KR20120079653A - Novel insulin growth factor-i from bos taurus and gene encoding the same - Google Patents

Novel insulin growth factor-i from bos taurus and gene encoding the same Download PDF

Info

Publication number
KR20120079653A
KR20120079653A KR1020110000967A KR20110000967A KR20120079653A KR 20120079653 A KR20120079653 A KR 20120079653A KR 1020110000967 A KR1020110000967 A KR 1020110000967A KR 20110000967 A KR20110000967 A KR 20110000967A KR 20120079653 A KR20120079653 A KR 20120079653A
Authority
KR
South Korea
Prior art keywords
igf
sequence
present
expression
cells
Prior art date
Application number
KR1020110000967A
Other languages
Korean (ko)
Inventor
주한승
최장원
Original Assignee
씨앤제이바이오텍(주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨앤제이바이오텍(주) filed Critical 씨앤제이바이오텍(주)
Priority to KR1020110000967A priority Critical patent/KR20120079653A/en
Publication of KR20120079653A publication Critical patent/KR20120079653A/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/142—Amino acids; Derivatives thereof
    • A23K20/147—Polymeric derivatives, e.g. peptides or proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2511/00—Cells for large scale production

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Polymers & Plastics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Animal Husbandry (AREA)
  • Food Science & Technology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

PURPOSE: A novel IGF-I, a gene encoding the same, and a method for preparing the IGF-I are provided to produce a large amount of host cells and to promote livestock growth. CONSTITUTION: An IGF-I(insulin-like growth factor I) has an amino acid of sequence number 1 and is derived from Bos Taurus. A nucleotide encoding IGF-I is denoted by sequence number 2 or 3. An expression vector containing the nucleotide encoding IGF-I is a plasmid for expressing E.coli or Bacillus. A composition for feed additive contains IGF-I. A method for producing a transformed microorganism for expression IGF-I comprises: a step of inserting the nucleotide sequence into an expression vector; and a step of transforming a microorganism with the expression vector.

Description

소 유래의 신규한 인슐린 유사 성장 인자-Ｉ 및 이를 암호화하는 유전자{Novel Insulin Growth Factor-I from Bos taurus and Gene Encoding the Same}Novel Insulin Growth Factor-I from Bos taurus and Gene Encoding the Same

본 발명은 세포 성장 활성을 갖는 신규한 인슐린 유사 성장 인자-I (insulin-like growth factor-I, IGF-I)에 관한 것이다. 보다 상세하게는 소의 간으로부터 순수분리 되며, 약 7.5kDa 의 분자량을 갖는 단일 서브유닛으로 이루어진 폴리펩티드로서, IGF-I 및 이 단백질을 암호화하는 유전자에 관한 것이다.
The present invention relates to a novel insulin-like growth factor-I (IGF-I) with cell growth activity. More specifically, the polypeptide is purely separated from bovine liver and consists of a single subunit having a molecular weight of about 7.5 kDa, which relates to IGF-I and the gene encoding this protein.

IGF는 은 1978년 Rinderknecht 등에 의해 사람의 혈청으로 부터 처음 분리되었고, 전구인슐린(proinsulin)의 구조와 유사함을 규명하였으며, 이에 따라 IGF 라고 명명하였다(Rinderknecht 등, J. Biol . Chem . 253:2769-2776(1978)). IGF는 두 종류의 아형이 존재하여 IGF-I과 IGF-II로 분류되며, IGF-I은 70개의 아미노산 잔기로 이루어진 분자량이 약 7.5kDa이며 염기성을 띠는 단일 서브유닛의 단백질이며, IGF-II는 67개의 아미노산 잔기로 구성된 분자량이 약 7 kDa의 약산성을 띠는 단일 써브유닛의 단백질이다(Daughaday 등, Endocr . Rev . 10:68-91(1989)). IGF-I는 세 개의 disulfide bond를 가지며 A, B, C 및 D로 명명된 4 개의 도메인(domain)을 가지고 있다. 이에 비해 전구인슐린은 A, B 및 C의 세 개의 도메인을, 분비된 활성형 인슐린은 A 및 B의 두 개의 도메인을 가지고 있다. IGF-I과 IGF-II의 아미노산 조성은 서로 약 70%가 동일하며 그들의 A와 B 도메인은 사람 인슐린의 A와 B 사슬과 약 50%의 서열 유사성을 가지고 있으며 인슐린처럼 IGF-I, II 모두 disulfide bond로 연결된 A, B 사슬을 가지고 있다. 반면 A 사슬과 B 사슬을 연결하는 부분(C-펩티드)은 IGF-I은 12개, IGF-II는 8개의 아미노산을 가지지만 전구인슐린의 C-펩티드는 31개 아미노산을 가지므로 전구인슐린과 구조적으로 다르다. 이런 구조적 유사성은 IGF-I이 인슐린 수용체에 붙는 능력을 갖는다. IGF-I은 수많은 종류의 세포들과 조직들의 성장, 생존과 분화에 관여하여 세포분열 및 대사 작용을 하는 성장인자들로서 동물의 성장발달 및 체세포 분화에 매우 중요한 역할을 하고 있다(Jones 등, Endocrinol . Rev . 16:3-34(1995); Frost 등, Endocrinol. 140:3962-3970(1999)). IGF-I은 주된 생성 기관인 간 이외에도 신체 거의 모든 조직에서 생성되고 대부분의 세포에 그 작용을 미쳐서 전형적인 내분비적인(endocrine) 작용과 함께 이웃한 세포에 작용하는 측분비(paracrine) 및 자가분비(autocrine) 형태의 작용기전을 가진다(Kaytor 등, J. Biol . Chem. 276:36896-36901(2001)). 간에서 IGF-I 합성 조절의 주요한 인자들은 뇌하수체 전엽에서 분비되는 성장호르몬 및 영양 상태이다. 성장호르몬이 부족하면 혈액이나 조직의 IGF-I 농도가 감소하며 성장호르몬 치료를 하면 다시 정상으로 회복되고, 만성적인 영양결핍이나 단기간의 공복 상태 및 단백질 부족에 의해서 혈중 IGF-I은 감소하는 것으로 알려져 있다(Bichell 등, Mol . Endocrinol. 6:1899-1908(1992); Zhang 등, Endocrinol. 139:4523-4530(1998)). IGF-I은 자신의 수용체는 물론 인슐린 수용체와도 결합하는 능력을 가지고 있으며, 수용체에 IGF-I이 결합하게 되면 세포의 성장을 촉진시키며, 또한 인슐린과 유사한 작용을 하는 것이 알려져 있어 성장을 매개한다하여 소마토메딘 C(Somatomedin C) 라고도 한다. IGF-I의 수용체는 간세포외에도 지방조직, 임파구 및 뼈 등 여러 조직에 존재하는 것으로 알려져 있고, 인슐린 수용체와는 다른 신호전달 경로를 갖는 것이 규명되었다. 간에서 혈액으로 분비된 IGF-I은 인슐린과 달리 50-150kDa의 분자량을 갖는 IGF 결합단백질(IGF binding proteins)과 결합되어 불활성상태의 결합체로 순환하다가 인체의 영양 상태나 생리적 변화에 의해서 결합단백질과 분리된 후에 체세포의 수용체와 결합함으로써 세포를 자극하게 된다. IGF 결합단백질은 현재까지 총 6개가 알려져 있으며(Shimasaki 등, Prog . Growth Factor Res. 3:243-246(1992)), 혈중에서 IGF-I의 90% 이상은 IGF 결합단백질-3와 결합하여 약 150kD의 복합체로서 존재하며 5% 미만이 유리형으로 존재한다(Baxter 등, J. Biol. Chem. 264:11843-11848(1989)). IGF 결합단백질은 혈중에서 IGF-I과 결합하여 IGF-I의 운반자 역할과 반감기를 조절하고, IGF의 작용을 억제하거나 증진시키는 역할을 한다. 특히, IGF 결합단백질-3는 혈액내에서 IGF-I을 운반하여 목표조직으로 유도할 뿐만 아니라, 단백질 분해효소에 의해 파괴되는 것을 막아주고, 목표조직에서 IGF-I 수용체와 상호작용을 조절히는 기능을 하는 것으로 알려져 있다(Kelley 등, Int. J. Biochem . Cell Biol . 28:619-637(1996)). IGF-I은 세포성장, 세포증식, 세포분화, 세포생존 등을 통하여 거의 모든 세포의 성장을 촉진하는 역할을 하여 생체내에서 1)뼈, 근육, 신경, 혈관 조직들을 형성 및 성장, 2)손상된 세포의 재생, 3)노화지연, 4)혈당 안정과 인슐린 저항성의 정상화 등과 같은 역할을 담당한다(Mathews 등, Endocrinol . 123:2827-2833(1988); Pardee, Sci . 246: 603-608(1989); Florini 등, J. Biol . Chem . 265:13435-13437(1990); Muta 등, J. Cell Physiol . 156:264-271(1993)). 그 외, IGF-I은 여러 세포에서 호르몬의 분비를 조절(Giudice, Endocr . Rev . 13:641-669(1992); Timsit 등, J. Clin . Endocrin . Metab . 75:183-188(1992)), 세포독성 T 세포의 기능 향상을 통하여 면역 반응 향상(Yamasaky 등, Endocrinol. 128:857-862(1991)) 등이 보고되는 등 실로 다양한 기능이 알려져 있다. 이러한 IGF의 성질을 이용하여 한국 특허출원 1990-0022193에서는 IGF-I의 발현벡터에 대하여 개시되었고, 한국 특허출원 2001-0075540에서는 피키아 파스토리스에서 재조합 IGF-I 단백질을 연속적으로 생산하는 방법에 대하여 개시되었고, 한국 특허출원번호 2005-7014530호에서는 IGF-1, IGF-2, VEGF(혈관 내피 세포 성장 인자) 또는 PDGF(혈소판 유래 성장인자)와 같은 성장인자와 비트로넥틴 또는 피브로넥틴 복합체가 상처 치료, 피부 재생에 효과적이어서, 화상치료에 유용하다는 보고가 있다. 한국 특허출원 2003-0012139에서는 재조합 IGF를 함유하는 화장료 조성물로 피부의 주름개선 효과가 현저함은 물론, 피부의 안전성까지 확보할 수 있는 효과에 대하여 개시되었고, 한국 특허출원번호 2004-009660에서는 인간의 두피에 대하여 발모를 촉진하는 발모 촉진 방법 및 발모제에 대하여 개시되었고, 한국 특허출원 2004-0046430에서는 IGF의 혈장 농도 측정을 통한 종돈의 성장형질 성적예측방법에 대하여 개시되었고, 한국특허 2005-7041530에서는 IGF가 암세포의 이동을 촉진하므로 이를 억제하여 암 세포 전이, 특히 유방암과 관련한 암 세포 전이를 억제하는 방법에 대하여 개시되었고, 한국 특허출원 2006-0025777에서는 녹용으로부터 분리된 신규 IGF-II의 폴리펩타이드 및 이의 유전자 및 이를 포함하는 형질전환체와 이를 이용하여 생산된 IGF-II는 골다공증의 치료제에 대하여 개시되었고, 한국 특허출원 2009-0046874에서는 IGF-I의 제조 방법을 제공하고 이 발명에 의하여 생산된 IGF-I은 알쯔하이머병과 같은 신경퇴행성 장애의 치료에 유용성에 대하여 개시되었고, 한국 특허출원 2009-7014300에서는 IGF-I 및 폴리(에틸렌 글라이콜)의 접합체 및 이 발명의 접합체는 알츠하이머병과 같은 신경퇴행성 장애의 치료에 유용성에 대하여 개시되었다. 유럽 특허 EP 2,172,480에서는 햄스터 IGF-I을 생산하는 방법에 대하여 개시되었고, 미국 특허출원번호 2000-723449호에서는 PDGF, KGF(각질세포 성장 인자) 및 IGF를 혼합하여 상피조직의 상처회복에 이용되는 치료용 조성물에 대하여 개시하고, 미국 특허출원번호 2001-972809에서는 파골세포의 작용을 억제하고 뼈를 만드는 조골세포의 작용을 활성화시킴으로서 골다공증을 치료에 유용하다고 보고하고 있으며, 미국 특허출원 2002-109971에서는 IGF를 이용하여 세포배양을 통한 재조합단백질의 수득율을 높이는데 이용하는 방법이 개발되었으며, 미국 특허출원 2004-029815에서는 IGF-I의 냉동 장기 보관을 위한 조성물에 대하여 개시되었고, 미국 특허 USP 5,534,493에서는 IGF-I/IGF-II 을 이용한 췌장 이상 치료 방법에 대하여 개시되었고, 미국 특허 USP 6,509,443에서는 반감기를 향상한 IGF-I 변이체에 대하여 개시되었고, 미국 특허 USP 6,514,937에서는 IGF 또는 IGF/IGFBP-3을 이용한 생리학적, 대사학적 이상 치료를 위한 방법에 대하여 개시되었고, 미국 특허 USP 6,756,484에서는 IGF-I 의 향상된 정제 방법에 대하여 개시되었다. 그러므로, IGF-I은 당뇨병, 왜소증, 면역조절, 퇴행성관절염, 그리고 이외에도 조직 재생, 근위축성 측색경화증, 알츠하이머 개선 등에 적용될 수 있는 유용한 물질이다.
IGF was first isolated from human serum by Rinderknecht et al. In 1978 and identified similar to the structure of proinsulin, hence the name IGF (Rinderknecht et al . , J. Biol . Chem . 253: 2769). -2776 (1978). IGF is classified into IGF-I and IGF-II due to the presence of two subtypes. IGF-I is a protein of about 7.5 kDa and a basic single subunit having a molecular weight of 70 amino acid residues. is the molecular weight consists of 67 amino acid residues in a weak acid band of approximately 7 kDa is a protein of a single sub - units (Daughaday, etc., Endocr Rev 10:.. 68-91 (1989)). IGF-I has three disulfide bonds and four domains named A, B, C and D. In contrast, proinsulin has three domains, A, B and C, and secreted active insulin has two domains, A and B. The amino acid composition of IGF-I and IGF-II is about 70% identical to each other, and their A and B domains have about 50% sequence similarity with the A and B chains of human insulin, and both IGF-I and II disulfide like insulin. It has A and B chains connected by bonds. On the other hand, the part connecting the A chain and the B chain (C-peptide) has 12 amino acids of IGF-I and 8 amino acids of IGF-II, but the C-peptide of the proinsulin has 31 amino acids, so it is structurally Is different. This structural similarity has the ability of IGF-I to attach to insulin receptors. IGF-I is a growth factor that plays a role in cell division and metabolism by being involved in the growth, survival and differentiation of numerous types of cells and tissues and plays a very important role in the growth and somatic differentiation of animals (Jones et al . , Endocrinol . . Rev 16: 3-34 (1995) ; Frost , etc., Endocrinol 140:. 3962-3970 (1999 )). IGF-I is produced by almost all tissues in the body, in addition to the liver, the main production organ, and acts on most cells, with typical endocrine and paracrine and autocrine acting on neighboring cells. Has a mechanism of action (Kaytor et al ., J. Biol . Chem . 276: 36896-36901 (2001)). The major factors in the regulation of IGF-I synthesis in the liver are the growth hormone and nutritional state secreted by the anterior pituitary gland. Insufficient growth hormone decreases the concentration of IGF-I in the blood or tissues, and recovery of growth hormone returns to normal, and blood IGF-I decreases due to chronic malnutrition or short-term fasting and protein deficiency. (Bichell et al., Mol . Endocrinol . 6: 1899-1908 (1992); Zhang et al., Endocrinol. 139: 4523-4530 (1998)). IGF-I has the ability to bind to its own receptors as well as insulin receptors.IGF-I binding to receptors promotes cell growth and is known to act like insulin, mediating growth. Somatomedin C (Somatomedin C) is also called. In addition to hepatocytes, IGF-I receptors are known to exist in various tissues such as adipose tissue, lymphocytes, and bones, and have been found to have different signaling pathways from insulin receptors. Unlike insulin, IGF-I is secreted from IGF-binding proteins, which have a molecular weight of 50-150kDa, and circulates into inactive conjugates. After separation, the cells are stimulated by binding to somatic cell receptors. IGF-binding proteins are known far and a total of six (Shimasaki etc., Prog. Growth Factor Res . 3: 243-246 (1992)), at least 90% of IGF-I in the blood is present as a complex of about 150 kD in combination with IGF binding protein-3 and less than 5% is free (Baxter et al., J. Biol. Chem. 264: 11843-11848 (1989). IGF-binding protein binds to IGF-I in the blood and regulates the carrier role and half-life of IGF-I, and serves to inhibit or enhance the action of IGF. In particular, IGF-binding protein-3 not only carries IGF-I in the blood and leads it to target tissues, but also prevents it from being destroyed by proteolytic enzymes and regulates the interaction with IGF-I receptors in target tissues. it is known that the function (Kelley, etc., Int. J. Biochem. Cell Biol . 28: 619-637 (1996). IGF-I promotes the growth of almost all cells through cell growth, cell proliferation, cell differentiation, cell survival, etc. 1) the formation and growth of bone, muscle, nerve, and vascular tissues in vivo, 2) damaged Cell regeneration, 3) delay in aging, and 4) normalization of blood sugar stabilization and insulin resistance (Mathews et al . , Endocrinol . 123: 2827-2833 (1988); Pardee, Sci . 246: 603-608 (1989). Florini et al . , J. Biol . Chem . 265: 13435-13437 (1990); Muta et al . , J. Cell Physiol . 156: 264-271 (1993). In addition, IGF-I controls the secretion of hormones from various cells (Giudice, Endocr Rev 13:. .... 641-669 (1992); Timsit , etc., J. Clin Endocrin Metab 75: 183-188 (1992) In addition, various functions are known, such as an improvement in immune response (Yamasaky et al., Endocrinol. 128: 857-862 (1991)), etc., through the function of cytotoxic T cells. Using the properties of IGF, Korean Patent Application No. 1990-0022193 discloses an expression vector of IGF-I. Korean Patent Application No. 2001-0075540 discloses a method for continuously producing recombinant IGF-I protein in Pichia pastoris. In Korean Patent Application No. 2005-7014530, a growth factor such as IGF-1, IGF-2, VEGF (vascular endothelial growth factor) or PDGF (platelet-derived growth factor) and a vitronectin or fibronectin complex are used for wound treatment, It is reported that it is effective for skin regeneration and is useful for burn treatment. In Korean Patent Application No. 2003-0012139, a cosmetic composition containing recombinant IGF has been described for the effect of improving the wrinkles of the skin as well as ensuring the safety of the skin, and in Korean Patent Application No. 2004-009660 A method for promoting hair growth and a hair regrowth agent for promoting hair growth on the scalp has been disclosed, and Korean patent application 2004-0046430 discloses a method for predicting growth traits of sows by measuring plasma concentrations of IGF, and in Korean patent 2005-7041530 Has been disclosed for inhibiting cancer cell metastasis, particularly cancer cell metastasis associated with breast cancer, by promoting the migration of cancer cells, Korean Patent Application 2006-0025777 discloses a novel IGF-II polypeptide isolated from antler and its Genes and transformants containing the same and IGF-II produced by using the same The Korean patent application 2009-0046874 provides a method for preparing IGF-I, and the IGF-I produced by the present invention has been disclosed for its usefulness in the treatment of neurodegenerative disorders such as Alzheimer's disease. In 2009-7014300, conjugates of IGF-I and poly (ethylene glycol) and conjugates of this invention have been disclosed for their usefulness in the treatment of neurodegenerative disorders such as Alzheimer's disease. European patent EP 2,172,480 discloses a method for producing hamster IGF-I, and US patent application No. 2000-723449 uses a combination of PDGF, KGF (keratinocyte growth factor) and IGF to treat wound healing of epithelial tissue. The composition for the present invention, US Patent Application No. 2001-972809 reports that osteoporosis is useful for treating osteoporosis by inhibiting the action of osteoclasts and activating the action of osteoblasts that make bones, US Patent Application 2002-109971 IGF A method for increasing the yield of recombinant protein through cell culture was developed. US Patent Application 2004-029815 discloses a composition for long-term storage of frozen IGF-I, and US Pat. No. 5,534,493 in / IGF-II has been described for the treatment of pancreatic abnormalities, the US patent USP 6,509,443 has a half-life An upper bound IGF-I variant is disclosed, US Pat. No. 6,514,937 discloses a method for the treatment of physiological and metabolic abnormalities using IGF or IGF / IGFBP-3, and US Pat. No. 6,756,484 improves the purification of IGF-I. A method was disclosed. Therefore, IGF-I is a useful substance that can be applied to diabetes, dwarfism, immunomodulation, degenerative arthritis, and other tissue regeneration, amyotrophic lateral sclerosis, and Alzheimer's improvement.

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

본 발명자들은 세포 성장 활성이 높고 대량 생산이 가능한 재조합 IGF-1의 개발을 위하여 예의 연구 노력하였고 그 결과 소의 간으로부터 세포 성장 활성이 높은 신규한 IGF-I 유전자 서열 및 아미노산 서열을 분석하고 이를 숙주 세포에서 대량 발현하여 본 발명을 완성하였다.The present inventors made extensive efforts to develop recombinant IGF-1 with high cell growth activity and mass production. As a result, the novel IGF-I gene sequence and amino acid sequence with high cell growth activity from bovine liver were analyzed and the host cell was analyzed. The present invention was completed by mass expression in.

따라서 본 발명의 목적은 상기 신규한 IGF-1을 제공하는 데 있다.It is therefore an object of the present invention to provide such novel IGF-1.

본 발명의 다른 목적은 상기 IGF-1을 코딩하는 유전자 및 이를 포함하는 발현벡터를 제공하는 데 있다.Another object of the present invention to provide a gene encoding the IGF-1 and an expression vector comprising the same.

본 발명의 또 다른 목적은 상기 IGF-1을 대량으로 발현할 수 있는 상기 발현벡터로 형질전환된 숙주세포를 제공하는 데 있다.Still another object of the present invention is to provide a host cell transformed with the expression vector capable of expressing the IGF-1 in a large amount.

본 발명의 또 다른 목적은 상기 IGF-1을 포함하는 사료 첨가용 조성물을 제공하는 데 있다.Another object of the present invention to provide a composition for feed addition containing the IGF-1.

본 발명의 또 다른 목적은 상기 IGF-1 발현용 형질전환 세포의 제조방법 및 상기 IGF-1 생합성 방법을 제공하는 데 있다.
Another object of the present invention to provide a method for producing a transformed cell for IGF-1 expression and the IGF-1 biosynthesis method.

본 발명의 또 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
Still other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 서열목록 제1서열로 표시되는 아미노산 서열을 포함하는 IGF-I(Insulin-like growth factor 1)을 제공한다.According to an aspect of the present invention, the present invention provides an Insulin-like growth factor 1 (IGF-I) comprising an amino acid sequence represented by SEQ ID NO: 1.

본 발명의 또 다른 양태에 따르면, 본 발명은 IGF-I을 코딩하는 뉴클레오타이드 서열을 제공한다.
According to another aspect of the invention, the invention provides a nucleotide sequence encoding IGF-I.

본 발명자들은 세포 성장 활성이 높고 대량 생산이 가능한 재조합 IGF-1의 개발을 위하여 예의 연구 노력하였고 그 결과 소의 간으로부터 세포 성장 활성이 높은 신규한 IGF-I 유전자 서열 및 아미노산 서열을 분석하고 이를 숙주 세포에서 대량 발현하여 본 발명을 완성하였다.The present inventors made extensive efforts to develop recombinant IGF-1 with high cell growth activity and mass production. As a result, the novel IGF-I gene sequence and amino acid sequence with high cell growth activity from bovine liver were analyzed and the host cell was analyzed. The present invention was completed by mass expression in.

상기 서열목록 제1서열은 본 발명의 IGF-1을 코딩하는 아미노산 서열로서, 기존에 알려지지 않은 신규한 아미노산 서열을 나타낸다. 본 발명의 서열목록 제1서열로 표시되는 아미노산 서열을 포함하는 IGF-1는 그 아미노산 서열이 동일하다면 그 출처에 관계없이 본 발명의 범위에 포함되는 것이다. The first sequence listing sequence is an amino acid sequence encoding IGF-1 of the present invention and represents a novel amino acid sequence that is not known in the past. IGF-1 including the amino acid sequence represented by the first sequence of the sequence listing of the present invention is included in the scope of the present invention regardless of the origin if the amino acid sequence is the same.

바람직한 구현예에서, 본 발명의 IGF-1는 소(Bos taurus)로부터 유래한 것이며, 보다 바람직하게는 소의 간으로부터 유래한 것이다.In a preferred embodiment, IGF-1 of the present invention is bovine ( Bos taurus ), and more preferably from bovine liver.

상기 본 발명의 IGF-1를 코딩하는 뉴클레오타이드 서열은 DNA(gDNA 및 cDNA) 그리고 RNA 분자를 포괄적으로 포함하는 의미를 갖으며, 핵산 분자에서 기본 구성 단위인 뉴클레오타이드는 자연의 뉴클레오타이드뿐만 아니라, 당 또는 염기 부위가 변형된 유사체(analogue)도 포함한다(Scheit, Nucleotide Analogs, John Wiley, New York(1980); Uhlman 및 Peyman, Chemical Reviews, 90:543-584(1990)). 본 발명의 상기 IGF-1를 코딩하는 뉴클레오타이드 서열은 변형될 수 있으며 상기 변형은 뉴클레오타이드의 추가, 결실 또는 비보존적 치환 또는 보존적 치환을 포함한다.The nucleotide sequence encoding the IGF-1 of the present invention has a meaning including comprehensively DNA (gDNA and cDNA) and RNA molecules, the nucleotides that are the basic structural unit in the nucleic acid molecule is not only natural nucleotides, but also sugars or bases also it includes analogs (analogue) the sites are modified (Scheit, Nucleotide analogs, John Wiley , New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990). The nucleotide sequence encoding the IGF-1 of the present invention may be modified and the modification includes addition, deletion or non-conservative substitution or conservative substitution of the nucleotide.

본 발명에서 상기 IGF-1를 코딩하는 뉴클레오타이드 서열은 인간의 간 cDNA 라이브러리로부터 중합연쇄반응으로 클로닝한 것을 사용하거나 말, 소, 돼지, 닭, 지렁이 및 갯지렁이 등의 다양한 동물 유래의 IGF-1 유전자를 사용할 수도 있다.In the present invention, the nucleotide sequence encoding the IGF-1 may be cloned by a polymerase chain reaction from a human liver cDNA library or may be derived from various animals such as horses, cattle, pigs, chickens, earthworms, and worms. Can also be used.

본 발명의 바람직한 구현예에 따르면, 상기 IGF-1를 코딩하는 뉴클레오타이드 서열은 서열목록 제2서열 또는 제3서열로 표시된다.According to a preferred embodiment of the present invention, the nucleotide sequence encoding the IGF-1 is represented by SEQ ID NO: 2 or 3 sequence.

IGF-1를 코딩하는 본 발명의 뉴클레오타이드 서열은 상기한 서열목록 제2서열 또는 제3서열에 한정되지 않으며, 상기 뉴클레오타이드 서열에 대하여 실질적인 동일성을 나타내는 뉴클레오타이드 서열도 포함하는 것으로 해석되며 이는degeneracy를 포함한다.The nucleotide sequence of the present invention encoding IGF-1 is not limited to the second or third sequence described above, and is also interpreted to include nucleotide sequences that exhibit substantial identity to the nucleotide sequence, which includes degeneracy. .

본 발명의 또 다른 양태에 따르면 본 발명은 상기 IGF-1를 코딩하는 뉴클레오타이드 서열을 포함하는 재조합 벡터를 제공한다.According to another aspect of the present invention, the present invention provides a recombinant vector comprising the nucleotide sequence encoding the IGF-1.

본 명세서에서 용어 “벡터”는 숙주 세포에서 목적 유전자를 발현시키기 위한 수단으로 플라스미드 벡터; 코즈미드 벡터; 그리고 박테리오파아지 벡터, 아데노바이러스 벡터, 레트로바이러스 벡터 및 아데노-연관 바이러스 벡터 같은 바이러스 벡터 등을 포함되며, 바람직하게는 플라스미드 벡터이다. As used herein, the term “vector” refers to a plasmid vector as a means for expressing a gene of interest in a host cell; Cosmid vectors; And viral vectors such as bacteriophage vectors, adenovirus vectors, retrovirus vectors, and adeno-associated virus vectors, and the like, and are preferably plasmid vectors.

본 발명의 바람직한 구현예에 따르면, 본 발명의 벡터에서 상기 IGF-1를 코딩하는 뉴클레오타이드 서열은 프로모터와 작동적으로 결합(operatively linked)되어 있다.According to a preferred embodiment of the present invention, the nucleotide sequence encoding the IGF-1 in the vector of the present invention is operatively linked with the promoter.

본 명세서에서, 용어 “작동적으로 결합된”은 핵산 발현 조절 서열(예: 프로모터, 시그널 서열, 또는 전사조절인자 결합 위치의 어레이)과 다른 핵산 서열사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 다른 핵산 서열의 전사 및/또는 해독을 조절하게 된다.As used herein, the term “operably linked” refers to the functional binding between a nucleic acid expression control sequence (eg, an array of promoters, signal sequences, or transcriptional regulator binding sites) and other nucleic acid sequences, thereby The regulatory sequence will control the transcription and / or translation of said other nucleic acid sequence.

본 발명의 재조합 벡터 시스템은 당업계에 공지된 다양한 방법을 통해 구축될 수 있으며, 이에 대한 구체적인 방법은 문헌(Sambrook et al., Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Laboratory Press(2001))에 개시되어 있으며, 이 문헌은 본 명세서에 참조로서 삽입된다. The recombinant vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are described in Sambrook et al., Molecular Cloning , A Laboratory Manual , Cold Spring Harbor Laboratory Press (2001), which is incorporated herein by reference.

본 발명의 벡터는 전형적으로 클로닝을 위한 벡터 또는 발현을 위한 벡터로서 구축될 수 있다. 또한, 본 발명의 벡터는 원핵 세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. Vectors of the present invention can typically be constructed as vectors for cloning or vectors for expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts.

예를 들어, 본 발명의 벡터가 발현 벡터이고, 원핵 세포를 숙주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터(예컨대, tac 프로모터, lac 프로모터, lacUV5 프로모터, lpp 프로모터, pL λ프로모터, pR λ프로모터, rac5 프로모터, amp 프로모터, recA 프로모터, SP6 프로모터, trp 프로모터 및 T7 프로모터 등), 해독의 개시를 위한 라이보좀 결합 자리 및 전사/해독 종결 서열을 포함할 수 있다. 숙주 세포로서 E. coli(예컨대, HB101, BL21, DH5α 등)가 이용되는 경우, E. coli 트립토판 생합성 경로의 프로모터 및 오퍼레이터 부위(Yanofsky, C., J. Bacteriol ., 158:1018-1024(1984)) 그리고 파아지 λ의 좌향 프로모터 (pL λ프로모터, Herskowitz, I. and Hagen, D., Ann . Rev . Genet ., 14:399-445(1980))가 조절 부위로서 이용될 수 있다. 숙주세포로서 바실러스 균이 이용되는 경우, 바실러스 츄린겐시스의 독소단백질 유전자의 프로모터(Appl . Environ. Microbiol . 64:3932-3938(1998); Mol . Gen . Genet . 250:734-741(1996)) 또는 바실러스균에서 발현 가능한 어떠한 프로모터(예컨대, AprE 프로모터)라도 조절부위로 이용될 수 있다.For example, when the vector of the present invention is an expression vector and the prokaryotic cell is used as a host, a strong promoter (for example, a tac promoter, lac) capable of promoting transcription can be obtained. Promoter, lac UV5 promoter, lpp promoter, p L λ promoter, p R λ promoter, rac 5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), ribosomal binding site for initiation of detoxification and Transcription / detox termination sequence. E. coli (eg, as a host cell) HB101, BL21, DH5α, etc.) is used, E. coli Promoter and operator sites of the tryptophan biosynthetic pathway (Yanofsky, C., J. Bacteriol . , 158: 1018-1024 (1984)) and the leftward promoter of phage λ (p L λ promoter, Herskowitz, I. and Hagen, D., . Ann Rev Genet, 14:. . 399-445 (1980)) may be used as a control region. When Bacillus bacteria are used as host cells, the promoter of the Bacillus Chuo toxin protein gene of ringen sheath (Appl Environ Microbiol 64: 3932-3938 ( 1998); Mol Gen Genet 250:...... 734-741 (1996) ) Or any promoter that can be expressed in Bacillus (eg, AprE promoter) can be used as a regulatory site.

한편, 본 발명에 이용될 수 있는 벡터는 당업계에서 종종 사용되는 플라스미드(예: pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX 시리즈, pET 시리즈, pUC19 및 pT7 시리즈 등), 파지(예: λgt4λB, λ-Charon, λΔz1 및 M13 등) 또는 바이러스 (예: SV40 등)를 조작하여 제작될 수 있다.On the other hand, vectors that can be used in the present invention are plasmids often used in the art (eg pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14). , pGEX series, pET series, pUC19 and pT7 series, etc.), phages (eg, λgt4λB, λ-Charon, λΔz1 and M13, etc.) or viruses (eg SV40, etc.) may be produced.

한편, 본 발명의 벡터가 발현 벡터이고, 진핵 세포를 숙주로 하는 경우에는, 포유동물 세포의 지놈으로부터 유래된 프로모터(예: 메탈로티오닌 프로모터, β-액틴 프로모터, 사람 헤모글로빈 프로모터 및 사람 근육 크레아틴 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터(예: 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토메갈로바이러스 프로모터, HSV의 tk 프로모터, 마우스 유방 종양 바이러스(MMTV) 프로모터 및 HIV의 LTR 프로모터)가 이용될 수 있으며, 전사 종결 서열로서 폴리아데닐화 서열을 일반적으로 갖는다.On the other hand, when the vector of the present invention is an expression vector and the eukaryotic cell is a host, promoters derived from the genome of mammalian cells (for example, metallothionine promoter, β-actin promoter, human hemoglobin promoter and human muscle creatine) Promoter) or a promoter derived from a mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, tk of HSV) Promoter, mouse breast tumor virus (MMTV) promoter and LTR promoter of HIV) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

본 발명의 벡터는 그로부터 발현되는 IGF-1의 정제를 용이하게 하기 위하여, 다른 서열과 융합될 수도 있다. 융합되는 서열은 예컨대, 글루타티온 S-트랜스퍼라제(Pharmacia, USA), 말토스 결합 단백질(NEB, USA), FLAG(IBI, USA) 및 6x His (hexahistidine; Quiagen, USA) 등이 있다.Vectors of the present invention may also be fused with other sequences to facilitate purification of IGF-1 expressed therefrom. Sequences to be fused include, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA).

또한, 본 발명의 발현 벡터는 선택표지로서, 당업계에서 통상적으로 이용되는 항생제 내성 유전자를 포함할 수 있으며, 예를 들어 암피실린, 겐타마이신, 카베니실린, 클로람페니콜, 스트렙토마이신, 카나마이신, 게네티신, 네오마이신 및/또는 테트라사이클린에 대한 내성 유전자를 포함할 수 있다.In addition, the expression vector of the present invention may include an antibiotic resistance gene commonly used in the art as a selectable label, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin Resistance genes for neomycin and / or tetracycline.

본 발명의 바람직한 구현예에 따르면, 본 발명의 발현벡터는 대장균 발현용 플라스미드 또는 바실러스 발현용 플라스미드이다. According to a preferred embodiment of the present invention, the expression vector of the present invention is E. coli expression plasmid or Bacillus expression plasmid.

바실러스 발현용 플라스미드의 가장 바람직한 구현예에 따르면, AprE 프로모터 및 AprE 단백질 분비 시그널 서열을 포함한다. AprE 단백질 분비 시그널 서열은 본 발명의 벡터를 이용하여 바실러스에서 IGF-I을 봉입체 없이 생산하는 데 매우 유리하다.
According to the most preferred embodiment of the Bacillus expression plasmid, it comprises the AprE promoter and AprE protein secretion signal sequence. AprE protein secretion signal sequences are very advantageous for the production of IGF-I without inclusion bodies in Bacillus using the vectors of the invention.

본 발명의 또 다른 양태에 따르면, 본 발명은 상기 재조합 벡터로 형질전환 된 숙주세포를 제공한다.According to another aspect of the present invention, the present invention provides a host cell transformed with the recombinant vector.

본 발명의 벡터를 안정되면서 연속적으로 클로닝 및 발현시킬 수 있는 숙주 세포는 당업계에 공지되어 어떠한 숙주 세포도 이용할 수 있으며, 예컨대, 에스케리치아 콜라이(Escherichia coli), 바실러스 서브틸리스 및 바실러스 츄린겐시스와 같은 바실러스 속 균주, 스트렙토마이세스(Streptomyces), 슈도모나스(Pseudomonas)(예를 들면, 슈도모나스 푸티다(Pseudomonas putida)), 프로테우스 미라빌리스(Proteus mirabilis) 또는 스타필로코쿠스(Staphylococcus)(예를 들면, 스타필로코쿠스 카르노수스(Staphylocus carnosus))와 같은 원핵 숙주 세포를 포함하나 이로 제한되는 것은 아니다. 상기 숙주세포는 바람직하게는 E. coli ER2738, E. coli XL-1 Blue, E. coli BL21(DE3), E. coli JM109, E. coli DH 시리즈, E. coli TOP10, E. coli TG1 또는 E. coli HB101와 같은 E. coli 또는 바실러스 서브틸리스이고 보다 바람직하게는 E. coli BL21(DE3) 또는 바실러스 서브틸리스이다.Host cells capable of stably and continuously cloning and expressing the vectors of the present invention are known in the art and can be used with any host cell, for example Escherichia coli), Bacillus subtilis and Bacillus strains such as Bacillus Chuo ringen system, Streptomyces (Streptomyces), Pseudomonas (Pseudomonas) (for example, Pseudomonas footage is (Pseudomonas putida)), Proteus Mira Billy's (Proteus mirabilis ) or Staphylococcus (e.g., Staphylocus prokaryotic host cells such as carnosus )), but are not limited to these. The host cell is preferably E. coli ER2738, E. coli XL-1 Blue , E. coli BL21 (DE3), E. coli JM109, E. coli DH series, TOP10 E. coli, E. coli TG1 or E. coli, such as E. coli HB101 Or Bacillus subtilis and more preferably E. coli BL21 (DE3) or Bacillus subtilis.

본 발명의 E. coli 또는 바실러스 균에서 생산한 재조합 IGF-1은 원핵세포에서 얻어진 것임에도 불구하고 직접 분비형태(secretion type)로 수득되는 것을 그 특징으로 한다. 일반적으로 대장균 또는 바실러스 균과 같은 원핵세포에서 진핵세포 단백질을 발현시키는 경우 결과물인 단백질이 봉입체(inclusion body) 형태로 얻어지게 된다. 이러한 경우 활성 있는 단백질을 얻기 위해서는 상기 봉입체를 풀어주고 재접힘(refolding)시키는 추가과정이 필요하다. 그러나, 본 발명의 형질전환 대장균 또는 형질전환 바실러스에서 생산되는 재조합 IGF-1은 봉입체 형태가 아닌 분비형태(secretion type)로서 직접 수득되어지므로 뭉쳐진 것을 풀고 재접힘시키는 추가과정이 요구되지 않는 장점이 있다.Recombinant IGF-1 produced by E. coli or Bacillus of the present invention is characterized in that it is obtained directly in secretion type (secretion type) despite being obtained from prokaryotic cells. In general, when eukaryotic protein is expressed in prokaryotic cells such as E. coli or Bacillus, the resulting protein is obtained in the form of inclusion body. In this case, in order to obtain an active protein, an additional process of releasing and refolding the inclusion body is required. However, recombinant IGF-1 produced in the transformed E. coli or transformed Bacillus of the present invention is obtained directly as a secretion type (secretion type), not the inclusion body form, there is an advantage that does not require the additional process of unpacking and refolding the aggregates. .

상기 벡터의 적합한 진핵세포 숙주 세포는 아스페르길러스 속(Aspergillus species)과 같은 진균, 피치아 파스토리스(Pichia pastoris), 사카로마이세스 세르비시아(Saccharomyces cerevisiae), 쉬조사카로마세스(Schizosaccharomyces) 및 뉴로스포라 크라사(Neurospora crassa)와 같은 효모, 그 밖의 하등 진핵세포, 그리고 곤충-유래 세포와 같은 고등 진핵생물의 세포를 포함한다. 또한, 식물 또는 포유동물로부터 유래한 세포도 숙주 세포로 이용할 수 있다. 바람직하게는, 숙주세포는 원숭이 신장 세포7(COS7: monkey kidney cells), NSO 세포, SP2/0, 차이니즈 햄스터 난소(CHO: Chinese hamster ovary) 세포, W138, 어린 햄스터 신장(BHK: baby hamster kidney) 세포, MDCK, 골수종 세포주, HuT 78 세포 및 293 세포를 포함하나 이에 한정되지 않는다. 보다 바람직하게는, 상기 숙주세포는 COS7 세포일 수 있다.
Suitable eukaryotic host cells of the vector are of the genus Aspergillus. fungi, such as species, Pichia pastoris , Saccharomyces cerevisiae , yeasts such as Schizosaccharomyces and Neurospora crassa , other lower eukaryotic cells, and insect-derived cells such as It includes cells of higher eukaryotes. In addition, cells derived from plants or mammals can also be used as host cells. Preferably, the host cell is monkey kidney cells (COS7), NSO cells, SP2 / 0, Chinese hamster ovary (CHO) cells, W138, baby hamster kidney (BHK) Cells, MDCK, myeloma cell line, HuT 78 cells and 293 cells. More preferably, the host cell may be a COS7 cell.

본 발명의 또 다른 양태에 따르면, 본 발명은 상기 IGF-I을 포함하는 사료첨가용 조성물을 제공한다. 본 발명의 조성물이 사료 첨가용 조성물로 제조되는 경우, 사료의 품질을 개선하거나 가축의 건강 및 활동을 향상시킬 목적으로 첨가되는 영양분 등 기타 통상적으로 사용되는 첨가물을 추가적으로 포함할 수 있으며, 예컨대, 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 본 발명의 조성물에 포함되는 IGF-I는 가축을 성장을 촉진시킬 수 있으며 숙주 세포에서 대량 발현이 가능하므로 의약산업, 식품산업 및 특히 사료산업 분야에서 유용하게 사용될 수 있다.
According to another aspect of the present invention, the present invention provides a composition for feed addition comprising the IGF-I. When the composition of the present invention is prepared as a feed additive composition, it may further include other commonly used additives such as nutrients added for the purpose of improving the quality of the feed or improving the health and activity of the livestock, for example, a lubricant , Wetting agents, sweetening agents, flavoring agents, emulsifying agents, suspending agents, preservatives and the like may be further included. IGF-I included in the composition of the present invention can promote the growth of livestock and can be usefully used in the pharmaceutical industry, the food industry and especially the feed industry because it can be expressed in a large amount in the host cell.

본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 상기 IGF-I를 코딩하는 뉴클레오타이드 서열을 발현벡터에 삽입시키는 단계; 및 (b) 상기 뉴클레오타이드 서열이 삽입된 발현벡터로 세포를 형질전환시키는 단계를 포함하는 IGF-I 발현용 형질전환 세포의 제조방법을 제공한다.According to another aspect of the invention, the present invention comprises the steps of (a) inserting the nucleotide sequence encoding the IGF-I into the expression vector; And (b) provides a method for producing a transformed cell for IGF-I expression comprising the step of transforming the cell with the expression vector into which the nucleotide sequence is inserted.

본 발명의 IGF-I를 발현하는 형질전환 세포의 제조방법은 재조합 숙주세포를 이용하여 상술한 신규 IGF-I를 생산하는 방법에 관한 것이므로 상술한 내용과 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다. Since the method for producing a transformed cell expressing IGF-I of the present invention relates to a method for producing the novel IGF-I described above using a recombinant host cell, the content in common with the above description is to avoid excessive complexity of the present specification. And the description thereof are omitted.

본 명세서에서, 숙주 세포로의 “형질전환” 및/또는 “형질감염”은 핵산을 유기체, 세포, 조직 또는 기관에 도입하는 어떤 방법도 포함되며 당 분야에서 공지된 바와 같이 숙주 세포에 따라 적합한 표준 기술을 선택하여 수행할 수 있다. 이런 방법에는 전기충격유전자전달법(electroporation), 원형질 융합, 인산 칼슘(CaPO4)) 침전, 염화 칼슘(CaCl2) 침전, 실리콘 카바이드 섬유 이용한 교반, 아그로 박테리아 매개된 형질전환, PEG, 덱스트란 설페이트, 리포펙타민 및 건조/억제 매개된 형질전환 방법 등이 포함되나 이로 제한되지 않는다. 예를 들어 염화칼슘법을 이용하는 칼슘 처리 또는 일렉트로포레이션은 일반적으로 원핵세포에 대해 사용될 수 있다(Sambrook et al., Molecular Cloning : A Laboratory Manual (New York: Cold Spring Haror Laboratory Press)(1989)). 아그로박테리움 투메파시엔스(Agrobacterium tumefaciens)를 사용한 형질감염은 특정 식물 세포의 형질전환에 사용될 수 있다((Shaw et. al, Gene, 23:315(1983), 국제 공개특허 WO 89/05859). 또한 세포벽이 없는 포유동물 세포의 경우, 인산칼슘 침전법을 사용할 수 있다(Graham et .al,, Virology, 52:456-457(1978)). 포유동물 숙주 세포로의 형질전환의 일반적인 방법 및 특징은 미국 특허 제4,399,216호에 기재되어 있다. 효모 내로의 형질전환은 일반적으로 반 솔링겐(Van Solingen) 등의 문헌(J. Bact.,130:946(1977)) 및 히시아오(Hsiao) 등의 문헌(Proc . Natl . Acad . Sci .( USA ), 76:3829(1979))의 방법에 따라 수행될 수 있다.As used herein, “transformation” and / or “transfection” into a host cell includes any method of introducing a nucleic acid into an organism, cell, tissue, or organ and is a standard suitable for a host cell as is known in the art. The technique can be selected and performed. These methods include electroporation, protoplast fusion, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, agitation with silicon carbide fibers, agro bacterial mediated transformation, PEG, dextran sulfate , Lipofectamine and dry / inhibited mediated transformation methods, and the like. Calcium treatment or electroporation, for example using the calcium chloride method, can generally be used for prokaryotic cells (Sambrook et al., Molecular Cloning : A Laboratory Manual (New York: Cold Spring Haror Laboratory Press) (1989). Agrobacterium tumefaciens transfection with tumefaciens ) can be used for the transformation of certain plant cells (Shaw et. al, Gene , 23: 315 (1983), International Publication WO 89/05859). In this case, calcium phosphate precipitation may be used (Graham et. Al, Virology , 52: 456-457 (1978)). General methods and features of transformation into mammalian host cells are described in US Pat. No. 4,399,216. Transformation into yeast is generally described by Van Solingen et al . ( J. Bact ., 130: 946 (1977)) and Hsiao et al . ( Proc . Natl . Acad . Sci . ( USA ) , 76: 3829 (1979)).

일 구현예에서, 본 발명의 IGF-I 발현용 형질전환 세포의 제조방법은 본 발명은 소 간으로부터 총 세포 RNA 를 추출?정제하는 단계; 상기 추출?정제된 RNA로부터 mRNA를 정제하는 단계; 상기 정제한 mRNA 로부터 cDNA 라이브러리를 제조하는 단계; 상기 제조된 cDNA 라이브러리로부터 IGF-I의 잘 보존된 서열을 바탕으로 디제너레이트 프라이머(degenerate primer)를 제작하고, 중합연쇄반응에 의해 클로닝하고 상기 클로닝된 유전자가 IGF-I 유전자임을 자동 염기서열 분석기에 의해 확인하는 단계; 클로닝된 IGF-I 유전자가 도입된 재조합 발현벡터를 제조하는 단계; 및 상기 재조합 IGF-I이 도입된 발현벡터를 발현용 균주에 형질전환시켜 재조합 균주를 제조하는 단계를 포함할 수 있다.In one embodiment, the method for producing a transformed cell for IGF-I expression of the present invention comprises the steps of extracting and purifying total cell RNA from bovine liver; Purifying mRNA from the extracted and purified RNA; Preparing a cDNA library from the purified mRNA; Based on the well-conserved sequence of IGF-I from the prepared cDNA library, a degenerate primer was prepared, cloned by a polymerase chain reaction, and the cloned gene was an IGF-I gene. Confirming by; Preparing a recombinant expression vector into which the cloned IGF-I gene is introduced; And converting the expression vector into which the recombinant IGF-I is introduced into an expression strain, thereby preparing a recombinant strain.

상기와 같이 제조한 형질전환 세포는 그 유전자를 발현시켜 재조합 인슐린 유사 성장 인자-I을 생산하게 할 수 있으며, 이렇게 생산한 재조합 IGF-I는 이를 유효성분으로 포함하는 성장 촉진제, 사료 첨가제 또는 식품 첨가제 등의 제조에 유용하게 사용될 수 있다.
The transformed cells prepared as described above may express the gene to produce recombinant insulin-like growth factor-I, and the recombinant IGF-I thus produced may be a growth accelerator, feed additive or food additive containing the same as an active ingredient. It can be usefully used for the production of such.

본 발명의 또 다른 양태에 따르면, 본 발명은 (a) 상기에서 상술한 형질전환 세포를 배양하여 IGF-I를 생합성 하는 단계; 및 (b) 상기 생합성된 IGF-I를 수득하는 단계를 포함하는 IGF-I의 생합성 방법을 제공한다.According to another aspect of the present invention, the present invention comprises the steps of (a) culturing the above-described transformed cells to biosynthesize IGF-I; And (b) provides a method of biosynthesis of IGF-I comprising the step of obtaining the biosynthetic IGF-I.

본 발명의 IGF-I 과발현용 형질전환 세포의 배양은 당업계에 공지된 통상의 배양 방법에 의해 배양될 수 있으며, 바람직하게는 단계 (a)는 발현 유도제(예컨대 IPTG) 존재 하에서 실시될 수 있다. Cultivation of the transformed cells for IGF-I overexpression of the present invention can be cultured by conventional culture methods known in the art, preferably step (a) can be carried out in the presence of an expression inducing agent (such as IPTG). .

상기 형질전환 세포 내에서 생합성된 IGF-I을 분리하는 단계는 당업계에 공지된 통상의 분리 또는 정제 방법에 따라 실시될 수 있다(참조: B. Aurousseau et al., Journal of the American Oil Chemists' Society, 57(3):1558-9331( 1980); Frank C. Magne et al., Journal of the American Oil Chemists' Society, 34(3):127-129(1957)).
The step of isolating biosynthesized IGF-I in the transformed cells can be carried out according to conventional isolation or purification methods known in the art (see B. Aurousseau et al., Journal of the American Oil Chemists' Society , 57 (3): 1558-9331 (1980); Frank C. Magne et al., Journal of the American Oil Chemists' Society , 34 (3): 127-129 (1957).

본 발명의 특징 및 이점을 요약하면 다음과 같다:The features and advantages of the present invention are summarized as follows:

(ⅰ) 본 발명은 신규한 IGF-I, 이를 코딩하는 유전자, 이를 발현하는 발현벡터 및 숙주세포와 이들을 이용한 상기 IGF-I의 생합성 방법을 제공한다.(Iii) The present invention provides novel IGF-I, genes encoding the same, expression vectors and host cells expressing the same, and methods for biosynthesis of the IGF-I using them.

(ⅱ) 본 발명의 IGF-I은 기존에 알려진 다른 서열을 가지며 숙주 세포에서 대량 생산될 수 있을 뿐만 아니라, 가축 성장을 촉진할 수 있기 때문에 특히 사료산업 분야에서 유용하게 사용할 수 있다.
(Ii) The IGF-I of the present invention can be usefully used in the field of feed industry especially because it has other known sequences and can be mass produced in host cells, and can promote livestock growth.

도 1은 본 발명의 IGF-F3 프라이머와 IGF-R6 프라이머 쌍을 이용하여 중합효소 연쇄반응한 결과를 나타내는 1% 아가로즈 겔 전기영동 사진이다.
레인 M: 1 kb 래더 DNA 분자량 마커
레인 1: 0 ng mRNA
레인 2: 5 ng mRNA
레인 3: 50 ng mRNA
레인 4: 100 ng mRNA 를 주형으로하여 중합효소 연쇄반응한 생성물
화살표는 0.86 kb 의 IGF-I cDNA 밴드를 나타낸다.
도 2는 중합효소 연쇄반응에서 얻은 0.87 kb DNA 단편의 염기 서열 및 이 서열로 유도된 아미노산 서열이다.
도 3은 소 간 유래의 IGF-I의 유전자가 클로닝되어 있는 대장균 발현용 플라스미드(pT7-IGF)의 모식도이다.
도 4는 pT7-IGF가 도입된 대장균 형질전환체에 IPTG를 첨가하여 배양함으로써 유도된 IGF-I을 SDS-PAGE(A) 및 Western blotting(B)으로 분석한 사진이다.
레인 M: 단백질 분자량 마커
레인 1: IPTG 유도전
레인 2: IPTG 유도후 4시간
화살표는 발현 유도된 IGF-I 밴드를 나타낸다.
도 5는 IGF-I의 유전자가 클로닝되어 있는 바실러스 발현용 플라스미드(pHPS-IGF)의 모식도이다.
PaprE 및 SS_AprE: AprE 프로모터 및 AprE 단백질 분비 시그널 서열
Ori322 및 Rep(pTA): 각각 E coli에서 플라스미드 복제에 필요한 복제원점 및 Bacillus Subtili에서 플라스미드 복제에 필요한 복제원점(replication origin)
Cm 및 Em: 각각 클로람페니콜 및 에리쓰로마이신의 저항성을 갖는 선별마커(selection marker) 이다.
도 6은 pHPS-IGF가 도입된 바실러스 형질전환체를 배양함으로써 유도된 IGF-I을 SDS-PAGE(A) 및 Western blotting(B)으로 분석한 사진이다.
레인 M: 단백질 분자량 마커,
레인 1: 접종 전
레인 2: 배양 후 12시간,
레인 3: 배양 후 24시간
화살표는 발현된 IGF-I 밴드를 나타낸다.Figure 1 is a 1% agarose gel electrophoresis picture showing the results of polymerase chain reaction using the IGF-F3 primer and IGF-R6 primer pair of the present invention.
Lane M: 1 kb ladder DNA molecular weight marker
Lane 1: 0 ng mRNA
Lane 2: 5 ng mRNA
Lane 3: 50 ng mRNA
Lane 4: product of polymerase chain reaction using 100 ng mRNA as a template
Arrows indicate IGF-I cDNA bands of 0.86 kb.
Figure 2 shows the base sequence of the 0.87 kb DNA fragment obtained from the polymerase chain reaction and the amino acid sequence derived from this sequence.
Figure 3 is a schematic diagram of E. coli expression plasmid (pT7-IGF) in which the gene of IGF-I derived from bovine liver is cloned.
Figure 4 is a photograph of IGF-I induced by culturing by adding IPTG to E. coli transformants introduced pT7-IGF by SDS-PAGE (A) and Western blotting (B).
Lane M: protein molecular weight marker
Lane 1: Before Induction of IPTG
Lane 2: 4 hours after induction of IPTG
Arrows indicate expression induced IGF-I bands.
5 is a schematic diagram of a Bacillus expression plasmid (pHPS-IGF) in which a gene of IGF-I is cloned.
PaprE and SS_AprE: AprE promoter and AprE protein secretion signal sequence
Ori322 and Rep (pTA): Replication origin and Bacillus for plasmid replication in E coli , respectively Replication origin for plasmid replication in Subtili
Cm and Em: Selection markers with resistance of chloramphenicol and erythromycin, respectively.
Figure 6 is a photograph of IGF-I induced by culturing Bacillus transformants introduced pHPS-IGF by SDS-PAGE (A) and Western blotting (B).
Lane M: protein molecular weight marker,
Lane 1: Before Inoculation
Lane 2: 12 hours after incubation,
Lane 3: 24 hours after incubation
Arrows indicate expressed IGF-I bands.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명 하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not to be construed as limiting the scope of the present invention. It will be self-evident.

실시예Example

<실시예 1> 소 간으로부터 mRNA 분리Example 1 mRNA Separation from Bovine Liver

본 발명에서는 IGF-I 유전자의 염기서열 및 아미노산 서열을 결정하기 위해 먼저 소 간으로부터 mRNA를 분리하여 이를 역전사반응시켜 cDNA를 제조하였다. 이를 위해 먼저 소의 간을 적출한 후 샘부르크 등의 방법(Sambrook 등 Molecular Cloning 3rd Ed. Cold Spring Harbor Laboratory, 2001)을 변형하여 mRNA를 분리하였다. 구체적으로, 소로부터 적출한 간 조직 1 g에 10 ㎖의 변성 용액(4 M 구아니디움 이소티오시아네이트, 25 mM 소듐 시트레이트, pH 7.0, 0.5% 사코실 및 0.1 M 2-머캅토에탄올)을 넣은 후 얼음 하에서 파쇄하고, 5,000 rpm에서 15분 동안 원심분리하여 상등액을 회수하였다. 이 상등액에 동량의 페놀과 클로로포름을 넣어 4 내지 5회 반복 추출하여 단백질을 제거하고, 상기 단백질 제거된 상등액에 2 M 초산 나트륨과 이소프로필 알콜(isopropanol, Sigma, USA)을 첨가하여 총 세포 RNA 침전물을 회수하여 여기에 DEPC(diethylpyrocarbonate, Sigma, USA)로 처리한 증류수를 첨가해 RNA 침전물을 녹여 RNA를 수득하였다. 올리고 dT(oligo-dT) 셀룰로스컬럼(Collaborative Biomedical Products, USA)을 사용하여 샘부르크 등의 방법에 따라 이렇게 수득된 총 세포 RNA로부터 mRNA를 정제하였다. 정제한 mRNA 용액을 260 nm와 280 nm의 파장에서 각각 흡광도를 측정하여 RNA의 양과 순도를 결정한 후 cDNA 합성을 위한 역전사 반응의 주형으로 사용하였다.
In the present invention, in order to determine the nucleotide sequence and amino acid sequence of the IGF-I gene, cDNA was prepared by first separating mRNA from bovine liver and reverse transcripting it. For this purpose, the liver of the cow was first extracted, and then modified by Samburg et al. (Sambrook et al., Molecular Cloning 3rd Ed. Cold Spring Harbor Laboratory, 2001). Specifically, 10 ml of denatured solution (4 M guanidium isothiocyanate, 25 mM sodium citrate, pH 7.0, 0.5% sacosyl and 0.1 M 2-mercaptoethanol) to 1 g of liver tissue extracted from bovine After crushing under ice and centrifuged for 15 minutes at 5,000 rpm to recover the supernatant. Into the supernatant, the same amount of phenol and chloroform were extracted 4 to 5 times to remove the protein, and 2 M sodium acetate and isopropyl alcohol (isopropanol, Sigma, USA) were added to the supernatant. The distilled water treated with DEPC (diethylpyrocarbonate, Sigma, USA) was added thereto to dissolve the RNA precipitate to obtain RNA. MRNA was purified from total cellular RNA thus obtained according to the method of Semburg et al. Using an oligo-dT cellulose column (Collaborative Biomedical Products, USA). Purified mRNA solution was used as a template for reverse transcription for cDNA synthesis after determining the amount and purity of RNA by measuring the absorbance at wavelengths of 260 nm and 280 nm, respectively.

<실시예 2> 소 간의 cDNA 라이브러리 제조Example 2 Preparation of cDNA Library for Bovine Liver

상기 실시예 1에서 소 간으로부터 분리한 mRNA를 이용해 cDNA 라이브러리 합성키트(BD Science, USA)를 이용하여 cDNA 라이브러리를 제조하였다. cDNA 라이브러리 제조 방법은 제조사의 방침에 따라 수행하였다. cDNA 라이브러리를 제조하기 위한 프라이머로는 하기의 서열을 갖는 프라이머를 사용하였다. cDNA의 제조는 구체적으로, 상기 실시예 1에서 분리한 mRNA 5 ㎍, 서열번호 4로 기재되는 CDS3' 프라이머(5' ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30NN 3', 10 uM) 1 ㎕, 서열번호 5으로 기재되는 CDS5' 프라이머(5' AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG 3', 10 uM) 1 ㎕, 적당량의 DEPC 처리된 물을 혼합하여 42℃에서 1시간 동안 반응한 후 25 mM NaOH 1 ㎕를 가하여 68℃에서 30분 동안 방치시켜 mRNA의 2차 구조를 제거하였다. 2차 구조가 제거된 상기 반응물 11 ㎕, DEPC 처리된 물 71 ㎕, 10 X 반응 완충용액 10 ㎕, 10 mM dNTP 혼합용액 2 ㎕, 서열번호 4로 기재되는 CDS3' 프라이머(10 uM) 2 ㎕, 서열번호 6로 기재되는 5' PCR 프라이머(5' AAGCAGTGGTATCAACGCAGAGT 3', 10 uM) 2 ㎕, 중합효소(Advantage 2 polymerase, 50X) 2 ㎕를 가하여 최종 부피가 100 ㎕가 되게 한 후 95℃에서 1분, 72℃에서 10분 동안 반응시킨 후, 95℃에서 1분, 68℃에서 10분 동안 반응을 3번 반복하여 이중 나선의 cDNA를 합성하고 페놀-클로로포름 추출과 에탄올 침전에 의해 합성된 cDNA를 회수하였다.CDNA library was prepared using cDNA library synthesis kit (BD Science, USA) using mRNA isolated from bovine liver in Example 1. The cDNA library preparation method was performed according to the manufacturer's policy. As a primer for preparing the cDNA library, a primer having the following sequence was used. Specifically, the preparation of cDNA was carried out by 5 μg of mRNA isolated from Example 1, CDS3 ′ primer (5 ′ ATTCTAGAGGCCGAGGCGGCCGACATG-d (T) 30 NN 3 ′, 10 uM) described in SEQ ID NO: 4, 1 μl, SEQ ID NO: 5 1 μl of a CDS5 ′ primer (5 ′ AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG 3 ′, 10 uM) described above was mixed with an appropriate amount of DEPC treated water for 1 hour at 42 ° C., and 1 μl of 25 mM NaOH was added thereto for 30 minutes at 68 ° C. It was left to remove the secondary structure of the mRNA. 11 μl of the reaction with the secondary structure removed, 71 μl of DEPC treated water, 10 μl of 10 × reaction buffer, 2 μl of 10 mM dNTP mixed solution, 2 μl of CDS3 ′ primer (10 uM) as set forth in SEQ ID NO: 4, 2 µl of 5 'PCR primer (SEQ ID NO: 6) (5' AAGCAGTGGTATCAACGCAGAGT 3 ', 10 uM) and 2 µl of Polymerase (Advantage 2 polymerase, 50X) were added so that the final volume was 100 µl and then 1 minute at 95 ° C. After 10 minutes at 72 ° C, the reaction was repeated three times for 1 minute at 95 ° C and 10 minutes at 68 ° C to synthesize double-stranded cDNA, and recover the synthesized cDNA by phenol-chloroform extraction and ethanol precipitation. It was.

cDNA 라이브러리 제조를 쉽게 하기 위하여 회수한 cDNA를 79 ㎕의 DEPC 처리한 물에 녹이고, 10 ㎕의 10X Sfi I 반응 완충용액, 1 ㎕의 BSA 용액(10 ㎍/㎕) 및 10 ㎕의 Sfi I(10 U/㎕, Promega, USA)를 가한 뒤 50℃에서 2시간 동안 반응시켜 합성된 cDNA의 5' 말단 및 3' 말단에 Sfi I 제한 효소 자리가 생성되도록 하였다. Sfi I 으로 처리한 cDNA 용액을 크로마스핀-400 컬럼(BD Bioscience, USA)에 전개하여 컬럼으로부터 빠져나오는 용액을 1 방울씩 받아 cDNA의 크기별로 회수하여 0.5 kb 이상 되는 크기의 cDNA 만을 모았다. 상기 cDNA는 에탄올 침전에 의해 회수한 후 침전물을 7 ㎕의 멸균 수에 녹였다. 위의 cDNA 용액 1 ㎕, Sfi I 제한 효소로 처리한 람다 트리플렉스2 벡터(500 ng/㎕) 1 ㎕, 10X 라이게이션 완충 용액 0.5 ㎕, 증류수 2 ㎕ 및 라이게이즈 효소 0.5 ㎕를 가하여 총 부피가 5 ㎕가 되게 하여 16℃에서 16시간 동안 반응시켜 상기 회수된 cDNA가 람다 트리플렉스2 벡터의 Sfi I 제한효소 인식부위에 삽입되도록 하였다.To facilitate cDNA library preparation, the recovered cDNA was dissolved in 79 μl of DEPC treated water, 10 μl of 10 × Sfi I reaction buffer, 1 μl of BSA solution (10 μg / μl) and 10 μl of Sfi I (10 U / μl, Promega, USA) was added and reacted at 50 ° C. for 2 hours to generate Sfi I restriction enzyme sites at the 5 ′ and 3 ′ ends of the synthesized cDNA. The cDNA solution treated with Sfi I was developed on a chromapin- 400 column (BD Bioscience, USA), and received one drop of the solution from the column, and collected by the size of the cDNA to collect only cDNA having a size of 0.5 kb or more. The cDNA was recovered by ethanol precipitation and then the precipitate was dissolved in 7 μl of sterile water. Add 1 μl of cDNA solution above, 1 μl of Lambda Triplex2 vector (500 ng / μl) treated with Sfi I restriction enzyme, 0.5 μl of 10 × ligation buffer solution, 2 μl of distilled water and 0.5 μl of ligation enzyme. The reaction was carried out at 16 ° C. for 16 hours, so that the recovered cDNA was inserted into the Sfi I restriction enzyme recognition site of the lambda triplex2 vector.

다음으로, 제조사의 지침에 따라 시험관내 패키징(In vitro packaging, GigaPackII, Stratagene, USA) 반응을 시킨 다음, 이를 대장균 XL1-Blue MRF'균주에 감염시켰다. 상기 감염된 대장균을 탑 아가로즈와 섞어 IPTG와 X-Gal이 잘 도포된 한천배지 위에 플레이팅하여 37℃에서 배양하여 플라크를 형성하도록 하였다. 형성된 전체 플라크 수 및 흰 플라크의 수를 측정하여 재조합 플라크(white color)의 생성 효율을 확인하여 플라크 형성능(titer)을 결정하였다. 안정하고 높은 타이터를 갖는 라이브러리를 만들기 위해 재조합 파지를 한천 플레이트(150 mm) 당 50,000 플라크 정도가 형성 되도록 숙주 세포에 감염하여 증폭한 후 SM 용액(5.8 g NaCl, 2 g MgSO4, 1M Tris-HCl 50 ㎖, pH 7.5 및 2% 젤라틴 2 ㎖/리터)을 사용하여 재조합 파지들을 추출하여 타이터를 결정하고, DMSO를 첨가하여 -80℃에 보관하였다. 또한, 이 초기 cDNA 라이브러리를 다시 숙주세포에 감염시켜 약 1011 pfu로 플라크를 증폭시켰다.
Next, in vitro packaging ( In vitro packaging, GigaPackII, Stratagene, USA) reaction was carried out according to the manufacturer's instructions, and then infected with E. coli XL1-Blue MRF 'strain. The infected E. coli was mixed with top agarose and plated on agar plate coated with IPTG and X-Gal to incubate at 37 ° C. to form a plaque. Plaque formation ability (titer) was determined by measuring the total number of plaques formed and the number of white plaques to determine the production efficiency of the recombinant plaque (white color). To generate a stable, high titer library, recombinant phages were infected and amplified to host cells to form about 50,000 plaques per agar plate (150 mm), followed by SM solution (5.8 g NaCl, 2 g MgSO 4 , 1 M Tris-). Recombinant phages were extracted using 50 mL of HCl, pH 7.5 and 2 mL / liter of 2% gelatin to determine titer, and DMSO was added and stored at -80 ° C. In addition, the initial cDNA library was again infected with host cells to amplify the plaque at about 10 11 pfu.

<실시예 3> 소 간의 IGF-I 유전자 염기서열 분석 및 이로부터 번역되는 아미노산 서열 분석Example 3 IGF-I Gene Sequencing of Bovine Liver and Amino Acid Sequence Analyzed from It

본 발명은 소 간의 IGF-I을 발현하는 유전자를 상기의 실시예 2에서 제조한 소 간 cDNA 라이브러리에서 중합연쇄반응 방법으로 증폭한 후에 클로닝하고 증폭된 IGF-I 유전자는 대장균의 플라스미드인 pGEM T easy 플라스미드 (Promega, USA) 에 삽입하였다. 상기 실시예 2에서 제조한 소간 cDNA 라이브러리를 주형으로 하고 서열번호 7로 기재되는 IGF-F3 프라이머(5' GGGGAATTCCTCTAAATCCCTCTTCTGTTTGC 3', 10 uM) 및 서열번호 8로 기재되는 IGF-R6 프라이머(5’ CCCAAGCTTCTACATTCTGTAGTTCTTGTT 3’, 10 uM) 쌍으로 하여 중합효소 연쇄반응을 시켰다. 이때, 중합효소 연쇄반응은 상기 기재된 프라이머를 각각 1 pmole 농도로 첨가하였으며, 10X 반응 완충용액, 0.5 mM dNTP, Taq DNA 중합효소 1-2 unit를 넣고 95℃에서 5분간 전처리 하고, 이후에 95℃ 1분, 65℃ 1분, 72℃ 2분의 연속 반응을 30회 반복하여 DNA를 증폭한 후에, 72℃에 서 10분간 처리하여 반응을 마무리 지었다. 중합 연쇄반응 방법 후 1% 아가로즈 젤(TAE 완충용액) 전기영동으로 DNA 절편의 생산을 확인하고(도 1), 상기 증폭된 약 0.87 Kb 크기의 DNA 절편을 겔로부터 분리하여, 이를 pGEM-T easy 플라스미드에 서브클로닝하고 그의 염기서열을 결정한 뒤 그로부터 번역되는 아미노산 서열을 알아보았다.   The present invention is cloned after amplifying a gene expressing bovine hepatic IGF-I by the polymerase chain reaction method in the bovine hepatic cDNA library prepared in Example 2 above, the amplified IGF-I gene is a plasmid of E. coli pGEM T easy Inserted into plasmid (Promega, USA). An IGF-F3 primer (5 'GGGGAATTCCTCTAAATCCCTCTTCTGTTTGC 3', 10 uM) described in SEQ ID NO: 7 and a small liver cDNA library prepared in Example 2, and an IGF-R6 primer (5 'CCCAAGCTTCTACATTCTGTAGTTCTTGTT 3) ', 10 uM) pairs were subjected to a polymerase chain reaction. At this time, the polymerase chain reaction was added the primers described above at 1 pmole concentration, respectively, 10X reaction buffer, 0.5 mM dNTP, Taq DNA polymerase 1-2 unit was added and pretreated for 5 minutes at 95 ℃, then 95 ℃ The reaction was repeated 30 times for 1 minute, 65 ° C, 1 minute, and 72 ° C for 2 minutes to amplify DNA, and then the reaction was completed at 72 ° C for 10 minutes. After the polymerase chain reaction method, 1% agarose gel (TAE buffer) electrophoresis confirmed the production of DNA fragments (FIG. 1), and the amplified DNA fragments of about 0.87 Kb were separated from the gels, which were then pGEM-T. After subcloning into an easy plasmid and determining its nucleotide sequence, the amino acid sequence translated therefrom was examined.

1) IGF-I cDNA 염기서열1) IGF-I cDNA Sequence

클로닝된 소 간 유래 IGF-I의 cDNA는 서열번호 1로 기재되는 염기서열을 가짐을 알 수 있었으며, 총 867 개의 염기로 이루어져 있고 서열번호 1에서 표시된 것처럼 개시코돈인 ATG와 종결코돈인 TGA를 갖는다. 이들은 완전히 발현될 수 있는 개방해독틀(open reading frame)의 크기는 종료서열(TGA)를 포함하여 서열번호 2로 기재되는 567 개의 염기로 이루어진다.
The cloned bovine liver-derived IGF-I cDNA had a nucleotide sequence as set out in SEQ ID NO: 1, consisting of a total of 867 bases and having an initiation codon, ATG, and a terminating codon, TGA, as shown in SEQ ID NO: 1. . They consist of 567 bases set forth in SEQ ID NO: 2, including the end sequence (TGA), in which the open reading frame can be fully expressed.

2) IGF-I cDNA의 번역2) Translation of IGF-I cDNA

상기의 소 간 유래의 IGF-I의 cDNA를 번역한 결과, 서열번호 3에서 보는 것처럼 IGF-I은 메티오닌(Met)으로 시작해서 아스파라긴(Asn)으로 끝나는 188개의 아미노산으로 구성되어 있는 것을 알 수 있었다. 또한, 본 발명의 IGF-I의 계산된 이론적인 등전점(pI) 는 9.8 로서 염기성 단백질임을 알 수 있었다.
As a result of translating the cDNA of IGF-I derived from bovine liver, as shown in SEQ ID NO: 3, it was found that IGF-I is composed of 188 amino acids starting with methionine (Met) and ending with asparagine (Asn). . In addition, the calculated theoretical isoelectric point (pI) of IGF-I of the present invention was found to be a basic protein as 9.8.

3) IGF-I 유전자의 다른 종과의 상동성 비교3) Comparison of homology with other species of IGF-I gene

IGF-I의 아미노산 서열을 비교 분석한 결과, 여러 종의 IGF-I과 아미노산 서열의 유사성을 보였다. 구체적으로, 오랑우탄(Pongo abelii) IGF-IB 94%, 침팬지(Pan troglodytes) IGF-I 90%, 사람(Homo sapiens) IGF-IB 90%, 개(Canis familiaris) IGF-I 90%, 멧돼지(Sus scrofa) IGF-I 87%, 집쥐(Rattus norvegicus) IGF-I 83% 및 생쥐(Mus musculus) IGF-I 81% 정도의 아미노산 서열 유사성을 나타냄을 확인하였다. 또한 기존에 밝혀진 소(Bos taurus)의 IGF-I 전구체는 153-154 개의 아미노산 잔기를 갖는 것으로 알려져 있으며 약 87% 의 서열 상동성을 나타냄을 확인하였다. 이에, 본 발명의 소 간 유래의 IGF-I은 기존의 소에서 보고된 IGF-I 단백질과 서열 상동성이 달라 신규한 IGF-I 임을 알 수 있었다.
A comparative analysis of the amino acid sequences of IGF-I showed similarities between the various amino acid sequences of IGF-I. Specifically, orangutans ( Pongo abelii ) IGF-IB 94%, Chimpanzee ( Pan troglodytes ) IGF-I 90%, human ( Homo sapiens ) IGF-IB 90%, dog ( Canis familiaris ) IGF-I 90%, Boar (Sus scrofa) IGF-I 87%, Rattus norvegicus ) IGF-I 83% and mice ( Mus musculus ) IGF-I showed an amino acid sequence similarity of about 81%. Also known as Bos taurus ) is known to have 153-154 amino acid residues and shows about 87% sequence homology. Thus, it was found that IGF-I derived from bovine liver of the present invention is novel IGF-I due to different sequence homology with IGF-I protein reported in existing cattle.

<< 실시예Example 4>  4> IGFIGF -I의 Of -I 대장균에서In E. coli 발현용 플라스미드 구축  Expression Plasmid Construction

본 발명에서 분석된 IGF-I 유전자가 클로닝 되어있는 플라스미드로부터 서열 번호 3으로 기재되는 IGF-I을 대량 생산하기 위하여 중합효소 연쇄 반응을 수행함으로써 IGF-I을 코딩하는 유전자를 증폭하였다. 이 때, 각 프라이머는 강력한 T7 프로모터를 갖는 pT7-7 플라스미드에 삽입이 잘 되도록 5'-말단에 Nde I, 3'-말단에 Hind III 제한 효소 자리를 갖게끔 서열번호 9로 기재되는 IGF-T7F 프라이머(5' GGGGCATATGATGGGAAAAATCAGCAGTCTTCCAAC 3', 10 uM) 및 서열번호 10으로 기재되는 IGF-T7R 프라이머(5' CCCCAAGCTTTCAGTTTCTAGCTCCAGTCTCTCTC 3', 10 uM)를 합성하였다. 상기의 IGF-T7F 프라이머의 밑줄친 부분은 Nde I 제한효소 인식부위 서열이고, IGF-T7R 프라이머의 밑줄친 부분은 Hind III 제한효소 인식부위 서열이다. 상기 IGF-T7F 및 IGF-T7R로 기재되는 프라이머 쌍을 사용하여 중합효소 연쇄 반응을 수행해 증폭된 DNA 단편을 아가로즈 겔 전기영동한 후 DNA 용출 키트를 사용하여 유전자를 순수하게 분리하였다. 상기 분리된 IGF 유전자 및 발현용 플라스미드 pT7-7(Tabor S and Richardson C, A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc Natl Acad Sci USA, 262:10741078(1985))를 Nde I 및 Hind III 로 각각 처리하고 아가로즈 겔 전기영동한 후 DNA 용출 키트를 사용하여 각각을 순수하게 분리하였다. 분리한 플라스미드와 IGF 유전자를 삼부르크 등의 방법에 따라 DNA 단편을 라이게이션하고 형질 전환하였다. 형질전환용 세포 E. coli BL21(DE3)(Invitrogen, USA) 100 ㎕에 라이게이션 반응된 DNA 0.1 내지 0.5 ㎍을 첨가하여 얼음에 30분간 방치한 후 42℃에서 1.5분간 열 충격을 주고, 1 ㎖의 LB 배지를 첨가하여 37℃에서 1시간 동안 배양한 후, 앰피실린(50 ㎍/㎖), IPTG 및 X-gal이 첨가된 LB 아가 평판 배지에 도말하고 37℃에서 16시간 동안 배양하여 형질 전환된 대장균을 얻었다. 형질 전환된 대장균은 항생제가 첨가된 엘비 액체배지에 접종하여 배양하고, 그 배양액의 일부를 취하여 알칼라인 용해 방법에 따라 플라스미드를 추출하여 클로닝된 부위의 제한효소로 절단하여 IGF-I DNA 단편이 도입되었는지를 확인하였다. 이렇게 하여 IGF 유전자가 도입된 발현용 벡터를 “pT7-IGF”로 명명하였다(도 3).
The gene encoding IGF-I was amplified by performing a polymerase chain reaction in order to mass-produce IGF-I described in SEQ ID NO: 3 from the plasmid cloned with the IGF-I gene analyzed in the present invention. At this time, each primer is Nde at the 5'-end so that it can be inserted into the pT7-7 plasmid with the strong T7 promoter. I, at the 3'-end Hind IGF-T7F primer (5 'GGGG CATATG ATGGGAAAAATCAGCAGTCTTCCAAC 3', 10 uM) as described in SEQ ID NO: 9 to have a III restriction enzyme site and IGF-T7R primer (5 'CCCC AAGCTT TCAGTTTCTAGCTCCAGTCTCTCTC 3', 10 ') uM) was synthesized. The underlined portion of the IGF-T7F primer is Nde I restriction enzyme recognition sequence and the underlined portion of IGF-T7R primer is Hind III restriction enzyme recognition site sequence. The amplified DNA fragments were subjected to polymerase chain reaction using primer pairs described as IGF-T7F and IGF-T7R, followed by agarose gel electrophoresis, and the genes were purely separated using a DNA elution kit. The isolated IGF gene and expression plasmid pT7-7 (Tabor S and Richardson C, A bacteriophage T7 RNA polymerase / promoter system for controlled exclusive expression of specific genes. Proc Natl Acad Sci USA, 262: the 10741078 (1985)) Nde I and Hind Each was treated with III and subjected to agarose gel electrophoresis, followed by pure separation using a DNA elution kit. The isolated plasmid and IGF gene were ligated and transformed by DNA fragments according to the method of Samburg et al. To transform the cells for transformation E. coli BL21 (DE3) (Invitrogen, USA) added 0.1 to 0.5 ug of ligation reaction DNA and left on ice for 30 minutes, heat shock at 42 ℃ for 1.5 minutes, 1 ml After incubation for 1 hour at 37 ° C with LB medium, the cells were plated in LB agar plate medium containing ampicillin (50 µg / ml), IPTG and X-gal and incubated at 37 ° C for 16 hours for transformation. Escherichia coli was obtained. The transformed Escherichia coli was inoculated in an Elbi liquid medium to which antibiotics were added, cultured, and a portion of the culture was taken to extract a plasmid according to the alkaline lysis method, and cut with a restriction enzyme at a cloned site to determine whether an IGF-I DNA fragment was introduced. It was confirmed. In this way, the expression vector into which the IGF gene was introduced was named “pT7-IGF” (FIG. 3).

<< 실시예Example 5>  5> 대장균에서In E. coli 재조합  Recombination IGFIGF -I 단백질 유도 및 -I protein induction and SDSSDS -- PAGEPAGE 분석 analysis

상기 실시예 4에서 재조합 플라스미드 pT7-IGF로 형질 전환된 E. coli BL21(DE3)를 암피실린(50 ㎍/㎖)을 포함하는 LB 배지에 접종하여 37℃에서 밤새 배양하여 종균으로 사용하였다. 암피실린을 포함하는 100 ㎖의 LB 배지(500 ㎖ 삼각 플라스크)에 상기 종균 1 ㎖을 취하여 접종한 후, 600 nm에서 흡광도가 0.6 내지 0.8에 도달할 때까지 키웠다. 단백질의 합성을 유도하기 위하여 IPTG를 1 mM이 되도록 첨가한 다음, 매 시간별로 배양액 1 ㎖을 취하여 단백질 분석을 위한 시료 제조를 위하여 사용하였다. 배양액으로부터 얻어진 균체를 SDS-PAGE 시료 처리 용액(0.05 M Tris-HCl, pH 6.8, 0.1 M DTT, 2% SDS, 10% 글리세롤 및 0.1% 브로모페놀 블루) 20 ㎕에 현탁하여 100℃에서 5분간 가열하여 세포를 파괴한 후 단백질 분석을 위하여 사용하였다. 단백질 전기영동은 램리 등의 방법(Laemmli 1970, Nature 227, 680-685)으로 수행하였다. 일정한 전기장에서 분리가 끝난 젤은 쿠마시 브릴리언트 블루 용액(Coomassie brilliant blue)에 넣어 1시간 정도 염색한 후 탈색용액(30% 메탄올, 10% 아세트산)에 옮겨 탈색하여 생산된 단백질을 확인하였다. 그 결과, ITPG 유도에 의해 시간이 지남에 따라 본 발명의 IGF-I의 발현이 유도됨을 확인하였으며(도 4A), IGF-I 항체를 이용하여 항체 면역 블라팅(Western blotting)한 결과 동일한 위치에서 밴드를 나타내어 본 발명의 IGF-I의 발현을 확인하였다(도 4B).
 E. coli BL21 (DE3) transformed with the recombinant plasmid pT7-IGF in Example 4 was inoculated in LB medium containing ampicillin (50 μg / ml) and cultured overnight at 37 ° C. to be used as a seed. 1 ml of the seed was inoculated into 100 ml of LB medium (500 ml Erlenmeyer flask) containing ampicillin and grown at 600 nm until the absorbance reached 0.6 to 0.8. In order to induce the synthesis of protein, IPTG was added to 1 mM, and then 1 ml of the culture medium was taken every hour and used for preparing a sample for protein analysis. The cells obtained from the culture were suspended in 20 µl of SDS-PAGE sample treatment solution (0.05 M Tris-HCl, pH 6.8, 0.1 M DTT, 2% SDS, 10% glycerol and 0.1% bromophenol blue) for 5 minutes at 100 ° C. The cells were destroyed by heating and used for protein analysis. Protein electrophoresis was performed by Lamley et al. (Laemmli 1970, Nature 227, 680-685). After the gel was separated in a constant electric field, the gel was placed in Coomassie brilliant blue and dyed for about 1 hour, and then transferred to a decolorizing solution (30% methanol, 10% acetic acid) to identify the produced protein. As a result, it was confirmed that the expression of IGF-I of the present invention is induced over time by the induction of ITPG (FIG. 4A), and the antibody immunoblotting using IGF-I antibody was performed at the same position. A band was shown to confirm the expression of IGF-I of the present invention (FIG. 4B).

<< 실시예Example 6>  6> IGFIGF -I의 Of -I 바실러스Bacillus 발현용 플라스미드 구축  Expression Plasmid Construction

본 발명에서 분석된 소 간 유래 IGF-I을 코딩하는 서열번호 2의 DNA 서열이 클로닝 되어있는 pT7-IGF 플라스미드와 AprE 프로모터 및 세포 밖으로 단백질을 분비하기 위한 신호 서열(Signal sequence)을 갖는 바실러스 형질전환용 pHPS-SP(Cai Heng et al., Expression and secretion of an acid-stable a-amylase gene in Bacillus subtilis by SacB promoter and signal peptide, Biotechnology Letters 27:17311736(2005))을 Nde I 과 Eco RI 으로 처리하고 전기 영동한 후 DNA 용출 키트로 각각 분리하였다. 분리한 각 IGF-I DNA 단편 및 pHPS-SP DNA 단편을 접합시킨 후, E. coli JM109(Promega, USA)에 실시예 4와 같이 형질전환시켰다. 형질전환체로부터 플라스미드를 추출하여 클로닝된 부위의 제한효소로 절단하여 서열번호 2 의 DNA 단편이 도입되었는지를 확인한 후, 상기 형질전환 벡터를 “pHPS-IGF”로 명명하였다(도 5). 형질전환된 대장균으로부터 pHPS-IGF 플리스미드를 분리하고 말로니 등(Mallonee 등, 1989, Appl. Environ. Microbiol. 55, 2517-2521)의 방법으로 상기 pHPS-IGF 플리스미드 DNA로 바실러스 균주를 형질전환 하였다. 구체적으로, B. subtilis를 티에스비(TSB, trypsic soy browth) 배지에 접종하고 37℃에서 하루 동안 배양하였다. 상기 배양액을 12.5 ㎖의 PGY 배지(1.5% 펩톤/0.5% 포도당/0.5% 이스트 추출물)에 1% 되게 접종한 후 600 nm에서 흡광도가 약 0.5에 도달할 때까지 배양하고 12.5 ㎖의 PGY/0.5 M 수크로스 배지와 최종 농도가 10 U/㎖ 되게 페니실린을 가하고 2시간 동안 더 배양하였다. 원심분리하여 세포를 회수하고, 회수한 세포를 2.5 ㎖의 SMMT 용액(0.5M 수크로스/20mM 말레이트/20mM MgCl2/TSB)에 현탁시키고, 최종 농도가 10 ㎎/㎖되게 리소자임을 가하고 35℃에서 1 시간 반응하였다. 원심분리하여 세포를 회수하고, 회수한 세포를 2 ㎖의 SMMT 용액에 현탁시킨 후 0.1 ㎖씩 분주하여 형질 전환용 세포로 사용하였다. 상기의 방법으로 제조한 B. subtilis 형질전환용 세포용액 0.1 ㎖에 0.1 ㎖의 pHPS-IGF 플라스미드 DNA(약 1 ㎍), 1.5 ㎖의 40% PEG8000 용액을 가한 후 잘 혼합하여 주고 0℃에서 2.5 분간 방치 후 37℃에서 약 5분 동안 더 배양하였다. 상기 배양액에 5 ㎖의 SMMP(0.5 M 수크로스/20mM 말레이트/20 mM MgCl2/1.5% 펩톤/0.5% 포도당/0.5% 이스트 추출물) 용액을 가한 후 간단하게 혼합한 후 원심분리하여 세포를 회수하였다. 상기의 회수한 세포에 1 ㎖의 SMMP 용액을 가한 후 30℃에서 약 30분 동안 배양하고 클로로암페니콜을 포함하는 TSB 아가 플레이트에 도말한 후 37℃에서 2-5 일간 배양하여 형질 전환체들을 얻었다. 형질 전환된 바실러스는 클로로암페니콜이 첨가된 TSB 액체배지에 접종하여 배양하고, 그 배양액의 일부를 취하여 알칼라인 용해 방법에 따라 플라스미드를 추출하여 클로닝된 부위의 제한효소로 절단하여 IGF DNA 단편이 도입되었는지를 확인하였다.
Bacillus transformation having a pT7-IGF plasmid in which the DNA sequence of SEQ ID NO: 2 encoding bovine liver-derived IGF-I cloned, a signal sequence for secreting proteins from the AprE promoter and a cell outside the cell PHPS-SP (Cai Heng et al., Expression and secretion of an acid-stable a -amylase gene in Bacillus subtilis by SacB promoter and signal peptide, Biotechnology Letters 27: 17311736 (2005)) was added to Nde I and Eco. After treatment with RI and electrophoresis, each was separated by DNA elution kit. After conjugation of each isolated IGF-I DNA fragment and pHPS-SP DNA fragment, E. coli JM109 (Promega, USA) was transformed as in Example 4. After extracting the plasmid from the transformant and cutting it with the restriction enzyme of the cloned site to confirm that the DNA fragment of SEQ ID NO: 2 was introduced, the transformation vector was named “pHPS-IGF” (FIG. 5). Isolate pHPS-IGF plasmid from transformed Escherichia coli and transform the Bacillus strain with the pHPS-IGF plasmid DNA by Maloney et al. (Mallonee et al., 1989, Appl. Environ. Microbiol. 55, 2517-2521). It was. Specifically, B. subtilis was inoculated in TSB (trypsic soy browth) medium and incubated at 37 ° C. for one day. The culture was inoculated 1% in 12.5 ml PGY medium (1.5% peptone / 0.5% glucose / 0.5% yeast extract), and then cultured at 600 nm until the absorbance reached about 0.5 and 12.5 ml of PGY / 0.5 M Sucrose medium and penicillin were added to a final concentration of 10 U / ml and further incubated for 2 hours. The cells were recovered by centrifugation, and the cells were suspended in 2.5 ml of SMMT solution (0.5M sucrose / 20mM maleate / 20mM MgCl 2 / TSB), and lysozyme was added at a final concentration of 10 mg / ml, followed by 35 ° C. Reaction was carried out for 1 hour. The cells were recovered by centrifugation, and the recovered cells were suspended in 2 ml of SMMT solution and then aliquoted in 0.1 ml to be used as cells for transformation. B. subtilis prepared by the above method 0.1 ml of pHPS-IGF plasmid DNA (about 1 µg) and 1.5 ml of 40% PEG8000 solution were added to 0.1 ml of the cell solution for transformation, followed by mixing well and standing at 0 ° C. for 2.5 minutes and then at 37 ° C. for about 5 minutes. It was further cultured. 5 ml of SMMP (0.5 M sucrose / 20 mM maleate / 20 mM MgCl 2 /1.5% peptone / 0.5% glucose / 0.5% yeast extract) solution was added to the culture, followed by simple mixing and centrifugation to recover the cells. It was. After adding 1 ml of SMMP solution to the recovered cells, the cells were incubated at 30 ° C. for about 30 minutes, plated on a TSB agar plate containing chloroamphenicol, and then cultured at 37 ° C. for 2-5 days to transformants. Got it. The transformed Bacillus was inoculated and cultured in TSB liquid medium to which chloroamphenicol was added, and a portion of the culture solution was taken, the plasmid was extracted according to the alkaline lysis method, and digested with restriction enzymes at the cloned site to introduce IGF DNA fragments. It was confirmed.

<< 실시예Example 7>  7> 바실러스에서In Bacillus 재조합  Recombination IGFIGF -I 단백질 유도 및 -I protein induction and SDSSDS -- PAGEPAGE 분석 analysis

상기 실시예 6에서 재조합 플라스미드 pHPS-IGF로 형질 전환된 B. subtilis를 클로로암페니콜을 포함하는 TSB 액체배지에 접종하여 37℃에서 밤새 배양하여 종균으로 사용하였다. 클로로암페니콜을 포함하는 100 ㎖의 TSB 배지(500 ㎖ 삼각 플라스크)에 상기 종균 1 ㎖을 취하여 접종한 후, 매 시간별로 배양액 1 ㎖을 취하여 원심분리(10,000 X g, 10 min) 하여 세포 배양액을 회수하였다. 상기 배양액 0.1 ml에 2배 부피의 에탄올을 첨가하여 잘 혼합한 후 -20℃에서 약 1 시간 동안 방치 후 원심분리(13,000 X g, 15 분) 하여 침전물을 회수하고 상온에서 30 분간 방치하여 잔존하는 에탄올을 제거하고 단백질 분석을 위한 시료 제조를 위하여 사용하였다. 상기 침전물을 SDS-PAGE 시료 처리 용액 20 ㎕에 현탁하여 100℃에서 5분간 가열하고 실시예 5의 방법으로 전기영동하여 본 발명의 IGF-I의 발현을 확인하였으며(도 6A), IGF-I 항체를 이용하여 항체 면역 블라팅(Western blotting) 한 결과 동일한 위치에서 밴드를 나타내어 본 발명의 IGF-I의 발현을 확인하였다(도 6B).
 B. subtilis transformed with recombinant plasmid pHPS-IGF in Example 6 was inoculated in TSB liquid medium containing chloroamphenicol and incubated overnight at 37 ° C. to be used as a seed. 1 ml of the seed was inoculated into 100 ml TSB medium (500 ml Erlenmeyer flask) containing chloroamphenicol, and then 1 ml of the culture medium was taken every hour and centrifuged (10,000 X g, 10 min). Was recovered. 2 ml volume of ethanol was added to 0.1 ml of the culture solution, mixed well, and left at −20 ° C. for about 1 hour, followed by centrifugation (13,000 X g, 15 minutes) to recover the precipitate, which was left at room temperature for 30 minutes. Ethanol was removed and used for sample preparation for protein analysis. The precipitate was suspended in 20 μl of SDS-PAGE sample treatment solution, heated at 100 ° C. for 5 minutes and electrophoresed by the method of Example 5 to confirm the expression of IGF-I of the present invention (FIG. 6A), and IGF-I antibody. Using antibody immunoblotting (Western blotting) showed a band at the same position to confirm the expression of IGF-I of the present invention (Fig. 6B).

<< 실시예Example 8>  8> 바실러스에서In Bacillus 생산한 재조합  Produced recombination IGFIGF -I 단백질의 쥐 성장 효능 Growth Efficacy of -I Protein

상기 실시예 7에서 생산한 재조합 IGF-1을 이용하여 쥐의 골 성장에 미치는 효능을 측정하였다.Efficacy on bone growth of rats was measured using recombinant IGF-1 produced in Example 7.

본 발명의 형질전환 대장균 또는 바실러스에서 생산한 재조합 IGF-1은 원핵세포에서 생산된 것임에도 불구하고 inclusion body 형태가 아닌 분비형태(secretion type)로 직접 수득되는 것을 특징으로 한다. 따라서, 상기 실시예 7에서 생산한 재조합 IGF-1을 곧바로 증류수에 희석하여 1 ug/kg의 양으로 4주령의 쥐에 20일 연속으로 경구투여 하였다. 대조군에는 증류수를 투여하였고 실험군당 10마리의 쥐를 사용하였다. 최종 투여 후 쥐를 희생하여 경골의 성장판 부위를 적출하였다. 분리된 조직을 10% 포르말린 용액에서 24시간 동안 고정한 다음 시료를 탈회하고 파라핀에 고정하였다. 마이크로톰을 사용하여 수직으로 1um의 두께로 절단하여 각각의 절편을 얻었다. 슬라이드 글라스에 고정하고 H&E 염색을 실시하고 마이크로 현미경을 사용해 성장판 부위의 사진을 촬영하였다. 길이 측정 프로그램을 사용해 성장판 길이를 측정하였다. 재조합 IGF-1을 투여한 쥐에서 경골의 성장판 길이 및 골길이 성장을 촉진하는 효능을 측정한 결과를 표1에 나타내었다.
Recombinant IGF-1 produced in the transformed E. coli or Bacillus of the present invention is characterized in that it is obtained directly in secretion type (secretion type), not in the form of inclusion body despite being produced in prokaryotic cells. Therefore, the recombinant IGF-1 produced in Example 7 was immediately diluted in distilled water and orally administered to 4 week old mice in an amount of 1 ug / kg for 20 consecutive days. Distilled water was administered to the control group and 10 rats were used per experimental group. After the final administration, the rats were sacrificed and the growth plate area of the tibia was removed. The detached tissue was fixed in 10% formalin solution for 24 hours, then the sample was demineralized and fixed in paraffin. Each section was obtained by vertically cutting to a thickness of 1 um using a microtome. Fixed to slide glass, subjected to H & E staining and photographed the growth plate area using a micro microscope. The growth plate length was measured using a length measuring program. Table 1 shows the results of measuring the growth plate length and bone length growth efficacy of the tibia in rats to which the recombinant IGF-1 was administered.

Figure pat00001
Figure pat00001

상기 표1 에서 확인할 수 있는 바와 같이, IGF-1 을 투여하지 않은 대조군과 재조합 플라스미드 pHPS-IGF 로 형질 전환된 B. subtilis에서 생산된 재조합 IGF-1을 투여한 시료군에서 성장판 (growth plate) 및 경골 (Tibia) 성장 길이의 차이는 각각 0.06 mm 및 0.59 mm 으로서, 쥐를 이용한 생체 시험에서 IGF-1 의 투여가 골 성장에 효과가 있음을 알 수 있었다.
As can be seen in Table 1, growth plate and growth plate in the control group not administered IGF-1 and the sample group administered recombinant IGF-1 produced from B. subtilis transformed with recombinant plasmid pHPS-IGF. Tibia growth lengths were 0.06 mm and 0.59 mm, respectively, and it was found that the administration of IGF-1 was effective in bone growth in rats.

<< 실시예Example 9>  9> 바실러스에서In Bacillus 생산한 재조합  Produced recombination IGFIGF -I 단백질의 닭 성장 효능 Growth Potency of -I Protein

상기 실시예 7에서 생산한 재조합 IGF-1 을 이용하여 닭의 성장에 미치는 효능을 측정하였다. 사료 1 kg 당 재조합 IGF-1이 1 ug 함유하도록 첨가하여 잘 혼합하여 닭 사료를 제조하였다. 닭은 비교적 체중이 균일한 개체를 각각 10,800 수 및 23,500 를 사용하였으며, 사료와 물은 자유롭게 섭취하도록 하였다. 사육은 30 일 간 하였으며, 처음 1 주간은 IGF-1 을 첨가한 사료를 공급하지 않고 사육하였으며, 사육 8 일부터 30 일까지 IGF-1 을 첨가한 사료를 공급하였다. 사육 기간이 끝난 후 사료의 급여량 및 체중을 측정하여, 사료 효율 및 증체량 등을 계산하였다. 재조합 IGF-1을 투여한 닭 성장에 미치는 효능을 측정한 결과를 표2에 나타내었다.
Efficacy on growth of chickens was measured using recombinant IGF-1 produced in Example 7. Chicken feed was prepared by adding well containing 1 ug of recombinant IGF-1 per kg of feed. The chickens used 10,800 and 23,500 individuals of relatively uniform weight, respectively, and feed and water were freely consumed. Breeding was carried out for 30 days, and the first one week was fed without feeding with IGF-1, and feeding with IGF-1 was added from 8 to 30 days of breeding. After the breeding period, the feed amount and body weight of the feed were measured to calculate the feed efficiency and weight gain. Table 2 shows the results of measuring the effect on chicken growth administered with recombinant IGF-1.

Figure pat00002
Figure pat00002

상기 표2 에서 확인할 수 있는 바와 같이, IGF-1 을 투여하지 않은 대조군과 재조합 IGF-1을 투여군에서 사료 효율은 대조군 및 IGF-1 투여군에서 각각 1.77 및 1.56 이었다. 일당 평균증체량의 차이는 10.18 g/일 이었으며, 평균 체중의 차이는 140 g (30 일 사육) 으로 닭를 이용한 생체 시험에서 IGF-1 의 투여가 성장 촉진 및 사료 효율 개선에 효과가 있음을 알 수 있었다.
As can be seen in Table 2, the feed efficiency was 1.77 and 1.56 in the control group and the IGF-1 group, respectively, and the control group without the IGF-1 and the recombinant IGF-1 group. The average daily weight difference was 10.18 g / day, and the average body weight difference was 140 g (30 days rearing), and it was found that the administration of IGF-1 was effective in promoting growth and improving feed efficiency in chickens. .

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> C&J BIOTECH <120> Novel Insulin Growth Factor-I from Bos taurus and Gene Encoding the Same <130> PN100642 <160> 10 <170> KopatentIn 2.0 <210> 1 <211> 188 <212> PRT <213> Bos taurus, IGF-1 <400> 1 Met Gly Lys Ile Ser Ser Leu Pro Thr Gln Leu Phe Lys Cys Cys Phe 1 5 10 15 Cys Asp Phe Leu Lys Gln Val Lys Met Pro Ile Thr Ser Ser Ser His 20 25 30 Leu Phe Tyr Leu Ala Leu Cys Leu Leu Ala Phe Thr Ser Ser Ala Thr 35 40 45 Ala Gly Pro Glu Thr Leu Cys Gly Ala Glu Leu Val Asp Ala Leu Gln 50 55 60 Phe Val Cys Gly Asp Arg Gly Phe Tyr Phe Asn Lys Pro Thr Gly Tyr 65 70 75 80 Gly Ser Ser Ser Arg Arg Ala Pro Gln Thr Gly Ile Val Asp Glu Cys 85 90 95 Cys Phe Arg Ser Cys Asp Leu Arg Arg Leu Glu Met Tyr Cys Ala Pro 100 105 110 Leu Lys Pro Ala Lys Ser Ala Arg Ser Val Arg Ala Gln Arg His Thr 115 120 125 Asp Met Pro Lys Ala Gln Lys Tyr Gln Pro Pro Ser Thr Asn Lys Lys 130 135 140 Met Lys Ser Gln Lys Arg Arg Lys Gly Gly Pro Lys Lys Arg Pro Gly 145 150 155 160 Gly Glu Gln Lys Glu Gly Thr Glu Ala Ser Gln Gln Met Gln Gly Lys 165 170 175 Met Lys Glu Gln Arg Arg Glu Thr Gly Ala Arg Asn 180 185 <210> 2 <211> 567 <212> DNA <213> Bos taurus, IGF-1, cDNA <400> 2 atgggaaaaa tcagcagtct tccaacccaa ttatttaagt gctgcttttg tgatttcttg 60 aagcaggtga agatgcccat cacatcctcc tcgcatctct tctatctggc cctgtgcttg 120 ctcgccttca ccagctctgc cacggcggga cccgagaccc tctgcggggc tgagttggtg 180 gatgctctcc agttcgtgtg cggagacagg ggcttttatt tcaacaagcc cacggggtat 240 ggctcgagca gtcggagggc gccccagaca ggaatcgtgg atgagtgctg cttccggagc 300 tgtgatctga ggaggctgga gatgtactgc gcgcctctca agcccgccaa gtcggcccgc 360 tcagtccgtg cccagcgcca caccgacatg cccaaggctc agaagtatca gcccccatct 420 accaacaaga aaatgaagtc tcagaagaga aggaaaggtg ggccaaagaa acgcccagga 480 ggggaacaga aggaggggac ggaagcaagt cagcagatgc aagggaagat gaaagagcag 540 aggagagaga ctggagctag aaactga 567 <210> 3 <211> 867 <212> DNA <213> Bos taurus, IGF-1, gDNA <400> 3 ctctaaatcc ctcttctgtt tgctaaatct cactgtcact gctaaattca gagcagatag 60 agcctgcgca atggaataaa gtcctcaaaa ttgaaatgtg acattgctct caacatctcc 120 catctccctg gatttctttt tgcctcatta ttcctgctaa ccaattcatt tccagacttt 180 gcacttcaga agcaatggga aaaatcagca gtcttccaac ccaattattt aagtgctgct 240 tttgtgattt cttgaagcag gtgaagatgc ccatcacatc ctcctcgcat ctcttctatc 300 tggccctgtg cttgctcgcc ttcaccagct ctgccacggc gggacccgag accctctgcg 360 gggctgagtt ggtggatgct ctccagttcg tgtgcggaga caggggcttt tatttcaaca 420 agcccacggg gtatggctcg agcagtcgga gggcgcccca gacaggaatc gtggatgagt 480 gctgcttccg gagctgtgat ctgaggaggc tggagatgta ctgcgcgcct ctcaagcccg 540 ccaagtcggc ccgctcagtc cgtgcccagc gccacaccga catgcccaag gctcagaagt 600 atcagccccc atctaccaac aagaaaatga agtctcagaa gagaaggaaa ggtgggccaa 660 agaaacgccc aggaggggaa cagaaggagg ggacggaagc aagtcagcag atgcaaggga 720 agatgaaaga gcagaggaga gagactggag ctagaaactg aacacaggca agaaaggaac 780 acggaggaaa gaaagactaa gacagaggaa gtacatttga agaacacaag tagagggagt 840 gcaggaaaca agaactacag aatgtag 867 <210> 4 <211> 59 <212> DNA <213> Artificial sequence, CDS3' primer <400> 4 attctagagg ccgaggcggc cgacatgttt tttttttttt tttttttttt tttttttnn 59 <210> 5 <211> 39 <212> DNA <213> Artificial sequence, CDS5' primer <400> 5 aagcagtggt atcaacgcag agtggccatt atggccggg 39 <210> 6 <211> 23 <212> DNA <213> Artificial sequence, 5' PCR primer <400> 6 aagcagtggt atcaacgcag agt 23 <210> 7 <211> 32 <212> DNA <213> Artificial sequence, IGF-F3 primer <400> 7 ggggaattcc tctaaatccc tcttctgttt gc 32 <210> 8 <211> 30 <212> DNA <213> Artificial sequence, IGF-R6 primer <400> 8 cccaagcttc tacattctgt agttcttgtt 30 <210> 9 <211> 36 <212> DNA <213> Artificial sequence, IGF-T7F primer <400> 9 ggggcatatg atgggaaaaa tcagcagtct tccaac 36 <210> 10 <211> 35 <212> DNA <213> Artificial sequence, IGF-T7R primer <400> 10 ccccaagctt tcagtttcta gctccagtct ctctc 35 <110> C & J BIOTECH <120> Novel Insulin Growth Factor-I from Bos taurus and Gene Encoding          the Same <130> PN100642 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 188 <212> PRT <213> Bos taurus, IGF-1 <400> 1 Met Gly Lys Ile Ser Ser Leu Pro Thr Gln Leu Phe Lys Cys Cys Phe   1 5 10 15 Cys Asp Phe Leu Lys Gln Val Lys Met Pro Ile Thr Ser Ser Ser His              20 25 30 Leu Phe Tyr Leu Ala Leu Cys Leu Leu Ala Phe Thr Ser Ser Ala Thr          35 40 45 Ala Gly Pro Glu Thr Leu Cys Gly Ala Glu Leu Val Asp Ala Leu Gln      50 55 60 Phe Val Cys Gly Asp Arg Gly Phe Tyr Phe Asn Lys Pro Thr Gly Tyr  65 70 75 80 Gly Ser Ser Ser Arg Arg Ala Pro Gln Thr Gly Ile Val Asp Glu Cys                  85 90 95 Cys Phe Arg Ser Cys Asp Leu Arg Arg Leu Glu Met Tyr Cys Ala Pro             100 105 110 Leu Lys Pro Ala Lys Ser Ala Arg Ser Val Arg Ala Gln Arg His Thr         115 120 125 Asp Met Pro Lys Ala Gln Lys Tyr Gln Pro Pro Ser Thr Asn Lys Lys     130 135 140 Met Lys Ser Gln Lys Arg Arg Lys Gly Gly Pro Lys Lys Arg Pro Gly 145 150 155 160 Gly Glu Gln Lys Glu Gly Thr Glu Ala Ser Gln Gln Met Gln Gly Lys                 165 170 175 Met Lys Glu Gln Arg Arg Glu Thr Gly Ala Arg Asn             180 185 <210> 2 <211> 567 <212> DNA <213> Bos taurus, IGF-1, cDNA <400> 2 atgggaaaaa tcagcagtct tccaacccaa ttatttaagt gctgcttttg tgatttcttg 60 aagcaggtga agatgcccat cacatcctcc tcgcatctct tctatctggc cctgtgcttg 120 ctcgccttca ccagctctgc cacggcggga cccgagaccc tctgcggggc tgagttggtg 180 gatgctctcc agttcgtgtg cggagacagg ggcttttatt tcaacaagcc cacggggtat 240 ggctcgagca gtcggagggc gccccagaca ggaatcgtgg atgagtgctg cttccggagc 300 tgtgatctga ggaggctgga gatgtactgc gcgcctctca agcccgccaa gtcggcccgc 360 tcagtccgtg cccagcgcca caccgacatg cccaaggctc agaagtatca gcccccatct 420 accaacaaga aaatgaagtc tcagaagaga aggaaaggtg ggccaaagaa acgcccagga 480 ggggaacaga aggaggggac ggaagcaagt cagcagatgc aagggaagat gaaagagcag 540 aggagagaga ctggagctag aaactga 567 <210> 3 <211> 867 <212> DNA <213> Bos taurus, IGF-1, gDNA <400> 3 ctctaaatcc ctcttctgtt tgctaaatct cactgtcact gctaaattca gagcagatag 60 agcctgcgca atggaataaa gtcctcaaaa ttgaaatgtg acattgctct caacatctcc 120 catctccctg gatttctttt tgcctcatta ttcctgctaa ccaattcatt tccagacttt 180 gcacttcaga agcaatggga aaaatcagca gtcttccaac ccaattattt aagtgctgct 240 tttgtgattt cttgaagcag gtgaagatgc ccatcacatc ctcctcgcat ctcttctatc 300 tggccctgtg cttgctcgcc ttcaccagct ctgccacggc gggacccgag accctctgcg 360 gggctgagtt ggtggatgct ctccagttcg tgtgcggaga caggggcttt tatttcaaca 420 agcccacggg gtatggctcg agcagtcgga gggcgcccca gacaggaatc gtggatgagt 480 gctgcttccg gagctgtgat ctgaggaggc tggagatgta ctgcgcgcct ctcaagcccg 540 ccaagtcggc ccgctcagtc cgtgcccagc gccacaccga catgcccaag gctcagaagt 600 atcagccccc atctaccaac aagaaaatga agtctcagaa gagaaggaaa ggtgggccaa 660 agaaacgccc aggaggggaa cagaaggagg ggacggaagc aagtcagcag atgcaaggga 720 agatgaaaga gcagaggaga gagactggag ctagaaactg aacacaggca agaaaggaac 780 acggaggaaa gaaagactaa gacagaggaa gtacatttga agaacacaag tagagggagt 840 gcaggaaaca agaactacag aatgtag 867 <210> 4 <211> 59 <212> DNA Artificial sequence, CDS3 'primer <400> 4 attctagagg ccgaggcggc cgacatgttt tttttttttt tttttttttt tttttttnn 59 <210> 5 <211> 39 <212> DNA Artificial sequence, CDS5 'primer <400> 5 aagcagtggt atcaacgcag agtggccatt atggccggg 39 <210> 6 <211> 23 <212> DNA Artificial sequence, 5 'PCR primer <400> 6 aagcagtggt atcaacgcag agt 23 <210> 7 <211> 32 <212> DNA Artificial sequence, IGF-F3 primer <400> 7 ggggaattcc tctaaatccc tcttctgttt gc 32 <210> 8 <211> 30 <212> DNA Artificial sequence, IGF-R6 primer <400> 8 cccaagcttc tacattctgt agttcttgtt 30 <210> 9 <211> 36 <212> DNA Artificial sequence, IGF-T7F primer <400> 9 ggggcatatg atgggaaaaa tcagcagtct tccaac 36 <210> 10 <211> 35 <212> DNA <213> Artificial sequence, IGF-T7R primer <400> 10 ccccaagctt tcagtttcta gctccagtct ctctc 35

Claims (11)

서열목록 제1서열로 표시되는 아미노산 서열을 포함하는 IGF-I(Insulin-like growth factor 1).
Insulin-like growth factor 1 (IGF-I) comprising an amino acid sequence represented by SEQ ID NO: 1 sequence.
제 1 항에 있어서, 상기 IGF-I은 소(Bos taurus)로부터 유래한 것을 특징으로 하는 IGF-I.
The method of claim 1, wherein the IGF-I is Bos taurus ) IGF-I characterized by.
제 1 항 또는 제 2 항의 IGF-I을 코딩하는 뉴클레오타이드 서열.
A nucleotide sequence encoding the IGF-I of claim 1.
제 3 항에 있어서, 상기 뉴클레오타이드 서열은 서열목록 제2서열 또는 제3서열로 표시되는 것을 특징으로 하는 뉴클레오타이드 서열.
The nucleotide sequence of claim 3, wherein the nucleotide sequence is represented by a second sequence or a third sequence of the sequence listing.
제 3 항 또는 제 4 항의 뉴클레오타이드 서열을 포함하는 발현벡터.
An expression vector comprising the nucleotide sequence of claim 3 or 4.
제 5 항에 있어서, 상기 발현벡터는 대장균 발현용 플라스미드 또는 바실러스 발현용 플라스미드인 것을 특징으로 하는 발현벡터.
The expression vector according to claim 5, wherein the expression vector is E. coli expression plasmid or Bacillus expression plasmid.
제 5 항의 발현벡터로 형질전환된 숙주세포.
A host cell transformed with the expression vector of claim 5.
제 7 항에 있어서 상기 숙주세포는 대장균 또는 바실러스 균인 것을 특징으로 하는 숙주세포.
8. The host cell of claim 7, wherein the host cell is Escherichia coli or Bacillus bacterium.
제 1 항 또는 제 2 항의 IGF-I를 포함하는 사료첨가용 조성물.
Feed composition according to claim 1 or 2 comprising the IGF-I.
다음 단계를 포함하는 IGF-I 발현용 형질전환 미생물의 제조방법:
(a) 제 3 항 또는 제 4 항의 뉴클레오타이드 서열을 발현벡터에 삽입시키는 단계; 및
(b) 상기 뉴클레오타이드 서열이 삽입된 발현벡터로 미생물을 형질전환시키는 단계.
Method for producing a transforming microorganism for IGF-I expression comprising the following steps:
(a) inserting the nucleotide sequence of claim 3 or 4 into an expression vector; And
(b) transforming the microorganism with the expression vector into which the nucleotide sequence is inserted.
(a) 제 7 항의 숙주세포를 배양하여 IGF-I을 생합성 하는 단계; 및 (b) 상기 생합성된 IGF-I을 수득하는 단계를 포함하는 IGF-I 생합성 방법.
(a) culturing the host cell of claim 7 to biosynthesize IGF-I; And (b) obtaining the biosynthesized IGF-I.
KR1020110000967A 2011-01-05 2011-01-05 Novel insulin growth factor-i from bos taurus and gene encoding the same KR20120079653A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020110000967A KR20120079653A (en) 2011-01-05 2011-01-05 Novel insulin growth factor-i from bos taurus and gene encoding the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110000967A KR20120079653A (en) 2011-01-05 2011-01-05 Novel insulin growth factor-i from bos taurus and gene encoding the same

Publications (1)

Publication Number Publication Date
KR20120079653A true KR20120079653A (en) 2012-07-13

Family

ID=46712528

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110000967A KR20120079653A (en) 2011-01-05 2011-01-05 Novel insulin growth factor-i from bos taurus and gene encoding the same

Country Status (1)

Country Link
KR (1) KR20120079653A (en)

Similar Documents

Publication Publication Date Title
EP4317181A1 (en) Recombinant type-i humanized collagen polypeptide, and preparation method therefor and use thereof
JP7252280B2 (en) Novel insulin analogue and use thereof
KR100205078B1 (en) Basic fibroblast growth factor and the method of preparing the same
CN110546161B (en) Insulin analogues with reduced binding to insulin receptor and uses thereof
SK171492A3 (en) Polypeptide, method of its preparation its use and pharmaceutical agent
KR102135976B1 (en) Peptide with collagen synthesis-promoting activity and methods using the same
JP2019195327A (en) Method and means for expressing basic fibroblast growth factor that is authentic and biologically active in bacillus subtilis
KR20230133672A (en) Peptide with collagen synthesis-promoting activity and methods using the same
Tomisawa et al. Efficient production of a correctly folded mouse α-defensin, cryptdin-4, by refolding during inclusion body solubilization
WO2016102580A1 (en) Alpha-1-antitrypsin (a1at) fusion proteins and uses thereof
Carpio et al. Cloning, expression and growth promoting action of Red tilapia (Oreochromis sp.) neuropeptide Y
KR100583350B1 (en) -1 Method for Producing Epidermal Growth Factor Using Fusion Proteins Comprising Fas-1 Domain
KR20120079653A (en) Novel insulin growth factor-i from bos taurus and gene encoding the same
JPH08508735A (en) Method for detecting the presence of polypeptide and method for converting the same
Zhang et al. Expression, purification, and C-terminal amidation of recombinant human glucagon-like peptide-1
CA2483330C (en) Multimeric ligands with enhanced stability
KR102581377B1 (en) Collagen type 4 small-molecular peptide having collagen synthesis promoting activity and method using the same
KR20120067569A (en) Novel ferritin having iron-binding activity and gene encoding the same
CN113811598A (en) Method for preparing recombinant protein
Wang et al. High-level expression, purification, and characterization of the recombinant grass carp pituitary adenylate cyclase-activating polypeptide
Xu et al. Characterization and Expression of Ailuropoda melanoleuca Leptin (ob gene)
JPH06172394A (en) Extracytoplasmic c-domain protein of growth hormone receptor
EA045778B1 (en) NEW INSULIN ANALOGUES AND THEIR APPLICATION
WO2007112682A1 (en) Recombinant human parathyroid hormone-related proteins and uses thereof

Legal Events

Date Code Title Description
A201 Request for examination
E601 Decision to refuse application