2424 P. stewartii subsp. indologenes ATCC 51785 P. stewartii subsp . indologenes ATCC 51785 Leafspot, Setaria italica Leafspot, Setaria italica IndiaIndia LMGLMG 2525 P. annanatis LMG 2665 P. annanatis LMG 2665 AnanasAnanas comosuscomosus BrazilBrazil Robbs, C.Robbs, C. 2626 P. dispersa LMG 2603 P. dispersa LMG 2603 SoilSoil JapanJapan Gavini, F. CUETMGavini, F. CUETM 2727 Brenneria rubrifaciens LMG 5117 Brenneria rubrifaciens LMG 5117 JuglansJuglans regiaregia USAUSA PDDCCPDDCC 2828 B. rubrifaciens ATCC 29291 B. rubrifaciens ATCC 29291 JuglansJuglans regiaregia USAUSA Starr, M. P. Starr, M. P. 2929 Pseudomonas fluorescens Gpf01 Pseudomonas fluorescens Gpf01 GinsengGinseng KoreaKorea Lim, C. K.Lim, C. K. 3030 P. syringae ATCC 53543 P. syringae ATCC 53543 -- USAUSA Eastman Kodak CoEastman Kodak co

* 1 : 비특허문헌 1 참조, Shrestha R. et al., 2003.* 1: See Non-Patent Document 1, Shrestha R. et al., 2003.

* 2 : 비특허문헌 2 참조, Kim et al., 1999.2: See Non-Patent Document 2, Kim et al., 1999.

* ATCC : American Type Culture Collection* ATCC: American Type Culture Collection

* DSM : Deutsche Sammlung von Mikroorganism* DSM: Deutsche Sammlung von Mikroorganism

* KACC : Korean Agricultural Culture Collection* KACC: Korean Agricultural Culture Collection

* KCCM : Korean Culture Centre of Mircoorganisms* KCCM: Korean Culture Center of Mircoorganisms

* KNUCPB : Kangwon National University Collection of Phytopaghogenic Bacteria* KNUCPB: Kangwon National University Collection of Phytopaghogenic Bacteria

* LMG : Laboratorium voor Microbiologie
* LMG: Laboratorium voor Microbiologie

실시예Example 1 :  One : PCRPCR 과 and 프라이머의Primer 개발 Development

본 발명에 따른 가지검은마름병 진단용 프라이머는 진뱅크로부터 hrp / dsp T3SS 유전자(gene : hrpN and hrcC) (진뱅크 기탁번호:gene bank accession no. DQ180962)로부터 개발되었다. 한편, 가지검은마름병원세균의 ERIC(Endobacterial repetitive integenic consensus)지역은 일반적 프라이머인 ERIC1R/ERIC2를 이용하여 PCR방법으로 증폭하여 분석된 염기서열(진뱅크 기탁번호:gene bank accession no. EF432747)을 바탕으로 EpERF/EpERR프라이머를 개발하였다.The primer for diagnosing bough black blight according to the present invention is a hrp / dsp T3SS gene (gene: hrpN) from Gene Bank. and hrcC ) (gene bank accession no. DQ180962). Meanwhile, ERIC (Endobacterial repetitive integenic consensus) region of eggplant black blight hospital bacterium was amplified by PCR method using general primers ERIC1R / ERIC2 (Genbank accession no .: gene bank accession no. EF432747). EpERF / EpERR primers were developed.

hrpN영역 475bp(염기쌍 : base pair)을 증폭할 수 있는 hrpNEPF(5-ACAGCGCATCGCTTACGCCT)와 hrpNEPR(5-TTTAACGGGGCTGCTGGG) 프라이머 조합을 얻고, hrcC영역의 740bp 증폭할 수 있는 hrcCEPF(5-ATCGCGCAGGGCGTTTTCCA)와 hrcCEPR(5-ACCGCACGGCGTTAAACCGA) 프라이머 조합을 얻고, ERIC영역의 638bp 증폭할 수 있는 EpERF(5-GCGGTCATAGTGGCAATGAT)와 EpERR(5-GCACCTGCGATGCAAAGATG) 프라이머 조합을 얻었다.
hrpN region 475bp (bp: base pair) that can be amplified hrpN EP F (5-ACAGCGCATCGCTTACGCCT) and hrpN EP R (5-TTTAACGGGGCTGCTGGG) to obtain a combination hrcC primer to amplify the 740bp, hrcC region EP F (5- ATCGCGCAGGGCGTTTTCCA) and hrcC EP R (5-ACCGCACGGCGTTAAACCGA) primer combinations were obtained, and 638bp amplified EpERF (5-GCGGTCATAGTGGCAATGAT) and EpERR (5-GCACCTGCGATGCAAAGATG) primer combinations were obtained.

가지검은마름병 진단용 프라이머Black blight diagnostic primer 프라이머명Primer Name 염기서열 (5'-3')SEQ ID NO: 5'-3 ' 서열목록Sequence List hrpNEPFhrpN EP F ACAGCGCATCGCTTACGCCTACAGCGCATCGCTTACGCCT 1One hrpNEPRhrpN EP R TTTAACGGGGCTGCTGGGTTTAACGGGGCTGCTGGG 22 hrcCEPFhrcC EP F ATCGCGCAGGGCGTTTTCCAATCGCGCAGGGCGTTTTCCA 33 hrcCEPRhrcC EP R ACCGCACGGCGTTAAACCGAACCGCACGGCGTTAAACCGA 44 EpERFEpERF GCGGTCATAGTGGCAATGATGCGGTCATAGTGGCAATGAT 55 EpERREpERR GCACCTGCGATGCAAAGATG GCACCTGCGATGCAAAGATG 66 ERIC1RERIC1R ATGTAAGCTCCTGGGGATTCACATGTAAGCTCCTGGGGATTCAC 77 ERIC2ERIC2 AAGTAAGTGACTGGGGTGAGCGAAGTAAGTGACTGGGGTGAGCG 88

본 발명에 있어서, PCR 증폭 25㎕의 반응부피(reaction volumes)로, 20pmol의 프라이머, 20μM 농도의 dNTP(Promega,USA), Taq 폴리머라제(polymerase) 1U(Biotools, Madrid, Spain)와 10ng의 DNA을 넣고 실행하였다. PCR 분석은 DNA thermal cycler(Bio-Rad,USA)를 이용하였다.In the present invention, PCR amplification reaction volume of 25 μl, 20 pmol primer, 20 μM dNTP (Promega, USA), Taq polymerase 1U (Biotools, Madrid, Spain) and 10 ng of DNA Was put and run. PCR analysis was performed using a DNA thermal cycler (Bio-Rad, USA).

프라이머의 PCR 방법은 94℃에서 2분 동안 초기 변성을 실행한 후, hrpNEPF/hrpNEPR 프라이머는 64℃에서 15초 동안 결합하고, hrcCEPF/hrcCEPR 프라이머는 63℃로 결합하고, EpERF/EpERR 프라이머는 58℃에서 30초 동안 결합하였다.PCR method of the primer was subjected to initial denaturation for 2 minutes at 94 ℃, hrpN EP F / hrpN EP R primer is bound for 15 seconds at 64 ℃, hrcC EP F / hrcC EP R primer is bound to 63 ℃ , EpERF / EpERR primers bound for 30 seconds at 58 ℃.

상기 결합한 이후 72℃에서 1분 동안 증폭을 30회 실행하였고, 마지막 증폭 단계는 72℃에서 7분 동안 실행하였다. 각각의 증폭된 PCR 산물 5㎕를 브롬화 에티듐으로 염색된 0.7% 아가로스 겔(agarose gel : Qbiogene, Irvine, CA, USA)로 전기영동 한 후에 UV 트랜스일루미네이터(transilluminator)로 관찰을 하였다. 그 결과를 도 1 및 도 2에 도시하였다.After the binding, amplification was performed 30 times for 1 minute at 72 ° C., and the final amplification step was performed at 72 ° C. for 7 minutes. 5 μl of each amplified PCR product was electrophoresed with 0.7% agarose gel (agarose gel: Qbiogene, Irvine, CA, USA) stained with ethidium bromide, and then observed with a UV transilluminator. The results are shown in FIGS. 1 and 2.

도 1에서 A는 hrpNEPF/hrpNEPR 프라이머를, B는 hrcCEPF/hrcCEPR 프라이머를 사용한 것으로, 레인(Lane)1 내지 레인 10은 E. pyrifoliae 균주들(strains : WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16)에 대한 결과이며, 레인 11 내지 레인 30은 표 1에 기재된 균주에 대한 결과이고, 레인 M은 사이즈 마커(size marker : 1kb DNA ladder, Promega™)이다.In Figure 1 A is a hrpN EP F / hrpN EP R primer, B is using hrcC EP F / hrcC EP R primer, Lane 1 to lane 10 is E. pyrifoliae Results for strains (WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16), lanes 11 to 30 are results for the strains listed in Table 1, and lane M is size Size marker (1kb DNA ladder, Promega ™).

도 2의 A는 EpERF/EpERR 프라이머를 개발하기 위해 사용된 일반적 ERIC1R/ERIC2 프라이머를, B는 EpERF/EpERR 프라이머를 사용한 것으로, 레인 1 내지 레인 10은 E. pyrifoliae 균주들(strains : WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16)에 대한 결과이며, 레인 11 내지 레인 30은 표 1에 기재된 균주에 대한 결과이고, 레인 M은 사이즈 마커(size marker : 1kb DNA ladder, Promega™)이다.FIG. 2A shows general ERIC1R / ERIC2 primers used for developing EpERF / EpERR primers, B uses EpERF / EpERR primers, and lanes 1 to 10 show E. pyrifoliae. Results for strains (WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16), lanes 11 to 30 are results for the strains listed in Table 1, and lane M is size Size marker (1kb DNA ladder, Promega ™).

도 1 및 도 2로부터 알 수 있는 바와 같이 Erwinia pyrifoliae종의 세균들은 증폭이 되었지만, 다른 세균들은 어떠한 밴드도 형성하지 않았다. 또한, 각각의 PCR 산물들을 시퀀스(sequence)하고 실험한 결과, Erwinia pyrifoliae의 DNA는 증폭이 되었지만, 다른 세균들은 안 되었음을 확인하였다. 따라서, hrpNEPF/hrpNEPR 프라이머, hrcCEPF/hrcCEPR 프라이머 및 EpERF/EpERR 프라이머가 가지검은마름병의 진단을 위해 사용될 수 있는 표식자임을 확인하였다.
 Erwinia as can be seen from FIGS. 1 and 2 The bacteria of the pyrifoliae species were amplified, but the other bacteria did not form any bands. In addition, as a result of sequencing and experimenting with each PCR product, Erwinia The DNA of pyrifoliae was amplified but not by other bacteria. Thus, it was confirmed that the hrpN EP F / hrpN EP R primer, the hrcC EP F / hrcC EP R primer, and the EpERF / EpERR primer are markers that can be used for the diagnosis of blight blight.

실시예Example 2 : 각  2: each 프라이머의Primer 가지검은마름병의Black blight 진단 유의성 및 민감성 실험 Diagnostic Significance and Sensitivity Experiments

프라이머의 가지검은마름병에 대한 진단 민감성을 검정하기 위해 DNA를 50 ng부터 0.5 fg 농도와 배양액으로 검출 한계를 측정하였다.The limit of detection was determined from 50 ng to 0.5 fg concentration of DNA and culture to assay the diagnostic susceptibility to the blight of primer.

먼저 DNA농도 검출한계 검정은 각각의 DNA를 50 ng으로 정량하여 10배 희석법으로 각각의 농도에 맞는 DNA를 준비하였으며, 배양액 검출한계 검정은 배양된 Erwinia pyrifoliae의 배양액을 OD 600=1가 되도록 멸균수를 첨가하여 세포현탁액을 준비하였다. 10배를 연속으로 희석하였으며, 각각의 배수마다 100㎕씩 나누어서 고체 영양 배지 페트리 디쉬(Petri-dish)에 접종하여 콜로니형성단위(colony-forming units : CFU)를 확인하였다. 또한, 각각의 배수마다 5㎕씩은 PCR을 행하여 프라이머의 민감도 값을 구하기 위하여 사용되었다. 각각의 PCR 산물들의 10㎕는 1% 아가로스겔(agarose gels)에 전기영동 후 관찰하였고, 프라이머의 민감도를 확인하기 위해 실험을 3번 반복하였고, 그 결과를 도 3 및 도 4에 도시하였다.First, the DNA concentration detection limit assay quantified each DNA at 50 ng and prepared DNA for each concentration by 10-fold dilution. The culture detection limit assay was cultured Erwinia. A culture suspension of pyrifoliae was prepared by adding sterile water so that OD 600 = 1. Ten-fold serial dilutions were performed, and 100 μl of each fold was inoculated into the petri-dish solid nutrient medium to confirm colony-forming units (CFU). In addition, 5 μl of each fold was used to determine the sensitivity value of the primer by PCR. 10 μl of each PCR product was observed after electrophoresis on 1% agarose gels, and the experiment was repeated three times to confirm the sensitivity of the primers, and the results are shown in FIGS. 3 and 4.

도 3A 및 도 4A는 DNA 농도에 따른 결과로서, 도 3A의 i은 hrpNEPF/hrpNEPR 프라이머, ii는 hrcCEPF/hrcCEPR 프라이머를 사용하였고, 도 4A는 EpERF/EpERR 프라이머를 사용하였고, 레인 1은 50 ng, 레인 2는 5 ng, 레인 3은 0.5 ng, 레인 4는 50 pg, 레인 5는 5 pg, 레인 6은 0.5 pg, 레인 7은 50 fg, 레인 8은 5 fg, 레인 9는 0.5 fg의 농도를 의미하고, 레인 10은 대조구로서 물이다.3A and 4A are results according to DNA concentration, i of FIG. 3A used hrpN EP F / hrpN EP R primer, ii used hrcC EP F / hrcC EP R primer, and FIG. 4A used EpERF / EpERR primer. Lane 1 is 50 ng, lane 2 is 5 ng, lane 3 is 0.5 ng, lane 4 is 50 pg, lane 5 is 5 pg, lane 6 is 0.5 pg, lane 7 is 50 fg, lane 8 is 5 fg, Lane 9 means a concentration of 0.5 fg and lane 10 is water as a control.

도 3B 및 도 4B는 순수배양 현탁액 농도에 따른 결과로서, 도 3B의 i은 hrpNEPF/hrpNEPR 프라이머, ii는 hrcCEPF/hrcCEPR 프라이머, 도 4B는 EpERF/EpERR 프라이머를 사용하였고, 레인 1은 1×106 CFU/ml, 레인 2는 1×105 CFU/ml, 레인 3은 1×104 CFU/ml, 레인 4는 1×103 CFU/ml, 레인 5는 1×102 CFU/ml, 레인 6은 1×101 CFU/ml, 레인 7은 1×100 CFU/ml의 농도를 의미하고, 레인 8은 대조구로서 물이며, 레인 M은 사이즈 마커(1kb DNA ladder, Promega™)이다. 3B and 4B are the results according to the pure culture suspension concentration, iB hrpN EP F / hrpN EP R primer, ii is hrcC EP F / hrcC EP R primer, Figure 4B was used EpERF / EpERR primer , Lane 1 is 1 × 10 6 CFU / ml, lane 2 is 1 × 10 5 CFU / ml, lane 3 is 1 × 10 4 CFU / ml, lane 4 is 1 × 10 3 CFU / ml, lane 5 is 1 × 10 2 CFU / ml, lane 6 means 1 × 10 1 CFU / ml, lane 7 means 1 × 10 0 CFU / ml, lane 8 is water as a control, and lane M is a size marker (1 kb DNA ladder). , Promega ™).

도 3 및 도 4로부터 알 수 있는 바와 같이 DNA 농도는 50 pg까지 검출되었고, 배양액으로는 5 × 101 CFU/ml(50 cells per reaction mixture)까지 검출이 되었다.
As can be seen from Figures 3 and 4 DNA concentration was detected up to 50 pg, the culture medium was detected up to 5 × 10 1 CFU / ml (50 cells per reaction mixture).

실시예Example 3 :  3: DNADNA 프로브(probe)와Probe and 도트dot 블로팅( Blotting DotDot blotingbloting ))

DNA probe는 DIG DNA Labeling Kit(Roche, Mannheim, Germany)로 labeling하였다. Labeling 과정은「manufacturer’s specifications for use in DNA-DNA hybridizations」에 따라 수행하였다. DNA의 적합한 dot bolt 희석은 0.2N NaOH와 같은 부피용액에서 100℃ 온도로 10분 동안 열을 가한 뒤 즉시 얼음에 식혀서 변성시킨 DNA 2.0㎕를 Hybond-N membrane(Amersham, NJ, USA)에 떨어뜨려서 준비하였다. DNA는 80℃ 오븐에서 2시간 동안 건조시킨 나일론 멤브레인(nylon membrane)에 고정시켰다.DNA probes were labeled with a DIG DNA Labeling Kit (Roche, Mannheim, Germany). The labeling process was performed according to `` manufacturer's specifications for use in DNA-DNA hybridizations ''. A suitable dot bolt dilution of DNA was applied to a Hybond-N membrane (Amersham, NJ, USA) by diluting 2.0 μl of DNA denatured by heating for 10 minutes at a temperature of 100 ° C. in a volume solution such as 0.2 N NaOH and immediately cooling on ice. Ready. DNA was fixed to a nylon membrane (nylon membrane) dried for 2 hours in an 80 ℃ oven.

멤브레인에 고정된 DNA는 Roller-Blot HB-3D(Techne, England) 하이브리다이저(hybridizer)안에서 65℃의 온도로 4시간 동안 prehybridization solution(5ml 20 × SSC, 0.1ml N-lauryoylsauosine, 0.01ml 10% SDS, 1ml 블로킹제(blocking agent)와 6.39ml의 증류수로 구성)으로 pre-hybridize시켰다. DNA probe는 100℃에서 10분 동안 열을 가한 후에, 아이스에 식혀서 변성시켰고, 그런 후에 준비된 prehybridization solution를 첨가하였다. Hybridization 후에, 멤브레인을 상온에서 2 × SSC, 0.1% SDS로 5분 동안 2회 세척하고, 65℃에서 0.2 × SSC, 0.1% SDS로 15분 동안 2번 세척하였다. 멤브레인을 세척 완충액(washing buffer : 0.1M maleic acid, 0.15M NaCl(pH 7.5), 0.3% Tween 20)으로 세척한 후, 블로킹 완충액(blocking buffer : 10%의 블로킹 용액 5ml와 말레산 완충액 45ml)으로 상온에서 30분 동안 처리한 다음, anti-DIG-AP conjugate(Bio-Rad, USA)를 사용한 antibody solution으로 30분간 처리하였다. 세척 완충액으로 15분 동안 2번 처리한 후, 검출 완충액(detection buffer : 0.1M NaCl, 0.1M Tris-HCl, 0.3% MgCl2)에서 5분 동안 안정화시켰다. Chemiluminescence 진단은 manufacturer’s protocol(Roche)에 따라 수행하였고, membranes은 chemiluminescent reaction을 찾기 위해 Kodak X-ray film (Eastman Kodak, Rochester, USA)에 1시간 30분 노출시켰고, 그 결과를 도 5에 도시하였다.The DNA immobilized on the membrane was prehybridization solution (5ml 20 × SSC, 0.1ml N-lauryoylsauosine, 0.01ml 10% for 4 hours at a temperature of 65 ° C in a Roller-Blot HB-3D (Techne, England) hybridizer). It was pre-hybridized with SDS, 1 ml blocking agent and 6.39 ml distilled water. The DNA probe was heated at 100 ° C. for 10 minutes, then cooled and denatured on ice, and then the prepared prehybridization solution was added. After hybridization, the membranes were washed twice with 2 × SSC, 0.1% SDS for 5 minutes at room temperature, and twice with 15 × with 0.2 × SSC, 0.1% SDS at 65 ° C. The membrane was washed with washing buffer (0.1 M maleic acid, 0.15 M NaCl (pH 7.5), 0.3% Tween 20) and then with blocking buffer (5 ml of 10% blocking solution and 45 ml maleic acid buffer). After 30 minutes of treatment at room temperature, the solution was treated with an antibody solution using an anti-DIG-AP conjugate (Bio-Rad, USA) for 30 minutes. After two treatments with wash buffer for 15 minutes, it was stabilized for 5 minutes in detection buffer (0.1M NaCl, 0.1M Tris-HCl, 0.3% MgCl 2 ). Chemiluminescence diagnosis was performed according to the manufacturer's protocol (Roche), and membranes were exposed to Kodak X-ray film (Eastman Kodak, Rochester, USA) for 1 hour and 30 minutes to find chemiluminescent reactions, and the results are shown in FIG. 5.

도 5는 본 발명에 따른 유전자의 dot blotting 분석 결과 사진으로서, A는 hrpNEPF, B는 hrpNEPR, C는 hrcCEPF를 프로브로 사용하였고, 레인 1 내지 레인 10은 E. pyrifoliae 균주들(strains : WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16)에 대한 dot blotting 결과이며, 레인 11 내지 레인 30은 상기 표 1에 기재된 균주들에 대한 dot blotting 결과이다.5 is a gene of the present invention As a result of dot blotting analysis, A was hrpN EP F, B was hrpN EP R, C was hrcC EP F, and lanes 1 to 10 were E. pyrifoliae. Dot blotting results for strains (WT3, WT15, WT18, WT19, WT20, WT30, Ep1, Ep4, Ep8, Ep16), and lanes 11 to 30 are dot blotting results for the strains described in Table 1 above. to be.

실험 결과, genetic markers의 종 특이성을 확인하기 위해 Probe gene sequence를 GenBank database에서 BLAST search를 하였지만, 다른 세균들의 DNA들과 유사성을 찾을 수 없었다. 도 5로부터 알 수 있는 바와 같이 Probe는 모든 E. pyliforiae 계열의 유전자 DNA를 hybridize할 수 있었지만, 다른 식물병원균들의 유전자 DNA로는 hybridize가 되지 않았다.
As a result, we performed BLAST search in the GenBank database for the probe gene sequence to confirm the species specificity of the genetic markers. As can be seen from Figure 5 Probe was able to hybridize all DNA genes of the E. pyliforiae series, but not with the genetic DNA of other plant pathogens.

실시예Example 4 : 혼합된 세균 배양과 인공적으로 감염시킨 식물체로부터  4: from mixed bacterial cultures and artificially infected plants 프라이머의Primer 특이성 검정 실험 Specificity test experiment

본 발명의 프라이머를 이용하여 자연조건과 유사한 다양한 세균이 혼용 존재하는 조건에서도 진단의 유효성을 확인하기 위해, E. pyrifoliae WT3(1 × 104 CFU/ml)의 순수 배양 현탁액을 E. amylovora ATCC 15580과 P. stewartii subsp. stewartii LMG 2712, B. rubrifaciens LMG 5110, P. carotovorum subsp. carotovorum ATCC 15713의 세포 현탁액(107 CFU/ml)과 혼합하고, 이 혼합물로 PCR진단을 하였다.In order to check the validity of the diagnosis in terms of a variety of bacteria, similar to natural conditions exist mixed with the primers of the present invention, E. pyrifoliae WT3 (1 × 10 4 CFU / ml) a suspension of pure culture E. amylovora ATCC 15580 and P. stewartii subsp. stewartii LMG 2712, B. rubrifaciens LMG 5110, P. carotovorum subsp. The cell suspension (10 7 CFU / ml) of carotovorum ATCC 15713 was mixed, and the mixture was subjected to PCR diagnosis.

또한 실질적 진단을 위해, 감염 식물체로부터 프라이머를 이용한 진단 여부를 검정하기 위하여 감염되지 않은 배 과실표면을 바늘로 찔러 그 상처에 세균 세포 현탁액(grown overnight in LB broth adjusted to approximately 1 × 108CFU/ml in phosphate-buffered saline) 10㎕을 접종하였다. 접종 3일 후에, 인공적으로 접종시킨 잎을 1g 잘라서 9ml 멸균수에 혼합시켰고, 현탁액의 1ml는 CTAB 방법으로 세균과 식물체의 DNA를 뽑는데 사용하였고, 1㎕ DNA는 PCR진단을 위한 복제 주형으로 사용하였다.In addition, for practical diagnosis, a needle was made to puncture the uninfected embryonating fruit surface with a needle to test whether the infection was made using a primer from the infected plant (grown overnight in LB broth adjusted to approximately 1 × 10 8 CFU / ml 10 μl of in phosphate-buffered saline) was inoculated. After 3 days of inoculation, 1 g of artificially inoculated leaves were cut and mixed in 9 ml sterile water, 1 ml of the suspension was used to extract bacteria and plant DNA by CTAB method, and 1 μl DNA was used as a replication template for PCR diagnosis. .

혼합된 세균 배양액으로 PCR을 행하여 계통 분류의 특이성을 확인하고 그 결과를 도 6 및 도 7에 도시하였다.PCR with the mixed bacterial culture solution The specificity of the lineage classification was confirmed and the results are shown in FIGS. 6 and 7.

도 6의 A는 혼합 균주 현탁액에 대한 결과로, i은 hrpNEPF/hrpNEPR 프라이머, ii는 hrcCEPF/hrcCEPR 프라이머를 사용하였고, 레인 1은 E. pyrifoliae WT3와 E. amylovora ATCC 15580의 혼합 균주 현탁액, 레인 2는 E. pyrifoliae WT15와 P. stewartii subsp. stewartii LMG 2712의 혼합 균주 현탁액, 레인 3은 E. pyrifoliae Ep1와 B. rubrifaciens LMG 5110의 혼합 균주 현탁액, 레인 4는 E. pyrifoliae Ep16와 P. carotovorum subsp. carotovorum ATCC 15713의 혼합 균주 현탁액, 레인 5는 E. amylovora ATCC 15580 균주 현탁액, 레인 6은 P. stewartii subsp. stewartii LMG 2712 균주 현탁액, 레인 7은 B. rubrifaciens LMG 5110 균주 현탁액, 레인 8은 P. carotovorum subsp. carotovorum ATCC 15713 균주 현탁액에 나타난 결과이다. 6A is a result of the mixed strain suspension, i used hrpN EP F / hrpN EP R primer, ii used hrcC EP F / hrcC EP R primer, lane 1 E. pyrifoliae Mixed strain suspension of WT3 and E. amylovora ATCC 15580 , lane 2 is E. pyrifoliae WT15 and P. stewartii subsp. stewartii Mixed Strain Suspension of LMG 2712, Lane 3 E. pyrifoliae Mixed strain suspension of Ep1 and B. rubrifaciens LMG 5110, lane 4 E. pyrifoliae Ep16 and P. carotovorum subsp. carotovorum Mixed strain suspension of ATCC 15713, lane 5 is E. amylovora ATCC 15580 strain suspension, lane 6 is P. stewartii subsp. stewartii LMG 2712 strain suspension, lane 7 B. rubrifaciens LMG 5110 strain suspension, lane 8 is P. carotovorum subsp. carotovorum Results shown in ATCC 15713 strain suspension.

도 6의 B는 접종 3일 후 인공적으로 감염시킨 식물체로부터 얻은 추출물에 대한 결과로, i은 hrpNEPF/hrpNEPR 프라이머, ii는 hrcCEPF/hrcCEPR 프라이머를 사용하였고, 레인 1 내지 레인 5는 E. pyrifoliae strains(WT3, WT15, WT18, Ep1, Ep16)로부터 감염시킨 식물체로부터 얻은 추출물에 대한 결과, 레인 6은 E. amylovora ATCC 15580, 레인 7은 P. stewartii subsp. stewartii LMG 2712, 레인 8은 P. carotovorum subsp. carotovorum ATCC 15713로부터 감염시킨 식물체로부터 얻은 추출물에 대한 결과를 나타내는 것이며, 레인 9는 비감염으로 증상이 없는 대조구, 레인 10은 E. pyrifoliae WT3의 염색체 DNA에 대한 결과를 나타내는 것이고, 레인 M은 사이즈 마커(1kb DNA ladder, Promega™)이다.FIG. 6B shows the extracts obtained from artificially infected plants 3 days after inoculation, i using hrpN EP F / hrpN EP R primers, ii used hrcC EP F / hrcC EP R primers, and lanes 1 to 3. Lane 5 is E. pyrifoliae Results for extracts from plants infected from strains (WT3, WT15, WT18, Ep1, Ep16), lane 6 for E. amylovora ATCC 15580 , lane 7 for P. stewartii subsp. stewartii LMG 2712, lane 8 shows P. carotovorum subsp. carotovorum Results are shown for extracts from plants infected from ATCC 15713, lane 9 is non-infectious control, lane 10 is for chromosomal DNA of E. pyrifoliae WT3, and lane M is size marker (1 kb). DNA ladder, Promega ™).

도 7A는 EpERF/EpERR 프라이머를 사용하여 혼합 균주 현탁액에 실험한 결과로, 레인 1은 E. pyrifoliae WT3와 E. amylovora ATCC 15580의 혼합 균주 현탁액, 레인 2는 E. pyrifoliae WT15와 P. stewartii subsp. stewartii LMG 2712의 혼합 균주 현탁액, 레인 3은 E. pyrifoliae Ep1와 B. rubrifaciens LMG 5110의 혼합 균주 현탁액, 레인 4는 E. pyrifoliae Ep16와 P. carotovorum subsp. carotovorum ATCC 15713의 혼합 균주 현탁액, 레인 5는 E. amylovora ATCC 15580 균주 현탁액, 레인 6은 P. stewartii subsp. stewartii LMG 2712 균주 현탁액, 레인 7은 B. rubrifaciens LMG 5110 균주 현탁액, 레인 8은 P. carotovorum subsp. carotovorum ATCC 15713 균주 현탁액에 나타난 결과이다.7A shows the results of experiments on mixed strain suspensions using EpERF / EpERR primers. Lane 1 shows E. pyrifoliae. WT3 and E. amylovora Mixed strain suspension of ATCC 15580, lane 2 E. pyrifoliae WT15 and P. stewartii subsp. stewartii Mixed Strain Suspension of LMG 2712, Lane 3 E. pyrifoliae Ep1 and B. rubrifaciens Mixed strain suspension of LMG 5110, lane 4 E. pyrifoliae Ep16 and P. carotovorum subsp. carotovorum Mixed strain suspension of ATCC 15713, lane 5 is E. amylovora ATCC 15580 strain suspension, lane 6 is P. stewartii subsp. stewartii LMG 2712 strain suspension, lane 7 is B. rubrifaciens LMG 5110 strain suspension, lane 8 is P. carotovorum subsp. carotovorum Results shown in ATCC 15713 strain suspension.

도 7B의 i는 E. pyrifoliae에 감염된 식물체의 증상을 나타낸 사진이다.7B is a photograph showing symptoms of a plant infected with E. pyrifoliae .

도 7B의 ii는 EpERF/EpERR 프라이머를 사용하여 접종 3일 후 인공적으로 감염시킨 식물체로부터 얻은 추출물에 실험한 결과로서, 레인 1 내지 레인 3은 E. pyrifoliae strains(WT3, Ep1, Ep16)로부터 감염시킨 미성숙 배로부터 얻은 추출물에 대한 결과, 레인 4 내지 레인 6은 E. pyrifoliae WT3로부터 감염시킨 미성숙 배, 가지, 잎으로부터 얻은 추출물에 대한 결과이고, 레인 7은 E. amylovora ATCC 15580, 레인 8은 비감염으로 증상이 없는 식물체, 레인 9는 대조구(물), 레인 10은 E. pyrifoliae WT3의 염색체 DNA, 레인 M은 사이즈 마커(1kb DNA ladder, Promega™)이다.Ii of FIG. 7B is a result of experiments on extracts obtained from artificially infected plants 3 days after inoculation using EpERF / EpERR primers. Lanes 1 to 3 were infected from E. pyrifoliae strains (WT3, Ep1, Ep16). Results for extracts from immature embryos , lanes 4 to 6 show E. pyrifoliae Results from extracts from immature embryos, branches, and leaves infected with WT3, lane 7 is E. amylovora ATCC 15580 , lane 8 is non-infectious plant, lane 9 is control (water), lane 10 is E. The chromosomal DNA of pyrifoliae WT3, lane M, is a size marker (1 kb DNA ladder, Promega ™).

도 6과 도 7로부터 알 수 있는 바와 같이 본 발명의 프라이머는 혼합된 배양액에서 E. pyliforiae를 진단할 수 있었지만, 다른 세균들에서는 진단이 되지 않았다. 또한, 증상이 없는 대조구 식물체로부터 추출된 DNA들은 증폭이 되지 않는 반면, 본 발명의 진단 방법은 인공적으로 3일 동안 감염시킨 식물체 조직(미성숙 배. 가지, 잎)들로부터 E. pyliforiae를 성공적으로 진단하였다(도 6B 및 도 7B참조). 뿐만 아니라, 감염을 시킨 후 7일 경과한 배에서도 같은 결과를 얻을 수 있었다.As can be seen from Figure 6 and 7 primer of the present invention was able to diagnose E. pyliforiae in the mixed culture, but not in other bacteria. In addition, while the DNAs extracted from the control plants without symptoms were not amplified, the diagnostic method of the present invention successfully diagnosed E. pyliforiae from plant tissues (immature embryos, branches, leaves) that were artificially infected for 3 days. (See FIGS. 6B and 7B). In addition, the same result was obtained in the embryo 7 days after the infection.

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항 들과 그것들의 등가물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> University-Industry Cooperation Foundation, Kangwon Natinal University <120> Primer and kit for diagnosis of Erwinia pyrifoliae and diagnosis method of Erwinia pyrifoliae using thereof <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 1 acagcgcatc gcttacgcct 20 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 2 tttaacgggg ctgctggg 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 3 atcgcgcagg gcgttttcca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 4 accgcacggc gttaaaccga 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 5 gcggtcatag tggcaatgat 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 6 gcacctgcga tgcaaagatg 20 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 7 atgtaagctc ctggggattc ac 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 8 aagtaagtga ctggggtgag cg 22 <110> University-Industry Cooperation Foundation, Kangwon Natinal University <120> Primer and kit for diagnosis of Erwinia pyrifoliae and diagnosis          method of Erwinia pyrifoliae using <160> 8 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 1 acagcgcatc gcttacgcct 20 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 2 tttaacgggg ctgctggg 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 3 atcgcgcagg gcgttttcca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 4 accgcacggc gttaaaccga 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 5 gcggtcatag tggcaatgat 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 6 gcacctgcga tgcaaagatg 20 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 7 atgtaagctc ctggggattc ac 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer for Erwinia pyrifoliae <400> 8 aagtaagtga ctggggtgag cg 22

Claims (3)

서열목록 제1서열로 표시되는 핵산단편과 서열목록 제2서열로 표시되는 핵산단편의 조합, 서열목록 제3서열로 표시되는 핵산단편과 서열목록 제4서열로 표시되는 핵산단편의 조합 및 서열목록 제5서열로 표시되는 핵산단편과 서열목록 제6서열로 표시되는 핵산단편의 조합으로 이루어진 군 중에서 선택된 어느 하나 이상의 조합을 포함하는 가지검은마름병 진단용 프라이머.The combination of the nucleic acid fragment represented by the first sequence and the nucleic acid fragment represented by the second sequence, the combination of the nucleic acid fragment represented by the third sequence and the nucleic acid fragment represented by the third sequence, and the sequence listing. A branch black blight diagnostic primer comprising any one or more combinations selected from the group consisting of a combination of the nucleic acid fragment represented by the fifth sequence and the nucleic acid fragment represented by the sixth sequence. 제1항에 의한 가지검은마름병 진단용 프라이머를 포함하는 가지검은마름병 진단용 키트.Eggplant black blight diagnostic kit comprising a primer for diagnosing bough black blight according to claim 1. 제1항에 의한 가지검은마름병 진단용 프라이머를 이용하여 중합효소 연쇄반응을 수행하는 단계를 포함하는 가지검은마름병 진단방법.Eggplant black blight diagnostic method comprising the step of performing a polymerase chain reaction using a primer for diagnosing bough black blight according to claim 1.
KR1020110003280A 2011-01-12 2011-01-12 Primer and kit for diagnosis of erwinia pyrifoliae and diagnosis method of erwinia pyrifoliae using thereof KR20120081896A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020110003280A KR20120081896A (en) 2011-01-12 2011-01-12 Primer and kit for diagnosis of erwinia pyrifoliae and diagnosis method of erwinia pyrifoliae using thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110003280A KR20120081896A (en) 2011-01-12 2011-01-12 Primer and kit for diagnosis of erwinia pyrifoliae and diagnosis method of erwinia pyrifoliae using thereof

Publications (1)

Publication Number Publication Date
KR20120081896A true KR20120081896A (en) 2012-07-20

Family

ID=46713891

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110003280A KR20120081896A (en) 2011-01-12 2011-01-12 Primer and kit for diagnosis of erwinia pyrifoliae and diagnosis method of erwinia pyrifoliae using thereof

Country Status (1)

Country Link
KR (1) KR20120081896A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220050441A (en) * 2020-10-16 2022-04-25 대한민국(농촌진흥청장) Primer set for detecting Erwinia pyrifoliae and uses thereof
KR20220168831A (en) * 2021-06-17 2022-12-26 대한민국(농촌진흥청장) Primer set for discriminating strain of Erwinia pyrifoliae and uses thereof

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220050441A (en) * 2020-10-16 2022-04-25 대한민국(농촌진흥청장) Primer set for detecting Erwinia pyrifoliae and uses thereof
KR20220168831A (en) * 2021-06-17 2022-12-26 대한민국(농촌진흥청장) Primer set for discriminating strain of Erwinia pyrifoliae and uses thereof

Similar Documents

Publication Publication Date Title
Lievens et al. A robust identification and detection assay to discriminate the cucumber pathogens Fusarium oxysporum f. sp. cucumerinum and f. sp. radicis‐cucumerinum
Strayer et al. A multiplex real-time PCR assay differentiates four Xanthomonas species associated with bacterial spot of tomato
CN108588249B (en) Primer pair for detecting sweet potato stem rot bacteria and detection method thereof
Jonit et al. Xanthomonas oryzae pv. oryzae, biochemical tests, rice (Oryza sativa), Bacterial Leaf Blight (BLB) disease, Sekinchan
KR100514431B1 (en) Primer Sets for Specifid Identification of a Pathogen Xanthomonas campestris pv. campestris, and Specific-Identification Methods of the Pathogen using the Primers
Bektas et al. Phylogenetic and morphological characterization of Fusarium oxysporum f. sp. cepae the causal agent of basal rot on onion isolated from Turkey
Choi et al. Identification and characterization of the causal organism of gummy stem blight in the muskmelon (Cucumis melo L.)
KR100942390B1 (en) Primer sets for detecting Xanthomonas oryzae pv. oryzicola or Xanthomonas oryzae pv. oryzae and multiplex PCR method using thereof
KR20120081896A (en) Primer and kit for diagnosis of erwinia pyrifoliae and diagnosis method of erwinia pyrifoliae using thereof
Kowalska et al. Burkholderia gladioli associated with soft rot of onion bulbs in Poland
Sharma et al. PCR based assay for the detection of Alternaria brassicicola in crucifers
Abed et al. Sequencing based phylogenetic analysis of local Mycoplasma gallisepticum of broiler chickens in Al-Dewaniyah Province/Iraq
Kharde et al. Molecular diversity among the isolates of Xanthomonas axonopodis pv. citri causing bacterial canker in citrus
Sherafati et al. Association of Pantoea agglomerans with the citrus bacterial canker disease in Iran
Rouhrazi et al. Genetic diversity of Iranian Agrobacterium strains from grapevine
Riaz et al. Molecular identification of Aspergillus flavus using inter transcribed spacers (ITS)
KR101259087B1 (en) Composition for identifying Pantoea stewartii subsp. stewartii and use thereof
KR101413121B1 (en) Method for detecting Acidovorax citrulli
Mohamed et al. Identification of different species of Rhodotorula using Internal Transcribed Spacers
KR101413123B1 (en) Primer set for detecting Xanthomonas oryzae pv. oryzicola and method for detecting using the same
Sinjare et al. PCR-RFLP analysis of the 16S rRNA and its regions in bacterial blight (Xanthomonas axonopodis pv. punicae) across pomegranate farms in Kurdistan Regions-Iraq.
KR101444244B1 (en) Primer Set for Detecting Xanthomonas oryzae pv. oryzae and Method for Detecting by Using the Same
Thapa et al. Direct detection of Brenneria rubrifaciens by polymerase chain reaction (PCR-based assay) using rubrifacine synthetic gene
KR101302194B1 (en) Composition for identifying Pantoea stewartii subsp. stewartii and use thereof
John et al. Isolation, identification and molecular characterization of Xanthomonas oryzae pv. oryzae from paddy fields of Kuttanad region, Kerala.

Legal Events

Date Code Title Description
A201 Request for examination
E601 Decision to refuse application