WO2007112682A1 - Recombinant human parathyroid hormone-related proteins and uses thereof - Google Patents

Abstract

Recombinant parathyroid hormone-related proteins (PTHrP1-86 and PTHrP1-141) and nucleotide sequences encoding these proteins are provided. The pharmaceutical application of PTHrP1-86 and PTHrP1-141 and therapeutic kits comprising these proteins are also provided. The recombinant proteins and the kits of the present invention can be used for treatment of osteoporosis.

Description

 Recombinant human parathyroid hormone related protein

 The invention relates to the field of protein engineering. In particular, the invention relates to recombinant human parathyroid hormone related proteins and uses thereof. Background technique

Malignant tumors often present with malignant tumors such as hypercalcemia syndrome (HHM) ^[U] , which show clinical symptoms and blood biochemical changes similar to hyperparathyroidism, but serum levels of parathyroid hormone (PTH) in patients Not significantly increased. The researchers then speculated that a substance with a physiological function similar to FTH was the cause of hypercalcemia. In 1983, the researchers confirmed that this substance is not FTH, but another protein secreted by tumor cells that is involved in calcium and phosphorus metabolism ^[3] . In 1987, the researchers cloned the cDNA of this substance and named it protein parathyroid hormone-related protein (PTHrP) ^[4 ' ⁵ⁱ . With the further study, the presence of PTHrP was detected in a variety of different normal tissues ^[6 ' ^7] , which was confirmed to be expressed in most tissues and organs, suggesting its importance in normal cell growth and differentiation. Sex ^[8] . The mouse knocked out of the PTHrP gene died in the embryonic stage and could not develop normally ^[9 , ιο ^] . From another aspect, it was confirmed that PTHrP is essential for the growth and development of the body.

PTH is secreted by the parathyroid glands into the blood and transported to target cells to exert their physiological effects, known as endocrine. This is not the case with PTHrP, which is mainly autocrine, paracrine and intracrine ^[6 ' ⁷ ' ^{11 ]} .

PTHrP is considered to be the second hormone in the PTH family ^[7] . PTHrP has a great similarity to the N-terminal sequence of the PTH amino acid sequence~~ PTHrP and PTH have 8 of the first 13 amino acids at the N-terminus (2nd, 3rd, 4th, 6th, 7th, 9th, 12th, 13th) The exact same [ ⁱ , the original researchers concluded that they have similar physiological functions. Studies have confirmed that the PTHrPN-terminal fragment and PTH act on a common receptor, the PTH1 receptor (PTH1R) ^[7] , which has a similar effect in regulating calcium and phosphorus metabolism. However, with the deepening of its research, the researchers found that there is a great difference between the two in terms of gene structure and physiological function. The clinical manifestations of PTH and PTHrP deficiency or excessive secretion are also very different. The gene structure of PTHrP is much more complex than PTH, and the genes encoding human PTH and PTHrP are located on the short arms of chromosomes 11 and 12, respectively ^[1 . PTHrP contains a total of 3 promoters and 9 exons, while PTH has only 3 exons (see Figure 1.1). Due to the different splicing processing methods of post-transcriptional mRNA, PTHrP has three mature protein forms after translation (PTHrPl-139, PTHrPl-141). And PTHrPl-173) ^[15] . In addition, there are significant differences in PTHrP genes between different species. The PTHrP gene in rats and mice is simpler than humans, with only 5 exons. The PTHrP mature peptides encoded by them are only PTHrPl-139 and PTHrPl-141 ^[6] .

The originally translated PTHrP precursor undergoes complex post-translational processing, including removal of the signal peptide (-36--1) and enzymatic cleavage of the endonuclease. PTHrP is digested to produce a variety of different polypeptide fragments, forming a group of polypeptides with different biological activities. Three bioactive secretory fragments have been confirmed: N-terminal fragment (1-36/37), intermediate fragment (38-94/95/101), C-terminal fragment (107-139/141) ^[12 ' ¹⁶ ' ^17] . Their biological functions are significantly different, and these polypeptide fragments are likely to have their own different receptors ^[12 ' ^18] . The N-terminal fragment is most similar to sputum in biological properties and exhibits similar physiological activities. They activate adenylate cyclase and/or phospholipase C by binding to a common receptor (PTH1R) to exert a variety of physiological functions ^{[19-21 ]} . Due to the different sites of protease action, the boundaries of the middle part are not well defined. The intermediate part of the polypeptide fragments 88-91 and 89-106 also contain a nuclear localization sequence (NLS), which is similar in structure to viral and mammalian transcription factors. Under its action, PTHrP can enter the nucleus and play a regulatory role in gene transcription. Although there are few PTHrPs entering the nucleus, these very small amounts of PTHrP play an extremely important role in the proliferation and differentiation of cells. The C-terminal fragment also contains NLS, which can enter the nucleus to exert transcriptional regulation and cause cell proliferation. In addition, the biological effects that are not found in the other two fragments can be exerted by the corresponding receptors specifically distributed in bone and brain tissues ^[6 , ^7] .

PTHrP is widely distributed in the body, and its target tissues and target organs are involved in almost all tissues and organs including bones, kidneys, blood vessels, smooth muscles, keratinocytes, placenta, islets, central nervous system, etc. ^[6 ' ^{7 ]} . In bone tissue, PTHrP binds to its receptor (PTH1R), promotes chondrocyte proliferation, inhibits terminal differentiation, and inhibits chondrocyte apoptosis. This results in bone growth and endochondral osteogenesis. PTHrP is very important for promoting fetal bone development and cannot be replaced by PTH. PTHrP also promotes osteoblast proliferation, inhibits osteoclast activity, and stimulates bone formation ^[7 ' ⁹ ' ^{23 ]} . In the kidney, PTHrP and PTH are involved in the regulation of calcium and phosphorus metabolism, which indirectly affects bone tissue metabolism; it also reduces renal blood flow velocity and glomerular filtration rate, and also promotes the proliferation of renal tubular and glomerular cells in kidney tissue. The repair process of injury plays a certain role ^[6 ' ²³ _ ^28] ; PTHrP is also expressed in smooth muscle cells (VSMC) and vascular endothelial cells, which has a strong relaxing effect on smooth muscle and can reduce the tension of hollow organs and blood vessels. In order to regulate digestion and absorption, lower blood pressure, maintain blood pressure balance ^[29 '^34]; In the pancreas, PTHrP can delay β cell apoptosis, promote β cell aggregation and insulin secretion ^[35 · ^37] . In addition, PTHrP can exert its specific physiological effects in tissues such as breast, placenta, skin, small intestine, heart, pituitary, and central nervous system ^[7] . These physiological functions of PTHrP indicate that PTHrP will be clinically broad in the future. Application prospects can be used for the treatment of various diseases such as osteoporosis, renal failure, diabetes, and hypertension. In recent years, research on PTHrP has been increasing, and PTHrP has also been known. However, until now, many of its physiological characteristics and mechanisms of action have not been well understood. Due to the extremely low expression level of PTHrP in serum and histiocytes, it is difficult to meet the needs of scientific research by extracting samples by pure protein alone.

 Genetic engineering technology uses enzymatic methods to specifically cleave and recombine DNA molecules from different sources into a new hybrid DNA molecule, which is then transformed into a host cell, allowing the gene of interest to be expressed in vitro. After further purification, a large amount of the protein of interest can be obtained. For proteins with low expression levels in vivo, it is difficult to obtain a large number of high-purity samples by simple protein extraction and purification methods, and genetic engineering technology can obtain a large number of pure products in a short period of time, and thus has received increasing attention. At present, the use of genetic engineering at home and abroad to obtain PTHrP is limited to shorter fragments, and the synthesis of polypeptide fragments of such length as PTHrPl-141 has not been reported.

 The Pichiapastoris expression system of Pichia pastoris has the advantages of convenient operation, economical and large-scale fermentation production of E. co., and correct folding and post-translational modification of recombinant proteins (eg glycosylation). And the secreted expression makes the product easy to purify. It can be grown in a permeate with methanol as the sole carbon source. This is because the peroxidase of the cell contains essential enzymes for the methanol metabolic pathway, such as: alcohol oxidation. Enzyme 1 (alcohol oxidasel, ΑΟΧ1) is the first enzyme in the methanol utilization pathway, and in methanol-cultured yeast, the enzyme accounts for more than 30% of the total cellular protein. Methanol strongly induces the AOX1 promoter, making its downstream foreign genes easily regulated and highly expressed. Compared with S. cerevisiae, Pichia pastoris has a reduced degree of glycosylation of the recombinant protein, and the latter expresses a high degree of glycosylation of the recombinant protein, which may result in hypersensitivity. Thus, clinical application of recombinant proteins from Pichia pastoris is safer.

 Animal experiments are widely used to detect the biological activity of biological samples. Animal experiments on different fragments of parathyroid hormone-related proteins can be used to determine the effects of parathyroid hormone-related proteins on osteogenesis in animals by testing biomechanics, bone metrology, and biochemical indicators that reflect bone remodeling. Confirm the biological activity of the different fragments. Summary of the invention

 One aspect of the invention provides a parathyroid hormone related protein PTHrPl-86, the amino acid sequence comprising the SEQ

The sequence shown by ID NO:8, or the amino acid sequence obtained by the conservative substitution, deletion, and addition of one or more (preferably several) amino acids of the sequence shown by SEQ ID NO: 8. In a preferred embodiment, the amino acid sequence is the sequence set forth in SEQ ID NO: 8.

Another aspect of the invention provides a nucleotide sequence encoding the parathyroid hormone-related protein PTHrP1-86 of the invention, comprising the sequence set forth in SEQ ID NO: 7 or comprising under stringent hybridization conditions and SEQ ID NO: 7. Shown Sequence hybridization sequence. In a preferred embodiment, the nucleotide sequence is the sequence set forth in SEQ ID NO: 7.

In the present invention, "hybridization under stringent conditions" means that the nucleic acid can be subjected to the conditions described in T. Maniatis et al. (ed.), Molecular Cloning: A Laboratory Manual 2 ^nd ed., Cold Spring Harbor Laboratory (1989) or Hybridization was carried out under similar conditions. For example, it refers to the ability to hybridize under conditions of: 0.5% SDS, 0.1% bovine serum albumin (BSA), 0.1% polyvinylpyrrolidone, 0.1% Ficoll 400 and 0.01% denatured salmon sperm The nucleic acid-immobilized membrane was incubated with the probe at pH 50 for 6-20 hours in 6xSSC of nucleic acid (lxSSC: 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0). After incubation, the membrane was washed in 2XSSC containing 0.5% SDS at 37 ° C while the SSC concentration was down-regulated to Ol x and the temperature was adjusted up to 50 ° C until the signal from the immobilized nucleic acid could be distinguished from the background, then Detection probe.

 In another aspect of the invention, a vector and host cell comprising a nucleotide sequence encoding a parathyroid hormone related protein PTHrP1-86 are provided. In a preferred embodiment, the host cell is a Pichia cell.

 In another aspect of the invention, there is provided the use of a human parathyroid hormone-related protein of the invention (PTHrPl-86 or PTHrPl-141) for the manufacture of a medicament for the treatment of osteoporosis.

 In another aspect of the invention, a method of treating osteoporosis comprising administering to a patient a therapeutically effective amount of a human parathyroid hormone-related protein of the invention (PTHrPl-86 or PTHrPl-141) is provided.

 In another aspect of the invention, there is provided a kit for treating osteoporosis comprising a therapeutically effective amount of a human parathyroid hormone-related protein of the invention (PTHrPl-86 or PTHrP1-141).

 The term "conservative substitution, deletion, addition" as used herein means that the amino acid or nucleotide sequence modified as described above still has the same function as the original sequence. Based on the sequence, one of ordinary skill in the art can fully determine sequences having the same function obtained after conservative substitution, deletion, and addition.

 The term "therapeutically effective amount" as used herein means a dose which a physician can determine to effectively exert a therapeutic effect, depending on the condition of the patient.

The present invention uses pGEM-T easy/PTHrPl-141, 1-86 as a template to obtain PTHrP1-141, 1-86 mature peptide cDNA by PCR, and clones the fragment into pGEM-T easy, and then uses pGEM-T The Xhol and EcoRI sites in the easy multiple cloning site were ligated into the same endonuclease-treated pPIC9K linkage to achieve directional cloning. The transformation methods of Pichia pastoris mainly include electroporation, protoplast method, PEG1000 method and lithium chloride method. The electroporation method has the highest conversion efficiency, and can produce 10 ³ - 10 ⁴ transformants per μ _§ plasmid DNA, but requires a special equipment electro-converter. The protoplast method also obtains better conversion efficiency, but requires more expensive Zymolyase to partially hydrolyze the cell wall, and the experimental process is also cumbersome. The PEG1000 conversion method is simple and economical. 10 ² - 10 ³ transformants can be produced per μ _§ plasmid DNA. In this study, a better conversion effect was obtained by this method, and an average of 100-200 transformants were obtained per 7 cm plate after the transformation. Advantages and effects

 Since the expression level of PTHrP in the human body is extremely low, it is difficult to obtain the expected yield by simply extracting the protein of interest from the tissue. The recombinant human parathyroid hormone related protein 1-86, 1-141 is prepared by the method of the invention, and is simple, safe and reliable. After purification, the recombinant polypeptide PTHrPl-86, 1-141 can meet the requirements of biological activity determination and animal experiments, and can be used for the treatment of osteoporosis.

 Rats, as experimental animals, are less expensive, easier to operate, and more reproducible. The treatment and administration method are simple and convenient to operate, and the effect is obvious. BRIEF DESCRIPTION OF THE DRAWINGS:

 Figure 1. PCR amplification of PTHrPl-141 gene using genomic DNA as a template, wherein 1 is DNA Marker DL2000: 2000, 1000, 750, 500, 250, and lOObp 2 is a PCR amplification product of PTHrPl-141.

 Figure 2. Recombinant plasmid pGEM-T easy/ PTHrPl-141 digestion, l. DNA Marker DL2000: 2000,

1000, 750, 500, 250, 100 bp 2. pGEM-T easy 3. pGEM-T easy/ PTHrPl-141 recombinant plasmid was digested.

 Figure 3. PCR amplification of PTHrPl-141 gene using pGEM-T easy/ PTHrPl-141 as a template, 1. DNA Marker DL2000: 2000, 1000, 750, 500, 250, lOObp 2. PTHrPl-141 PCR amplification product.

 Figure 4. PCR amplification of PTHrPl-86 gene using pGEM-T easy/ PTHrPl-141 as a template, 1. DNA

Marker DL2000: 2000, 1000, 750, 500, 250, lOObp 2. PTHrP 1-86 PCR amplification product.

 Figure 5. Construction of pQE-30Xa/PTHrP 1-141 and pQE-3 OXa/PTHrP 1 -86 expression vectors.

 Figure 6. Restriction map of pQE-30Xa/PTHrPl-141 recombinant plasmid, wherein 1 is 1. DNA Marker DL2000: 2000, 1000, 750, 500, 250, 100 bp; 2. Recombinant plasmid pQE-30Xa/ PTHrPl-141 The Pv II enzyme product; 3. The recombinant plasmid pQE-30Xa/ PTHrPl-141.

 Figure 7. Restriction map of pQE-30Xa/PTHrPl-86 recombinant plasmid, wherein 1 is 1. DNA Marker DL2000: 2000, 1000, 750, 500, 250, 100 bp; 2. Recombinant plasmid pQE-30Xa/ PTHrP 1-86 Pvu II digestion product; 3. Recombinant plasmid pQE-30Xa/ PTHrPl-86.

Fig. 8 Results of SDS-PAGE electrophoresis of pQE-30Xa/PTHrPl-141 expression product in Ec M15[pREP4], wherein 1 is M15[pREP4] induced expression, fragmentation is precipitated; 2 is M15[pREP4] induced expression, fragmentation On 3; M15[pREP4] transformed with empty pQE-30Xa plasmid induced expression, fragmentation; 4 was induced by empty pQE-30Xa plasmid transformed with M15[pREP4], and the supernatant was broken; 5 was pQE-30Xa/ PTHrPl -141 Recombinant plasmid-transformed M15[pREP4]-induced expression (O.lmmol/L IPTG), fragmentation; 6 is pQE-30Xa/ PTHrPl-141 recombinant plasmid transformed M15[pREP4] induced expression (O.lmmol/L IPTG), the supernatant of the bacterium; 7 is the M15[pREP4]-induced expression (2.0mmol/L IPTG) transformed by pQE-30Xa/ PTHrPl-141 recombinant plasmid, and the fragment is precipitated; 8 is the recombinant plasmid pQE-30Xa/ PTHrPl-141 Transformed M15[pREP4] induced expression (2.0 mmol/L IPTG), the supernatant of the bacterium; 9 is the molecular weight of the protein: 116.0 kD, 66.2 kD, 45.0 kD, 35.0 kD, 25.0 kD, 18.4 kD, 14.4 kD.

Figure 9. Results of SDS-PAGE electrophoresis of pQE-30Xa/PTHrPl-86 expression product in E.co// M15[pREP4], where 1 is M15[pREP4] induced expression for 4 hours, and the supernatant is sterilized; M15[pREP4] transformed with pQE-30Xa plasmid induced expression for 4 hours, and the supernatant was pulverized; 3 was induced by p15E-30Xa/ PTHrPl-86 recombinant plasmid, and M15[pREP4] was induced to express for 4 hours (1.0 mmol/L IPTG). The supernatant of the bacterium was 4; M15[pREP4] transformed with pQE-30Xa/ PTHrPl-86 recombinant plasmid was induced to express for 4 hours (2.0mmol/L IPTG), and the supernatant was broken; 5 was the molecular weight of the polypeptide: 16.95kD, 14.44kD , 10.60kD _; 6 is induced by M15[pREP4] for 4 hours, and the bacteria are precipitated; 7 is M15[pREP4] transformed with empty pQE-30Xa plasmid and induced to express for 4 hours, and the bacteria are precipitated; 8 is pQE-30Xa/ PTHrPl-86 The recombinant plasmid-transformed M15[pREP4] induced expression for 4 hours (1.0 mmol/L IPTG), and the pellet was precipitated; 9 was induced by pQE-30Xa/PTHrP1-86 recombinant plasmid M15[pREP4] for 4 hours (2.0 mmol/L) IPTG), pellet precipitation.

 Figure 10. Western Blotting of the recombinant protein PTHrP1-141, where 1 is the protein molecular weight marker (amino black staining): 66.2 kD, 45 kD, 35 kD, 25 kD, 18.4 kD, 14.4 kD; 2 is the color of the induced expression product result.

Figure 11. Western Blotting identification of the recombinant protein PTHrPl-86, wherein 1 is the molecular weight marker of the polypeptide (amino black staining): 16.95 kD, 14.44 kD, 10.60 kD _; 2 is the coloration result of the induced expression product.

 Figure 12. Recombinant PTHrPl-141 and PTHrPl-86 bioactivity assays.

 Figure 13. Yeast expression shuttle plasmid pPIC9 shows 'intent.

Figure 14. PCR identification of plasmid pPIC9K-PTHrPl-86. 1: PCR product with empty plasmid pPIC9K as template; 2, 3, 5, 6, 7: PCR product with recombinant plasmid pPIC9K-PTHrpl-86 as template; : DNA molecular weight Marker 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp _o

Figure 15. Silver staining results of yeast medium supernatant after SDS-PAGE electrophoresis. l: pPIC9K transformant induced expression in 120-hour culture supernatant; 2: pPIC9K/PTHrP transformant induced expression on 12-hour medium Clear electrophoresis; 3: _P PIC9K/PTHrP transformant induced expression 24 hours culture supernatant; 4: _P PIC9K/PTHrP transformant induced expression 48 hours culture supernatant; 5: Protein molecular weight marker: 97.4KD, 66.2KD , 43.0KD, 31.0 D, 20.0KD, 14.4KD; 6: pPIC9K/PTHrP transformant induced expression 72 hours culture supernatant; 7: _P PIC9K7PTHrP transformant induced expression 96 hours culture supernatant; 8: pPIC9K/ The PTHrP transformant induced expression of the culture supernatant for 108 hours; 9: pPIC9K/PTHrP transformant induced expression for 120 hours of culture supernatant electrophoresis.

 Figure 16. Effect on bone mineral density in rats, PO.05 in the castration group, no difference in the remaining groups.

 Figure 17. Effect of serum osteocalcin levels in rats. Ovariectomized group: PO.05, PTH1-34 high dose group, PTH1-141 high dose group and PTH1-141 low dose group P<0.05.

 Figure 18. Effect on rat tibia, P < 0.05 in the castration group, no difference in the remaining groups.

 Figure 19. Effect on serum alkaline phosphatase in rats. The high dose group of PTH1-34 and the high dose group of PTHrPl-141 were higher than the other groups.

 Figure 20. Effect on serum calcium and phosphorus in rats. P<0.05 in the sham operation group PO.05, the high-dose group of PST1-141 and the low-dose group of PTH1-141.

 Figure 21. Effect of maximal stress on the femur of rats.

 Figure 22. Effect on the maximum femur load in rats.

 Figure 23. Effect of maximum deformability of the femur in rats.

 Figure 24. Effect on femur elongation in rats.

 Figure 25. Effect on femur bone volume in rats.

 Figure 26. Effect of rat femoral single-label volume on rats.

 Figure 27. Effect of the double-labeled table volume on the rat femur.

 Figure 28. Effect of the volume ratio of single and double markers on the femur of rats.

 Figure 29. Effect on the bone mass of the femur bone in rats.

 Figure 30. Effect on femur bone mass in rats.

 Figure 31. Effect on the femoral absorption surface area of rats.

 Figure 32. Effect on fecal mineralization rate in rats.

 Figure 33. Effect on fecal mineralization time in rats.

Figure 34. Effect on the reconstruction time of rat femur bone The invention is described in detail below by way of examples. It is to be understood by those skilled in the art that the following examples are for illustrative purposes only and are not to be construed as limiting. The scope of the invention is defined by the appended claims.

 E. coli JM109 strain was purchased from QIAGEN company, E. coli M15 [pREP4] strain was purchased from QIAGEN company; rat osteosarcoma cell line UMR 106 was purchased from the United States ATCC (American Tissue Culture Collection); The pGEM-T Easy carrier was purchased from Promega, and the pQE-30Xa was purchased from QIAGEN.

Restriction endonucleases EcoRI, Sail, Stul, Pvu ll, r73⁄4 DNA polymerase, P_yro6erf DNA polymerase, nucleic acid molecular weight marker DL2 000, dNTP were purchased from TaKaRa; T ₄ DNA ligase was purchased from Promega; Markers were purchased from Sigma; medium molecular weight protein markers, RNase purchased from White Fermentas.

Ampicillin, kanamycin, isopropylthio-β-D-galactoside (IPTG), 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) Tris, Tri _C ine, sodium dodecyl sulfate (SDS) were purchased from Huamei Bioengineering Co., Ltd. 3-isobutyl small methylxanthine (IBMX), agarose, glycine, ethidium bromide (EB), phenylmethylsulfonyl fluoride (PMSF), and cyclic adenosine monophosphate (cAMP) are products of Sigma, USA. Ammonium persulfate (AP), tetramethylethylenediamine (TEMED), acrylamide and methylenebisacrylamide were purchased from USB Corporation of the United States. HRP-labeled rabbit anti-goat IgG was purchased from Beijing Dingguo Bioengineering Co., Ltd. Goat anti-human PTHrP (N-19) IgG was purchased from SANTA CRUZ. hPTHl-34 was purchased from BACHEM. Other reagents are imported or domestically analyzed.

 Yeast Extract, Tryptone, Agar, and DMEM are all GIBCO products. Fetal bovine serum was purchased from Hyclone.

 The DNA rapid purification and recovery kit was purchased from Beijing Dingguo Biotechnology Co., Ltd. The ProbandTM M-NTA Affinity Chromatography Protein Purification Kit was purchased from Invitrogen. The BCA protein concentration assay kit is a product of PIERCE. The DAB chromogenic kit was purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd. Example 1. Construction of pGEM-T easy/ΡΤΗφ 1-141 recombinant plasmid

(l) Acquisition of the PTHrPl-141 gene

Human genomic DNA was extracted from whole blood according to the TKM method ^[38] . Using the extracted human genomic DNA as a template, the PTHrP1-141 gene was amplified by PCR using the following primers:

Upstream primer: 5, --- GCG^4I C i GCTGTGTCTGAACATCAGCTCCTC---3, ( SEQ ID NO: l ) , where is the start codon; the base indicated by the slash is the EcoRI restriction site.

 Downstream primer: 5,---GGG C(3⁄4Ci ATGCCTCCGTGAATCGAGCTC---3, ( SEQ ID

NO: 2), wherein the base represented by the oblique line is the /1 restriction site, and TI4. is the anti-codon of the stop codon TAA.

 The PCR reaction system was as follows: genomic DNA was Ι.ΟμΙ, lOxPCR buffer was 2.5μ1, dNTP (2.5 mmol/L each) was 1.5μ1, upstream primer (5μιηο1/0 was Ι.ΟμΙ, downstream primer (5 mol/L) For 1.0 μl, r DNA polymerase (lU^L) was Ι.ΟμΙ, and dd3⁄40 was 17.0 μl.

 The PCR reaction conditions were: pre-denaturation at 95 ° C for 5 min; denaturation at 95 ° C for 45 sec, annealing at 58 ° C for 45 sec, 72. C extends for 45 sec, 30 cycles; the last 72 ° C extends for 10 min. The 2μ1 PCR amplification product was subjected to 1.5% agarose gel electrophoresis, and the molecular weight of the amplified product was 423 bp (SEQ ID NO: 3) with reference to the nucleic acid molecular weight marker DL 2 000.

(2) Construction of recombinant plasmid pGEM-T easy/ PTHrPl-141

The PCR amplification product described above was recovered by a DNA rapid purification recovery kit (purchased from Beijing Dingguo Biotechnology Co., Ltd.) and then ligated to the pGEM-T easy vector. It was then transformed into competent bacteria E. co/JM109 prepared according to the Nishimmm method ^[39] .

A small amount of plasmid was extracted by alkaline lysis ^[39 ' ^4()] . By restriction endonuclease EcoRK 8-20U/ D0.5^, Sal 8-20U/ l) 0.5| digestion, two fragments of about 3000 bp and about 450 bp were observed, as shown in Fig. 2. The recombinant plasmid was named _P GEM-T/PTHrPl-141 o Example 2. Construction and expression of pQE-30Xa/PTHrPl-141 and pQE-30Xa/PTHrPl-86 recombinant plasmids (1) Amplification of PTHrPl-141 and PTHrPl- 86 fragment:

 Using the above recombinant pGEM-T easy/PTHrP 1-141 plasmid as a template, the PTHrPl-141 and PTHrPl-86 fragments were amplified by PCR as follows:

Upper and lower primers (shared by PTHrPl-141 and PTHrPl-86):

 5 '- ATGGCTGTGTCTGAACATCAG—, (SEQ ID NO: 4)

Downstream primer (for PTHrPl-141), wherein the base indicated by the slash is the I cleavage site:

5 '-CCGrCG^CTTAATGCCTCCGTGAATC-3 ' ( SEQ ID NO: 5 )

 (for PTHrPl-86):

5'-GTCAATGCGTCGACITAAGGTGTCTTGAGCGGCTG-3 ' (SEQ ID NO: 6) The PCR reaction conditions were pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 45 sec, annealing at 58 °C for 45 sec, and extension at 72 °C for 45 sec. 30 cycles; the last 72 ° C extension for 10 min. The size of the PTHrP1-141 fragment was 423 bp (SEQ ID NO: 3), see Figure 3. The size of the PTHrP1-86 fragment is 258 bp, see Figure 4 (SEQ ID NO: 7, the encoded amino acid sequence is set forth in SEQ ID NO: 8). (2) Construction of _P QE-30Xa/PTHrPl-141 and pQE-30Xa/PTHrPl-86 recombinant plasmids

 The pQE-30Xa vector was digested with Stu I and Sal I, and ligated with the partially amplified product of the PCR amplification products PTHrPl-141 and PTHrPl-86 obtained in l. Plasmid pQE-30Xa ^ Both the PTHrPl-141 and PTHrPl-86 sequences have a restriction endonuclease restriction enzyme Ρι^ Π cleavage site. If the ligation product is pQE-30Xa/PTHrPl-141 recombinant, 3285 bp and 613 bp will be produced after digestion. Two cleavage fragments; if pQE-30Xa/PTHrPl-86 recombinant, then two digestion fragments of 3285 bp and 448 bp will be produced after digestion; if the vector is self-ligated, a 3509 bp fragment will be produced by digestion. That is, the linearized plasmid pQE-30Xa was obtained. The above plasmid was confirmed by PTO II digestion to obtain the above recombinant plasmid (see Figures 6 and 7). DNA sequence analysis was performed on the recombinant plasmid with positive results by restriction enzyme digestion, which was further confirmed to be correct. Recombinant. (3). Expression of PTHrPl-141 and PTHrPl-86 in E.co/ M15[pREP4]

 The recombinants pQE-30Xa/PTHrPl-141 and pQE-30Xa/PTHrPl-86 were transformed into E. coli M15 [pREP4]. IPTG (final concentration 1 匪 ol/L) induced E. coli M15 [pREP4] bacteria transformed with recombinant pQE-30Xa/PTHrPl-141 and pQE-30Xa/PTHrPl-86 plasmids for 6 hours.

The expression product was induced by pQE-30Xa/PTHrPl-141 by SDS-PAGE ^[39 ' ^4Q] . The fusion protein expressed by the E. coli M15 [pREP4] host strain containing no pQE-30Xa plasmid and the host strain containing the blank pQE-30Xa plasmid included the carrier protein (2.2 kD) and PTHrPl-141 ( 16.2 kD). Therefore, deep-stained protein bands should be visible at approximately 18-19 kDa. The target band is slightly larger than the predicted molecular weight. See Figure 8.

The expression product was induced by pDSE-30Xa/PTHrPl-86 by SDS-PAGE. The fusion protein including the carrier protein (2.2 kD) and PTHrPl-86 (1O.OkD) was used as a control against the Eco/ ₇ ' M15 [pREP4] host strain containing the pQE-30Xa plasmid and the host strain containing the blank pQE-30Xa plasmid. Therefore, a deep-stained protein band should be visible at about 12-13 kDa. The results are shown in Figure 9.

 The yield of the fusion protein in the supernatant of the bacterium increased with the increase of the final concentration of IPTG, and reached a peak at 1.0 mmol/L.

The protein in the gel was transferred to the PVDF membrane by semi-dry method, and the goat anti-human PTHrP (N-19) polyclonal antibody was used as the primary antibody, and the horseradish peroxidase-labeled rabbit anti-goat IgG antibody was used as the secondary antibody for the Western antibody. Blot ^[43] identification. The PVDF membrane used for Western Blotting assay has a 22kD deep-stained band after substrate color development, and its position is consistent with the specific band position of the recombinant plasmid-induced expression product, see Figure 10. The PVDF membrane used for Western Blotting assay showed a 12kD deep-stained band after substrate color development, and its position was consistent with the specific band position of the recombinant plasmid-induced expression product, see Figure 11.

At the same time, the recombinant protein was purified using the Invitrogen ProBandTM Purification System kit. Example 3. Determination of biological activity of recombinant PTHrPl-141 and PTHrPl-86 ^[45 ' ^46]

PTH and PTHrP play a physiological role through a common receptor ^[19 ' ^2Q] , and bioactive PTH or PTHrP binds to a receptor and triggers a cascade of cascades triggered by intracellular second messenger cAMP, thus The intracellular cAMP concentration will increase significantly. Whether the recombinant PTHrPl-86 and PTHrPl-141 were biologically active was determined by measuring changes in cAMP in the rat osteosarcoma cell line UMR106 (see Table 1 below). The results showed that both recombinant PTHrPl-141 and PTHrPl-86 could increase the intracellular cAMP level in a dose-dependent manner, and the former was more effective, but the intensity of both was lower than that of PTH1-34, as shown in Fig. 12. The specific process is as follows.

1. Cell culture and sample processing

The rat osteosarcoma cell line UMR 106 ^{[47] was} resuscitated and passaged to 24-well plates after 2-3 passages. TTC, 5 C0 ₂ , cultured in DMEM complete culture. When the cells reached 80% confluence (10 ⁶ or more), discard the culture solution, rinse the cells twice with cold PBS, and add serum-free DMEM medium, 5% C0. ₂ incubated at 37 ° C for 24 hr. The serum-free medium was discarded and rinsed twice with cold PBS solution. The above serum-free medium containing 1 mmol/L of IBMX was added for 60 minutes to inhibit the activity of phosphodiesterase. Saline for the blank control, hPTHl-34 as positive controls, three samples (hPTHl-34, PTHrPl-141 recombinant Wo Jie PTHrPl-86) a final concentration of ^{10- 10 mol / L, l (} T 9 mol / L ^{, 10 -8 mol / L, 10-} 7 mol / L, 10- 6 mol / L, 10 -5 mol / L. 5% C0 2, 37 ° C effect 5min. 4 ° C ice bath to terminate the reaction, discarded The culture solution was washed twice with cold PBS, and 1 mL of cold acid ethanol (O.Olmol/L HCK 95% ethanol) was added, and the mixture was allowed to stand at 20 ° C for 24 hours to extract cAMP. Repeated freezing and thawing for 3 times, the cells were scraped off, and the cells were collected. Suspension. Ultrasonic disruption of cells (40W, 3sec each, 3sec, 20 times). Centrifuge at 15000xg for 10 minutes at 4°C, place the supernatant in a new tube, dry at 80°C, reconstitute with ΙΟΟμΙ^ ,, For cAMP assays.

 2. Determination of cAMP content

The cAMP content was determined by HPLC. The cAMP value of the sample to be tested is obtained by comparing the area above the peak with the area under the peak of the cAMP standard curve. The cAMP standard was purchased from SIGMA and the standards were diluted to different concentrations to establish a standard curve. 3. Correct the cAMP content determination results by the total protein concentration of the cell lysate

 The total protein concentration of the cell lysate was determined by the BCA method, and the measured intracellular cAMP ratio was used as the corrected cAMP content measurement result.

 Table 1 Stimulation of intracellular cAMP levels by recombinant PTHrPl-86 and PTHrPl-141

Example 3. Construction and expression of _P PIC9k/PTHrPl-141 and pPIC9k/PTHrPl-86 recombinant plasmids (1). Construction of recombinant plasmid pPIC9K/PTHrPl-86 The PTHrP1-86 fragment obtained in Example 2 was ligated into pGEM-T easy (the same method as before), and the purified DNA fragment was recovered by digestion with EcoI and EcoRI, and the same expression plasmid pPIC9 was used. Figure 13) Make the connection. The recombinant plasmid pIC9/PTHrPl-86 was subjected to restriction enzyme digestion and sequencing (sequencing primer was 5'AOX1 supplied by Invitrogen) to determine the correct recombinant.

(2). Transformation of recombinants

After the empty plasmid pPIC9K and the above recombinant plasmid pIC9/PTHrPl-86 were linearized by Sail digestion, Pichia pastoris strain GS 115 (purchased from Invitrogen) was transformed by electroporation. Coated on MD plate ( 1.34% YNB (yeast nitrogen source, completely synthetic medium without any carbon source), 4xl (T ⁵ % biotin, 2% glucose, 1.5% agar) 30 ° C inverted culture In the day, the grown colonies were inoculated into YPD medium (10 g/L yeast powder; 20 g/L peptone; 20 g/L glucose), and after shaking culture, yeast genomic DNA was extracted as a template, and the above PCR method was used (the same example) 2) Screening of recombinants. The results showed that the recombinant plasmid pIC9/ PTHrPl-86 and the empty pPIC9 transformed yeast strain had different size bands, and the recombinant plasmid amplified two bands: a size of 2200 bp, which is a PCR amplification of the yeast AOX1 gene. The additional product was 771 bp, which is the sum of the fragment 492 bp and the insert 279 bp between the corresponding upstream and downstream primers of pPIC9. The results are shown in Figure 14. The recombinant plasmid pIC9/ PTHrPl-86 was integrated into the yeast chromosome.

(4). Induced expression of recombinant yeast strains:

The recombinant Pichia pastoris single colonies (empty plasmid transformation products and recombinant plasmid transformation products, respectively) were picked and inoculated into 100 mL of BMGY medium (10 g/L yeast extract, 20 g/L peptone, 10 g/L glycerol). , 13.4 g / L YNB, 0.4 mg / L biotin, 0.1 mol / L potassium phosphate buffer), culture at 30 ° C shaking until OD _6Q . =4.0. Collect the cells by centrifugation, discard the BMGY medium, and replace with 25 ml of BMMY medium (10 g/L yeast extract, 20 g/L peptone, 10 g/L glycerol, 13.4 g/L YNB, 0.4 mg/L biotin). , 0.1 mol/L potassium phosphate buffer), shaking culture was continued at 30 ° C, and 0.125 ml of methanol (final concentration of 0.5% V/V) was added every 24 hours to induce expression. After 5 days, the culture was stopped, and the supernatant was centrifuged at 15 000 x g, and an appropriate amount was applied for SDS polyacrylamide gel electrophoresis. A recombinant yeast strain containing the PTHrP mature peptide coding sequence showed a distinct protein staining band at 10 KD, whereas the control yeast strain (an empty plasmid-transformed yeast cell strain) did not have this band, see Figure 15.

(5). Fermentation (5L):

5.1 Seed culture: Pick the recombinant Pichia pastoris identified above to inoculate 100 mL BMGY culture. The medium was shaken at 30 ° C to OD _{6C (} = 3.0 (about 18 hrs).

5.2 Fermentation: The seed solution was transferred to 5 L of BMGY medium, and 5 ml of 7.5% kanamycin (final concentration of 75 _g / ml) was added, and 30 'C, fermentation culture was carried out. The medium OD ₆ c was sampled every 1 hr. The absorbance value was raised to OD ₆ o (=2.0 (about 10 hrs).

5.3 Induced expression: 2 OOOxg was centrifuged at room temperature for 5 min to collect the cells, and the cells were suspended in 500 ml of BMMY medium, and culture was continued for 30 Ό, and 2.5 ml of methanol was added every 24 hr (final concentration was 0.5% V/V). A total of 144 hr was induced, and a small amount of samples were taken at 72 hr, 96 hr, and 120, respectively.

 5.4 Electrophoretic identification: The supernatant was retained by centrifugation at 15 OOOxg, and a small amount was used as described above for SDS polyacrylamide gel electrophoresis. Example 4. Construction of recombinant plasmid pPIC9K/PTHrPl-141

 (1) Construction of recombinant plasmid pPIC9K/PTHrPl-141

 The pGEM-T easy/ PTHrPl-141 obtained above was transferred into Escherichia coli JM109, and the plasmid was extracted by alkaline lysis, and the DNA fragment was purified by XhoI and EcoRI digestion, and the same expression plasmid pPIC9 was used. connection. The recombinant plasmid was identified by enzyme digestion. Simultaneous sequencing was performed, and the sequencing primers were 5'ΑΟΧ1 provided by Invitrogen.

(2) . Transformation of recombinants

pIC9 / PTHrPl-141 linearized by Sail digestion preclude the use of the PEG method ^[39] Pichia pastoris GS115 transformed competent cells (simultaneously transformed with empty plasmid), coated on MD plates (1.34% YNB, 4xl0- ^5% bio Inoculum, 2% glucose, 1.5% agar) Incubate for 30 days at 30 °C, inoculate each colony grown in YPD medium, and shake the culture, extract yeast genomic DNA as a template, and PCR (same example 2) Recombinant. The results showed that the recombinant plasmid pIC9/ PTHrPl-141 and the empty pPIC9 transformed yeast strain were amplified by different sizes, and the recombinant plasmid amplified two bands: one piece was 2200 bp, which is the PCR amplification product of yeast AOX1 gene, and the other is 936 bp, which is the sum of the fragment 492 bp between the upstream and downstream primers of pPIC9 and the insert 444 bp. The recombinant plasmid pIC9/ PTHrPl-141 was integrated into the yeast chromosome.

(4). Induced expression of recombinant yeast strains:

Picking up a recombinant Pichia pastoris single colony (empty plasmid transformation product, and recombinant plasmid transformation product) In lOOmL BMGY culture medium, incubate at 30 ° C until OD _{6Q (} ) = 4.0. The cells were collected by centrifugation, the BMGY medium was discarded, and 25 ml of BMMY medium was replaced, and shaking culture was continued for 30 Torr. 0.125 ml of methanol (final concentration of 0.5% V/V) was added every 24 hours to induce expression. After 5 days, the culture was stopped, and the supernatant was centrifuged at 15 000 x g, and an appropriate amount was applied for SDS polyacrylamide gel electrophoresis. A recombinant yeast strain containing the PTHrPl-141 mature peptide coding sequence showed a distinct protein staining band at 22 KD, whereas the control yeast strain (an empty plasmid transformed yeast cell line) did not have this band.

 (5). Fermentation (5L) Part of Example 3 (5) Example 5. Identification of therapeutic effect:

1. Animal selection and grouping

 Selection: Female SD (Sprague-Dawley) rats, 160 weeks old, weighing 225-308 grams, with an average of 262.87±18.68 grams, purchased from the Department of Experimental Animal Science of Peking University Medical School (Laboratory Animal Quality Certificate No. - 0034797), The animal level is secondary (clean grade). Animals were free to drink water and eat during the test. The feed is standard granules, drinking water is tap water, iron cage feeding, natural day and night lighting, good indoor ventilation (relative humidity 40-70%, room temperature is maintained at 18-20 ° C).

 Animal grouping: The selected animals were grouped by weight and divided into 6 groups according to the random principle: sham operation group, negative control group, PTH1-34 high dose group, PTH1-34 low dose group, PTHrPl-86 high dose group, PTHrPl-86 Low dose group. Twenty animals in each group, except for the sham operation group, all the other groups underwent castration surgery. 2. Preparation of castrated animal models

 Rats were anesthetized by intraperitoneal injection at a dose of 0.3 mL/100 g body weight using 10% chloral hydrate. After anesthesia, the rats were fixed in the prone position, and after the skin was disinfected, the muscle tissue was bluntly separated through the back incision, and then the peritoneal cavity was opened, and the ovary was confirmed to be ligated and excised. The tissue is returned to the body, and the gentamicin is irrigated and the wound is sutured, and the wound is naturally awakened. After 16 weeks of castration surgery, the bone density of the lumbar vertebrae of the rats was measured, and the animal model was confirmed to be successful.

3. Administration process

Twenty weeks after the operation, the patient was administered subcutaneously once a day through the neck and back for 6 weeks. The groups were administered as follows: The sham operation group was given vehicle (acidified saline), the negative control group, the vehicle, and the PTH1-34 high dose group was given PTH1-34 protein from Shanghai Saijin Biomedical Co., Ltd. (40nmol/kg body weight), PTH1-34 low dose group to PTHl-34 (5nmol/kg body weight), PTHrPl-86 high dose group to recombinant PTHrPl-86 protein (40nmol/kg) Body weight), PTHrPl-86 low dose group was given recombinant PTHrPl-86 protein (5nmol/kg body weight), PTHrPl-141 high dose group was given recombinant PTHrPl-141 protein (40nmol/kg body weight), PTHrPl-141 low dose group was given recombinant PTHrPl -141 protein (5 nmol/kg body weight). Tetracycline was injected intraperitoneally 10 days before the end of the administration and 3 days before the end of the administration. After the end of the administration, the animals were sacrificed by exsanguination of the femoral artery.

4. Detect the following indicators

 According to the prior art [57, 58, 59], the following indicators are detected:

 (1) Routine biochemical tests:

 (a) Effect on bone mineral density in rats (see Figure 16) P<0.05 in the castrated group, no difference in the remaining groups.

 (b) Effects on serum osteocalcin levels in rats (see Figure 17). Ovariectomized group: PO.05, PTH1-34 high dose group, PTH1-141 high dose group and PTH1-141 low dose group compared with PO. 05

 (c) Effects on rat tibia (see Figure 18). Castration group P<0,05, no difference in the remaining groups

 (d) Effects on serum alkaline phosphatase in rats (see Figure 19) PTH1-34 high-dose group and PTHrPl-141 high-dose group were higher than the other groups

 (e) Effect on serum calcium and phosphorus in rats (Fig. 20) P.0.05 in the sham operation group PO.05, the castration group and the PTH1-141 high dose group were compared with the PTH1-141 low dose group.

 (2) Effects on osteogenesis ^ ^ Biomechanical test, osteometry

 In the WDW-10KN microcomputer-controlled electronic universal testing machine, a three-point bending test was performed. The loading point was located at 1/3 of the femoral shaft, and the gauge distance of the two fulcrums was 20 mm. The test machine was loaded at a constant speed and the loading speed was 2 mm/min. The test is as follows:

 Effects on maximal stress of the femur in rats (see Figure 21)

 Effects on the maximum femur load in rats (see Figure 22)

 Effects on the maximum deformability of the femur in rats (see Figure 23)

 Effects on femur elongation in rats (see Figure 24)

 Effects on femoral bone volume in rats (see Figure 25)

 Effect on the volume of the single-labeled femur in rats (see Figure 26)

 Effect on the volume of the double-labeled femur in rats (see Figure 27)

 The effect of the volume ratio of single and double markers on the femur of rats (see Figure 28)

 Effects on the femoral bone mass in rats (see Figure 29)

Effects on the femur bone width in rats (see Figure 30) Effects on the femoral absorption surface area of rats (see Figure 31)

 Effects on fecal mineralization rate in rats (see Figure 32)

 Effects on femoral mineralization time in rats (see Figure 33)

 The effect of femoral bone reconstruction time in rats (see Figure 34). The above results show that the mechanical indexes of the castration group are significantly reduced, while the structural mechanics and material mechanics indexes of the PTHrPl-86 and PTHrPl-141 groups are significantly increased, indicating that PTHrPl -86 and PTHrPl-141 can improve the mechanical properties of bone, high flexural strength, enhanced resistance to deformation, increased toughness and reduced brittleness. It is not easy to break. It is proved that PTHrPl-86 and PTHrPl-141 can effectively improve the anti-fracture ability of bone and have certain curative effect on the treatment and prevention of osteoporosis.

 The experimental results confirmed that PTHrPl-86 and PTHrPl-141 can accelerate bone turnover, promote new bone formation, improve bone mechanical properties, have high flexural strength, enhanced resistance to deformation, increased toughness, reduced brittleness, and are less prone to fracture. It is proved that PTHrPl-86 can effectively improve the anti-fracture ability of bone and has certain curative effect on the treatment and prevention of osteoporosis. At the same time, it is proved that the method of the animal is effective, and the therapeutic effect of PTHrPl-86 on osteoporosis can be well determined. references

 1. Burtis WJ, Brady TG, Orlof JJ, et al. Immunochemical characterization of circulating parathyroid hormone-related protein in patients with humoral hypercalcemia of cancer. N Engl J Med. 1990; 322: 1 106-1 112

 2. Stewart AF. Hypercalcemia associated with cancer. N Engl J Med. 2005; 352:373-379

3. Strewler GJ, Williams RD, Nissenson RA. Human renal carcinoma cells produce hypercalcemia in the nude mouse and a novel protein recognized by parathyroid hormone receptors. J Clin Invest . 19^ ; 71 :769-774

4. Stewart AF, Insogna KL, Goltzman D, et al. Identification of adenylate cyclase-stimulating activity and cytochemical glucose-6-phosphate dehydrogenase-stimulating activity in extracts of tumors from patients with humoral hypercalcemia of malignancy. Proc Natl Acad Sci USA. 1983; 80: 1 454-1 458

5. Suva LJ, Winslow GA, Wettenliall RE, et al, A parathyroid hormone-related protein implicated in malignant hypercalcemia: cloning and expression. Science. 1987; 237:893-896

Philbrick WM, Wysolmerski JJ, Galbraith S et al Defining the roles of parathyroid hormone-related protein in normal physiology. Physiology. 1996; 76: 127-173

Strewler GJ. Mechanisms of Disease: The Physiology of Parathyroid Hormone-Related Protein. N Engl J Med 2000; 342: 177-185

Martin TJ ₅ Moseley JM, Williams ED. Parathyroid hormone-related protein: hormone and cytokine. J Endocrinol Λ99Ί 154:S23-S37

Karaplis AC, Luz A, Glowacki J, et al. Lethal skeletal dysplasia from targeted disruption of the parathyroid hormone-related peptide gene. Genes Dev.1994; 8:277-289 Soegiarto DW, Kiachopoulos S, Schipani E, et al. Partial Rescue of PTH/PTHrP receptor knockout mice by targeted expression of the Jansen transgene. Endocrinology, 2001 ; 142:5 303-5 310

Jans DA, Thomas RJ, Gillespie MT. Parathyroid hormone-related protein (PTHrP): a nucleocytoplasmic shuttling protein with distinct paracrine and intracrine roles. Vitam Horm. 2003; 66:345-384

Orloff JJ, Reddy D, de Papp AE, et al. Parathyroid hormone-related protein as a prohormone: posttranslational processing and receptor interactions. Endocr Rev. 1994; 15:40-60

Marguerite M, Andrew CW ₅ Barbara ED, et al. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy. Proc Natl Acad Sci USA, 1988; 85 : 597-601

Yasuda T, Banville D, Hendy GN et al. Characterization of the human parathyroid hormone-like peptide gene: functional and evolutionary aspects. J Biol Chem. 1989; 264: 7 720-7 725

Clemens TL, Cormier Sarah, Eichinger A, et al. Parathyroid hormone-related protein and its receptors: nuclear functions and roles in the renal and cardiovascular systems, the placental trophoblasts and the pancreatic islets. Br J Pharmacol. 2001 ; 134: 1 113 -1 136

Wu TL, Vasavada RC, Yang K, et al. Structural and physiologic characterization of the mid-region secretory species of parathyroid hormone-related protein. J Biol Chem, 1996; 271 : 24 371 - 24 381

 17. Plawner LL, Philbrick WM, Burtis WJ, et al. Cell type-specific secretion of parathyroid hormone-related protein via the regulated versus the constitutive secretory pathway. J Biol Chem, 1995; 270: 14 078 - 14 084

18. Orloff JJ, Kats Y, Urena P, et al. Further evidence for a novel receptor for amino-terminal parathyroid hormone-related protein on keratinocytes and squamous carcinoma cell lines. Endocrinology. 1995; 136: 3 016 a 3 023

 19. Juppner H, Abou-Samra AB, Freeman M, et al. A G protein-linked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science. 1991 ; 254: 1024-1026

 20. Abou-Samra A, Juppner H, Force T, et aL Expression cloning of a common receptor for parathyroid hormone and parathyroid hormone-related peptide from peptide osteoblast-like cells: a single receptor stimulates intracellular accumulation of both camp and inositol trisphosphates and Increase intracellular free calcium. Natl Acad Sci USA. 1992; 89: 2732-2736

 21. Marmstadt M, Juppner H, Gardella TJ. Receptors for PTH and PTHrP: their biological importance and functional properties. Am J Physiol. 1999; 277: F665-75

2. Valln A, Guillen C, Esbrit P. C-terminal parathyroid hormone-related protein (PTHrP) (107-139) stimulates intracellular Ca ²⁺ through a receptor different from the type 1 PTH PTHrP receptor in osteoblastic osteosarcoma UMR 106 cells. Endocrinology 2QQl

142: 2 752 - 2 759

 3. Kovacs CS, Chafe LL, Fudge NJ, et al PTH regulates fetal blood calcium and skeletal mineralization independently of PTHrP. Endocrinology. 2001 ; 142: 4 983 - 4 993 4. Massfelder T, Parekh N, Endlich K, et al. Effect of intrarenally infused parathyroid hormone-related protein on renal blood flow and glomerular filtration rate in the anaesthetized rat. Br J Pharmacol 1996; 118: 1 995-2 000

 5. Caverzasio J, Bonjour JP. Characteristics and regulation of Pi transport in osteogenic cells for bone metabolism. Kidney Int. 1996; 49: 975-980

6. Massfelder T, Saussine C, Simeoni U, et al. Evidence for adenylyl cyclase-dependent receptors for parathyroid hormone (PTH)-related protein in rabbit kidney glomeruli. Life Sci. 1993; 53: 875-881

27. Massfelder T, Stewart AF ₃ Endlich N, et ah Parathyroid hormone-related protein detection and ineraction with NO and cyclic AMP in the renovascular system. Kidney Int, 1996; 50: 1 591-1 603

28. Saussine C, Massfelder T, Parnin F, et al. Renin stimulating properties of parathyroid hormone-related peptide in the isolated perfused rat kidney. Kidney Int. 1993; 44: 764-773

 29. Massfelder T, Dann P, Wu TL et al. Opposing mitogenic and anti-mitogenic actions of parathyroid hormone-related protein in vascular smooth muscle cells: a critical role for nuclear targeting. Proc Natl Acad Sci USA. 1997; 94: 13 630-13 635

 30. Pirola CJ, Wang HM, Kamyar A, et al. Angiotensin II regulates parathyroid hormone-related protein expression in cultured rat aortic smooth muscle cells through transcriptional and post-transcriptional mechanisms. J, Biol. Chem. 1993; 268: 1 987 -1 994

31. Steers WD, Broder SR, Persson K, et al. Mechanical stretch increases secretion of parathyroid hormone-related protein by cultured bladder smooth muscle cell. J. UroL 1998; 160: 908-912

 32. Maeda S, Sutliff RL, Qian J, et al. Targeted overexpression of parathyroid hormone-related protein (PTHrp) to vascular smooth muscle in transgenic mice lowers blood pressure and alters cascular contractility. Endocrinology. 1999; 140: 1 815-1 825

33. Massfelder T, Fiaschi-taesch N, Stewart AF, et al. parathyroid hormone-related peptide- a smooth muscle tone and proliferation regulatory protein. Curr. Opin. Nephrol. Hypertens, 1998; 7: 27-32

 34. Wolzt M, Schmetterer L, Dorner G, et aL hemodynamic effects of Parathyroid hormone-related peptide (1-34) in human. J Clin Endocrinol Metab. 1997; 82: 2 548-2

551

 35. Gaich G, Orloff J J, Atillasoy EJ, et al, Amino-terminal Parathyroid hormone-related protein: specific binding and cytosolic calcium responses in rat insulinoma cell. Endocrinology. 1993; 132: 1 402-1 409

36. Porter SE, Sorenson RL, Dann P, et al. Progressive pancreatic islet hyperplasia in the Islet- targeted, Parathyroid hormone - related protein-overexpressing mouse. Endocrinology. 1998; 139: 3 743-3 751

 37. Vasavada RC, Garcia-ocana A, Zawalich WS et al. Targeted expression of placental lactogen in the beta cells of transgenic mice results in beta cell proliferation, islet mass augmentation, and hypoglycaemia. J Biol Chem. 2000; 275: 15 399 -15 406

38. Lahiri DK, Schnabei B. DNA isolation by a rapid method from human blood samples: effect of MgCl2 ₃ EDTA, storage time and temperature on DNA yield and quality. Biochem genet. 1993; 31 :321-325

 39. Lu Shengdong, Editor-in-Chief, Modern Molecular Biology Experiment Technology (Second Edition). China Union Medical University Press. 1999 40. Huang Peitang Translation, Guide to Molecular Cloning (Third Edition). Science Press. 2002

 41. Yan Ziying, Wang Hailin Trans. A Guide to the Editing of Molecular Biology. Science Press. 1999

 42. Guo Junjun. Protein Electrophoresis Technology. Science Press. 1999

 43. Shen Guan, Zhou Qilin, editor. Modern Immunology Test Technology (Second Edition), Hubei Science and Technology Press. 2002.

44. Thorikay M, Kramer S, Reynolds FH, et al. Synthesis of a gene encoding parathyroid hormone-like peptide- (1-141): purification and biological characterization of the expressed protein. Endocrinology. 1989; 124: 111-118

 45. Hammonds RG, Jr, McKay P, et al. Purification and characterization of recombinant human parathyroid hormone-related protein. J Biol Chem. 1989; 264: 14 806-14 811

46. Smith PK, Krohn RL Measurement of protein using bicinchoninic acid. Anal Biochem.

 1985; 150:76

 47. Situ Zhenqiang, Editor-in-Chief Wu Junzheng. Cell Culture. World Book Publishing House, 1996

 48. Rian E, Jemtland R, Olstad OK, et al Synthesis of human parathyroid-hormone-related protein (1 -141) in Saccharomyces cerevisiae. A correct amino-terminal processing vital for the hormone's biological activity is obtained by an ubiquitin fusion protein Approach. Eur J Biochem, 1993; 213: 641-648

 49. Shatzman AR. Expression systems. Cum Opin. Biotechnol 1995; 6: 491-493

 50. Makrides SC. Strategies for achieving high-level expression of genes in Escherichia coli. Microbiol Rev. 1996;60:512-538

51. Gold, L. Expression of heterologous proteins in Escherichia coli. Methods EnzymoL 1990; 185: 11-14 Gu J, Stephenson CG, and ladarola MJ. Recombinant proteins attached to a Ni-NTA column: Use in affinity purification of antibodies. Biotechniques.1994; 17:257-262 Janknecht R, de Martynoff G, Lou J, et al. Rapid And efficient purification of native histidine-tagged protein expressed by recombinant vaccinia virus. Proc Natl Acad Sci C/ & 4. 1991 ; 88: 8 972-8 976

Thorikay M, Kramer S, Reynolds FH, et al. Synthesis of a gene encoding parathyroid hormone-like protein- (1-141): purification and biological characterization of the expressed protein. Endocrinology. 1989; 124: 111-118

Zhang Wenyi. Construction of a highly efficient expression system for genetically engineered parathyroid hormone (PTH) and its therapeutic effect on PTH in an animal model of osteoporosis. Tianjin Medical University PhD thesis. 2001

Chen Kai. Cloning and expression of the coding sequence of parathyroid hormone-related peptides (1-141 and 1-86). Tianjin Medical University Master's Thesis. 2004

Lu Bangchao, Wang Jian, Zhao Ming et al. Effects of amylin on bone biomechanical properties in rats with glucocorticoid osteoporosis. BULLETIN OF MEDICAL POSTGRADUATE, 2006, Volume 19, Issue 10.

Mo Meiying, Huang Lianfang, Leng Yang et al. Morphometry of bone tissue to observe the effects of low calcium and low protein diet on rat bone. Chinese Journal of Clinical Nutrition, 2002, 04

Wang Xueqian. Osteoporosis and Osteoarthrosis Volume - Test and Clinical Diagnosis. June 2006

Claims

Rights request

I. A parathyroid hormone-related protein, the amino acid sequence comprising the sequence shown in SEQ ID NO: 8, or comprising the sequence represented by SEQ ID NO: 8 by conservative substitution, deletion, addition of one or more amino acids The resulting amino acid sequence.

 The parathyroid hormone-related protein according to claim 1, which has the amino acid sequence of SEQ ID NO: 8.

 3. A nucleotide sequence encoding the parathyroid hormone-related protein of claim 1 or 2.

 The nucleotide sequence according to claim 3, which comprises the sequence shown in SEQ ID NO: 7, or a sequence which hybridizes to the sequence shown in SEQ ID NO: 7 under stringent hybridization conditions.

 The nucleotide sequence of claim 4 which is the sequence of SEQ ID NO: 7.

 6. A vector comprising the nucleotide sequence of claim 4 or 5 jf.

 7. A host cell comprising the vector of claim 6.

 8. The host cell of claim 7, which is Pichia pastoris Pkhia pastoris or Escherichia coli.

 9. The use of a human parathyroid hormone-related protein for the preparation of a medicament for the treatment of osteoporosis, wherein the human parathyroid hormone-related protein is selected from the human parathyroid hormone-related protein according to claim 1 or 2. Or a human parathyroid hormone-related protein 1-141 having the sequence of SEQ ID NO: 3.

 10. A method of treating osteoporosis, comprising administering to a patient a therapeutically effective amount of a human parathyroid hormone-related protein, wherein said human parathyroid hormone-related protein is selected from the group consisting of claim 1 or 2. Human parathyroid hormone-related protein, or human parathyroid hormone-related protein 1-141 having the sequence of SEQ ID NO: 3.

 II. A kit for treating osteoporosis, comprising a therapeutically effective amount of a human parathyroid hormone-related protein, wherein the human parathyroid hormone-related protein is selected from the human parathyroid gland according to claim 1 or 2. A related protein, or a human parathyroid hormone-related protein 1-141 having the sequence of SEQ ID NO: 3.