KR20120052841A

KR20120052841A - A vaccine composition against porcine e. coli diarrhea

Info

Publication number: KR20120052841A
Application number: KR1020100140342A
Authority: KR
Inventors: 황철호
Original assignee: 단국대학교 산학협력단
Priority date: 2010-11-16
Filing date: 2010-12-31
Publication date: 2012-05-24
Also published as: KR101263099B1

Abstract

PURPOSE: A vaccine composition for treating E.coli diarrhea in a pig is provided to prevent K88ac infection and to effectively induce antibody formation. CONSTITUTION: A transformant is prepared by transforming a recombinant vector containing a gene in which fused with a signal peptide, mucosal immune adjuvant, and pilin antigen. The mucosal immune adjuvant is CTB(cholera toxin B subunit). The fused gene is a gene encoding amino acid sequence of sequence number 33. The transformant is Agrobacterium, E.coli, or plant cells.

Description

A vaccine composition against porcine E. coli diarrhea

본 발명은 시그널 펩타이드(signal peptide), 점막면역보조제 및 필린(pilin) 항원이 융합된 유전자를 포함하는 재조합 벡터, 상기 제조합 벡터로 형질전환된 형질전환체, 상기 형질전환체를 포함하는 돼지 대장균 설사증의 백신 조성물, 이의 제조방법 및 돼지 대장균 설사증의 치료방법에 관한 것이다. The present invention provides a recombinant vector comprising a gene in which a signal peptide, a mucosal immune adjuvant, and a pilin antigen are fused, a transformant transformed with the prepared vector, and porcine E. coli including the transformant. The present invention relates to a vaccine composition for diarrhea, a method for preparing the same, and a method for treating swine E. coli diarrhea.

대장균의 감염에 의한 설사증은 병원성 대장균이 주로 오염된 사료나 물 등을 통한 경구감염에 의해 전파되며, 신생자돈에 있어서는 분변을 통한 감염이나 어미의 유두를 통한 감염이 주경로이다. 병원성 대장균은 장관벽에 부착하여 증식한다. 이때 질병을 일으키게 되는 중요한 두 가지 인자가 관련되는데, 그것은 집락형성 인자(colonization factor)와 독소(toxin) 생성 여부이다. 집락형성 인자는 대장균이 소장 점막에 부착하는데 중요한 역할을 하는 것으로 균체 밖으로 돌출된 단백질로 이루어진 작은 머리털 같은 구조를 이루며 필러스(pilus) 또는 섬모(fimbriae)라고 알려져 있다. 대장균 균체 외부에 돌출된 필러스 또는 섬모를 통해 장관 벽에 부착된 대장균은 장관 내에서 증식하며 여러 가지 독소를 생산한다. 돼지 설사증을 유발하는 대장균은 그 항원성에 따라 혈청형(serotype)이 나뉘어지는데, 그것들은 각각 O(somatic), K(capsular or microcapsular), H(flagellar) 및 F(fimbrial)이다. 국내에서 발생하는 돼지 대장균 설사증 중 가장 기본적인 발병 원인균들은 K 항원성으로 알려져 있다(박최규, 김노미 (1997) 국내 돼지 질병 역학조사 및 방제기술 연구; 자돈설사병 발생상황 조사 연구, 농촌진흥청수의과학 연구소, pp.72?78). K 항원성의 대표적인 대장균은 장독성 대장균(Enterotoxigenic Escherichia coli; ETEC)으로서 필린(pilin)이라는 특이적 표면 항원(surface antigen)을 가지고 있어 이를 통해 숙주세포의 장 점막 표면 수용체에 특이적으로 결합한 후 장독소(enterotoxin)를 분비함으로써 설사를 유발한다(Mooi FR et al., J. Bact. 150:512-52118, 1982). 상기 필린은 병원균의 집단화를 용이하게 해준다.
Diarrhea caused by E. coli infection is spread by oral infection through pathogenic E. coli contaminated feed or water. In newborn piglets, infection through feces or infection of the mother's nipple is the main route. Escherichia coli multiply by attaching to the intestinal wall. Two important factors that cause disease are related, namely, colonization factor and toxin production. Colony forming factors play an important role in E. coli adhesion to the small intestinal mucosa. They form a small hair-like structure composed of proteins protruding out of the cells and are known as pilus or fimbriae. Escherichia coli attached to the intestinal wall through a filament or cilia protruding outside the E. coli cells grows in the intestine and produces various toxins. E. coli, which causes swine diarrhea, is divided into serotypes according to its antigenicity, which are O (somatic), K (capsular or microcapsular), H (flagellar), and F (fimbrial), respectively. The most common pathogens of swine E. coli diarrhea occurring in Korea are known to be K antigenic (Park, Choi-Kyu, Kim, Nomi (1997). .72? 78). The representative E. coli K antigen is Enterotoxigenic Escherichia coli (ETEC), which has a specific surface antigen called pilin, which specifically binds to the intestinal mucosal surface receptors of the host cell and then enters the toxin. diarrhea is caused by the secretion of enterotoxin (Mooi FR et al., J. Bact. 150: 512-52118, 1982). The filins facilitate the grouping of pathogens.

한편, 항생제는 미생물에 의해 생성되는 가용성 유기물질로서 다른 미생물의 성장을 억제, 파괴하는 물질이다. 원래 미생물에서만 생산되었으나 현재는 공업적으로 생산되는 화합물도 항생제 작용을 나타낸다. 이러한 항생제는 병원균을 억제하기 위한 의학 및 수의학적 목적으로 개발되었으나 동물의 성장 촉진 및 사료효율 개선효과도 인정되어 사료첨가제로 사용되기도 한다(Sarmah 2006). Meanwhile, antibiotics are soluble organic substances produced by microorganisms and are substances that inhibit and destroy the growth of other microorganisms. Originally produced only by microorganisms, now industrially produced compounds also exhibit antibiotic action. These antibiotics have been developed for medical and veterinary purposes to suppress pathogens, but they are also used as feed additives because they are recognized for promoting animal growth and improving feed efficiency (Sarmah 2006).

양돈 산업에 있어서 항생제의 사용은 성장률 개선 이외에도 어린 돼지의 폐사율을 감소시키는 효과와 위생상태가 불량한 환경에서 자돈 폐사율 감소 효과로 인해 사육밀도가 높은 농장일수록 사용 효과가 크게 나타난다. 그러나 가축에 대한 무분별한 항생제의 사용으로 항생제 잔류물, 세균의 내성 증가 및 동물에서 사람으로 세균의 내성 전이 등 인체에 미치는 안전문제가 제기됨에 따라 전세계적으로 가축에 대한 사료첨가제용 항생제 사용이 금지되고 있는 추세이다. In the swine industry, the use of antibiotics increases the mortality rate of young pigs in addition to improving the growth rate, and in farms with higher densities due to the lower mortality rate in poor hygiene. However, the use of indiscriminate antibiotics on livestock raises safety concerns on humans such as antibiotic residues, increased bacterial resistance and the transfer of bacterial resistance from animals to humans. There is a trend.

최근 미국 FDA에서 가축 성장을 촉진하는 항생제에 한해 제한을 권고하고 인체에 영향을 줄 수 있는 강력한 항생제에 관해서는 금지 법안검토 중이다. 국내에서도 2011년 7월부터 사료에서의 항생제 첨가가 전면 금지됨에 따라 인체에 무해하고 성장효율이 우수한 사료첨가제의 개발이 시급한 실정이다. The US FDA recently recommends restrictions on antibiotics that promote livestock growth and is reviewing bans on potent antibiotics that could affect the human body. In Korea, the addition of antibiotics in feeds has been banned since July 2011. Therefore, it is urgent to develop feed additives that are harmless to humans and have excellent growth efficiency.

또한 양돈농가의 항생제 사용은 경제적인 손실을 초래하는 자돈의 전염성 질환인 소화기나 호흡기 계통의 질병들을 예방 및 치료하기 위하여 주로 사용되어진다. 현재 항생제외 개발된 백신주사들은 소화기나 호흡기 계통 질병들을 효과적으로 방어할 수 있는 점막면역체계를 유도할 수 없어 그 효용성이 떨어져 현재 새로운 백신 개발의 필요성이 대두되고 있다. 소화기나 호흡기 계통의 질병 발병 장소인 점막은 피부의 약 200배 면적으로 몸에서 가장 외부로 수많은 병원균에 노출되어 있으면서 많은 항체들을 만들기 위하여 림포사이트(Lymphocytes)(B 세포 및 T 세포)가 systemic immunity 3배에 해당하는 양를 보유하고 있다. 특히 사람의 장에서 분비하는 IgA는 1 kg당 40 mg으로 IgG의 두 배에 해당된다(Conley et al., 1987). 이러한 강력한 면역시스템을 가지고 있지만 수많은 단백질과 병원균에 노출되어 있어 면역관용상태에 도달되어 면역 시스템을 가동하기가 쉽지 않다(Mowat and Weiner, 1999). 그러나 점막면역체계는 장내 면역체계가 자극을 받아 항체가 형성되면 해당 항원에 대한 항체가 유선 내 면역체계에도 발생되는 등 유기적으로 연결되어 있어 그 활용성이 크다(Haneberg et al., 1994). 이러한 점막면역시스템을 효과적으로 가동시키는 백신으로 현재 식물경구백신이 주목 받고 있다. 생독백신과 사독백신은 병원체를 약화시키거나 죽인 것으로 적절한 접종을 시행하지 못할 경우 부작용이 나타날 수 있다. 재조합백신은 유전적으로 조작된 박테리아, 효모 또는 포유류의 세포에서 병원균의 항원성을 갖는 유전자를 분리하여 발현시킨 것을 백신으로 사용하는 것이다. 대장균에서 생산된 재조합 백신의 경우 병원체 오염의 배제와 저렴한 대량 생산비용의 이점이 있으나 동식물 단백질의 경우 대장균과의 번역 후 변형체계의 차이로 인해 면역성이 저하되기도 하며, 재조합 대장균 백신의 경구 투여 시 장의 비우호적 조건에 의해 단백질이 파괴되기도 한다(Amanda and Charles 2000; Tacket 2005). 식물과 같은 고등생물의 단백질 발현 체계를 이용할 경우 면역성 저하 문제나 장의 비우호적 조건을 회피할 수 있다(Kong 2001; Youm 2007).
In addition, the use of antibiotics by pig farmers is mainly used to prevent and treat diseases of the digestive or respiratory system, which are infectious diseases of piglets that cause economic losses. Currently, vaccine injections developed for antibiotics cannot induce a mucosal immune system that can effectively protect against digestive or respiratory diseases. The mucous membrane, which is the place of disease of the digestive or respiratory system, is about 200 times the area of the skin and is exposed to numerous pathogens from the outside of the body. It has the equivalent of a ship. In particular, the human gut secreted IgA is 40 mg / kg, twice that of IgG (Conley et al., 1987). Although it has such a strong immune system, it is exposed to numerous proteins and pathogens, making it difficult to operate the immune system by reaching an immune tolerance (Mowat and Weiner, 1999). However, mucosal immunity system is highly useful because the intestinal immune system is stimulated and antibodies are formed, and the antibody to the antigen is also generated in the immune system in the mammary gland (Haneberg et al., 1994). Phyto-oral vaccines are attracting attention as vaccines that effectively operate the mucosal immune system. Live and dead vaccines are attenuated or killed by pathogens and can cause side effects if proper inoculation is not given. Recombinant vaccine is a vaccine that isolates and expresses a gene having an antigenicity of a pathogen in cells of genetically engineered bacteria, yeasts or mammals. Recombinant vaccines produced by E. coli have the advantages of eliminating pathogen contamination and low cost of mass production. However, animal and plant proteins may be less immune due to differences in post-translational modifications with E. coli. Proteins are also destroyed by unfriendly conditions (Amanda and Charles 2000; Tacket 2005). Higher organism protein expression systems, such as plants, can be used to circumvent immunity deprivation problems and intestinal unfriendly conditions (Kong 2001; Youm 2007).

이러한 배경 하에 본 발명자들은 필린(pilin) 항원에 점막면역보조제인 콜레라 톡신(cholera toxin)의 비독성 부분인 B 하단위 유전자 및 저온관련 유전자인 CLP(chitinase like protein)의 시그널 펩타이드(signal peptide)를 융합하여 상기 융합 유전자를 발현하는 형질전환체를 개발하고, 상기 형질전환체를 최적화된 조건으로 기내 배양하였으며, 상기 기내 배양된 형질전환체가 포함된 백신 조성물을 돼지에 경구 투여시 기존에 사용되는 재조합 백신보다 돼지 대장균 설사증의 예방 및 치료 효과가 우수함을 확인함으로써 본 발명을 완성하기에 이르렀다.
Against this background, the present inventors have applied the signal peptide of the B subunit gene, which is a non-toxic part of cholera toxin, which is a mucosal immune adjuvant, and the signal peptide of CLP (chitinase like protein), which is a low temperature related gene, to the pilin antigen. The transformants expressing the fusion gene by fusion were developed, the transformants were cultured in-flight under optimized conditions, and the recombinants used in the oral administration of the vaccine composition containing the incubated transformants to swine were used. The present invention was completed by confirming that the vaccine prevents and treats E. coli diarrhea better.

본 발명의 목적은 돼지 대장균 설사증에 대한 백신으로 사용될 수 있는 형질전환체를 제공하는 것이다. It is an object of the present invention to provide a transformant which can be used as a vaccine against porcine E. coli diarrhea.

본 발명의 다른 목적은 돼지 대장균 설사증에 대한 백신으로 사용될 수 있는 형질전환체에 도입될 재조합 벡터를 제공하는 것이다. Another object of the present invention is to provide a recombinant vector to be introduced into a transformant that can be used as a vaccine against swine E. coli diarrhea.

본 발명의 또 다른 목적은 상기 형질전환체, 상기 형질전환체의 단백질 추출물 또는 상기 형질전환체로부터 분리된 재조합 단백질을 포함하는 돼지 대장균 설사증 백신 조성물을 제공하는 것이다. Still another object of the present invention is to provide a swine Escherichia coli diarrhea vaccine composition comprising the transformant, the protein extract of the transformant or the recombinant protein isolated from the transformant.

본 발명의 또 다른 목적은 상기 형질전환체, 상기 형질전환체의 단백질 추출물 또는 상기 형질전환체로부터 분리된 재조합 단백질을 포함하는 돼지 대장균 설사증의 예방 또는 치료용 사료 조성물 및 사료 첨가제를 제공하는 것이다. Still another object of the present invention is to provide a feed composition and feed additive for preventing or treating swine E. coli diarrhea comprising the transformant, the protein extract of the transformant or the recombinant protein isolated from the transformant.

본 발명의 또 다른 목적은 상기 백신 조성물, 사료 조성물 또는 사료 첨가제를 돼지에 경구투여하여 돼지 대장균 설사증을 예방 또는 치료하는 방법을 제공하는 것이다. Still another object of the present invention is to provide a method for preventing or treating swine E. coli diarrhea by orally administering the vaccine composition, feed composition or feed additive to pigs.

본 발명의 또 다른 목적은 시그널 펩타이드, 점막면역보조제 및 필린 항원이 융합된 돼지 대장균 설사증 백신의 제조방법을 제공하는 것이다.
Still another object of the present invention is to provide a method for producing swine E. coli diarrhea vaccine in which a signal peptide, a mucosal immune adjuvant, and a filin antigen are fused.

상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 점막면역보조제 및 필린(pilin) 항원이 융합된 유전자를 포함하는 재조합 벡터로 형질전환된 형질전환체에 관한 것이다. 또한 본 발명은 시그널 펩타이드(signal peptide), 점막면역보조제 및 필린(pilin) 항원이 융합된 유전자를 포함하는 재조합 벡터로 형질전환된 형질전환체에 관한 것이다.
As one aspect for achieving the above object, the present invention relates to a transformant transformed with a recombinant vector comprising a gene fused to a mucosal immune adjuvant and pilin (pilin) antigen. The present invention also relates to a transformant transformed with a recombinant vector comprising a gene fused to a signal peptide, a mucosal immune adjuvant and a pilin antigen.

다른 양태로서 본 발명은 점막면역보조제 및 필린 항원이 융합된 유전자를 포함하는 재조합 벡터에 관한 것이다. 또한 시그널 펩타이드, 점막면역보조제 및 필린 항원이 융합된 유전자를 포함하는 재조합 벡터에 관한 것이다.
In another aspect, the present invention relates to a recombinant vector comprising a gene fused with a mucosal immune adjuvant and a pilin antigen. It also relates to a recombinant vector comprising a gene fused to a signal peptide, mucosal immune adjuvant and filin antigen.

본 발명에서 용어 “시그널 펩타이드(signal peptide)" 는 분비 단백질이나 막단백질의 N 말단에 위치하며, 단백질이 막을 통과할 때 신호가 되는 아미노산을 의미한다. 본 발명의 상기 시그널 펩타이드는 세포 밖 공간에 축적되는 저온관련 유전자인 CLP(chitinase like protein)의 시그널 펩타이드가 바람직하며, 점막 면역보조제 항원 앞에 융합되어 아포프라스트(apoplastic)로 단백질을 이동시키는 시그널 펩타이드가 바람직하다. 더 바람직하게는 서열번호 25의 아미노산 서열로 구성된 것 또는 서열번호 26의 염기서열로 구성된 시그널 펩타이드이다. 본 발명의 일 실시예에서는 상기 시그널 펩타이드를 점막면역보조제와 필린 항원에 융합시켰을 때, 시판되는 돼지 대장균 설사증의 재조합 백신(Porcilis coli, Intervet Ltd)보다 설사증 예방 또는 치료효과가 우수함을 확인할 수 있었다(도 10). 상기 재조합 백신은 K-12 균주(strain) 유래 LT 톡소이드, 필린항원 및 오일(W/O) 보좌제로 구성된 백신 조성물이다. In the present invention, the term "signal peptide" refers to an amino acid which is located at the N terminus of a secreted protein or membrane protein and is a signal when the protein passes through the membrane. Preferred is a signal peptide of CLP (chitinase like protein), which accumulates at low temperature, and preferably a signal peptide that is fused in front of mucosal adjuvant antigen to transfer the protein to apoplasts. Or a signal peptide consisting of the nucleotide sequence of SEQ ID NO: 26. In an embodiment of the present invention, when the signal peptide was fused to a mucosal immune adjuvant and filin antigen, it was confirmed that the prevention or treatment of diarrhea was superior to commercially available recombinant vaccine of porcine E. coli diarrhea (Porcilis coli, Intervet Ltd) ( 10). The recombinant vaccine is a vaccine composition consisting of a K-12 strain derived LT toxoid, filin antigen and an oil (W / O) adjuvant.

본 발명에서 용어“점막면역보조제”는 점막 면역을 증강시키는 면역 보조제를 의미하며, 그 예로는 CTB(Cholera toxin subunit B, CTB), LTB(Heat-Labile Toxin B subunit), 식물 독소인 ricin toxin B [ricinus communis A-B dimeric toxin B subuit (RTB)]가 있으며, 그 종류는 제한되지 않는다. As used herein, the term “mucosa immunity adjuvant” refers to an adjuvant that enhances mucosal immunity. Examples include CTB (Cholera toxin subunit B, CTB), LTB (Heat-Labile Toxin B subunit), and plant toxin ricin toxin B. [ricinus communis AB dimeric toxin B subuit (RTB)], but its kind is not limited.

바람직하게는, 본 발명의 점막면역보조제는 콜레라 톡신(Cholera toxin)이며, 더 바람직하게는 콜레라 톡신 서브유닛 B(Cholera toxin subunit B, CTB)이다. 상기 점막면역시스템의 문지기 역할을 하는 M 세포를 겨냥하는 점막면역보조제인 콜레라 독소 B 하단위 단백질인 "CTB(cholera toxin B subunit)"의 예로는 진뱅크 수탁번호(GenBank accesion No.) AF409120에 기재된 단백질을 들 수 있으며, 그 "변이형"이란 상기 CTB 단백질에 하나 이상의 아미노산의 치환, 결실 또는 삽입을 일으킨 단백질로서, GM₁ 갱글리오사이드(ganglioside)에 대한 결합 활성을 야생형 대비 50% 이상 유지하는 단백질로 정의된다. 가장 바람직하게는 서열번호 27의 아미노산 서열로 구성되거나 서열번호 28의 염기서열을 갖는 CTB이다. Preferably, the mucosal immune adjuvant of the present invention is cholera toxin, more preferably cholera toxin subunit B (CTB). An example of the cholera toxin B subunit (CTB), which is a mucosal immune adjuvant targeting M cells serving as a gatekeeper of the mucosal immune system, is described in GenBank accesion No. AF409120. The term “variant” refers to a protein that causes substitution, deletion or insertion of one or more amino acids into the CTB protein, which maintains at least 50% of the binding activity for GM ₁ ganglioside compared to the wild type. Defined as protein. Most preferably it is a CTB consisting of the amino acid sequence of SEQ ID NO: 27 or having a nucleotide sequence of SEQ ID NO: 28.

본 발명에서 용어 “필린(pilin) 항원”은 돼지 대장균 설사증을 유발하는 항원으로서, 장독성 대장균(Enterotoxigenic Escherichia coli; ETEC)의 특이적 표면 항원(surface antigen)을 의미한다. 상기 필린 항원은 숙주세포의 장 점막 표면 수용체에 특이적으로 결합한 후 장독소(enterotoxin)를 분비함으로써 설사를 유발한다(Mooi FR et al., J. Bact. 150:512-52118, 1982). 본 발명에서 점막면역보조제 및 시그널 펩타이드와 융합되는 필린 항원은 서열번호 29의 아미노산 서열로 구성되거나 서열번호 30의 염기서열을 갖는 것이 바람직하다. As used herein, the term “pilin antigen” refers to a specific surface antigen of E. coli (Enterotoxigenic Escherichia coli; ETEC). The filin antigen specifically binds to the intestinal mucosal surface receptors of host cells and induces diarrhea by secreting enterotoxin (Mooi FR et al., J. Bact. 150: 512-52118, 1982). In the present invention, the phyllin antigen fused with a mucosal immune adjuvant and a signal peptide is preferably composed of the amino acid sequence of SEQ ID NO: 29 or has a nucleotide sequence of SEQ ID NO: 30.

본 발명에서 용어 "벡터"는 숙주 세포로 염기의 클로닝 및/또는 전이를 위한 임의의 매개물을 말한다. 벡터는 다른 DNA 단편이 결합하여 결합된 단편의 복제를 가져올 수 있는 복제단위(replicon)일 수 있다. "복제단위"란 생체 내에서 DNA 복제의 자가 유닛으로서 기능하는, 즉, 스스로의 조절에 의해 복제 가능한, 임의의 유전적 단위 (예를 들면, 플라스미드, 파지, 코스미드, 염색체, 바이러스)를 말한다. 용어 "벡터"는 시험관 내, 생체 외 또는 생체 내에서 숙주 세포로 염기를 도입하기 위한 바이러스 및 비 바이러스 매개물을 포함한다. 용어 "벡터"는 또한 미니구형 DNA를 포함할 수 있다. 예를 들면, 상기 벡터는 박테리아 DNA 서열을 갖지 않는 플라스미드일 수 있다. CpG 영역에서 풍부한 박테리아 DNA 서열의 제거는 전이유전자 발현 사일런싱을 감소시키고 플라스미드 DNA 벡터로부터 보다 지속적인 발현을 가져오기 위해 행해지고 있다. 용어 "벡터"는 또한 슬리핑 뷰티(Sleeping Beauty)같은 트랜스포존(Izsvak et al. J. MoI. Biol. 302:93-102 (2000)), 또는 인공 염색체를 포함할 수 있다. As used herein, the term "vector" refers to any medium for cloning and / or transferring bases to a host cell. The vector may be a replica that other DNA fragments can bind to and result in replication of the bound fragments. A "replicating unit" refers to any genetic unit (eg, plasmid, phage, cosmid, chromosome, virus) that functions as a self-unit of DNA replication in vivo, i.e., is capable of replicating by its own regulation. . The term "vector" includes viral and non-viral mediators for introducing bases into host cells in vitro, ex vivo or in vivo. The term "vector" may also include minispherical DNA. For example, the vector may be a plasmid that does not have a bacterial DNA sequence. Removal of bacterial DNA sequences enriched in the CpG region has been done to reduce transgene expression silencing and lead to more sustained expression from plasmid DNA vectors. The term “vector” may also include transposons (Szping, et al. J. MoI. Biol. 302: 93-102 (2000)), such as Sleeping Beauty, or artificial chromosomes.

본 발명의 상기 재조합 벡터에는 점막면역보조제인 CTB 및 필린 항원이 융합되어 포함될 수 있다. 바람직하게는 서열번호 31로 표시되는 아미노산을 암호화하는 유전자가 포함되는 것이다. 또는 서열번호 32로 표시되는 염기서열을 포함하는 유전자가 포함되는 것이다.The recombinant vector of the present invention may include a fusion of CTB and filin antigens, which are mucosal immune adjuvant. Preferably, the gene encoding the amino acid represented by SEQ ID NO: 31 is included. Or a gene comprising a nucleotide sequence represented by SEQ ID NO: 32.

또한 상기 재조합 벡터에는 시그널 펩타이드, 점막면역보조제인 CTB 및 필린 항원이 융합되어 포함될 수 있으며, 바람직하게는 서열번호 33로 표시되는 아미노산을 암호화하는 유전자가 포함되는 것이다. 또는 서열번호 34로 표시되는 염기서열을 포함하는 유전자가 포함되는 것이다. 또한 본 발명의 재조합 벡터에는 식물 발현용 프로모터 및 전사종결자가 작동가능하게 연결될 수 있다. 상기 "작동가능하게 연결된"은 일반적으로 기능을 수행하도록 염기 발현 조절 서열과 목적하는 단백질을 코딩하는 염기 서열이 작동 가능하게 연결되어 코딩하는 염기 서열의 발현에 영향을 미칠 수 있다. 재조합 벡터와의 작동가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있다. In addition, the recombinant vector may include a fusion of a signal peptide, a mucosal immune adjuvant CTB and a pilin antigen, and preferably includes a gene encoding an amino acid represented by SEQ ID NO: 33. Or a gene comprising a nucleotide sequence represented by SEQ ID NO: 34. In addition, the recombinant vector of the present invention can be operably linked to the promoter for plant expression and transcription terminator. Said "operably linked" may generally affect the expression of a base sequence that is operably linked to and encodes a base expression control sequence and a base sequence encoding a protein of interest to perform a function. Operable linkage with recombinant vectors can be made using genetic recombination techniques known in the art, and site-specific DNA cleavage and linkage can be made using cleavage and linking enzymes, and the like, in the art.

본 발명에서 용어, “형질전환”은 외부로부터 주어진 DNA에 의하여 생물의 유전적인 성질이 변하는 것으로, 즉 생물의 어떤 계통의 세포에서 추출된 핵산의 일종인 DNA를 다른 계통의 살아있는 세포의 주었을 때 DNA가 그 세포에 들어가서 유전형질이 변화하는 현상으로 형질변환? 형전환 또는 형변환 등이라고도 한다. In the present invention, the term “transformation” refers to a change in the genetic properties of an organism by DNA given from the outside, that is, when DNA is a kind of nucleic acid extracted from a cell of a certain organism, the DNA of a living cell of another strain Enters the cell and transforms it with a change in genotyping? Also called type conversion or type conversion.

본 발명에서 용어, “형질전환체”는 형질전환으로 인해 생성된 형질전환식물 또는 형질전환동물을 의미하며, 유전자 재조합 기술을 이용하여 특정 유전자의 변형 또는 변이가 유발되어 생성된 유전자재조합체를 포함한다. 바람직하게 본 발명의 형질전환체는 식물세포 유래의 형질전환체일 수 있다.As used herein, the term “transformer” refers to a transformed plant or a transgenic animal produced by transformation, and includes a genetic recombinant produced by modification or mutation of a specific gene using genetic recombination technology. do. Preferably, the transformant of the present invention may be a transformant derived from plant cells.

본 발명에서 용어, “식물세포”는 식물체를 구성하는 기본이 되는 단위로, 식물 조직의 배양 세포, 배양 조직, 배양기관 또는 전체 식물일 수 있으며, 바람직하게 배양 세포, 배양 조직 또는 배양 기관일 수 있고, 더욱 바람직하게는 배양 세포의 가능한 모든 형태일 수 있으며, 가장 바람직하게는 당근 유래의 세포일 수 있다.As used herein, the term “plant cell” is a basic unit constituting a plant, and may be cultured cells, culture tissues, culture organs or whole plants of plant tissue, preferably culture cells, culture tissues, or culture organs. And more preferably all possible forms of cultured cells, most preferably cells derived from carrots.

본 발명에서 용어, “식물 조직”은 분화된 또는 미분화된 식물의 조직, 예를 들면 이에 한정되진 않으나, 뿌리, 줄기, 잎, 꽃가루, 종자, 암 조직 및 배양에 이용되는 다양한 형태의 세포들, 즉 단일 세포, 원형질체(protoplast), 싹 및 캘러스 조직을 포함한다. 식물 조직은 인 플란타(in planta)이거나 기관 배양, 조직 배양 또는 세포 배양 상태일 수 있다.As used herein, the term “plant tissue” refers to tissues of differentiated or undifferentiated plants, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, Ie, single cells, protoplasts, shoots and callus tissue. The plant tissue may be in planta or in an organ culture, tissue culture or cell culture.

본 발명에서 용어, "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호화된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 상기 유전자는 변형된 것으로써 인위적인 수단에 의해 세포 내 재도입된 것이다. As used herein, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. Recombinant cells can also express genes found in natural cells, which are modified and reintroduced into cells by artificial means.

본 발명의 형질전환체는 당업계에 공지된 형질전환에 이용될 수 있는 세포이면 제한없이 당업자에 의해 적절하게 선택되어 사용될 수 있으며, 본 발명의 형질전환체는 아그로박테리움, 대장균 또는 형질전환 식물일 수 있고, 바람직하게 상기 형질전환체는 식물세포일 수 있으며, 더욱 바람직하게는 담배, 애기장대, 감자, 상추, 무, 배추, 토마토, 콩, 쌀, 보리, 밀, 옥수수 및 당근으로 이루어진 군으로부터 선택되는 것인 형질전환체 일 수 있다. The transformant of the present invention may be appropriately selected and used by those skilled in the art without limitation as long as the cell can be used for transformation known in the art, and the transformant of the present invention may be Agrobacterium, Escherichia coli or a transgenic plant. Preferably, the transformant may be a plant cell, more preferably a group consisting of tobacco, Arabidopsis, potato, lettuce, radish, Chinese cabbage, tomato, soybean, rice, barley, wheat, corn and carrot It may be a transformant is selected from.

본 발명의 일 실시예에서는 형질전환체를 기내 배양하면서 당근 캘러스, 미성숙 배 및 유식물의 항원 발현양을 측정하여 발달 단계에 따른 항원 발현양을 알아본 결과, 당근 캘러스에서 가장 많은 항원양이 함유되어 있는 것을 확인하고, 이를 돼지 대장균 설사증의 백신 및 사료 조성물로 사용하였다. 따라서 본 발명의 형질전환체는 CTB 및 필린 항원이 융합된 유전자가 도입된 당근 캘러스, 또는 시그널 펩타이드, CTB 및 필린 항원이 융합된 유전자가 도입된 당근 캘러스가 바람직하며, 보다 바람직하게는 상기 당근 캘러스가 0.1 내지 2ppm 범위의 2,4-D, 0.01 내지 0.2 ppm 범위의 키네틴(kinetin) 및 2 내지 4%(w/v)의 자당(sucrose)이 포함된 배지에서 기내배양된 것이다.
In one embodiment of the present invention, the antigen expression level according to the developmental stage by measuring the antigen expression amount of carrot callus, immature embryo and seedlings while culturing the transformant in-flight, containing the highest amount of antigen in carrot callus It was confirmed that this, and used as a vaccine and feed composition of swine E. coli diarrhea. Therefore, the transformant of the present invention is preferably a carrot callus into which a gene fused with CTB and pilin antigens is introduced, or a carrot callus into which a signal peptide, CTB and pilin antigens are fused, and more preferably the carrot callus. Is cultured in-flight in a medium containing 2,4-D in the range of 0.1 to 2 ppm, kinetin in the range of 0.01 to 0.2 ppm and sucrose of 2 to 4% (w / v).

또 다른 양태로서 본 발명은 본 발명의 형질전환체, 상기 형질전환체의 단백질 추출물 또는 상기 형질전환체로부터 분리된 재조합 단백질을 포함하는 돼지 대장균 설사증 백신 조성물에 관한 것이다. In another aspect, the present invention relates to a porcine E. coli diarrhea vaccine composition comprising a transformant of the present invention, a protein extract of the transformant or a recombinant protein isolated from the transformant.

본 발명에서 용어, “형질전환체” 는 상기에서 설명한 바와 같다. In the present invention, the term "transformer" is as described above.

본 발명에서 용어, “백신”은 생체에 면역을 주는 항원을 함유한 생물학적인 제제로서, 감염증의 예방을 위하여 사람이나 동물에 주사하거나 경구투여함으로써 생체에 면역이 생기게 하는 면역원 또는 항원성 물질을 말한다. As used herein, the term “vaccine” refers to a biological agent containing an antigen that immunizes a living body, and refers to an immunogen or antigenic substance that immunizes the living body by injection or oral administration to a human or animal to prevent infection. .

본 발명에서 용어, “면역원” 또는 “항원성 물질”은 펩티드, 폴리펩티드, 상기 폴리펩티드를 발현하는 유산균, 단백질, 상기 단백질을 발현하는 유산균, 올리고뉴클레오티드, 폴리뉴클레오티드, 재조합 박테리아 및 재조합 바이러스로 구성된 군에서 선택된 어느 하나인 것을 특징으로 할 수 있다. 구체적인 예를 들면, 상기 항원 물질은 불활성화된 전체 또는 부분 세포 제제 형태, 또는 통상적인 단백질 정제, 유전 공학 기법 또는 화학 합성에 의해 수득되는 항원 분자 형태일 수 있다. As used herein, the term “immunogen” or “antigenic substance” refers to a peptide, polypeptide, lactic acid bacteria expressing the polypeptide, protein, lactic acid bacteria expressing the protein, oligonucleotide, polynucleotide, recombinant bacteria and recombinant virus in the group consisting of It may be characterized in that it is any one selected. In specific embodiments, the antigenic substance may be in the form of an inactivated whole or partial cell preparation, or in the form of an antigen molecule obtained by conventional protein purification, genetic engineering techniques or chemical synthesis.

상기 항원의 함량은 백신 조성물 총 중량에 대해서 1 내지 10 중량%일 수 있으며, 바람직하게는 5% 중량 이내일 수 있다. The content of the antigen may be 1 to 10% by weight relative to the total weight of the vaccine composition, preferably within 5% by weight.

본 발명에 따른 백신 조성물은 안정제, 유화제, 수산화알루미늄, 인산알루미늄, pH 조정제, 계면활성제, 리포솜, 이스콤(iscom) 보조제, 합성 글리코펩티드, 증량제, 카복시폴리메틸렌, 세균 세포벽, 세균 세포벽의 유도체, 세균백신, 동물 폭스바이러스 단백질, 서브바이랄(subviral) 입자 보조제, 콜레라 독소, N, N-디옥타데실-N',N'-비스(2-하이드록시에틸)-프로판디아민, 모노포스포릴 지질 A, 디메틸디옥타데실-암모늄 브로마이드 및 이의 혼합물로 구성된 군에서 선택된 어느 하나 이상의 제 2 보조제를 추가로 함유하는 것을 특징으로 할 수 있다.
Vaccine compositions according to the invention are stabilizers, emulsifiers, aluminum hydroxide, aluminum phosphate, pH adjusters, surfactants, liposomes, iscom adjuvants, synthetic glycopeptides, extenders, carboxypolymethylenes, bacterial cell walls, derivatives of bacterial cell walls, Bacterial vaccine, animal poxvirus protein, subviral particle adjuvant, cholera toxin, N, N-dioctadecyl-N ', N'-bis (2-hydroxyethyl) -propanediamine, monophosphoryl lipid A, dimethyldioctadecyl-ammonium bromide and mixtures thereof may be further contained in at least one second adjuvant.

또한, 본 발명의 백신 조성물은 수의학적으로 허용 가능한 담체를 포함할 수 있다. 본 발명에서 용어, "수의학적으로 허용 가능한 담체"란 임의의 및 모든 용매, 분산 매질, 코팅제, 항원보강제, 안정제, 희석제, 보존제, 항균제 및 항진균제, 등장성 작용제, 흡착지연제 등을 포함한다. 백신용 조성물에 포함될 수 있는 담체, 부형제, 희석제로는 락토즈, 덱스트로스, 슈크로스, 솔비톨, 만니톨, 자일리톨, 말티톨, 전분, 글리세린, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘포스페이트, 칼슘실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.In addition, the vaccine composition of the present invention may comprise a veterinary acceptable carrier. As used herein, the term "veterinarily acceptable carrier" includes any and all solvents, dispersion media, coatings, adjuvant, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorptive delay agents and the like. Carriers, excipients, and diluents that may be included in the composition for vaccines include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

또한, 본 발명의 백신용 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 제제화할 경우에는 보통 사용되는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제할 수 있다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 레시틴 유사 유화제에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 슈크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용할 수 있다. 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등을 사용할 수 있으며, 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수용성제, 현탁제, 유제, 동결건조제제가 포함된다. 비수용성제제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.In addition, the vaccine composition of the present invention can be used in the form of oral dosage forms, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and sterile injectable solutions, respectively, according to conventional methods. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used can be prepared. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient such as starch, calcium carbonate and sucrose in the lecithin-like emulsifier. (sucrose), lactose (lactose), gelatin, etc. can be mixed and prepared. In addition to simple excipients, lubricants such as magnesium styrate talc may also be used. As a liquid preparation for oral administration, suspending agents, liquid solutions, emulsions, syrups, etc. may be used, and various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin, may be included. Can be. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations. As the non-aqueous preparation and suspending agent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate and the like can be used.

본 발명의 식물 형질전환체를 동결건조하여 동물의 사료나 식수에 첨가하여 투여할 수 있으며, 상기한 방법으로 투여하였을 경우 장독소 대장균 K88ac에 대하여 점막면역반응 뿐만 아니라 전신면역반응을 유도할 수 있다. 또한 식물 형질전환체를 경구용으로 사용할 경우 동물성 바이러스 오염 가능성이 낮고, 생산되는 재조합 CTB에 K88ac 필린 항원이 융합된 변형 단백질이 식물에 함유되어 있으므로 장기간 보관 및 이동이 가능할 뿐만 아니라, 주사접종으로 인한 비용소모를 대폭 절감시킬 수 있다.
The plant transformant of the present invention can be lyophilized and added to animal feed or drinking water, and when administered in the above-described manner, it can induce mucosal immunity as well as systemic immune responses against enterotoxin E. coli K88ac. . In addition, when the plant transformant is used orally, it is less likely to be contaminated with animal viruses, and the plant contains a modified protein in which the recombinant CTB is fused with K88ac filin antigen, so that it can be stored and transported for a long time. The cost can be greatly reduced.

또한 본 발명은, 상기 백신용 조성물을 인간을 제외한 동물에 주입하여 항원에 대한 항체 생성률을 높이는 방법에 관한 것이다.The present invention also relates to a method of increasing the antibody production rate against the antigen by injecting the vaccine composition into animals other than humans.

본 발명에서 용어, "인간을 제외한 동물"은 포유류 또는 조류인 것을 특징으로 할 수 있고, 상기 "주입"은 피하주사, 근육내 주사, 피하내 주사, 복막내 주사, 비강투여, 구강투여, 경피투여 및 경구투여로 구성된 군에서 선택된 어느 하나의 방법으로 수행되는 것을 특징으로 할 수 있다. 바람직하게 본 발명의 백신은 경구용 백신일 수 있다.In the present invention, the term "animal except human" may be characterized as a mammal or a bird, the "injection" is subcutaneous injection, intramuscular injection, subcutaneous injection, intraperitoneal injection, nasal administration, oral administration, transdermal It may be characterized in that it is carried out by any one method selected from the group consisting of administration and oral administration. Preferably the vaccine of the present invention may be an oral vaccine.

또한, 본 발명에서 용어, "주사" 또는 "투여"는 투여대상의 나이, 성별, 체중 등에 따라 투여량이 달라질 수 있고, 투여경로, 질병의 정도, 성별, 체중, 나이 등에 따라서도 백신의 투여량이 달라질 수 있다.
In the present invention, the term "injection" or "administration" may vary depending on the age, sex, and weight of the subject to be administered, and the dose of the vaccine also depends on the route of administration, the degree of disease, sex, weight, age, and the like. Can vary.

또 다른 양태로서, 본 발명은 본 발명의 형질전환체, 상기 형질전환체의 단백질 추출물 또는 상기 형질전환체로부터 분리된 재조합 단백질을 포함하는 돼지 대장균 설사증의 예방 또는 치료용 사료 조성물에 관한 것이다. In another aspect, the present invention relates to a feed composition for the prevention or treatment of porcine E. coli diarrhea comprising a transformant of the present invention, a protein extract of the transformant or a recombinant protein isolated from the transformant.

본 발명에서 용어, “예방”은 본 발명의 시그널 펩타이드, 점막면역보조제 및 필린 항원이 융합된 형태로 형질전환된 형질전환체 또는 상기 형질전환체를 유효성분으로 하는 조성물의 투여로 돼지 대장균 설사증을 억제 또는 지연시키는 모든 행위를 말한다. As used herein, the term “prevention” refers to porcine E. coli diarrhea by administration of a transformant transformed into a fused form of the signal peptide, mucosal immunity adjuvant and filin antigen or a composition comprising the transformant as an active ingredient. Any action that inhibits or delays.

본 발명에서 용어, “치료”는 본 발명의 시그널 펩타이드, 점막면역보조제 및 필린 항원이 융합된 형태로 형질전환된 형질전환체 또는 상기 형질전환체를 유효성분으로 하는 조성물의 투여로 돼지 대장균 설사 증상이 호전되거나 이롭게 되는 모든 행위를 말한다.In the present invention, the term "treatment" refers to porcine E. coli diarrhea symptoms by administration of a transformant transformed in a fused form of the signal peptide, mucosal immunity adjuvant and filin antigen or a composition comprising the transformant as an active ingredient. It refers to all actions that improve or benefit this.

본 발명에서 사용한 사료 조성물은 본 발명에 따른 사료 첨가제를 유효성분으로 포함하는 한 당업계에 공지된 다양한 형태의 조성비로 당업자에 의해 적절하게 구성될 수 있으며, 바람직하게는 단백질 20%, 지방, 에테르 추출물 4.5%, 지방, 산 가수분해 5.4%, 조섬유질 4.7%, 회분 6%, 칼슘 0.80% 및 인산염 0.62%를 포함하는 사료 조성물일 수 있다.
The feed composition used in the present invention may be appropriately configured by those skilled in the art in various forms of composition known in the art as long as it includes the feed additive according to the present invention as an active ingredient, preferably 20% protein, fat, ether It may be a feed composition comprising 4.5% extract, 5.4% fat, acid hydrolysis, 4.7% crude fiber, 6% ash, 0.80% calcium and 0.62% phosphate.

또 다른 양태로서, 본 발명은 본 발명의 형질전환체, 상기 형질전환체의 단백질 추출물 또는 상기 형질전환체로부터 분리된 재조합 단백질을 포함하는 돼지 대장균 설사증의 예방 또는 치료용 사료 첨가용 조성물에 관한 것이다. In still another aspect, the present invention relates to a composition for preventing or treating swine E. coli diarrhea, comprising a transformant of the present invention, a protein extract of the transformant, or a recombinant protein isolated from the transformant. .

본 발명의 사료 첨가용 조성물은 당업계에 공지된 다양한 형태로 제조될 수 있으며, 바람직하게는 시그널 펩타이드, 점막면역보조제 및 필린 항원이 융합된 형태로 형질전환된 형질전환체를 유효성분으로 포함하는 것이다. 더 바람직하게는 시그널 펩타이드, CTB 및 필린 항원이 융합된 유전자를 포함하는 재조합 벡터가 형질전환된 당근 캘러스, 상기 당근 캘러스를 0.1 내지 2ppm 2,4-D 및 0.01 내지 0.2 ppm 키네틴(kinetin)이 포함된 배지에서 기내 배양한 당근캘러스를 유효성분으로 포함하는 것이다. 또한 상기 배지에는 캘러스의 경우는 2 내지 4%, 바람직하게는 3%의 자당, 유식물체의 경우는 2 내지 3%, 바람직하게는 2.5%의 자당이 포함된 것이 바람직하다. 또한 기내 배양시 공기 주입량은 300cc/min 이 바람직하다. The feed composition of the present invention may be prepared in various forms known in the art, preferably comprising a transformant transformed in a fused form of a signal peptide, mucosal immunity adjuvant and filin antigen as an active ingredient will be. More preferably, a carrot callus transformed with a recombinant vector comprising a gene fused with a signal peptide, CTB and pilin antigen, and 0.1 to 2 ppm 2,4-D and 0.01 to 0.2 ppm kinetin are contained in the carrot callus. Carrots cultured in-flight in a cultured medium is to be included as an active ingredient. In addition, it is preferable that the medium contains 2 to 4% of sucrose, preferably 3% of sucrose, 2 to 3% of seedlings, and preferably 2.5% of sucrose. In addition, the amount of air injected during in-flight culture is preferably 300 cc / min.

본 발명에 따른 사료 첨가제는 개별적으로 사용될 수 있고 종래 공지된 사료 첨가제와 병용하여 사용될 수 있고 종래의 사료첨가제와 순차적 또는 동시에 사용될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다. The feed additives according to the present invention can be used individually and in combination with conventionally known feed additives and can be used sequentially or simultaneously with conventional feed additives. And single or multiple administrations. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.

본 발명의 사료용 조성물을 적용할 수 있는 개체는 특별히 한정되지 않고, 어떠한 형태의 것이든 적용 가능하다. 예를 들면, 닭, 돼지, 원숭이, 개, 고양이, 토끼, 모르모트, 래트, 마우스, 소, 양, 염소 등과 같은 동물에 제한없이 적용가능하며, 본 발명의 일 실시예에 따르면 상기 백신 조성물 또는 사료 조성물을 경구투여한 모돈에서 태엉난 자돈에 대장균 공격 접종 후 임상반응을 관찰한 결과, 설사정도가 일반 사료 또는 Intervet사에서 시중 판매되고 있는 재조합 백신(Porcilis coli)을 근육주사한 모돈에서 태어난 자돈보다 완화된 것을 확인할 수 있었다(도 10). 따라서 본 발명의 재조합 백신 또는 사료 조성물은 돼지 설사 방제에 탁월한 효과가 있다.
The individual to which the composition for feed of the present invention can be applied is not particularly limited and may be applied in any form. For example, it is applicable without limitation to animals such as chickens, pigs, monkeys, dogs, cats, rabbits, morphotes, rats, mice, cows, sheep, goats, etc., according to one embodiment of the invention the vaccine composition or feed Clinical responses were observed after inoculation of E. coli challenged to piglets born with oral administration of the composition, and the degree of diarrhea was higher than that of pigs born from sows injected with intramuscularly injected recombinant vaccine (Porcilis coli) commercially available from General Feed or Intervet. It was confirmed that the relaxation (Fig. 10). Therefore, the recombinant vaccine or feed composition of the present invention has an excellent effect on controlling pig diarrhea.

또 다른 양태로서, 본 발명은 돼지 대장균 설사증의 예방 또는 치료 방법에 관한 것이다. 구체적으로, 상기 백신 조성물을 돼지 대장균 설사증의 예방 및 치료가 필요한 개체에게 투여함으로써 돼지 대장균 설사증을 예방 및 치료하는 방법에 관한 것이다. 또한, 상기 사료 조성물 또는 사료 첨가용 조성물을 개체에 투여함으로써 돼지 대장균 설사증을 예방 및 치료하는 방법을 포함한다.
In another aspect, the present invention relates to a method for preventing or treating swine E. coli diarrhea. Specifically, the present invention relates to a method for preventing and treating swine E. coli diarrhea by administering the vaccine composition to a subject in need of prevention and treatment of swine E. coli diarrhea. The method also includes a method of preventing and treating swine E. coli diarrhea by administering the feed composition or the feed composition to the subject.

또 다른 양태로서, 본 발명은 (1) 시그널 펩타이드, 점막면역보조제 및 필린 항원이 융합된 유전자를 포함하는 재조합 벡터를 제조하는 단계; (2) 상기 단계 (1)의 재조합 벡터를 아그로박테리아에 도입시키는 단계; 및 (3) 상기 단계 (2)의 아그로박테리아와 식물세포를 형질전환시키는 단계를 포함하는 시그널 펩타이드, 점막면역보조제 및 필린 항원이 융합된 돼지 대장균 설사증 백신의 제조방법에 관한 것이다. In another embodiment, the present invention comprises the steps of (1) preparing a recombinant vector comprising a gene fused to a signal peptide, mucosal immune adjuvant and filin antigen; (2) introducing the recombinant vector of step (1) into an Agrobacteria; And (3) relates to a method for producing a swine Escherichia coli diarrhea vaccine fused with a signal peptide, mucosal immunity adjuvant and pilin antigen comprising the step of transforming the agrobacteria and plant cells of step (2).

상기 단계 (1)은 본 발명의 시그널 펩타이드, 점막면역보조제 및 필린 항원이 융합된 유전자를 포함하는 재조합 벡터를 제조하는 단계에 관한 것이다. 상기 융합된 유전자는 서열번호 33으로 표시되는 아미노산을 암호화하는 유전자인 것이 바람직하다. Step (1) relates to the step of preparing a recombinant vector comprising a gene fused to the signal peptide, mucosal immunity adjuvant and filin antigen of the present invention. The fused gene is preferably a gene encoding an amino acid represented by SEQ ID NO: 33.

상기 단계 (2) 및 단계 (3)은 단계 (1)의 재조합 벡터를 아그로박테리아에 도입시키는 단계; 및 아그로박테리아와 식물세포를 형질전환시키는 단계를 포함하는 돼지 대장균 설사증에 대한 백신 제조방법에 관한 것이다.Step (2) and step (3) include the steps of introducing the recombinant vector of step (1) into Agrobacteria; And it relates to a vaccine production method for porcine E. coli diarrhea comprising the step of transforming agrobacteria and plant cells.

본 발명의 발현벡터를 아그로박테리아에 형질도입시키는 방법은 당업계에 공지된 방법을 당업자에 의해 적절하게 변형되어 적용될 수 있으며, 바람직하게 본 발명에서는 아그로박테리아 튜머파시엔스 GV31에 본 발명의 재조합 벡터를 freeze-thaw 방법을 이용하여 형질전환하였다. 또한, 상기 백신제조방법은 당업계에 공지된 백신의 제조방법에 따라, 본 발명의 항원 조성물을 적절한 중량 %로 첨가하여 제조할 수 있으며, 바람직하게 백신 조성물 총 중량에 대해서 1 내지 10 중량%일 수 있으며, 바람직하게는 5% 중량 이내일 수 있다.The method of transducing the expression vector of the present invention to Agrobacteria may be appropriately applied by those skilled in the art by methods known in the art. Preferably, in the present invention, the recombinant vector of the present invention may be added to Agrobacteria tumerfaciens GV31. Transformation was performed using the freeze-thaw method. In addition, the vaccine manufacturing method can be prepared by adding the appropriate weight% of the antigenic composition of the present invention, according to the preparation of vaccines known in the art, preferably 1 to 10% by weight relative to the total weight of the vaccine composition And preferably within 5% by weight.

본 발명의 일 실시예에서는 형질전환체를 기내 배양 했을 때 형질전환 백신당근 캘러스의 최적 배양기간은 45일에 정지기에 도달하였고, 2,4-D와 시토키닌(cytokinin)류의 농도별 조합에 의한 결과는 1 ppm의 2,4-D 과 0.1 ppm의 키네틴의 조합에서 생장이 가장 좋았다. 그리고 45일 배양 후 최대 생장을 보여 접종량(배지량의 0.1%)의 60배까지 증식하였다. 생물반응기 최적 운전공정을 위한 접종량을 설정하기 위하여 백신당근 캘러스는 0.1, 0.2, 0.6%로, 유식물체는 0.2, 0.5, 1.0%로 20L 생물반응기에 접종하여 실험을 수행하였고, 생백신당근 캘러스는 배지량의 0.2%를 접종한 후 공기주입량을 300, 700, 1,500cc/min로, 유식물체는 배지량의 0.5%를 접종한 후 공기주입량을 300, 700, 1,500cc/min로 하여 생물반응기의 최적 공기 주입량을 확인하였다(실시예 3). 확인 결과를 바탕으로, 상기 백신 제조방법은 상기 (3) 단계에서 얻어진 형질전환체를 0.1 내지 2ppm 2,4-D, 0.01 내지 0.2 ppm 키네틴(kinetin) 및 2 내지 4%(w/v)의 자당이 포함된 배지에서 배양하는 단계를 추가로 포함하는 것이 바람직하다.
In one embodiment of the present invention, the optimal incubation period of the transgenic vaccine carrot callus reached a stop period at 45 days when the transformant was in-flight cultured, and the combination of concentrations of 2,4-D and cytokinin by cytokinin The result was the best growth in the combination of 1 ppm 2,4-D and 0.1 ppm kinetin. After 45 days of cultivation, the maximum growth was shown, and the cells were grown to 60 times the inoculation amount (0.1% of the medium). Vaccine carrot callus was inoculated in 20L bioreactor with 0.1, 0.2, and 0.6% and seedlings were 0.2, 0.5, and 1.0% to set the inoculum for the optimal operation of the bioreactor. After inoculating 0.2% of the air, the air injection amount was 300, 700, 1,500 cc / min, and the seedlings were inoculated with 0.5% of the medium, and the air injection amount was 300, 700, 1,500 cc / min. Was confirmed (Example 3). Based on the results of the confirmation, the vaccine preparation method comprises 0.1 to 2 ppm 2,4-D, 0.01 to 0.2 ppm kinetin and 2 to 4% (w / v) of the transformant obtained in step (3). It is preferred to further comprise the step of culturing in a medium containing sucrose.

본 발명의 점막면역보조제 및 필린 항원이 융합된 재조합 벡터 또는 시그널펩타이드, 점막면역보조제 및 필린 항원이 융합된 재조합 벡터를 형질전환하여 얻어진 식물 형질전환체는 경구 백신으로 사용하여 필린 단일 항원 및 기존에 사용되고 있는 돼지 대장균 설사증에 대한 재조합 백신보다 K88ac에 대하여 중화활성을 가지는 항체형성을 더 효과적으로 유도하여 K88ac 감염을 예방할 수 있다. 특히, 종래 돼지 대장균 설사증 방지에 사용되고 있는 항생제를 대체하는 고부가가치 사료첨가제로서 유용하게 사용될 수 있으며, 이를 통해 양돈 농가의 생산성 향상과 고품질 축산물의 생산에 크게 이바지할 것으로 기대된다.
Plant transformants obtained by transforming a recombinant vector or signal peptide fused with a mucosal immune adjuvant and a pilin antigen, and a recombinant vector fused with a mucosal immunity adjuvant and a pilin antigen were used as oral vaccines to obtain a single antigen and K88ac infection can be prevented by more effectively inducing antibody formation having neutralizing activity against K88ac than the recombinant vaccine against swine coli diarrhea. In particular, it can be usefully used as a high value-added feed additive to replace the antibiotics that have been used to prevent the conventional pig E. coli diarrhea, through which it is expected to contribute greatly to the productivity of pig farms and the production of high quality livestock products.

도 1은 pK2GW7CTB::pilin 벡터 구축 모식도를 나타낸 것이다.
도 2는 재조합 PCR로 증폭한 후 시그널 펩타이드 및 CTB::필린(pilin)의 융합 여부를 1% 아가로즈 젤로 확인한 결과를 나타낸 것이다(A). 또한 3.5Kb의 sp-CTB-pilin 유전자가 TOPO 벡터에 삽입되었는지를 확인한 결과(B) 및 sp-CTB-pilin 유전자가 아그로박테리아(Agrobacteria)(GV3101)에 형질전환되었는지를 11616bp, 1284bp 사이즈의 밴드로 확인한 결과(C)를 나타낸 것이다.
도 3은 점막면역보조제 융합 필린 유전자가 형질전환된 당근식물로부터 추출한 DNA를 PCR한 다음 그 산물을 전기영동한 사진이다.
도 4는 sp::CTB::pilin 유전자가 형질전환된 당근식물로부터 추출한 DNA를 PCR한 다음 그 산물을 전기영동한 사진이다(M: 1kb 래더 마커(ladder marker); P, pKspCTBpilin; N, 비형질전환 캘러스; 1, NspCTJ3-2; 2, NspCTJ3-3; 3, NspCTJ4-1; 4, NspCTJ4-2; 5, NspCTJ5-1; 6, NspCTJ8-4; 7, NspCTJ10-1; 8, NspCTJ10-3; 9, NspCTJ11-1; 10, NspCTJ14-2; 11, NspCTJ15-1).
도 5는 점막면역보조제 융합 필린 유전자가 형질전환된 당근식물로부터 추출한 단백질에 대하여 웨스턴 블롯한 사진이다.
도 6은 sp::CTB::pilin 유전자가 형질전환된 당근 캘러스, 미성숙 배 및 유식물을 따로 분석하여 발달 단계에 따른 항원 발현 양의 차이을 확인한 결과이다.
도 7은 점막면역보조제 융합 필린 유전자가 형질전환된 당근식물을 자돈에 경구투여한 후 대장균을 공격접종하여 설사를 일으키고 12시간 간격으로 관찰하여 설사정도를 수치화하여 평균값을 나타낸 것이다.
도 8은 마우스 경구 면역 반응 실험에서 경구 투여 시점을 도식화하여 나타낸 것이다.
도 9는 쥐에 대한 당근 형질전환체 미성숙배, 유식물, 캘러스, 미성숙배+유식물, 뿌리등과 같이 조직별로 경구 투여시 형성된 IgG 항체의 양을 ELISA로 나타낸 것이다.
도 10은 신생자돈에 대장균 공격 접종 후 임상 반응을 24시간 간격으로 7일간 관찰하여 설사정도를 수치화하여 평균값을 나타낸 것이다(CHAC, 사료를 먹인 모돈에서 태어난 자돈(음성 대조구); RVI, 시중 판매되고 있는 Inver 사 재조합 백신을 근육주사한 모돈에서 태어난 자돈(양성 대조구); NspCT, 형질전환체 NspCTJ11-1 경구 투여한 모돈에서 태어난 자돈(실험구)).1 shows a schematic diagram of pK2GW7CTB :: pilin vector construction.
Figure 2 shows the result of confirming the fusion of the signal peptide and CTB :: pilin (1) agarose gel after amplification by recombinant PCR (A). In addition, as a result of confirming that the 3.5 Kb sp-CTB-pilin gene was inserted into the TOPO vector (B) and whether the sp-CTB-pilin gene was transformed into Agrobacteria (GV3101) into a band of 11616bp and 1284bp The result confirmed (C) is shown.
Figure 3 is a photograph of the DNA extracted from the carrot plants transformed mucosal immune adjuvant fusion filin gene and then electrophoresed the product.
FIG. 4 is a PCR image of a DNA extracted from a carrot plant transformed with the sp :: CTB :: pilin gene, followed by electrophoresis of the product (M: 1 kb ladder marker; P, pKspCTBpilin; N, B) Transformation callus; 1, NspCTJ3-2; 2, NspCTJ3-3; 3, NspCTJ4-1; 4, NspCTJ4-2; 5, NspCTJ5-1; 6, NspCTJ8-4; 7, NspCTJ10-1; 8, NspCTJ10- 3; 9, NspCTJ11-1; 10, NspCTJ14-2; 11, NspCTJ15-1).
Figure 5 is a Western blot photograph of the protein extracted from the carrot plants transformed mucosal adjuvant fusion filin gene.
6 is a result of analyzing the carrot callus, immature embryos and seedlings transformed with the sp :: CTB :: pilin gene separately to determine the difference in the amount of antigen expression according to the developmental stage.
Figure 7 orally administered carrot plants transformed with mucosal adjuvant fusion pilin gene in piglets after challenged with E. coli to cause diarrhea and observed at intervals of 12 hours to show the average value of the diarrhea.
8 is a schematic showing the time of oral administration in mouse oral immune response experiments.
Figure 9 shows the amount of IgG antibody formed upon oral administration by tissue, such as carrot transformant immature embryo, seedlings, callus, immature embryo + seedlings, roots, etc. in mice by ELISA.
Figure 10 shows the average value of the diarrhea by observing the clinical response of E. coli challenge inoculated piglets at 24 hours intervals for 7 days (CHAC, pigs born from feed sows (negative control); RVI, commercially available) Piglets born from sows injected intramuscularly with Inver's recombinant vaccine (positive control); piglets born from sows administered orally administered NspCT, transformant NspCTJ11-1).

이하, 하기 실시예를 통하여 본 발명을 더욱 상세하게 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.
Hereinafter, the present invention will be described in more detail with reference to the following examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not construed as being limited by these embodiments.

실시예 1. 재조합 벡터의 제조Example 1 Preparation of Recombinant Vectors

1-1. 점막 면역보조제(1-1. Mucosal adjuvant ( CTBCTB )의 합성) Synthesis

콜레라 톡신 서브유닛 B(Cholera toxin subunit B, CTB) 유전자를 기내에서 합성하기 위하여, 보고된 CTB 염기배열을 바탕으로 프라이머를 제작하였다(Areas et al., 2002). 그리고 CTB1 프라이머와 CTB2 프라이머가 교차 될 수 있도록 CTB1-2 프라이머를 구성하였다(표 1). 서로 교차된 프라이머를 주형으로 다음과 같은 조건에서 PCR을 수행하였다; 템플레이트 100 pmol 혹은 10 pmol의 15개 프라이머 혼합물, 10× pfu 반응버퍼 5 ㎕, 10 mM dNTP 1 ㎕, pfu 폴리머라제 2.5 U(Solgent 사); 94℃ 5분, 94℃ 1분, 54℃ 1분(57℃, 60℃), 72℃ 1분, 72℃ 5분. 상기 조건을 한 사이클(cycle)로 하여 총 30회 반복수행하였다. In order to synthesize the Cholera toxin subunit B (CTB) gene in-flight, primers were prepared based on the reported CTB nucleotide sequence (Areas et al., 2002). And the CTB1-2 primer was constructed so that the CTB1 primer and CTB2 primer can be crossed (Table 1). PCR was performed under primers crossed with each other under the following conditions; 15 primer mixtures of 100 pmol or 10 pmol template, 5 μl of 10 × pfu reaction buffer, 1 μl of 10 mM dNTP, 2.5 U of pfu polymerase from Solgent; 94 ° C 5 minutes, 94 ° C 1 minute, 54 ° C 1 minute (57 ° C, 60 ° C), 72 ° C 1 minute, 72 ° C 5 minutes. A total of 30 repetitions of the above conditions were carried out in one cycle.

얻어진 PCR 산물은 TAE 1.0% 아가(agar)에 전기영동한 후, Gene Clean Kit(QIAGEN 사)를 이용하여 젤로부터 DNA를 회수하였다. 분리된 DNA는 pGEM-T easy vector(Promega사)에 연결한 후 NotI 제한효소로 절단하여 클로닝 여부를 확인하였다. 얻어진 T-vector 클로닝 산물은 솔젠트(주)에 의뢰하여 염기배열을 파악하여 NCBI의 alignment와 blast (http//::www.ncbi.nlm.nih.gov/BLAST)를 통해 상동성을 평가하였다.The obtained PCR product was electrophoresed in TAE 1.0% agar, and then DNA was recovered from the gel using a Gene Clean Kit (QIAGEN). The isolated DNA was connected to pGEM-T easy vector (Promega) and then cleaved with NotI restriction enzyme to confirm cloning. The obtained T-vector cloning product was commissioned by Solgent Co., Ltd. to determine the nucleotide sequence, and evaluated homology through alignment and blast of NCBI (http // :: www.ncbi.nlm.nih.gov/BLAST). .

CTB 유전자 합성에 필요한 프라이머 시퀀스(서열번호 1 내지 15)Primer sequences required for CTB gene synthesis (SEQ ID NOs: 1-15) 이름name 시퀀스sequence CTB1(서열번호 1)CTB1 (SEQ ID NO: 1) caccatgatcaagctcaagtttggagtgttcttcactgtgctcc
caccatgatcaagctcaagtttggagtgttcttcactgtgctcc
CTB2(서열번호 2)CTB2 (SEQ ID NO: 2) ttagctctgcctatgcacatggcaccccacaaaacatcacttagctctgcctatgcacatggcaccccacaaaacatcac CTB1-2(서열번호 3)CTB1-2 (SEQ ID NO: 3) tcacaagaagtgacacgagg aatcgagacggatacgtgtatcacaagaagtgacacgagg aatcgagacggatacgtgta CTB3(서열번호 4)CTB3 (SEQ ID NO: 4) tgacttgtgtgctgagtaccataacacccagatccatacctgacttgtgtgctgagtaccataacacccagatccatacc CTB4(서열번호 5)CTB4 (SEQ ID NO: 5) ctcagtgacaagatcttgagctacaccgagagccttgctgctcagtgacaagatcttgagctacaccgagagccttgctg CTB3-4(서열번호 6)CTB3-4 (SEQ ID NO: 6) tattgtgggtttaggtatgg gagttactgttctagaaatctattgtgggtttaggtatgg gagttactgttctagaaatc CTB5(서열번호 7)CTB5 (SEQ ID NO: 7) gcaagagggagatggctatcatcaccttcaagaatggtgcgcaagagggagatggctatcatcaccttcaagaatggtgc CTB6(서열번호 8)CTB6 (SEQ ID NO: 8) taccttccaagtggaggtgcctggaagccaacatattgattaccttccaagtggaggtgcctggaagccaacatattgat CTB5-6(서열번호 9)CTB5-6 (SEQ ID NO: 9) tagtggaagttcttaccacg atggaaggttcacctccacgtagtggaagttcttaccacg atggaaggttcacctccacg CTB7(서열번호 10)CTB7 (SEQ ID NO: 10) agccaaaagaaggccattgagaggatgaaggacacacttaagccaaaagaaggccattgagaggatgaaggacacactta CTB8(서열번호 11)CTB8 (SEQ ID NO: 11) ggattgcttacctcactgaggctaaggtggagaagctttgggattgcttacctcactgaggctaaggtggagaagctttg CTB7-8(서열번호 12)CTB7-8 (SEQ ID NO: 12) ctcctacttcctgtgtgaat cctaacgaatggagtgactcctcctacttcctgtgtgaat cctaacgaatggagtgactc CTB9(서열번호 13)CTB9 (SEQ ID NO: 13) tgtgtggaacaacaagacccctcatgctattgtgtgtggaacaacaagacccctcatgctattg CTB10(서열번호 14)CTB10 (SEQ ID NO: 14) ctgccatcagcatggctaatggacctggacctctgccatcagcatggctaatggacctggacct CTB9-10(서열번호 15)CTB9-10 (SEQ ID NO: 15) gttctggggagtacgataac gacaatagtcgtaccgattagttctggggagtacgataac gacaatagtcgtaccgatta

그 결과, 서열번호 25의 염기서열을 갖는 CTB 유전자를 기내 합성하였다.
As a result, a CTB gene having the nucleotide sequence of SEQ ID NO: 25 was synthesized in-flight.

1-2. 점막 면역보조제와 항원 유전자의 융합 1-2. Fusion of mucosal adjuvant and antigen gene

상기 1-1에서 클로닝된 CTB 유전자와 T-vector에 클로닝된 K88ac의 필린(pilin) 유전자를 융합하기 위하여, 재조합 PCR(Higuchi., 1990) 방법을 근거로 하여 프라이머를 제작하였고, CTB와 항원 단백질이 유연성을 가질 수 있도록 CTB 염기와 항원 염기 사이에 힌지(Hinge)(GPGP)를 추가하였다(표 2).In order to fuse the CTB gene cloned in 1-1 and the pilin gene of K88ac cloned in T-vector, primers were prepared based on recombinant PCR (Higuchi., 1990) method, and CTB and antigen proteins. To have this flexibility, a hinge (GPGP) was added between the CTB base and the antigen base (Table 2).

재조합 PCR은 아래와 같은 조건으로 진행하였다; 템플레이트 T-CTB, T-항원(필린) 플라스미드 DNA 1 ng, 10× pfu 반응버퍼 5 ㎕, 10mM dNTP 1 ㎕, pfu 폴리머라제 2.5 U(Solgent사), 10 pmol CTB entry 5'(서열번호 1), CTB+필린 융합 3'(서열번호 16), 필린+CTB 융합 5'(서열번호 17), 필린 융합 3' (서열번호 19) 프라이머 1 ㎕; 94℃ 5분, 94℃ 1분, 45℃ 1분, 72℃ 4분, 72℃ 5분. 상기 조건을 한 사이클(cycle)로 하여 총 30회 반복수행하였다. 융합된 유전자는 TAE 1.0% 아가(agar)에 전기영동한 후 Gene Clean Kit (QIAGEN사)를 이용하여 젤(gel)로부터 DNA를 회수하였다. Recombinant PCR proceeded under the following conditions; Template T-CTB, T-antigen (phyllin) plasmid DNA 1 ng, 5 μl of 10 × pfu reaction buffer, 1 μl of 10 mM dNTP, pfu polymerase 2.5 U (Solgent), 10 pmol CTB entry 5 ′ (SEQ ID NO: 1) , 1 μl of CTB + filin fusion 3 ′ (SEQ ID NO: 16), pilin + CTB fusion 5 ′ (SEQ ID NO: 17), pilin fusion 3 ′ (SEQ ID NO: 19) primers; 94 ° C 5 minutes, 94 ° C 1 minute, 45 ° C 1 minute, 72 ° C 4 minutes, 72 ° C 5 minutes. A total of 30 repetitions of the above conditions were carried out in one cycle. The fused gene was electrophoresed in TAE 1.0% agar, and then DNA was recovered from the gel using a Gene Clean Kit (QIAGEN).

CTB와 필린 항원 유전자를 재조합하기 위한 프라이머(서열번호 1, 16 내지 18)Primers for recombining CTB and filin antigen genes (SEQ ID NOs: 1, 16-18) 이름name 시퀀스sequence 산물product CTB entry 5'(서열번호 1)CTB entry 5 '(SEQ ID NO: 1) caccatgatcaagctcaagtttggagtgttcttcactgtgctcccaccatgatcaagctcaagtttggagtgttcttcactgtgctcc CTB
CTB::필린CTB
CTB :: Pillin CTB+필린 융합 3' (서열번호 16)CTB + Philin Fusion 3 '(SEQ ID NO: 16) cagagtctttttcataggtccaggtccattagccatgctg
pilin Hinge CTB cagagtctttttcat aggtccaggtcc attagccatgctg
pilin Hinge CTB CTBCTB 필린+CTB 융합 5' (서열번호 17)Filin + CTB fusion 5 '(SEQ ID NO: 17) cagcatggctaat g gacctggacctatgaaaaagactctg
CTB Hinge pilincagcatggctaat g gacctggacct atgaaaaagactctg
CTB Hinge pilin 필린Filin 필린 융합 3'(서열번호 18)Filin fusion 3 '(SEQ ID NO: 18) tcatgctaggttcagcggagcgctccactgagtgctggtatcatgctaggttcagcggagcgctccactgagtgctggta 필린
CTB::필린Filin
CTB :: Pillin

그 결과, 힌지(Hinge)를 포함하여 서열번호 28로 표시되는 CTB 및 서열번호 30으로 표시되는 필린 유전자를 융합하였다.
As a result, the CTB represented by SEQ ID NO: 28 and the filin gene represented by SEQ ID NO: 30 were fused including a hinge.

1-3. 점막 면역보조제 융합 항원 유전자의 1-3. Of mucosal adjuvant fusion antigen genes 클로닝Cloning

PCR 산물인 CTB::필린 유전자에 클로닝 벡터인 pENTR^TM Directional TOPO Cloning(Invitrogen사)와 염 용액(salt solution)(Invitrogen사)을 각각 1 ml 넣어 조심스럽게 섞은 다음, 실온에서 1시간 반응시켰다. 이후 상기 반응 산물 2 ml와 E. coli One Shot TOP 10 cell(Invitrogen사)을 섞고 얼음에서 30분, 42℃에서 30초 반응시키고, 다시 얼음에서 10분간 두었다. S.O.C 배지 250 ㎕를 첨가하여 37℃에서 1시간 배양한 후 50 ㎕를 pENTR/D/TOPO의 선발마커인 항생제 카나마이신(50 ㎍/㎕)이 포함된 고체 LB배지에 도말하여 37℃ 배양기에서 16시간 두었고, 선발된 콜로니를 액체 LB배지 5 ml에 접종하여 키운 후 DNA-spin kit(Intron 사)를 이용하여 DNA를 추출하였다. 추출된 Topo-CTB::필린(pilin), fasG는 제한효소 EcoRI과 NotI로, Topo-CTB::fljB는 제한효소 HindIII로 잘라 확인하였다.
PENTR ^TM , a cloning vector for the PCR product CTB :: Philin gene 1 ml each of Directional TOPO Cloning (Invitrogen) and salt solution (Invitrogen) was carefully mixed and allowed to react at room temperature for 1 hour. Then 2 ml of the reaction product and E. coli One Shot TOP 10 cells (Invitrogen) were mixed and reacted for 30 minutes on ice and 30 seconds at 42 ° C, and then placed on ice for 10 minutes. After incubation for 1 hour at 37 ° C by adding 250 μl of SOC medium, 50 μl was plated on solid LB medium containing antibiotic kanamycin (50 μg / μl), a selection marker of pENTR / D / TOPO, for 16 hours in a 37 ° C incubator. The colonies were inoculated into 5 ml of liquid LB medium and grown, and DNA was extracted using a DNA-spin kit (Intron). Extracted Topo-CTB :: pilin and fasG were identified by restriction enzymes EcoRI and NotI, and Topo-CTB :: fljB was digested with restriction enzyme HindIII.

1-4. 시그널 1-4. signal 펩타이드(signal peptide)의Of peptides 융합 및 Fusion and PCRPCR 클로닝Cloning

세포 밖 공간에 축적되는 저온관련 유전자인 CLP(chitinase like protein)의 시그널 펩타이드(signal peptide)를 점막 면역보조제 융합 항원에 연결하였다. 시그널 펩타이드(Signal peptide)와 CTB::필린 유전자를 융합하기 위하여 프라이머를 재조합 PCR(Higuchi., 1990) 방법을 근거로 하여 제작하였다(표 3). 우선 각각의 유전자를 아래와 같은 방법으로 증폭한 후 재조합 PCR을 진행하였다. A signal peptide of CLP (chitinase like protein), which accumulates in the extracellular space, was connected to a mucosal adjuvant fusion antigen. Primers were prepared based on recombinant PCR (Higuchi., 1990) to fuse signal peptides with CTB :: phyllin genes (Table 3). First, each gene was amplified by the following method, followed by recombinant PCR.

sp::CTB::항원의 재조합 PCR 수행시 사용한 프라이머(서열번호 19 내지 23)Primers used to perform recombinant PCR of sp :: CTB :: antigen (SEQ ID NOs: 19 to 23) 이름name 서열order 산물product 시그널 펩타이드 5'
(서열번호 19)Signal peptide 5 '
(SEQ ID NO: 19) caccgttagcatggcgcggtatgctgcgct
caccgttagcatggcgcggtatgctgcgct
시그널 펩타이드(signal peptide)Signal peptide sp-CTB 3'(서열번호 20)sp-CTB 3 '(SEQ ID NO: 20) cttgagcttgatcatcgcgtagaaccccctcttgagcttgatcatcgcgtagaaccccct 시그널 펩타이드(signal peptide)Signal peptide CTB-sp-필린 3' (서열번호 21)CTB-sp-pilin 3 '(SEQ ID NO: 21) agggggttctacgcgatgatcaagctcaag
agggggttctacgcgatgatcaagctcaag
CTB필린(CTBpilin)CTBpilin 필린 3' (서열번호 22)Filin 3 '(SEQ ID NO: 22) tcatgctaggttcagcggagcgctccactgtcatgctaggttcagcggagcgctccactg CTB필린CTBpilinCTB Pilin 시그널 펩타이드 5' (서열번호 19)Signal peptide 5 '(SEQ ID NO: 19) caccgttagcatggcgcggtatgctgcgct
caccgttagcatggcgcggtatgctgcgct
spCTB필린(spCTBpilin)spCTBpilin CTB 필린 3'(서열번호 23)CTB Filin 3 '(SEQ ID NO: 23) tcatgctaggttcagcggagcgctccactgtcatgctaggttcagcggagcgctccactg spCTB필린(spCTBpilin)spCTBpilin

시그널 펩타이드 유전자를 클로닝하기 위해 다음 조건에서 PCR을 수행하였다; 템플레이트 pMJU-CLP 1 ng, 10× pfu 반응버퍼 5 ㎕, 10 mM dNTP 1 ㎕, pfu 폴리머라제 2.5 U(Solgent 사), 10 pmol sp 5' 프라이머(서열번호 19) 1 ㎕, 10 pmol sp-CTB 3' 프라이머(서열번호 20) 1 ㎕; 94℃ 5분, 94℃ 30초, 50.6℃ 30초, 72℃ 40초, 72℃ 5분. 상기 조건을 한 사이클(cycle)로 하여 총 35회 반복수행하였다.PCR was performed under the following conditions to clone the signal peptide genes; Template pMJU-CLP 1 ng, 10 μl pfu reaction buffer 5 μl, 10 mM dNTP 1 μl, pfu polymerase 2.5 U (Solgent) 1 μl 10 pmol sp 5 ′ primer (SEQ ID NO: 19), 10 pmol sp-CTB 1 μl 3 ′ primer (SEQ ID NO: 20); 94 ° C 5 minutes, 94 ° C 30 seconds, 50.6 ° C 30 seconds, 72 ° C 40 seconds, 72 ° C 5 minutes. A total of 35 repetitions of the above conditions were carried out in one cycle.

시그널 펩타이드 유전자를 얻기 위해 수행한 PCR 결과, 예상된 CL 의 시그널 펩타이드 유전자의 크기인 162bp의 결과물을 확인하였다. As a result of PCR performed to obtain the signal peptide gene, the result of 162 bp, which is the size of the expected peptide signal peptide gene, was confirmed.

그리고 CTB 항원 유전자를 클로닝하기 위해 다음 조건에서 PCR을 수행하였다; 템플레이트 TOPO-CTB::필린 1 ng, 10× pfu 반응버퍼 5 ㎕, 10 mM dNTP 1 ㎕, 10 pmol CTB-sp 5' 프라이머(agggggttctacgcgatgatcaagctcaag, 서열번호 24) 1 ㎕, 10 pmol 필린 3' 프라이머(서열번호 22) 1 ㎕, pfu 폴리머라제 2.5 U ; 94℃ 5분, 94℃ 30초, 50.6℃ 30초, 72℃ 4분, 72℃ 5분, 상기 조건을 한 사이클로 하여 총 35회 반복 수행하였다. 얻어진 각각의 PCR 산물은 1.0% TAE 아가로즈 젤에 전기영동 한 후 Gene Clean Kit (QIAGEN사)를 이용하여 젤로부터 분리하였다. CTB와 필린 유전자가 서로 융합된 항원유전자를 얻기 위해 수행한 PCR 결과, 예상된 1224bp 크기의 밴드가 증폭되었다.PCR was then performed under the following conditions to clone the CTB antigen gene; Template TOPO-CTB :: 1 ng of fillin, 5 μl of 10 × pfu reaction buffer, 1 μl of 10 mM dNTP, 10 pmol CTB-sp 5 ′ primer (agggggttctacgcgatgatcaagctcaag, SEQ ID NO: 24) 1 μl, 10 pmol pilin 3 ′ primer (SEQ ID NO: 24) No. 22) 1 μl, pfu polymerase 2.5 U; A total of 35 repetitions were performed at 94 ° C. for 5 minutes, 94 ° C. for 30 seconds, 50.6 ° C. for 30 seconds, 72 ° C. for 4 minutes, and 72 ° C. for 5 minutes. Each obtained PCR product was electrophoresed on 1.0% TAE agarose gel and then separated from the gel using Gene Clean Kit (QIAGEN). As a result of PCR performed to obtain an antigen gene in which CTB and filin genes were fused to each other, an expected 1224 bp band was amplified.

시그널 펩타이드 유전자와 CTB 항원 유전자 PCR 산물을 템플레이트로 하여 다음 조건에서 재조합 PCR을 수행하였다(Higuchi., 1990); 템플레이트 시그널 펩타이드 30 ng, 템플레이트 CTB 항원 30 ng, 10× pfu 반응버퍼 5 ㎕, 10 mM dNTP 1 ㎕, pfu 폴리머라제(Solgent 사) 2.5 U, 10 pmol sp 5' 프라이머 1 ㎕, CTB-sp 5' 프라이머 1 ㎕, 필린 3' 프라이머 1 ㎕, CTB-필린 3' 프라이머 1 ㎕; 94℃ 5분, 94℃ 30초, 45℃ 30초, 72℃ 4분을 한 사이클로 하여 총 5회 반복 수행하였으며, 94℃ 30초, 60℃ 30초, 72℃ 4분 72℃ 5분을 한 사이클로 하여 총 30회 반복 수행하였다. 얻어진 PCR 산물은 1.0% TAE 아가로즈 젤에 전기영동 한 후 Gene Clean Kit(QIAGEN사)를 이용하여 젤로부터 회수하였다. 시그널 펩타이드(sp)의 크기가 162bp로 매우 작기 때문에 sp 유전자의 융합여부를 정확히 확인하기 위하여 CTB 항원과 함께 비교하였다. sp-CTB-필린 유전자의 크기는 1386bp로 1224bp의 CTB-필린보다 사이즈가 큰 것을 확인하였다(도 2A).
Recombinant PCR was performed under the following conditions using a template of the signal peptide gene and the CTB antigen gene PCR product (Higuchi., 1990); Template signal peptide 30 ng, template CTB antigen 30 ng, 10 × pfu reaction buffer 5 μl, 10 mM dNTP 1 μl, pfu polymerase (Solgent) 2.5 U, 10 pmol sp 5 ′ primer 1 μl, CTB-sp 5 ' 1 μl primer, 1 μl filin 3 ′ primer, 1 μl CTB-filin 3 ′ primer; A total of 5 cycles were performed at 94 ° C 5 minutes, 94 ° C 30 seconds, 45 ° C 30 seconds, and 72 ° C 4 minutes in one cycle. A total of 30 iterations were performed in cycles. The obtained PCR product was electrophoresed on 1.0% TAE agarose gel and then recovered from the gel using Gene Clean Kit (QIAGEN). Since the signal peptide (sp) was very small at 162 bp, it was compared with the CTB antigen to confirm the fusion of the sp gene. The size of the sp-CTB-phyllin gene was 1386bp, which was larger than that of 1224bp CTB-phylline (FIG. 2A).

1-5. 분비형 점막 면역보조제 1-5. Secretory mucosal adjuvant 융합항원Fusion antigen PCRPCR 클로닝Cloning

시그널 펩타이드 유전자가 융합된 CTB-항원 유전자를 각각 pENTR^TM Directional TOPO Cloning(Invitrogen 사) 벡터에 라이게이션 하여 벡터 구축한 후 제한효소 NotI과 BglII를 처리하여 클로닝 여부를 확인하였다. 예상한 바와 같이 sp-CTB-pilin 유전자가 삽입된 경우는 3573bp, 299bp의 두 밴드가 관찰되었다(도 2B). 얻어진 TOPO벡터 클로닝 산물은 (주)솔젠트에 의뢰하여 염기배열을 파악하여 NCBI의 alignment와 blast를 통해 기존에 보고된 유전자와 동일함을 알아내었다.
PENTR ^™ , a CTB-antigen gene fused with a signal peptide gene, respectively Directional TOPO Cloning (Invitrogen) vectors were ligated to construct a vector and then cloned by treating with restriction enzymes NotI and BglII. As expected, when the sp-CTB-pilin gene was inserted, two bands of 3573bp and 299bp were observed (FIG. 2B). Obtained TOPO The vector cloning product was commissioned by Solgent Co., Ltd. to identify the base sequence and found that it is identical to the previously reported gene through NCBI alignment and blast.

1-6. 1-6. 식물형질전환용For plant transformation 벡터 구축 및 Vector building and 아그로박테리아Agrobacteria (( AgrobacteriaAgrobacteria )) 형질전환Transformation

pENTR/D/TOPO-CTB::antigen과 식물형질전환용 벡터인 pK2GW7.0(Invitrogen 사)를 LR clonase(Invitrogen 사)와 함께 혼합하여 25℃ 배양기에서 1시간 동안 배양하여 재조합시킨 뒤 proteinase K(Invitrogen 사) 1 ㎕를 넣고 잘 섞어 37℃ 배양기에서 10분간 LR clonase의 활성을 멈추게 하였다. E. coli One Shot TOP 10 cell(Invitrogen 사)에 위와 같은 방법으로 형질전환을 진행하고 pK2GW7.0 벡터 선발 마커인 항생제 스펙티노마이신(spectinomycin)(50 ㎍/㎕)이 포함된 고체 LB배지에 도말하여 37℃ 배양기에 16시간 배양하여 선발하였다. 콜로니 중 일부를 선택하여 액체 LB배지 5 ㎖에 키운 후 DNA-spin kit(Intron 사)을 이용하여 DNA를 추출하였다. pENTR / D / TOPO-CTB :: antigen and plant transformation vector pK2GW7.0 (Invitrogen) were mixed with LR clonase (Invitrogen), incubated for 1 hour in a 25 ° C incubator and recombined with proteinase K ( 1 μl of Invitrogen) was added and mixed well to stop LR clonase activity for 10 minutes in a 37 ° C. incubator. E. coli One shot TOP 10 cells (Invitrogen) were transformed in the same manner as above, and plated on solid LB medium containing antibiotic spectinomycin (50 ㎍ / μl), a pK2GW7.0 vector selection marker. The culture was selected by incubation for 16 hours. Some of the colonies were selected and grown in 5 ml of liquid LB medium, and DNA was extracted using a DNA-spin kit (Intron).

또한 pENTR/D/TOPO-sp::CTB::antigen과 식물형질전환용 벡터인 pK2GW7,0 (Invitrogen 사)를 LR clonase Ⅱ(Invitrogen 사)를 이용하여 재조합 시킨 뒤 형질전환된 콜로니로부터 추출된 pKCTB::antigen은 제한효소 HindIII로 잘라 확인하였다. 확인된 벡터는 freeze-thaw 방법으로 아그로박테리아(Agrobacteria) (GV3101)에 형질전환하였다 (안 남., 1999). 제한효소 처리 결과 예상한 바와 같이 sp-CTB-pilin 유전자가 삽입된 경우는 11616bp, 1284bp의 사이즈를 확인하였으며(도 2C), Freeze/Thaw 방법을 통하여 클로닝된 pKsp-CTB-antigen 벡터를 아그로박테리아 GV3101에 삽입한 후 콜로니 PCR 방법을 통해 형질전환 여부를 확인하였다.
In addition, pKCTB extracted from transformed colonies after recombination of pENTR / D / TOPO-sp :: CTB :: antigen and plant transformation vector pK2GW7,0 (Invitrogen) with LR clonase II (Invitrogen) :: antigen was determined by restriction enzyme HindIII. Identified bacteria Agrobacterium vector (Agrobacteria) by freeze-thaw method (GV3101) was transformed (Annam., 1999). As expected as a result of restriction enzyme treatment, when the sp-CTB-pilin gene was inserted, the size of 11616bp and 1284bp was confirmed (FIG. 2C), and the pKsp-CTB-antigen vector cloned through the Freeze / Thaw method was used for agrobacterium GV3101. After insertion in the colony PCR method was confirmed whether the transformation.

실시예Example 2: 2: 당근형질전환과Carrot transformation and 형질전환체의 분석 Transformant Analysis

2-1. 2-1. 아그로박테리아(Agrobacteria AgrobacteriaAgrobacteria )를) 이용한 당근 형질전환 Carrot Transformation

상기 실시예 1에서 분리한 점막면역보조제 융합 필린 유전자, 시그널 펩타이드가 결합된 점막면역보조제 융합 필린 유전자를 도입하기 위한 식물로 조춘 5촌(J; 중앙종묘), 한여름 5촌(H; 농우종묘), 만산 5촌(M; 중앙종묘)으로 이루어진 5 품종의 당근을 사용하였다. 당근 종자는 70% EtOH로 3번 씻고, 4% 유한락스로 30분간 소독한 후 멸균수를 이용하여 5~6번 씻어 준비하였다. 멸균 소독한 당근 종자를 0.8% 아가 배지에 치상하여 25℃ 암조건에서 7일간 발아시킨 배축을 0.3~0.5㎝ 간격으로 자른 후 MS⁺배지(4.4g/l MS 염 w/비타민(Duchefa 사), 0.1mg/l 2iP, 1mg/l 2,4-D, 3% 수크로스)에서 1~2일간 진탕배양 하였다. 2일간 M9배지(6g/l Na₂HPO₄, 3g/l KH₂PO₄, 0.5g/l NaCl, 1g/l NH₄Cl, 0.5g/l MgSO₄, 2g/l 글루코스, 0.015g/l CaCl₂)에 항생제(100㎍/㎕ 스펙티노마이신)를 첨가한 배지에서 키운 아그로박테리아(Agrobacteria)를 MS⁺배지에 재현탁하여 2일간 배양한 당근 배축과 암조건에서 5~10분간 공동배양한 후 식물절편을 멸균된 종인에 옮겨 공기 건조(air dry)한 후 액체 MS⁺배지에서 하루 현탁배양(25, 100rpm, 암조건)하여 카베니실린 400㎍/㎕와 카나마이신 100㎍/㎕이 포함된 고체 MS⁺배지에 옮긴 후 캘러스를 유도하였다.
Muchon immunity adjuvant fusion pilin gene isolated in Example 1, mucosa immunity adjuvant fusion pilin gene combined with signal peptides Chochon 5 village (J; Central seedling), midsummer 5 village (H; , 5 varieties of carrots (M; Joongsan Seedling) were used. Carrot seeds were washed three times with 70% EtOH, sterilized with 4% finite lacquer for 30 minutes, and then washed 5 to 6 times using sterile water. Sterilized sterilized carrot seeds were cut into 0.8% agar medium and germinated in embryos for 7 days at 25 ° C dark conditions at 0.3 ~ 0.5cm intervals, followed by MS ⁺ medium (4.4g / l MS salt w / vitamin (Duchefa), 0.1mg / l 2iP, 1mg / l 2,4-D, 3% sucrose) was incubated for 1 to 2 days. M9 medium for 2 days (6 g / l Na ₂ HPO ₄ , 3 g / l KH ₂ PO ₄ , 0.5 g / l NaCl, 1 g / l NH ₄ Cl, 0.5 g / l MgSO ₄ , 2 g / l glucose, 0.015 g / l Agrobacteria grown in a medium containing CaCl ₂ ) with antibiotics (100 μg / μl spectinomycin) were resuspended in MS ⁺ medium and co-cultivated for 2 to 10 days in carrot embryos and cancer conditions. The plant sections were then transferred to sterile strains and air dried, then suspended in liquid MS ⁺ medium for one day (25, 100 rpm, dark) to contain 400 μg / μl of carbenicillin and 100 μg / μl of kanamycin. Callus was induced after transfer to solid MS ⁺ medium.

2-2. 2-2. PCRPCR 을 통한 형질전환 당근의 분석Analysis of transgenic carrots

식물 genomic DNA를 분리한 후, 다음과 같은 조건에서 PCR을 수행하였다(Kang et al., 2004); 템플레이트 0.2~1 ㎍, 2× PCR master mixture(Inton 사) 10 ㎕, 10 pmol sp 5' primer, 10 pmol antigen 3' primer; 94℃ 2분, 94℃ 30초, 60℃ 1분, 72℃ 2분, 72℃ 5분. 상기 조건을 1사이클로 하여 35회 반복수행하였다. After separating plant genomic DNA, PCR was performed under the following conditions (Kang et al., 2004); Template 0.2-1 μg, 2 × PCR master mixture (Inton) 10 μl, 10 pmol sp 5 'primer, 10 pmol antigen 3' primer; 94 ° C 2 minutes, 94 ° C 30 seconds, 60 ° C 1 minute, 72 ° C 2 minutes, 72 ° C 5 minutes. The above condition was repeated 35 times with 1 cycle.

얻어진 PCR 산물을 1.0% TAE 아가(agar)에 전기영동하여 당근 식물 유전체 내로의 점막면역보조제 융합 필린 유전자 및 sp::CTB::pilin 유전자 도입 여부를 확인하였다. The obtained PCR product was electrophoresed in 1.0% TAE agar to confirm whether the mucosal adjuvant fusion pilin gene and sp :: CTB :: pilin gene were introduced into the carrot plant genome.

그 결과, 조사 대상 세포주의 76%에서 점막면역보조제 융합 필린 유전자가 게놈 DNA(genomic DNA) 내에 안정적으로 삽입되었음이 확인되었다(도 3). As a result, it was confirmed that the mucosal adjuvant fusion filin gene was stably inserted into genomic DNA in 76% of the cell line under investigation (FIG. 3).

또한 22개 세포주에서 sp::CTB::pilin 유전자가 삽입되었음을 확인하였고, 확인된 개체는 카나마이신 100 ㎍/㎖이 포함된 MS^- 배지에서 식물체로 재분화하였다(도 4).
In addition, it was confirmed that the sp :: CTB :: pilin gene was inserted in 22 cell lines, and the identified individuals were re ^{-differentiated} into plants in MS ^- medium containing 100 µg / ml of kanamycin (FIG. 4).

2-3. 2-3. 웨스턴Weston 블롯Blot 분석 analysis

추출된 전체 단백질을 15% SDS-PAGE를 이용하여 전기영동을 실시하였다. 전기영동이 끝난 후 Towbin buffer를 사용하여 70 V에서 2시간 30분 동안 블롯팅(blotting)하였다. TBST(100 mM Tris-HCl pH8.0, 150 mM NaCl, 0.05% Tween 20)에 10분간 씻은 후 TBST에 5% 무지방 우유(nonfat dry milk)를 넣은 용액에서 블롯킹(blocking)시켰다. 블롯킹된 멤브레인을 2회 TBST로 씻은 후 1차 항체(Pilin antibody)를 1:10,000의 비율로 TBST에 희석하여 30분간 흔들어 주고 다시 TBST로 20분씩 4회 씻어주고, 2차 항체(anti-rabbit IgG AP conjugate, Promega사)를 TBST에 1:7,500의 비율로 희석한 후 30분간 반응시켰다. 20분간 4회 TBST로 멤브레인을 씻어주고 물기만 마를 정도로 건조시킨 다음 10㎖ AP 용액(100 mM Tris HCl pH 9.5, 100 mM NaCl, 5 mM MgCl₂)에 66 ㎕ NPT(nitroblue tetrazolium, 50 ㎎/㎖)와 33 ㎕ BCIP (5-bromo-4-chloro-3-indolyl phosphate, 50 ㎎/㎖)를 첨가해 암상태의 상온에서 발색반응을 하여 분석하였다. The extracted whole protein was subjected to electrophoresis using 15% SDS-PAGE. After electrophoresis, blotting was performed for 2 hours and 30 minutes at 70 V using Towbin buffer. After washing for 10 minutes in TBST (100 mM Tris-HCl pH8.0, 150 mM NaCl, 0.05% Tween 20) was blocked in a solution containing 5% nonfat dry milk in TBST. After washing the blocked membrane with TBST twice, dilute the primary antibody (Pilin antibody) in TBST at a ratio of 1: 10,000, shake it for 30 minutes, wash again 4 times with TBST for 20 minutes, and then use the secondary antibody (anti-rabbit). IgG AP conjugate, Promega) was diluted in a ratio of 1: 7,500 in TBST and reacted for 30 minutes. Rinse the membrane with TBST four times for 20 minutes, dry to dryness, and then 66 µl NPT (nitroblue tetrazolium, 50 mg / ml) in 10 ml AP solution (100 mM Tris HCl pH 9.5, 100 mM NaCl, 5 mM MgCl ₂ ). ) And 33 μl BCIP (5-bromo-4-chloro-3-indolyl phosphate, 50 mg / ml) were added and analyzed by color reaction at room temperature in the dark.

웨스턴 분석 결과, 4계통에서 도입된 유전자의 발현에 따라 예상되는 28.7 kDa (pilin), 42.9 kDa (CTB::pilin)의 단백질이 생성됨을 확인하였다(도 5). 도 5에서 P는 양성대조군으로 K88ac의 필린 유전자를 대장균에서 발현시킨 것이고, N은 비 형질전환된 당근이고 1-4는 NCTJ17-3, NCTH21-5, NCTH34-1 및 NCTH40-1로 형질전환당근이다. As a result of Western analysis, it was confirmed that 28.7 kDa (pilin) and 42.9 kDa (CTB :: pilin) proteins were generated according to the expression of the genes introduced in four lines (FIG. 5). In FIG. 5, P is a positive control group expressing K88ac filin gene in E. coli, N is a non-transformed carrot and 1-4 is NCTJ17-3, NCTH21-5, NCTH34-1 and NCTH40-1 to be.

반면에 대조 식물에서는 이들 단백질이 발현되지 않았다. In contrast, these proteins were not expressed in control plants.

또한 기내 배양하면서 당근 캘러스, 미성숙 배 및 유식물을 따로 분석하여 발달 단계에 따른 항원 발현 양이 차이 나는 것을 확인한 결과 대체로 동일 조직당 항원양이 가장 많이 발현되는 것은 캘러스였다(도 6. 표 4). 표 5는 NspCT J 11-1 세포의 각 발달 단계에서 필린 항원의 농도를 나타낸 것이다. In addition, carrot callus, immature embryos and seedlings were analyzed separately during in-flight cultivation to confirm that the antigen expression amount was different according to the developmental stage. As a result, callus was most expressed in the same amount of tissue per tissue (FIG. 6. Table 4). . Table 5 shows the concentrations of filin antigens at each developmental stage of NspCT J 11-1 cells.

실시예Example 3: 3: 당근형질전환과Carrot transformation and 형질전환체의 기내 배양 Incubation of transformants

3-1. 3-1. 캘러스Callus 생장에 빛이 미치는 영향 Effect of light on growth

명/암 조건에 따른 백신당근 캘러스의 최적 배양기간을 확인하기 위한 실험을 15일마다 배지를 교체해 주면서 수행하였는데, 명/암에 따른 큰 생장차이는 없는 것으로 나타났으며, 45일 정도에 정지기에 도달하는 것으로 판단되어 추후 진행되는 실험의 배양기간은 45일로 정하였다.
Experiments were conducted to determine the optimal incubation period of the vaccine carrot callus according to light / dark conditions by changing the medium every 15 days. There was no significant difference in growth according to light / dark. The incubation period of subsequent experiments was determined to be 45 days.

3-2. 당 농도에 따른 3-2. According to sugar concentration 캘러스Callus 생장 growth

최적 자당(sucrose) 농도를 규명하기 위하여 백신당근 NspCT 캘러스는 자당(sucrose)　1, 3, 7%로 처리하였고, 유식물체는 1, 2.5, 7%로 처리하여 생물반응기에서 배양하였다. 그 결과, 캘러스는 자당을 3%로 처리했을 때, 유식물체는 자당을 2.5%으로 처리했을 때 생장속도가 가장 빨랐다.
To determine the optimal sucrose concentration, the vaccine carrot NspCT callus was treated with sucrose 1, 3 and 7%, and the seedlings were treated with 1, 2.5 and 7% and cultured in a bioreactor. As a result, callus treated at 3% sucrose and seedlings at 2.5% sucrose.

3-3. 호르몬 조건3-3. Hormonal conditions

형질전환 백신당근 캘러스의 최적 식물호르몬 조건을 규명하기 위하여 MS 기본배지에 옥신류(2,4-D, NAA, IBA)는 0, 1, 2, 5ppm 농도로, 싸이토카인류(kinetin, BA, 2-IP)는 0, 0.1, 0.2, 0.5ppm으로 처리하여 실험하였다. 그 중 2,4-D와 싸이토카인류의 농도별 조합에 의한 결과는 2,4-D 1ppm과 키네틴(kinetin) 0.1ppm을 조합으로 처리하였을 때 가장 생장이 좋았으며, 45일 배양 후 접종량(배지량의 0.1%)의 60배까지 생장하였다.
In order to determine the optimal plant hormone condition of transgenic vaccine carrot callus, auxin (2,4-D, NAA, IBA) concentrations of 0, 1, 2, 5 ppm in the basic MS medium, cytokines (kinetin, BA, 2) -IP) was tested by treatment with 0, 0.1, 0.2, 0.5ppm. Among the combinations of 2,4-D and cytokines by concentration, the best results were obtained when 2,4-D 1ppm and 0.1 ppm of kinetin were treated in combination. Up to 60 times).

3-4. 생물반응기의 공기 주입량 3-4. Air injection volume of bioreactor

생물반응기의 최적 공기 주입량을 설정하기 위하여 백신당근 캘러스는 배지량의 0.2%를 접종한 후 공기주입량을 300, 700, 1,500cc/min로, 유식물체는 배지량의 0.5%를 접종한 후 공기주입량을 300, 700, 1,500cc/min로 하여 실험하였다. 그 결과, 공기주입량 300cc/min 일 때 가장 생장이 좋았다.
Vaccine carrot callus was inoculated with 0.2% of the media volume to 300, 700, 1,500cc / min and seedlings were inoculated with 0.5% of the media volume. , 700, 1,500cc / min was tested. As a result, the best growth was obtained when the air injection amount was 300 cc / min.

실시예Example 4: 4: 필린Filin -- CTBCTB 항원이 형질전환된 당근의 경구투여를 통한 돼지 대장균 설사증 예방 효과 Prevention of swine E. coli diarrhea through oral administration of antigen-transformed carrot

14일령된 3원 교잡종(Duroc × Yorkshire × Landrace) 자돈(전북 소재 대상 농장) 36 마리를 12마리씩 총 3 그룹으로 나누었다. 하기 표 5에 기재된 각 시험사료를 유지사료(선진)에 첨가하여 각 그룹의 자돈에 경구투여하였다. 시험사료의 투여는 14일령, 18일령 및 22일령에 4일 간격으로 3회에 걸쳐 수행하였다. 이때 음성 대조구에는 유지사료만을 투여하였으며, 실험구에는 시험사료(필린-CTB 융합 유전자) 240g을 펜(pen) 단위로 사료 2400g에 혼합하여 투여하였다(사료 총 중량에 대하여 10 중량%로 투여). 하기 표 3에 기재된 각 당근의 중량은 모두 건조 중량(dry weight)이다.Thirteen 36-day-old three-way hybrids (Duroc × Yorkshire × Landrace) piglets (target farms in Jeonbuk) were divided into three groups of 12 animals. Each test feed described in Table 5 below was added to the maintenance feed (advanced) and orally administered to piglets of each group. Administration of the test feed was performed three times at four-day intervals at 14, 18 and 22 days of age. At this time, only the maintenance feed was administered to the negative control, and 240 g of the test feed (phyllin-CTB fusion gene) was mixed and administered to 2400 g of feed in pen units (administered at 10% by weight based on the total weight of the feed). The weight of each carrot shown in Table 3 is a dry weight (dry weight).

실험그룹 및 그에 따른 시험사료Experimental Group and Test Feeds 그룹 group 도면상 표기 Notation in drawing 시험 사료Trial feed 음성 대조구 Negative control CHACCHAC -- 실험구Experimental Section NctNct 필린-CTB 융합 유전자 형질전환 당근(20g/두)Filin-CTB fusion gene transgenic carrot (20 g / two) 음성 대조구 Negative control NN 필린 항원 유전자 발현 당근(20g/두)Phyllin antigen gene expression carrot (20 g / two)

이후, 자돈이 26일령이 되었을 때 K88ac(단국대학교 김인호 교수님으로부터 분양받음)를 6×10¹¹cfu/㎖의 농도로 2㎖씩 1회 공격접종하였다. 그런 후 12시간 간격으로 쉐르만 등의 방법(Sherman et al., Infect Immun.42:656-658, 1983)에 따라 FC 스코어(fecal score)(정상적인 분: 0, 연변: 1, 묽은 설사: 2, 심한 설사: 3)를 측정하였다.Then, when piglets were 26 days old, K88ac (prepared by Professor Kim In-ho from Dankook University) was challenged once with 2 ml at a concentration of 6 × 10 ¹¹ cfu / ml. Then, at 12 hour intervals, according to Sherman et al., Infect Immun. 42: 656-658, 1983, the FC score (normal minute: 0, stool: 1, diarrhea: 2). , Severe diarrhea: 3) was measured.

대장균의 공격접종 12시간 후부터 3일간 측정하여 FC 스코어의 측정 결과를 도 7에 도시하였다. 도 7에 도시된 바와 같이, 본 발명에 따른 점막면역보조제 융합 필린 항원이 형질전환된 당근을 투여한 경우에는 필린 항원에 비하여 설사가 적게 유발되었다. 특히 공격접종한지 3일째 되는 날에는 2배 넘게 차이가 발생되었다. 상기 결과로부터 본 발명에 따라 장독성 대장균 유래의 필린 유전자에 점막면역보조제(CTB)를 융합하여 도입된 형질전환 당근이 단일 필린 유전자가 형질전환 당근에 비하여 돼지 대장균 설사증에 대하여 탁월한 예방 효과를 나타냄을 알 수 있다.
The measurement result of FC score was measured for 3 days after 12 hours of challenge inoculation of E. coli, and is shown in FIG. As shown in FIG. 7, when the carrot was transfected with the mucosal adjuvant fusion fibrin antigen according to the present invention, diarrhea was less induced than the fibrin antigen. In particular, the difference occurred more than twice on the third day after the challenge. From the above results, the transgenic carrots introduced by fusing mucosal immunity adjuvant (CTB) to the phyllogenic gene derived from E. coli in accordance with the present invention exhibited an excellent preventive effect against swine E. coli diarrhea compared to the transgenic carrot. Able to know.

실시예Example 5: 5: spsp -- 필린Filin -- CTBCTB 가 형질전환된 당근의 경구투여를 통한 돼지 대장균 설사증의 예방 효과 Effect of E. coli diarrhea through oral administration of transgenic carrot

시그널 펩타이드를 융합한 sp-pilin-CTB 융합 유전자가 형질전환된 형질전환체의 돼지 설사증 예방효과를 알아보기 위해 Mouse는 8주령된 BALB/c로 그룹당 8마리를 사용하였다. 대조구로는 일반당근 30mg과 사료를 먹이고 처리구는 미성숙 배 25mg(4.03ug), 캘러스 20mg(3.8ug), 유식물 35mg(3.836ug), 미성숙배 + 유식물 20mg(3.98ug)계통의 당근 형질전환체를 동결건조하여 곱게 간 후 증류수와 혼합하여 사용하였다. 일주일 간격으로 4번의 경구투여로 시료를 먹였으며 경투투여 2일 전과 경구투여 4일 후에 혈청을 얻어냈다(도 8). In order to investigate the prevention effect of pig diarrhea of transformants transformed with sp-pilin-CTB fusion gene fused with signal peptide, 8 rats of 8-week old BALB / c were used per group. The control group was fed 30 mg of normal carrot and feed, and the treated group was 25 mg (4.03 ug) of immature pear, 20 mg (3.8 ug) of callus, 35 mg (3.836 ug) of seedlings, immature embryos + 20 mg (3.98 ug) of seedlings. The sieve was lyophilized, ground finely, and mixed with distilled water. Samples were fed by four oral administrations at weekly intervals and serum was obtained two days before and four days after oral administration (FIG. 8).

항원을 카보네이트 코팅 버퍼(Carbonate coating buffer)(0.1M, pH 9.6)에 3,000배 희석 하고 ELISA 플레이트 각 웰에 코팅 버퍼로 희석된 항원 100ul씩 분주한 다음 4℃에 밤새 배양 시킨 후 세척 완충용액(Washing buffer)을 각 웰에 200ul씩 분주한 다음 3회 세척한다. 웰에 블롯킹 버퍼(Blocking buffer) 200ul씩 분주한 다음 37℃, 1시간 정치고 세척 완충용액(Washing buffer)을 각 웰에 200ul씩 분주한 다음 3회 세척하였다. 그런 후 conjugate anti-bovine IgG peroxidase PBS에 1:8000 비율로 희석하여 각 웰에 100ul씩 분주한 후 37℃, 1시간 반응시켰다. 세척 완충용액을 각 웰에 200ul씩 분주한 다음 4회 세척하였다. 기질(OPD)을 각 웰에 100ul씩 분주한 다음 실온에서 정확히 10분간 반응시키고, 정지 용액(Stopping solution) 50ul를 가하여 반응을 중지시키고 ELISA 판독기 450nm로 흡광도를 측정하였다. 쥐에 대한 당근 형질전환체 미성숙배, 유식물, 캘러스, 미성숙배+유식물, 뿌리등과 같이 조직별로 경구 투여시 병원균 항체 생성 여부를 규명하기 위하여 1주 간격으로 4회 경구투여하고 혈청을 채취하였다. 채취한 혈청으로 필린 단백질과 반응을 확인한 결과 대조구와 처리구간의 유의적인 차이가 있었고 캘러스가 가장 높은 차이를 보였다(도 9).
The antigen was diluted 3,000-fold in carbonate coating buffer (0.1M, pH 9.6), and 100 ul of the antigen diluted in the coating buffer was dispensed in each well of the ELISA plate, followed by incubation at 4 ° C. overnight, followed by washing. buffer) is dispensed into each well of 200ul and washed three times. 200 ul of blocking buffer was dispensed into the wells, and then, 200 1 of washing buffer was placed in each well at 37 ° C. for 1 hour, and then washed three times. Then, diluted 1: 8000 ratio in conjugate anti-bovine IgG peroxidase PBS was dispensed 100ul each well and reacted at 37 ℃, 1 hour. Wash buffer was dispensed into each well of 200 ul and then washed four times. The substrate (OPD) was dispensed into each well for 100ul and then reacted for exactly 10 minutes at room temperature. The reaction was stopped by adding 50ul of stopping solution, and the absorbance was measured with an ELISA reader 450nm. Carrot transformants in rats were orally administered 4 times per week and serum collected to determine whether pathogen antibodies were produced when administered orally by tissue such as immature embryos, seedlings, callus, immature embryos + seedlings and roots. It was. As a result of confirming the reaction with fibrin protein with the collected serum, there was a significant difference between the control and the treatment group and the callus showed the highest difference (FIG. 9).

또한 시그널 펩타이드를 융합한 sp-pilin-CTB 융합 유전자가 형질전환된 형질전환체를 직접 돼지에 투여하여 돼지 대장균 설사증의 예방 효과를 알아보았다. In addition, a transformant transformed with a sp-pilin-CTB fusion gene fused with a signal peptide was directly administered to pigs to examine the prevention effect of S. coli diarrhea.

Escherichia coli (E. coli )에 대한 백신을 실시하지 않은 양돈장의 모돈(요크셔 x 랜드레이스)을 대상으로 비형질전환 당근 백신 투여군(음성 대조군, CHAC), 시중 판매되고 있는 재조합 백신(Porcilis coli, Intervet korea Ltd.) 투여군(양성 대조구, RVI), 형질전환 당근 백신 투여군(실험구, NspCT)으로 각 5두씩을 선발하여 비형질전환 당근 투여군은 분만전 2주와 4주전에 각 25g씩의 비형질전환 당근을 투여하였다. 재조합 백신 투여군은 재조합 백신(Porcilis coli, Intervet korea Ltd.) 2ml을 목뒤 근육부위에 접종하였고, 형질전환 당근 백신 투여군은 2.34mg의 항원양이 되는 25g의 형질전환 당근 백신을 분만전 2주와 4주전에 각각 경구투여하였다. 분만 당일 초유를 수집하였고 같은 시기에 출생된 포유자돈을 각 군당 10두를 선발하여 7일간 포유를 시킨 후에 실험 사육돈방(2.0 X 1 X 0.5m)으로 이동하여 사육하였으며 보온시설하에 주위환경을 통제하였고 돈방의 온도와 습도는 일정하게 유지시켰으며 돈방바닥은 매일 청소를 실시하였다. Escherichia Non-transgenic carrot vaccine group (negative control, CHAC) and commercially available recombinant vaccines (Porcilis coli, Intervet korea) for sows (Yorkshire x Landrace) in pig farms not vaccinated against coli (E. coli ) . Ltd.) administration group (positive control group, RVI) and transgenic carrot vaccine administration group (experimental group, NspCT), each 5 heads were selected, and the non-transgenic carrot administration group was transformed by 25 g each for 2 and 4 weeks before delivery. Carrots were administered. The recombinant vaccine group was inoculated with 2 ml of the recombinant vaccine (Porcilis coli, Intervet Korea Ltd.) in the muscle area of the back of the neck. The transgenic carrot vaccine group received 25 g of the transformed carrot vaccine, which is 2.34 mg of antigen, 2 weeks and 4 days before delivery. Each week was administered orally. The colostrum was collected on the day of delivery and 10 pigs were born at the same time for each group for 7 days and then transferred to the experimental breeding pig room (2.0 X 1 X 0.5m) for breeding. The temperature and humidity of the piglet were kept constant, and the piglet was cleaned daily.

실험구와 대조구의 포유자돈은 각각의 실험돈방에 24시간 동안 적응시킨 후 8일령에 공격접종을 실시하였고 포유자돈에 ETEC의 공격접종은 카테타를 이용하여 모든 처리구에 천안 단국대학교 동물자원과학과 사료 영양학 실험실에서 분양받은 장독소 대장균 K88ac를 1.0× 10¹⁰CFU/ml경구투여 한 후에 초기반응을 보기 위하여 각 군당 5두는 3일간 관찰하였고 나머지 5두는 7일간 관찰하였다. 실험자돈은 시기별로 채혈하고 체중을 측정하였다. Mammal pigs from experimental and control groups were adapted to each experimental pig for 24 hours and then challenged at 8 days of age. The challenge of ETEC was applied to all pigs from Cheonan Dankook University animal resources science and feed nutrition laboratory. After the oral administration of E. coli K88ac pretreated at 1.0 × 10 ¹⁰ CFU / ml, five heads of each group were observed for three days and the remaining five were observed for seven days. The experimental pigs were collected and weighed for each period.

실험기간 동안에는 대용유(돈돈밀크, (주)제일제단사료)를 제조사의 권장사항에 따라 급여하였고 음수는 자유롭게 섭취하도록 하였으며 돈방 주위는 정기적으로 소독하였다. 또한 공격접종을 한 후 최초 12시간 후와 공격접종 후 24시간 간격으로 Sherman 등 (1983)의 방법에 의하여 설사지수(Fecal Consistency (FC) score)(정상적인 분, 0; 연변, 1; 묽은 설사, 2; 심한설사, 3)를 측정하였다.
During the experimental period, substitute oil (Dondon Milk, Cheil First Foods Co., Ltd.) was fed according to the manufacturer's recommendation. Drinking water was freely consumed. In addition, by the method of Sherman et al. (1983) at intervals of 12 hours after the first vaccination and 24 hours after the vaccination, the Fecal Consistency (FC) score (normal minute, 0; yeonyeon, 1; weak diarrhea, 2; severe diarrhea, 3) was measured.

측정한 결과, 비형질전환 당근 투여군은 공격접종후 12시간 후에 설사를 시작하였고 재조합 백신 투여군과 본원발명의 형질전환 당근 백신 투여군은 24시간후 부터 설사를 시작하였다. 형질전환 당근 백신 투여군은 나머지 군과 유의적으로 낮은 설사지수를 보였다. 공격접종후 2일차부터 6일차까지 형질전환 당근 백신 투여군의 설사지수가 나머지 군에 비하여 다소 낮은 경향을 보였으나 유의적인 차이는 없었다. 그러나 7일차에 본원발명의 형질전환 당근 백신 투여군의 설사지수가 0.4로 비형질전환 당근 투여군과 재조합백신 투여군 각각 1.2와 0.8보다 유의적으로 낮은 설사 지수를 보였다(도 10).
As a result, the non-transgenic carrot administration group began diarrhea 12 hours after challenge and the recombinant vaccine administration group and the transformed carrot vaccine administration group of the present invention started diarrhea 24 hours later. The transgenic carrot vaccine group had a significantly lower diarrhea index than the rest. Diarrhea index of transgenic carrot vaccine group from day 2 to day 6 was slightly lower than that of the other groups, but there was no significant difference. However, on the 7th day, the diarrhea index of the transformed carrot vaccine-treated group of the present invention was 0.4, which was significantly lower than 1.2 and 0.8, respectively, in the non-transgenic carrot-treated group and the recombinant vaccine-treated group (FIG. 10).

<110> Industry-Academic Cooperation Foundation, Dankook University <120> A vaccine composition against porcine E. coli diarrhea <130> PA100792/KR <150> KR10-2010-0113896 <151> 2010-11-16 <160> 34 <170> KopatentIn 1.71 <210> 1 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB1 <400> 1 caccatgatc aagctcaagt ttggagtgtt cttcactgtg ctcc 44 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB2 <400> 2 ttagctctgc ctatgcacat ggcaccccac aaaacatcac 40 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB1-2 <400> 3 tcacaagaag tgacacgagg aatcgagacg gatacgtgta 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB3 <400> 4 tgacttgtgt gctgagtacc ataacaccca gatccatacc 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB4 <400> 5 ctcagtgaca agatcttgag ctacaccgag agccttgctg 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB3-4 <400> 6 tattgtgggt ttaggtatgg gagttactgt tctagaaatc 40 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB5 <400> 7 gcaagaggga gatggctatc atcaccttca agaatggtgc 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB6 <400> 8 taccttccaa gtggaggtgc ctggaagcca acatattgat 40 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB5-6 <400> 9 tagtggaagt tcttaccacg atggaaggtt cacctccacg 40 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB7 <400> 10 agccaaaaga aggccattga gaggatgaag gacacactta 40 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB8 <400> 11 ggattgctta cctcactgag gctaaggtgg agaagctttg 40 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB7-8 <400> 12 ctcctacttc ctgtgtgaat cctaacgaat ggagtgactc 40 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB9 <400> 13 tgtgtggaac aacaagaccc ctcatgctat tg 32 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB10 <400> 14 ctgccatcag catggctaat ggacctggac ct 32 <210> 15 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB9-10 <400> 15 gttctgggga gtacgataac gacaatagtc gtaccgatta 40 <210> 16 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 3' primer for CTB-pilin fusion <400> 16 cagagtcttt ttcataggtc caggtccatt agccatgctg 40 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 5' primer for pilin-CTB fusion <400> 17 cagcatggct aatggacctg gacctatgaa aaagactctg 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 3' primer for pilin fusion <400> 18 tcatgctagg ttcagcggag cgctccactg agtgctggta 40 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 5' primer for signal peptide <400> 19 caccgttagc atggcgcggt atgctgcgct 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 3' primer for sp-CTB <400> 20 cttgagcttg atcatcgcgt agaaccccct 30 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 3' primer for CTB-sp-pilin <400> 21 agggggttct acgcgatgat caagctcaag 30 <210> 22 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 3' primer for pilin <400> 22 tcatgctagg ttcagcggag cgctccactg 30 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB-pilin <400> 23 tcatgctagg ttcagcggag cgctccactg 30 <210> 24 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 5' primer for CTB-sp <400> 24 agggggttct acgcgatgat caagctcaag 30 <210> 25 <211> 56 <212> PRT <213> Artificial Sequence <220> <223> signal peptide of CLP <400> 25 Leu Leu Val Ser Met Ala Arg Tyr Ala Ala Leu Ala Ala Leu Leu Leu 1 5 10 15 Ala Val Ala Val Gly Gly Ala Ala Ala Gln Gly Val Gly Ser Val Ile 20 25 30 Thr Gln Ser Val Tyr Ala Ser Met Leu Pro Asn Arg Asp Asn Ser Gln 35 40 45 Cys Pro Ala Arg Gly Phe Tyr Ala 50 55 <210> 26 <211> 168 <212> DNA <213> Artificial Sequence <220> <223> signal peptide of CLP <400> 26 cttctagtta gcatggcgcg gtatgctgcg ctcgccgcgc tcctgctcgc cgtggcggtg 60 ggcggcgccg cggcgcaggg cgtgggctcc gtcatcacgc aatcggtgta cgcgagcatg 120 ctgcccaacc gcgacaactc gcagtgcccg gccagggggt tctacgcg 168 <210> 27 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> CTB <400> 27 Met Ile Lys Leu Lys Phe Gly Val Phe Phe Thr Val Leu Leu Ser Ser 1 5 10 15 Ala Tyr Ala His Gly Thr Pro Gln Asn Ile Thr Asp Leu Cys Ala Glu 20 25 30 Tyr His Asn Thr Gln Ile His Thr Leu Asn Asp Lys Ile Leu Ser Tyr 35 40 45 Thr Glu Ser Leu Ala Gly Lys Arg Glu Met Ala Ile Ile Thr Phe Lys 50 55 60 Asn Gly Ala Thr Phe Gln Val Glu Val Pro Gly Ser Gln His Ile Asp 65 70 75 80 Ser Gln Lys Lys Ala Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Ala 85 90 95 Tyr Leu Thr Glu Ala Lys Val Glu Lys Leu Cys Val Trp Asn Asn Lys 100 105 110 Thr Pro His Ala Ile Ala Val Ile Ser Met Ala Asn 115 120 <210> 28 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> CTB <400> 28 atgatcaagc tcaagtttgg agtgttcttc actgtgctcc ttagctctgc ctatgcacat 60 ggcaccccac aaaacatcac tgacttgtgt gctgagtacc ataacaccca aatccatacc 120 ctcaatgaca agatcttgag ctacaccgag agccttgctg gcaagaggga gatggctatc 180 atcaccttca agaatggtgc taccttccaa gtggaggtgc ctggaagcca acatattgat 240 agccaaaaga aggccattga gaggatgaag gacacactta ggattgctta cctcactgag 300 gctaaggtgg agaagctttg tgtgtggaac aacaagaccc ctcatgctat tgctgttatc 360 agcatggcta at 372 <210> 29 <211> 279 <212> PRT <213> Artificial Sequence <220> <223> pilin <400> 29 Met Lys Lys Thr Leu Ile Ala Leu Ala Met Ala Ala Ser Ala Ala Ser 1 5 10 15 Gly Met Ala His Ala Trp Met Thr Gly Asp Phe Asn Gly Ser Val Asp 20 25 30 Ile Gly Gly Ser Ile Thr Ala Asp Asp Tyr Arg Gln Lys Trp Glu Trp 35 40 45 Lys Val Gly Thr Gly Leu Asn Gly Phe Gly Asn Val Leu Asn Asp Leu 50 55 60 Thr Asn Gly Gly Thr Lys Leu Thr Ile Thr Gly Thr Gly Asn Lys Pro 65 70 75 80 Ile Leu Leu Gly Arg Thr Lys Glu Ala Phe Ala Thr Pro Val Thr Gly 85 90 95 Gly Val Asp Gly Ile Pro His Ile Ala Phe Thr Asp Tyr Glu Gly Ala 100 105 110 Ser Val Val Leu Arg Asn Pro Asp Gly Glu Thr Asn Lys Lys Gly Leu 115 120 125 Ala Tyr Phe Val Leu Pro Met Lys Asn Ala Glu Gly Thr Lys Val Gly 130 135 140 Ser Glu Lys Val Asn Ala Ser Tyr Ala Gly Val Leu Gly Arg Gly Gly 145 150 155 160 Val Thr Ser Ala Asp Gly Glu Leu Leu Ser Leu Phe Ala Asp Gly Leu 165 170 175 Ser Ser Ile Phe Cys Gly Gly Leu Pro Arg Gly Ser Glu Leu Ser Ala 180 185 190 Gly Ser Ala Ala Ala Ala Arg Thr Lys Leu Phe Gly Ser Leu Ser Arg 195 200 205 Asn Asp Ile Leu Gly Gln Ile Gln Arg Val Asn Ala Asn Ile Thr Ser 210 215 220 Leu Val Asp Val Ala Gly Ser Tyr Arg Glu Asn Met Glu Tyr Thr Asp 225 230 235 240 Gly Thr Val Val Ser Ala Ala Tyr Ala Leu Gly Ile Ala Asn Gly Gln 245 250 255 Thr Ile Glu Ala Thr Phe Asn Gln Ala Val Thr Thr Ser Thr Gln Trp 260 265 270 Ser Ala Pro Leu Asn Leu Ala 275 <210> 30 <211> 840 <212> DNA <213> Artificial Sequence <220> <223> pilin <400> 30 atgaaaaaga ctctgattgc actggcaatg gctgcatctg ctgcatctgg tatggcacat 60 gcctggatga ctggtgattt caatggttcg gtcgatatcg gtggtagtat cactgcagat 120 gattatcgtc agaaatggga atggaaagtt ggtacaggtc ttaatggatt tggtaatgta 180 ttgaatgacc tgaccaatgg tggaaccaaa ctgaccatta ctggtactgg taataagcca 240 attttgttag gccggaccaa agaagcattt gctacgccag taactggtgg tgtagatgga 300 attcctcata ttgcatttac tgactatgaa ggagcttctg tagtactcag aaaccctgat 360 ggtgaaacta ataaaaaagg tttagcatat tttgttctgc cgatgaaaaa tgcagagggc 420 actaaagttg gttcagagaa agtgaatgca tcttatgccg gtgtgttagg gagaggtggg 480 gttacttctg cggacgggga gctgctttcg ctttttgccg acgggttgag ctctatcttt 540 tgtggtggtt tgccgagggg ttctgaactc tcggctggga gtgccgcagc ggcgcgcaca 600 aagttgtttg gaagtctatc aagaaatgat attctcggac agattcaaag agtaaacgca 660 aatattactt ctcttgttga cgtcgcaggt tcttacaggg aaaacatgga gtacactgat 720 ggaactgttg tttctgctgc ctatgcactg ggtattgcaa acggtcagac tattgaggca 780 acttttaatc aggctgtaac taccagcact cagtggagcg ctccgctgaa cctagcatga 840 840 <210> 31 <211> 407 <212> PRT <213> Artificial Sequence <220> <223> CTB::pilin <400> 31 Met Ile Lys Leu Lys Phe Gly Val Phe Phe Thr Val Leu Leu Ser Ser 1 5 10 15 Ala Tyr Ala His Gly Thr Pro Gln Asn Ile Thr Asp Leu Cys Ala Glu 20 25 30 Tyr His Asn Thr Gln Ile His Thr Leu Asn Asp Lys Ile Leu Ser Tyr 35 40 45 Thr Glu Ser Leu Ala Gly Lys Arg Glu Met Ala Ile Ile Thr Phe Lys 50 55 60 Asn Gly Ala Thr Phe Gln Val Glu Val Pro Gly Ser Gln His Ile Asp 65 70 75 80 Ser Gln Lys Lys Ala Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Ala 85 90 95 Tyr Leu Thr Glu Ala Lys Val Glu Lys Leu Cys Val Trp Asn Asn Lys 100 105 110 Thr Pro His Ala Ile Ala Val Ile Ser Met Ala Asn Gly Pro Gly Pro 115 120 125 Met Lys Lys Thr Leu Ile Ala Leu Ala Ile Ala Ala Ser Ala Ala Ser 130 135 140 Gly Met Ala His Ala Trp Met Thr Gly Asp Phe Asn Gly Ser Val Asp 145 150 155 160 Ile Gly Gly Ser Ile Thr Ala Asp Asp Tyr Arg Gln Lys Trp Glu Trp 165 170 175 Lys Val Gly Thr Gly Leu Asn Gly Phe Gly Asn Val Leu Asn Asp Leu 180 185 190 Thr Asn Gly Gly Thr Lys Leu Thr Ile Thr Val Thr Gly Asn Lys Pro 195 200 205 Ile Leu Leu Gly Arg Thr Lys Glu Ala Phe Ala Thr Pro Val Thr Gly 210 215 220 Gly Val Asp Gly Ile Pro His Ile Ala Phe Thr Asp Tyr Glu Gly Ala 225 230 235 240 Ser Val Val Leu Arg Asn Pro Asp Gly Glu Thr Asn Lys Lys Gly Leu 245 250 255 Ala Tyr Phe Val Leu Pro Met Lys Asn Ala Glu Gly Thr Lys Val Gly 260 265 270 Ser Val Lys Val Asn Ala Ser Tyr Ala Gly Val Leu Gly Arg Gly Gly 275 280 285 Val Thr Ser Ala Asp Gly Glu Leu Leu Ser Leu Phe Ala Asp Gly Leu 290 295 300 Ser Ser Ile Phe Cys Gly Gly Leu Pro Arg Gly Ser Glu Leu Ser Ala 305 310 315 320 Gly Ser Ala Ala Ala Ala Arg Thr Lys Leu Phe Gly Ser Leu Ser Arg 325 330 335 Asn Asp Ile Leu Gly Gln Ile Gln Arg Val Asn Ala Asn Ile Thr Ser 340 345 350 Leu Val Asp Val Ala Gly Ser Tyr Arg Glu Asn Met Glu Tyr Thr Asp 355 360 365 Gly Thr Val Val Ser Ala Ala Tyr Ala Leu Gly Ile Ala Asn Gly Gln 370 375 380 Thr Ile Glu Ala Thr Phe Asn Gln Ala Val Thr Thr Ser Thr Gln Trp 385 390 395 400 Ser Ala Pro Leu Asn Leu Ala 405 <210> 32 <211> 1224 <212> DNA <213> Artificial Sequence <220> <223> CTB::pilin <400> 32 atgatcaagc tcaagtttgg agtgttcttc actgtgctcc ttagctctgc ctatgcacat 60 ggcaccccac aaaacatcac tgacttgtgt gctgagtacc ataacaccca aatccatacc 120 ctcaatgaca agatcttgag ctacaccgag agccttgctg gcaagaggga gatggctatc 180 atcaccttca agaatggtgc taccttccaa gtggaggtgc ctggaagcca acatattgat 240 agccaaaaga aggccattga gaggatgaag gacacactta ggattgctta cctcactgag 300 gctaaggtgg agaagctttg tgtgtggaac aacaagaccc ctcatgctat tgctgttatc 360 agcatggcta atggacctgg acctatgaaa aagactctga ttgcactggc aattgctgca 420 tctgctgcat ctggtatggc acatgcctgg atgactggtg atttcaatgg ttcggtcgat 480 atcggtggta gtatcactgc agatgattat cgtcagaaat gggaatggaa agttggtaca 540 ggtcttaatg gatttggtaa tgtattgaat gacctgacca atggtggaac caaactgacc 600 attactgtta ctggtaataa gccaattttg ttaggccgga ccaaagaagc atttgctacg 660 ccagtaactg gtggtgtaga tggaattcct catattgcat ttactgacta tgaaggagct 720 tctgtagtac tcagaaaccc tgatggtgaa actaataaaa aaggtttagc atattttgtt 780 ctgccgatga aaaatgcaga gggcactaaa gttggttcag tgaaagtgaa tgcatcttat 840 gccggtgtgt tagggagagg tggggttact tctgcggacg gggagctgct ttcgcttttt 900 gccgacgggt tgagctctat cttttgtggt ggtttgccga ggggttctga actctcggct 960 gggagtgccg cagcggcgcg cacaaagttg tttggaagtc tatcaagaaa tgatattctc 1020 ggacagattc aaagagtaaa cgcaaatatt acttctcttg ttgacgtcgc aggttcttac 1080 agggaaaaca tggagtacac tgatggaact gttgtttctg ctgcctatgc actgggtatt 1140 gcaaacggtc agactattga ggcaactttt aatcaggctg taactaccag cactcagtgg 1200 agcgctccgc tgaacctagc atga 1224 <210> 33 <211> 461 <212> PRT <213> Artificial Sequence <220> <223> sp::CTB::pilin <400> 33 Val Ser Met Ala Arg Tyr Ala Ala Leu Ala Ala Leu Leu Leu Ala Val 1 5 10 15 Ala Val Gly Gly Ala Ala Ala Gln Gly Val Gly Ser Val Ile Thr Gln 20 25 30 Ser Val Tyr Ala Ser Met Leu Pro Asn Arg Asp Asn Ser Gln Cys Pro 35 40 45 Ala Arg Gly Phe Tyr Ala Met Ile Lys Leu Lys Phe Gly Val Phe Phe 50 55 60 Thr Val Leu Leu Ser Ser Ala Tyr Ala His Gly Thr Pro Gln Asn Ile 65 70 75 80 Thr Asp Leu Cys Ala Glu Tyr His Asn Thr Gln Ile His Thr Leu Asn 85 90 95 Asp Lys Ile Leu Ser Tyr Thr Glu Ser Leu Ala Gly Lys Arg Glu Met 100 105 110 Ala Ile Ile Thr Phe Lys Asn Gly Ala Thr Phe Gln Val Glu Val Pro 115 120 125 Gly Ser Gln His Ile Asp Ser Gln Lys Lys Ala Ile Glu Arg Met Lys 130 135 140 Asp Thr Leu Arg Ile Ala Tyr Leu Thr Glu Ala Lys Val Glu Lys Leu 145 150 155 160 Cys Val Trp Asn Asn Lys Thr Pro His Ala Ile Ala Val Ile Ser Met 165 170 175 Ala Asn Gly Pro Gly Pro Met Lys Lys Thr Leu Ile Ala Leu Ala Met 180 185 190 Ala Ala Ser Ala Ala Ser Gly Met Ala His Ala Trp Met Thr Gly Asp 195 200 205 Phe Asn Gly Ser Val Asp Ile Gly Gly Ser Ile Thr Ala Asp Asp Tyr 210 215 220 Arg Gln Lys Trp Glu Trp Lys Val Gly Thr Gly Leu Asn Gly Phe Gly 225 230 235 240 Asn Val Leu Asn Asp Leu Thr Asn Gly Gly Thr Lys Leu Thr Ile Thr 245 250 255 Gly Thr Gly Asn Lys Pro Ile Leu Leu Gly Arg Thr Lys Glu Ala Phe 260 265 270 Ala Thr Pro Val Thr Gly Gly Val Asp Gly Ile Pro His Ile Ala Phe 275 280 285 Thr Asp Tyr Glu Gly Ala Ser Val Val Leu Arg Asn Pro Asp Gly Glu 290 295 300 Thr Asn Lys Lys Gly Leu Ala Tyr Phe Val Leu Pro Met Lys Asn Ala 305 310 315 320 Glu Gly Thr Lys Val Gly Ser Glu Lys Val Asn Ala Ser Tyr Ala Gly 325 330 335 Val Leu Gly Arg Gly Gly Val Thr Ser Ala Asp Gly Glu Leu Leu Ser 340 345 350 Leu Phe Ala Asp Gly Leu Ser Ser Ile Phe Cys Gly Gly Leu Pro Arg 355 360 365 Gly Ser Glu Leu Ser Ala Gly Ser Ala Ala Ala Ala Arg Thr Lys Leu 370 375 380 Phe Gly Ser Leu Ser Arg Asn Asp Ile Leu Gly Gln Ile Gln Arg Val 385 390 395 400 Asn Ala Asn Ile Thr Ser Leu Val Asp Val Ala Gly Ser Tyr Arg Glu 405 410 415 Asn Met Glu Tyr Thr Asp Gly Thr Val Val Ser Ala Ala Tyr Ala Leu 420 425 430 Gly Ile Ala Asn Gly Gln Thr Ile Glu Ala Thr Phe Asn Gln Ala Val 435 440 445 Thr Thr Ser Thr Gln Trp Ser Ala Pro Leu Asn Leu Ala 450 455 460 <210> 34 <211> 1392 <212> DNA <213> Artificial Sequence <220> <223> sp::CTB::pilin <400> 34 cttctagtta gcatggcgcg gtatgctgcg ctcgccgcgc tcctgctcgc cgtggcggtg 60 ggcggcgccg cggcgcaggg cgtgggctcc gtcatcacgc aatcggtgta cgcgagcatg 120 ctgcccaacc gcgacaactc gcagtgcccg gccagggggt tctacgcgat gatcaagctc 180 aagtttggag tgttcttcac tgtgctcctt agctctgcct atgcacatgg caccccacaa 240 aacatcactg acttgtgtgc tgagtaccat aacacccaaa tccataccct caatgacaag 300 atcttgagct acaccgagag ccttgctggc aagagggaga tggctatcat caccttcaag 360 aatggtgcta ccttccaagt ggaggtgcct ggaagccaac atattgatag ccaaaagaag 420 gccattgaga ggatgaagga cacacttagg attgcttacc tcactgaggc taaggtggag 480 aagctttgtg tgtggaacaa caagacccct catgctattg ctgttatcag catggctaat 540 ggacctggac ctatgaaaaa gactctgatt gcactggcaa tggctgcatc tgctgcatct 600 ggtatggcac atgcctggat gactggtgat ttcaatggtt cggtcgatat cggtggtagt 660 atcactgcag atgattatcg tcagaaatgg gaatggaaag ttggtacagg tcttaatgga 720 tttggtaatg tattgaatga cctgaccaat ggtggaacca aactgaccat tactggtact 780 ggtaataagc caattttgtt aggccggacc aaagaagcat ttgctacgcc agtaactggt 840 ggtgtagatg gaattcctca tattgcattt actgactatg aaggagcttc tgtagtactc 900 agaaaccctg atggtgaaac taataaaaaa ggtttagcat attttgttct gccgatgaaa 960 aatgcagagg gcactaaagt tggttcagag aaagtgaatg catcttatgc cggtgtgtta 1020 gggagaggtg gggttacttc tgcggacggg gagctgcttt cgctttttgc cgacgggttg 1080 agctctatct tttgtggtgg tttgccgagg ggttctgaac tctcggctgg gagtgccgca 1140 gcggcgcgca caaagttgtt tggaagtcta tcaagaaatg atattctcgg acagattcaa 1200 agagtaaacg caaatattac ttctcttgtt gacgtcgcag gttcttacag ggaaaacatg 1260 gagtacactg atggaactgt tgtttctgct gcctatgcac tgggtattgc aaacggtcag 1320 actattgagg caacttttaa tcaggctgta actaccagca ctcagtggag cgctccgctg 1380 aacctagcat ga 1392 <110> Industry-Academic Cooperation Foundation, Dankook University <120> A vaccine composition against porcine E. coli diarrhea <130> PA100792 / KR <150> KR10-2010-0113896 <151> 2010-11-16 <160> 34 <170> Kopatentin 1.71 <210> 1 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB1 <400> 1 caccatgatc aagctcaagt ttggagtgtt cttcactgtg ctcc 44 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB2 <400> 2 ttagctctgc ctatgcacat ggcaccccac aaaacatcac 40 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB1-2 <400> 3 tcacaagaag tgacacgagg aatcgagacg gatacgtgta 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB3 <400> 4 tgacttgtgt gctgagtacc ataacaccca gatccatacc 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB4 <400> 5 ctcagtgaca agatcttgag ctacaccgag agccttgctg 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB3-4 <400> 6 tattgtgggt ttaggtatgg gagttactgt tctagaaatc 40 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB5 <400> 7 gcaagaggga gatggctatc atcaccttca agaatggtgc 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB6 <400> 8 taccttccaa gtggaggtgc ctggaagcca acatattgat 40 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB5-6 <400> 9 tagtggaagt tcttaccacg atggaaggtt cacctccacg 40 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB7 <400> 10 agccaaaaga aggccattga gaggatgaag gacacactta 40 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB8 <400> 11 ggattgctta cctcactgag gctaaggtgg agaagctttg 40 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB7-8 <400> 12 ctcctacttc ctgtgtgaat cctaacgaat ggagtgactc 40 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB9 <400> 13 tgtgtggaac aacaagaccc ctcatgctat tg 32 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB10 <400> 14 ctgccatcag catggctaat ggacctggac ct 32 <210> 15 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB9-10 <400> 15 gttctgggga gtacgataac gacaatagtc gtaccgatta 40 <210> 16 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 3 'primer for CTB-pilin fusion <400> 16 cagagtcttt ttcataggtc caggtccatt agccatgctg 40 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 5 'primer for pilin-CTB fusion <400> 17 cagcatggct aatggacctg gacctatgaa aaagactctg 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 3 'primer for pilin fusion <400> 18 tcatgctagg ttcagcggag cgctccactg agtgctggta 40 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 5 'primer for signal peptide <400> 19 caccgttagc atggcgcggt atgctgcgct 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 3 'primer for sp-CTB <400> 20 cttgagcttg atcatcgcgt agaaccccct 30 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 3 'primer for CTB-sp-pilin <400> 21 agggggttct acgcgatgat caagctcaag 30 <210> 22 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 3 'primer for pilin <400> 22 tcatgctagg ttcagcggag cgctccactg 30 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer for CTB-pilin <400> 23 tcatgctagg ttcagcggag cgctccactg 30 <210> 24 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 5 'primer for CTB-sp <400> 24 agggggttct acgcgatgat caagctcaag 30 <210> 25 <211> 56 <212> PRT <213> Artificial Sequence <220> <223> signal peptide of CLP <400> 25 Leu Leu Val Ser Met Ala Arg Tyr Ala Ala Leu Ala Ala Leu Leu Leu 1 5 10 15 Ala Val Ala Val Gly Gly Ala Ala Ala Gln Gly Val Gly Ser Val Ile 20 25 30 Thr Gln Ser Val Tyr Ala Ser Met Leu Pro Asn Arg Asp Asn Ser Gln 35 40 45 Cys Pro Ala Arg Gly Phe Tyr Ala 50 55 <210> 26 <211> 168 <212> DNA <213> Artificial Sequence <220> <223> signal peptide of CLP <400> 26 cttctagtta gcatggcgcg gtatgctgcg ctcgccgcgc tcctgctcgc cgtggcggtg 60 ggcggcgccg cggcgcaggg cgtgggctcc gtcatcacgc aatcggtgta cgcgagcatg 120 ctgcccaacc gcgacaactc gcagtgcccg gccagggggt tctacgcg 168 <210> 27 <211> 124 <212> PRT <213> Artificial Sequence <220> <223> CTB <400> 27 Met Ile Lys Leu Lys Phe Gly Val Phe Phe Thr Val Leu Leu Ser Ser 1 5 10 15 Ala Tyr Ala His Gly Thr Pro Gln Asn Ile Thr Asp Leu Cys Ala Glu 20 25 30 Tyr His Asn Thr Gln Ile His Thr Leu Asn Asp Lys Ile Leu Ser Tyr 35 40 45 Thr Glu Ser Leu Ala Gly Lys Arg Glu Met Ala Ile Ile Thr Phe Lys 50 55 60 Asn Gly Ala Thr Phe Gln Val Glu Val Pro Gly Ser Gln His Ile Asp 65 70 75 80 Ser Gln Lys Lys Ala Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Ala 85 90 95 Tyr Leu Thr Glu Ala Lys Val Glu Lys Leu Cys Val Trp Asn Asn Lys 100 105 110 Thr Pro His Ala Ile Ala Val Ile Ser Met Ala Asn 115 120 <210> 28 <211> 372 <212> DNA <213> Artificial Sequence <220> <223> CTB <400> 28 atgatcaagc tcaagtttgg agtgttcttc actgtgctcc ttagctctgc ctatgcacat 60 ggcaccccac aaaacatcac tgacttgtgt gctgagtacc ataacaccca aatccatacc 120 ctcaatgaca agatcttgag ctacaccgag agccttgctg gcaagaggga gatggctatc 180 atcaccttca agaatggtgc taccttccaa gtggaggtgc ctggaagcca acatattgat 240 agccaaaaga aggccattga gaggatgaag gacacactta ggattgctta cctcactgag 300 gctaaggtgg agaagctttg tgtgtggaac aacaagaccc ctcatgctat tgctgttatc 360 agcatggcta at 372 <210> 29 <211> 279 <212> PRT <213> Artificial Sequence <220> <223> pilin <400> 29 Met Lys Lys Thr Leu Ile Ala Leu Ala Met Ala Ala Ser Ala Ala Ser 1 5 10 15 Gly Met Ala His Ala Trp Met Thr Gly Asp Phe Asn Gly Ser Val Asp 20 25 30 Ile Gly Gly Ser Ile Thr Ala Asp Asp Tyr Arg Gln Lys Trp Glu Trp 35 40 45 Lys Val Gly Thr Gly Leu Asn Gly Phe Gly Asn Val Leu Asn Asp Leu 50 55 60 Thr Asn Gly Gly Thr Lys Leu Thr Ile Thr Gly Thr Gly Asn Lys Pro 65 70 75 80 Ile Leu Leu Gly Arg Thr Lys Glu Ala Phe Ala Thr Pro Val Thr Gly 85 90 95 Gly Val Asp Gly Ile Pro His Ile Ala Phe Thr Asp Tyr Glu Gly Ala 100 105 110 Ser Val Val Leu Arg Asn Pro Asp Gly Glu Thr Asn Lys Lys Gly Leu 115 120 125 Ala Tyr Phe Val Leu Pro Met Lys Asn Ala Glu Gly Thr Lys Val Gly 130 135 140 Ser Glu Lys Val Asn Ala Ser Tyr Ala Gly Val Leu Gly Arg Gly Gly 145 150 155 160 Val Thr Ser Ala Asp Gly Glu Leu Leu Ser Leu Phe Ala Asp Gly Leu 165 170 175 Ser Ser Ile Phe Cys Gly Gly Leu Pro Arg Gly Ser Glu Leu Ser Ala 180 185 190 Gly Ser Ala Ala Ala Ala Arg Thr Lys Leu Phe Gly Ser Leu Ser Arg 195 200 205 Asn Asp Ile Leu Gly Gln Ile Gln Arg Val Asn Ala Asn Ile Thr Ser 210 215 220 Leu Val Asp Val Ala Gly Ser Tyr Arg Glu Asn Met Glu Tyr Thr Asp 225 230 235 240 Gly Thr Val Val Ser Ala Ala Tyr Ala Leu Gly Ile Ala Asn Gly Gln 245 250 255 Thr Ile Glu Ala Thr Phe Asn Gln Ala Val Thr Thr Ser Ser Gln Trp 260 265 270 Ser Ala Pro Leu Asn Leu Ala 275 <210> 30 <211> 840 <212> DNA <213> Artificial Sequence <220> <223> pilin <400> 30 atgaaaaaga ctctgattgc actggcaatg gctgcatctg ctgcatctgg tatggcacat 60 gcctggatga ctggtgattt caatggttcg gtcgatatcg gtggtagtat cactgcagat 120 gattatcgtc agaaatggga atggaaagtt ggtacaggtc ttaatggatt tggtaatgta 180 ttgaatgacc tgaccaatgg tggaaccaaa ctgaccatta ctggtactgg taataagcca 240 attttgttag gccggaccaa agaagcattt gctacgccag taactggtgg tgtagatgga 300 attcctcata ttgcatttac tgactatgaa ggagcttctg tagtactcag aaaccctgat 360 ggtgaaacta ataaaaaagg tttagcatat tttgttctgc cgatgaaaaa tgcagagggc 420 actaaagttg gttcagagaa agtgaatgca tcttatgccg gtgtgttagg gagaggtggg 480 gttacttctg cggacgggga gctgctttcg ctttttgccg acgggttgag ctctatcttt 540 tgtggtggtt tgccgagggg ttctgaactc tcggctggga gtgccgcagc ggcgcgcaca 600 aagttgtttg gaagtctatc aagaaatgat attctcggac agattcaaag agtaaacgca 660 aatattactt ctcttgttga cgtcgcaggt tcttacaggg aaaacatgga gtacactgat 720 ggaactgttg tttctgctgc ctatgcactg ggtattgcaa acggtcagac tattgaggca 780 acttttaatc aggctgtaac taccagcact cagtggagcg ctccgctgaa cctagcatga 840 840 <210> 31 <211> 407 <212> PRT <213> Artificial Sequence <220> CTB :: pilin <400> 31 Met Ile Lys Leu Lys Phe Gly Val Phe Phe Thr Val Leu Leu Ser Ser 1 5 10 15 Ala Tyr Ala His Gly Thr Pro Gln Asn Ile Thr Asp Leu Cys Ala Glu 20 25 30 Tyr His Asn Thr Gln Ile His Thr Leu Asn Asp Lys Ile Leu Ser Tyr 35 40 45 Thr Glu Ser Leu Ala Gly Lys Arg Glu Met Ala Ile Ile Thr Phe Lys 50 55 60 Asn Gly Ala Thr Phe Gln Val Glu Val Pro Gly Ser Gln His Ile Asp 65 70 75 80 Ser Gln Lys Lys Ala Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Ala 85 90 95 Tyr Leu Thr Glu Ala Lys Val Glu Lys Leu Cys Val Trp Asn Asn Lys 100 105 110 Thr Pro His Ala Ile Ala Val Ile Ser Met Ala Asn Gly Pro Gly Pro 115 120 125 Met Lys Lys Thr Leu Ile Ala Leu Ala Ile Ala Ala Ser Ala Ala Ser 130 135 140 Gly Met Ala His Ala Trp Met Thr Gly Asp Phe Asn Gly Ser Val Asp 145 150 155 160 Ile Gly Gly Ser Ile Thr Ala Asp Asp Tyr Arg Gln Lys Trp Glu Trp 165 170 175 Lys Val Gly Thr Gly Leu Asn Gly Phe Gly Asn Val Leu Asn Asp Leu 180 185 190 Thr Asn Gly Gly Thr Lys Leu Thr Ile Thr Val Thr Gly Asn Lys Pro 195 200 205 Ile Leu Leu Gly Arg Thr Lys Glu Ala Phe Ala Thr Pro Val Thr Gly 210 215 220 Gly Val Asp Gly Ile Pro His Ile Ala Phe Thr Asp Tyr Glu Gly Ala 225 230 235 240 Ser Val Val Leu Arg Asn Pro Asp Gly Glu Thr Asn Lys Lys Gly Leu 245 250 255 Ala Tyr Phe Val Leu Pro Met Lys Asn Ala Glu Gly Thr Lys Val Gly 260 265 270 Ser Val Lys Val Asn Ala Ser Tyr Ala Gly Val Leu Gly Arg Gly Gly 275 280 285 Val Thr Ser Ala Asp Gly Glu Leu Leu Ser Leu Phe Ala Asp Gly Leu 290 295 300 Ser Ser Ile Phe Cys Gly Gly Leu Pro Arg Gly Ser Glu Leu Ser Ala 305 310 315 320 Gly Ser Ala Ala Ala Ala Arg Thr Lys Leu Phe Gly Ser Leu Ser Arg 325 330 335 Asn Asp Ile Leu Gly Gln Ile Gln Arg Val Asn Ala Asn Ile Thr Ser 340 345 350 Leu Val Asp Val Ala Gly Ser Tyr Arg Glu Asn Met Glu Tyr Thr Asp 355 360 365 Gly Thr Val Val Ser Ala Ala Tyr Ala Leu Gly Ile Ala Asn Gly Gln 370 375 380 Thr Ile Glu Ala Thr Phe Asn Gln Ala Val Thr Thr Ser Ser Gln Trp 385 390 395 400 Ser Ala Pro Leu Asn Leu Ala 405 <210> 32 <211> 1224 <212> DNA <213> Artificial Sequence <220> CTB :: pilin <400> 32 atgatcaagc tcaagtttgg agtgttcttc actgtgctcc ttagctctgc ctatgcacat 60 ggcaccccac aaaacatcac tgacttgtgt gctgagtacc ataacaccca aatccatacc 120 ctcaatgaca agatcttgag ctacaccgag agccttgctg gcaagaggga gatggctatc 180 atcaccttca agaatggtgc taccttccaa gtggaggtgc ctggaagcca acatattgat 240 agccaaaaga aggccattga gaggatgaag gacacactta ggattgctta cctcactgag 300 gctaaggtgg agaagctttg tgtgtggaac aacaagaccc ctcatgctat tgctgttatc 360 agcatggcta atggacctgg acctatgaaa aagactctga ttgcactggc aattgctgca 420 tctgctgcat ctggtatggc acatgcctgg atgactggtg atttcaatgg ttcggtcgat 480 atcggtggta gtatcactgc agatgattat cgtcagaaat gggaatggaa agttggtaca 540 ggtcttaatg gatttggtaa tgtattgaat gacctgacca atggtggaac caaactgacc 600 attactgtta ctggtaataa gccaattttg ttaggccgga ccaaagaagc atttgctacg 660 ccagtaactg gtggtgtaga tggaattcct catattgcat ttactgacta tgaaggagct 720 tctgtagtac tcagaaaccc tgatggtgaa actaataaaa aaggtttagc atattttgtt 780 ctgccgatga aaaatgcaga gggcactaaa gttggttcag tgaaagtgaa tgcatcttat 840 gccggtgtgt tagggagagg tggggttact tctgcggacg gggagctgct ttcgcttttt 900 gccgacgggt tgagctctat cttttgtggt ggtttgccga ggggttctga actctcggct 960 gggagtgccg cagcggcgcg cacaaagttg tttggaagtc tatcaagaaa tgatattctc 1020 ggacagattc aaagagtaaa cgcaaatatt acttctcttg ttgacgtcgc aggttcttac 1080 agggaaaaca tggagtacac tgatggaact gttgtttctg ctgcctatgc actgggtatt 1140 gcaaacggtc agactattga ggcaactttt aatcaggctg taactaccag cactcagtgg 1200 agcgctccgc tgaacctagc atga 1224 <210> 33 <211> 461 <212> PRT <213> Artificial Sequence <220> Sp :: CTB :: pilin <400> 33 Val Ser Met Ala Arg Tyr Ala Ala Leu Ala Ala Leu Leu Leu Ala Val 1 5 10 15 Ala Val Gly Gly Ala Ala Ala Gln Gly Val Gly Ser Val Ile Thr Gln 20 25 30 Ser Val Tyr Ala Ser Met Leu Pro Asn Arg Asp Asn Ser Gln Cys Pro 35 40 45 Ala Arg Gly Phe Tyr Ala Met Ile Lys Leu Lys Phe Gly Val Phe Phe 50 55 60 Thr Val Leu Leu Ser Ser Ala Tyr Ala His Gly Thr Pro Gln Asn Ile 65 70 75 80 Thr Asp Leu Cys Ala Glu Tyr His Asn Thr Gln Ile His Thr Leu Asn 85 90 95 Asp Lys Ile Leu Ser Tyr Thr Glu Ser Leu Ala Gly Lys Arg Glu Met 100 105 110 Ala Ile Ile Thr Phe Lys Asn Gly Ala Thr Phe Gln Val Glu Val Pro 115 120 125 Gly Ser Gln His Ile Asp Ser Gln Lys Lys Ala Ile Glu Arg Met Lys 130 135 140 Asp Thr Leu Arg Ile Ala Tyr Leu Thr Glu Ala Lys Val Glu Lys Leu 145 150 155 160 Cys Val Trp Asn Asn Lys Thr Pro His Ala Ile Ala Val Ile Ser Met 165 170 175 Ala Asn Gly Pro Gly Pro Met Lys Lys Thr Leu Ile Ala Leu Ala Met 180 185 190 Ala Ala Ser Ala Ala Ser Gly Met Ala His Ala Trp Met Thr Gly Asp 195 200 205 Phe Asn Gly Ser Val Asp Ile Gly Gly Ser Ile Thr Ala Asp Asp Tyr 210 215 220 Arg Gln Lys Trp Glu Trp Lys Val Gly Thr Gly Leu Asn Gly Phe Gly 225 230 235 240 Asn Val Leu Asn Asp Leu Thr Asn Gly Gly Thr Lys Leu Thr Ile Thr 245 250 255 Gly Thr Gly Asn Lys Pro Ile Leu Leu Gly Arg Thr Lys Glu Ala Phe 260 265 270 Ala Thr Pro Val Thr Gly Gly Val Asp Gly Ile Pro His Ile Ala Phe 275 280 285 Thr Asp Tyr Glu Gly Ala Ser Val Val Leu Arg Asn Pro Asp Gly Glu 290 295 300 Thr Asn Lys Lys Gly Leu Ala Tyr Phe Val Leu Pro Met Lys Asn Ala 305 310 315 320 Glu Gly Thr Lys Val Gly Ser Glu Lys Val Asn Ala Ser Tyr Ala Gly 325 330 335 Val Leu Gly Arg Gly Gly Val Thr Ser Ala Asp Gly Glu Leu Leu Ser 340 345 350 Leu Phe Ala Asp Gly Leu Ser Ser Ile Phe Cys Gly Gly Leu Pro Arg 355 360 365 Gly Ser Glu Leu Ser Ala Gly Ser Ala Ala Ala Ala Arg Thr Lys Leu 370 375 380 Phe Gly Ser Leu Ser Arg Asn Asp Ile Leu Gly Gln Ile Gln Arg Val 385 390 395 400 Asn Ala Asn Ile Thr Ser Leu Val Asp Val Ala Gly Ser Tyr Arg Glu 405 410 415 Asn Met Glu Tyr Thr Asp Gly Thr Val Val Ser Ala Ala Tyr Ala Leu 420 425 430 Gly Ile Ala Asn Gly Gln Thr Ile Glu Ala Thr Phe Asn Gln Ala Val 435 440 445 Thr Thr Ser Thr Gln Trp Ser Ala Pro Leu Asn Leu Ala 450 455 460 <210> 34 <211> 1392 <212> DNA <213> Artificial Sequence <220> Sp :: CTB :: pilin <400> 34 cttctagtta gcatggcgcg gtatgctgcg ctcgccgcgc tcctgctcgc cgtggcggtg 60 ggcggcgccg cggcgcaggg cgtgggctcc gtcatcacgc aatcggtgta cgcgagcatg 120 ctgcccaacc gcgacaactc gcagtgcccg gccagggggt tctacgcgat gatcaagctc 180 aagtttggag tgttcttcac tgtgctcctt agctctgcct atgcacatgg caccccacaa 240 aacatcactg acttgtgtgc tgagtaccat aacacccaaa tccataccct caatgacaag 300 atcttgagct acaccgagag ccttgctggc aagagggaga tggctatcat caccttcaag 360 aatggtgcta ccttccaagt ggaggtgcct ggaagccaac atattgatag ccaaaagaag 420 gccattgaga ggatgaagga cacacttagg attgcttacc tcactgaggc taaggtggag 480 aagctttgtg tgtggaacaa caagacccct catgctattg ctgttatcag catggctaat 540 ggacctggac ctatgaaaaa gactctgatt gcactggcaa tggctgcatc tgctgcatct 600 ggtatggcac atgcctggat gactggtgat ttcaatggtt cggtcgatat cggtggtagt 660 atcactgcag atgattatcg tcagaaatgg gaatggaaag ttggtacagg tcttaatgga 720 tttggtaatg tattgaatga cctgaccaat ggtggaacca aactgaccat tactggtact 780 ggtaataagc caattttgtt aggccggacc aaagaagcat ttgctacgcc agtaactggt 840 ggtgtagatg gaattcctca tattgcattt actgactatg aaggagcttc tgtagtactc 900 agaaaccctg atggtgaaac taataaaaaa ggtttagcat attttgttct gccgatgaaa 960 aatgcagagg gcactaaagt tggttcagag aaagtgaatg catcttatgc cggtgtgtta 1020 gggagaggtg gggttacttc tgcggacggg gagctgcttt cgctttttgc cgacgggttg 1080 agctctatct tttgtggtgg tttgccgagg ggttctgaac tctcggctgg gagtgccgca 1140 gcggcgcgca caaagttgtt tggaagtcta tcaagaaatg atattctcgg acagattcaa 1200 agagtaaacg caaatattac ttctcttgtt gacgtcgcag gttcttacag ggaaaacatg 1260 gagtacactg atggaactgt tgtttctgct gcctatgcac tgggtattgc aaacggtcag 1320 actattgagg caacttttaa tcaggctgta actaccagca ctcagtggag cgctccgctg 1380 aacctagcat ga 1392

Claims

A transformant transformed with a recombinant vector comprising a gene fused to a signal peptide, a mucosal immune adjuvant and a pilin antigen.

The transformant of claim 1, wherein the mucosal immune adjuvant is CTB (cholera toxin B subunit).

The transformant of claim 1, wherein the fused gene is a gene encoding an amino acid sequence represented by SEQ ID NO: 33.

The transformant of claim 1, wherein the transformant is in-flight cultured in a medium containing 2,4-D in the range of 0.1 to 2 ppm and kinetin in the range of 0.01 to 0.2 ppm.

The transformant of claim 1, wherein the transformant is cultured in-flight in a medium containing 2 to 4% (w / v) sucrose.

The transformant of claim 1, wherein the transformant is selected from the group consisting of Agrobacterium, Escherichia coli, or plant cells.

The tobacco plant of claim 6, wherein the plant cell is tobacco. A transformant selected from the group consisting of Arabidopsis, potato, lettuce, radish, cabbage, tomato, soybean, rice, barley, wheat, corn, and carrot.

The transformant of claim 6, wherein the plant cell is carrot callus.

A recombinant vector comprising a gene fused to a signal peptide, mucosal immunity adjuvant and pilin antigen.

The swine E. coli diarrhea vaccine composition comprising the transformant of any one of claims 1 to 8, a protein extract of the transformant or a recombinant protein isolated from the transformant.

A feed composition for preventing or treating swine E. coli diarrhea comprising a transformant of any one of claims 1 to 8, a protein extract of the transformant or a recombinant protein isolated from the transformant.

The composition for the prevention or treatment of porcine E. coli diarrhea comprising a transformant of any one of claims 1 to 8, a protein extract of the transformant or a recombinant protein isolated from the transformant.

A method for preventing or treating swine E. coli diarrhea by orally administering the composition of any one of claims 10 to 12 in pigs.

(1) preparing a recombinant vector comprising a gene fused to a signal peptide, a mucosal immune adjuvant and a pilin antigen;
(2) introducing the recombinant vector of step (1) into an Agrobacteria; And
(3) A method for producing a swine Escherichia coli diarrhea vaccine fused with a signal peptide, mucosal immunity adjuvant and pilin antigen, comprising the step of transforming the agrobacteria and plant cells of step (2).

15. The method according to claim 14, wherein the transformant obtained in step (3) comprises 2,4-D in the range of 0.1 to 2 ppm, kinetin in the range of 0.01 to 0.2 ppm and 2 to 4% (w / v). Sucrose (sucrose) further comprising the step of culturing in a medium containing.