KR20120052484A - Composition for detecting or measuring cho cell dna - Google Patents

Abstract

PURPOSE: A composition for detecting or quantitating DNA from CHO cells is provided to specifically detect DNA and to manufacture bio medicinal products using host cells. CONSTITUTION: A primer set for detecting DNA from CHO(Chinese hamster ovary) cell is denoted by sequence numbers 1 and 2. A composition for detecting or quantitating DNA of CHO cells contains the primer set of sequence numbers 1 and 2 and a probe of sequence number 3. The DNA of CHO cells is genomic DNA. A method for detecting or quantitating DNA of CHO cells comprises: a step of isolating DNA from a sample; a step of performing PCR using the primer and probe; and a step of measuring fluorescence signal.

Description

Composition for detecting or measuring CHO cell DNA

The present invention relates to a composition for detecting or quantifying CHO cell DNA, and more particularly, to a primer and a probe capable of specifically detecting CHO cell DNA.

Chinese Hamster Ovary (CHO) cells are widely used as host cells for producing purified protein medicines and have been approved by many regulatory agencies. Contamination of host cell DNA in purified protein drugs produced from CHO cells is not considered to be a major risk factor but must be controlled at the lowest level, so the World Health Organization (WHO) has less than 10 ng of host cell DNA per dose in a drug. It is recommended.

Residual DNA in purified protein drugs includes blot hybridization method, THRESHOLD (Molecular Devices Corporation) method using enzymatic reaction, and quantitative real time polymerase chain reaction (PCR) method. However, the blot hybridization method has a higher detection and quantification limit than other methods, and the THRESHOLD method has a disadvantage in that the cost of the experimental material is high and all DNA contained in the sample is detected. On the other hand, quantitative Real Time Polymerase Chain Reaction (PCR) methods can be accurately quantified with lower detection and quantification limits and faster time than other methods and are currently used to detect bacterial, fungal and viral DNA. have.

Accordingly, the present inventors confirmed that the present invention can accurately detect and quantify host cell DNA remaining in purified proteins by preparing primers and probes specific for CHO cells and performing quantitative real-time polymerase chain reaction using the same. Completed.

Accordingly, an object of the present invention is to provide a primer set for detecting CHO (Chinese Hamster Ovary) cell DNA represented by the nucleotide sequences of SEQ ID NOs: 1 and 2.

It is also an object of the present invention to provide a composition for detecting or quantifying CHO (Chinese Hamster Ovary) cell DNA, comprising a primer set represented by the nucleotide sequence of SEQ ID NO: 1 and 2 and a probe represented by the nucleotide sequence of SEQ ID NO: 3 It is.

It is also an object of the present invention to provide a kit for the detection or quantification of CHO (Chinese Hamster Ovary) cell DNA comprising the composition. Also an object of the present invention (a) extracting DNA from a sample, (b) Performing PCR (Polymerase chain reaction) on the DNA extracted in step (a) with a primer set represented by a nucleotide sequence of SEQ ID NOs: 1 and 2 and a probe represented by a nucleotide sequence of SEQ ID NO: 3, and (c It provides a method for detecting or quantifying the DNA of CHO cells comprising the step of measuring the fluorescent signal.

In order to achieve the above object, the present invention provides a primer set for detecting CHO (Chinese Hamster Ovary) cell DNA represented by the nucleotide sequence of SEQ ID NO: 1 and 2.

The present invention also provides a composition for detecting or quantifying CHO (Chinese Hamster Ovary) cell DNA, comprising a primer set represented by the nucleotide sequences of SEQ ID NOs: 1 and 2 and a probe represented by the nucleotide sequences of SEQ ID NO: 3.

The present invention also provides a kit for detecting or quantifying CHO (Chinese Hamster Ovary) cell DNA comprising the composition.

In another aspect, the present invention (a) extracting DNA from a sample, (b) the primer set represented by the nucleotide sequence of SEQ ID NO: 1 and 2 and the nucleotide sequence of SEQ ID NO: 3 with respect to the DNA extracted in step (a) It provides a method of detecting or quantifying the DNA of CHO cells, including performing a polymerase chain reaction (PCR) with a probe represented by, and (c) measuring a fluorescence signal.

Hereinafter, the present invention will be described in more detail.

In the present invention, 'CHO (Chinese Hamster Ovary) cells' are cells derived from ovaries of Chinese hamsters, but are not limited thereto, and preferably include at least one selected from the group consisting of CHO-DXB11, CHO-DG44 and CHO-K1. do.

In the present invention, 'sample' may be a culture obtained by culturing CHO cells as a host cell for the preparation of a biopharmaceutical or a purified product of the culture, but is not limited thereto. Preferably, a recombinant protein or monoclonal antibody is prepared. May be a culture of transformed CHO cells, or a purification thereof. Methods of preparing the cultures or purified products are well known in the art. The biopharmaceutical may be a purified protein, but is not limited thereto, and the purified protein includes a purified protein having pharmaceutical, diagnostic properties, or properties useful for commercial, experimental, or other uses. In addition, the purified protein may be a therapeutic protein, and the therapeutic protein may be a therapeutic antibody, although not limited thereto. The antibody includes monoclonal antibodies, polyclonal antibodies. The antibody may be a non-human animal antibody, a humanized antibody, a chimeric antibody, a human antibody, a modified antibody bound to another molecule (for example, a polymer such as PEG), an antibody having an amino acid sequence modified, or an antibody having a modified sugar chain. Antibodies are also included.

'Probe' in the present invention is a nucleic acid molecule capable of specifically binding to the target sequence (blue portion of Figure 2) of CHO cell DNA, preferably CHO cell genomic DNA, more preferably CHO cell genomic DNA At least one selected from the group consisting of a radioisotope, a ligand, a fluorescent substance, a chemiluminescent agent and an enzyme may be attached. More preferably, a fluorescent marker is inserted at one end and a fluorescent inhibitor is inserted at the other end. It may be. Specifically, 6-FAM (6-carboxyfluorescein), TET (5'-Tetrachloro-Fluorescein), VIC, 6-JOE (6-carboxy-4 ', 5'-dichloro at one end (preferably 5' end) -2 ', 7'-dimethoxyfluorescein), NED, 6-carboxy-X-rhodamine (ROX), Texas Red, Cy3, Cy5 and HEX (2', 4 ', 5', 7'-tetrachloro-6-carboxy- Any one selected from the group consisting of 4,7-dichlorofluorescein can be labeled, and 6-TAMRA (6-carboxytetramethylrhodamine), BHQ-1,2,3 (Black Hole) at the opposite end (preferably 3 'end) Quencher) and DABCYL Dark Quencher may be labeled with any one selected from the group consisting of.

The probe may preferably be represented by the nucleotide sequence of SEQ ID NO: 3, but if there is some alteration (deletion, substitution or addition) of the sequence if it can form a hybrid with the target sequence, the probe of the present invention Included. For example, 80%, preferably 90%, more preferably 95%, even more preferably 99% homology with the nucleotide sequence of SEQ ID NO: 3 is included in the primer set of the present invention.

The primer set of the present invention is represented by the nucleotide sequences of SEQ ID NOs: 1 and 2, and has a characteristic of specifically detecting CHO (Chinese Hamster Ovary) cell DNA. Chinese Hamster Ovary) can specifically detect the cell DNA, in particular the sample can be easily contaminated with bacteria, preferably one or more bacteria selected from the group consisting of Sphingomonas Paucimobilis , Bacillus cereus or Staphylococcus epidermidis , The primer set is characterized by being able to specifically detect DNA of CHO (Chinese Hamster Ovary) cells differently from the bacteria.

The primer set of the present invention is specifically annealed to the target sequence (red, green portion of FIG. 2) of CHO cell DNA, preferably CHO cell genomic DNA, more preferably CHO cell genomic DNA. There is a characteristic that can form a hybrid (hybrid). The primer set can initiate DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different deoxynucleoside triphosphates at appropriate buffer and temperature.

Primer set of the present invention is preferably represented by the nucleotide sequence of SEQ ID NO: 1 and 2, but the target sequence of the CHO cell DNA, preferably CHO cell genomic DNA, more preferably CHO cell genomic DNA (Fig. 2 If the hybridization can be formed by specifically annealing to the red and green portions of the above, it is included in the primer set of the present invention even if there is some alteration (deletion, substitution or addition) of the sequence. For example, even if there is 80%, preferably 90%, more preferably 95%, even more preferably 99% homology with the nucleotide sequence of SEQ ID NOS: 1 and 2 included in the primer set of the present invention do.

Meanwhile, the composition for detecting or quantifying CHO (Chinese Hamster Ovary) cell DNA of the present invention includes a primer set represented by the nucleotide sequences of SEQ ID NOs: 1 and 2, and a probe represented by the nucleotide sequence of SEQ ID NO: 3. do.

The composition of the present invention includes a primer set represented by the nucleotide sequences of SEQ ID NOs: 1 and 2 and a probe represented by the nucleotide sequences of SEQ ID NO: 3 to specifically detect and quantify CHO (Chinese Hamster Ovary) cell DNA. have.

The CHO cell DNA may be, but is not limited to, genomic DNA of CHO cells remaining in a sample, preferably the culture of CHO cells or purified products thereof, which can be easily infected with bacteria as described above. Can be. Therefore, the composition of the present invention is characterized by being able to specifically detect and quantify only DNA of CHO (Chinese Hamster Ovary) cells to distinguish them from the bacteria.

The composition of the present invention may further include reagents, DNA polymerases, and dNTPs necessary for the hybridization of the primer set and the probe, and also stabilize the primer set and the probe, and buffers and solvents that become a medium of the reaction. And the like may be further included.

On the other hand, the kit for the detection or quantification of Chinese Hamster Ovary (CHO) cell DNA of the present invention is characterized in that it comprises the composition of the present invention.

The kit of the present invention includes a composition containing the primer and probe of the present invention, and thus can specifically detect and quantify Chinese Hamster Ovary (CHO) cell DNA.

The kit of the present invention may further include components conventionally used in the microbial detection kit, preferably to perform a polymerase chain reaction (PCR), more preferably a Real Time-Polymerase chain reaction (RT-PCR). It may further include components and supports commonly used. The support is not limited thereto but is preferably selected from the group consisting of nitrocellulose membrane, 96 well plate synthesized with polyvinyl resin, 96 well plate synthesized with polystyrene resin, or glass slide glass. Can be.

On the other hand, the method of detecting or quantifying the DNA of the CHO cell of the present invention (a) extracting the DNA from the sample, (b) the base sequence of SEQ ID NO: 1 and 2 for the DNA extracted in the step (a) Performing a polymerase chain reaction (PCR) with a primer set represented by a primer set and a probe represented by a nucleotide sequence of SEQ ID NO: 3, and (c) measuring a fluorescence signal.

Extracting DNA from the sample in step (a) is possible using methods commonly known in the art, but preferably, DNA can be easily extracted from the sample using a commercially available DNA extraction kit.

As described above, the sample may be a culture of CHO cells or a culture of the host cells and they may be easily contaminated with bacteria, but using the quantitative or detection method of the present invention, CHO cells may be excluded. Only DNA can be specifically detected or quantified.

By performing the polymerase chain reaction (PCR) in step (b), the fluorescent signal may be generated only when the DNA of CHO cells is present. Specifically, the primer sets represented by the nucleotide sequences of SEQ ID NOs: 1 and 2 specifically hybridize to DNA of CHO cells, and the probes represented by the nucleotide sequences of SEQ ID NO: 3 also hybridize to DNA of CHO cells, resulting in PCR (Polymerase chain reaction). ), But not limited thereto, the fluorescent marker and the fluorescent inhibitor attached to the probe may be separated to generate a fluorescent signal.

In the step (b), the PCR is not limited thereto, but may preferably be a quantitative real-time polymerase chain reaction (qRT-PCR). For the qRT-PCR method and apparatus, methods and apparatus known in the art may be used, but are not limited thereto, and preferably, SLAN real time PCR detection system (LG Life Science, Korea), LightCyclerTM (Roche, Germany), ABI PRISM ™ 7000/7700, 7500 (Applied Biosystems, USA), iCycler ™ (Bio-Rad, USA), Rotor-Gene ™ (Corbett, Australia) or Opticon ™ (PharmaTech, USA).

In the step (b), PCR may be performed by additionally including reagents, DNA polymerases, and dNTPs necessary for the primer set and the probe to hybridize, and further, stabilize the primer set and the probe, and It may be performed by further including a buffer, a solvent, and the like as a medium.

Measuring the fluorescence signal in the step (c) can be easily measured by those skilled in the art using the apparatus described in the step (b), specifically, the fluorescent marker and the fluorescence inhibitor attached to the probe reacts by PCR Fluorescence signals generated separately in the process can be measured.

The CHO cell DNA contained in the unknown sample may be quantified by substituting the fluorescence signal intensity measured through the step (c) into a standard curve measured through a standard sample (a sample having a specific content of CHO cell DNA). .

In one embodiment of the present invention using the primers and probes of the present invention to obtain a standard curve for CHO-DXB11, CHO-DG44 and CHO-K1, respectively, described in Figures 4a, 4b and 4c, respectively, It was confirmed that it has a linearity, through which it was possible to quantify the CHO cell DNA contained in the unknown sample.

The primer of the present invention and the composition containing the same can specifically detect only CHO cell DNA, and are contained in the culture or purified product of the cell produced in the process of producing a biopharmaceutical using the cell as a host cell. It can be readily used to effectively detect or quantify CHO cell DNA.

1 is a schematic diagram illustrating a process of detecting and quantifying residual DNA through real-time PCR by purifying recombinant protein cultured in CHO cells and extracting the DNA remaining in the purified protein.
Figure 2 shows the sequence of Genomic DNA fragments extracted from Cricetulus griseus (CHO) cells.
3A, 3B and 3C show the results of real-time PCR for each concentration using Genomic DNA extracted from CHO-DXB11, CHO-DG44 and CHO-K1 cells as templates.
Figures 4a, 4b and 4c shows the linearity of the standard curve of CHO-DXB11, CHO-DG44 and CHO-K1 Genomic DNA, respectively.

Hereinafter, the present invention will be described in detail with reference to Examples. The following examples are intended to illustrate the present invention in detail, but the present invention is not limited thereto.

Example 1 Preparation of Primers and Probes

The inventors of the present invention described the sequence of Genomic DNA fragments extracted from Cricetulus griseus (Chinese hamster) cells disclosed in Peter Morin Nissom's paper (Biologicals 35 (2007) 211-215) (FIG. 2). Sets and probes were devised.

Primer and Probe Sequences Primers and probes order SEQ ID NO: Forward primer 5'- CCCTAGACTTGCTGTGGATGTG -3 ' One Reverse primer 5'- TTAGCAGACACTGTTGCAGAGACA -3 ' 2 Probe sequence FAM 5'- ACCAGTCAGCTGATGTGGACACCCC -3 'TAMRA 3

Methods of making and using probes and primers are described, for example, in Molecular Cloning: A Laboratory Manual, 2nd ed., Vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992; And Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990.

Example 2: Preparation before quantitative real-time polymerase reaction

2-1. Preparation and DNA Extraction of CHO Genomic DNA Standard Solutions

CHO-K1 cell genomic DNA was extracted and diluted to 1 μg / ml using the QIAGEN (Cat. No. 13343) kit for use as a standard for drawing standard curves. Standard solutions were prepared from the above CHO-K1 cells (available from ATCC, catalog number: CCL-61, lot number: 3442943) Genomic DNA standard stock solution (1 μg / ml). First, a standard solution (100,000 pg / ml) was prepared by diluting 10 times from a 1 μg / ml solution. To make a standard solution (No. 1), 100,000 pg / ml was extracted with a DNA extraction kit (Wako Pure Chemical Industries, Catalog No .: 295-50201), followed by 10 times of each standard solution (No. 2-6). Prepared by dilution. Ten-fold dilutions were prepared using nuclease-free water (Ambion, Cat. No. 9937) as shown in Table 2 below and were simply vortexed at full speed. Finally, CHO-K1 Genomic DNA standard solutions were prepared at 100,000 pg / ml, 10,000 pg / ml, 1,000 pg / ml, 100 pg / ml, 10 pg / ml, and 1 pg / ml.

Dilution of CHO Genomic DNA Standard Solution Standard solution
number CHO gDNA Concentration
(pg / ml) Dilution method One 100,000 100,000 pg / mL CHO Genomic DNA Extraction Using DNA Kit 2 10,000 100 μl standard solution + 900 μl nucleated free water 3 1,000 100 μl standard solution 2 + 900 μl nucleated free water 4 100 100 μl standard solution 3 + 900 μl nucleated free water 5 10 100 μl Standard Solution 4 + 900 μl nucleated free water 6 One 100 μl of No.5 solution + 900 μl of nucleated free water 7 0 Nuclease Free Water Extraction Using DNA Kits

Standard solutions of genomic DNA of CHO-K1, CHO-DXB11 and CHO-DG44 were prepared in the same manner as above. In addition, since the CHO-DXB11 and CHO-DG44 cells were prepared in the same manner as the CHO-K1 cells in the following examples for the control solution and spike samples for quality control of CHO Genomic DNA, the following description will be made based on CHO-K1 cells. The description for CHO-DXB11 and CHO-DG44 cells will be omitted.

DNA of the standard solution was extracted using a DNA extraction kit (Wako Pure Chemical Industries, Cat. No .: 295-50201) as follows.

65 μl glycogen solution was placed in 26 mL sodium iodide solution. 2 μl glycogen solution was added to a 40 ml wash solution and mixed immediately. Dispense 500 μl each of the nucleated free water as a blank and 100,000 pg / ml CHO-K1 Genomic DNA standard solution into a 2 ml sterile tube. 20 μl sodium N-lauoyl sarcosinate was added to the tube and mixed. (If white precipitate is formed, incubate for 10 minutes at 60 ± 5 ° C using a heating block and digital thermometer.) 10 μl proteolytic enzyme K (20 mg / ml) (New England Biolabs, Catalog No .: P8102S) I mixed it. This was incubated at 60 ± 5 ° C. for 20 minutes in a heating block. 500 μl of NaI solution containing glycogen was added and vortexed, followed by incubation for 15 minutes at 50 ± 5 ° C. in a heating block. 900 μl isopropanol (Sigma-Aldrich, catalog number: I9782) was added thereto, and then allowed to stand at room temperature for 30 ± 5 minutes. After briefly centrifugation (13,000 RPM X 15 minutes), a white precipitate was confirmed. The supernatant and the solution remaining on the tube wall were removed using a pipette. 800 μl wash solution was placed in a tube and vortexed to remove any precipitate from the tube wall. After centrifugation (13,000 RPM X 10 minutes) the supernatant was removed using a micro pipette. 1,500 μl of washing solution containing glycogen was placed in a tube and vortexed. The supernatant was removed after centrifugation (13,000 RPM X 10 minutes). The remaining precipitate contains DNA and carrier glycogen. The precipitate was air dried at room temperature for about 30 minutes, and then the precipitate was dissolved in 500 μl nucleated free water.

2-2. Preparation and Extraction of Control Solution for CHO Genomic DNA Quality Control

Control solutions for quality control of CHO Genomic DNA were prepared from the CHO Genomic DNA stock solution (1 μg / ml) prepared in Example 2-1. 100,000 pg / ml, 1,000 pg / ml and 100 pg / ml CHO Genomic DNA solutions were prepared by diluting 10 times from 1,000,000 pg / ml CHO Genomic DNA solutions. Ten-fold dilutions were prepared by mixing 100 μl CHO Genomic DNA solution and 900 μl water. Each of the three quality control solutions were prepared using a 20-fold dilution of 100,000 pg, 1,000 pg, and 100 pg of standard solution per ml. A 20-fold dilution was prepared by placing 50 μl of DNA in 950 μl of water and simply vortexing at full speed. Finally, control solutions for CHO Genomic DNA quality control were prepared to be 5,000 pg, 50 pg, and 5 pg per ml.

Dilution of Control Solution for CHO Genomic DNA Quality Control Sample number CHO gDNA Concentration
(pg / ml) Dilution method One 5,000 50 μl standard solution of Table 2 + 900 μl of nucleated free water 2 50 50 μl standard solution of Table 2 + 900 μl of nucleated free water 3 5 50 μl standard solution of Table 2 + 900 μl of nucleated free water

DNA of the control solution for quality control was extracted using a DNA extraction kit (Wako Pure Chemical Industries, Cat. No .: 295-50201). 500 μl of each CHO Genomic DNA quality control solution was dispensed into a 2 ml sterile tube with a lid, and the DNA extraction procedure below was performed in the same manner as the DNA extraction method of the standard solution described in Example 2-1. It was.

2-3. Preparation and DNA Extraction of Recombinant Protein Samples

The composition of the recombinant protein sample used in this example is shown in the following table.

Composition of Recombinant Protein Samples sample Furtherance Sample 1 Recombinant Protein (25 mg / mL), 10 mM Tris, 4% Manitol, 1% Sucrose Sample 2 Monoclonal Antibody A (20 mg / ml), 25 mM sodium citrate, 154 mM sodium chloride, 0.07% Tween 80 Sample 3 Monoclonal antibody B (20 mg / ml), 5 mM L-histidine, 100 mM trehalose, 0.01% Tween20

Residual DNA present in the recombinant protein was extracted using a DNA extraction kit (Wako Pure Chemical Industries, Cat. No .: 295-50201). The protein concentration of the recombinant protein sample was diluted to a concentration within the range of 1 mg / ml 20 mg / ml. 500 μl of the diluted recombinant protein sample was dispensed into a 2 ml sterile tube with a lid. Subsequently, the DNA extraction process was performed in the same manner as the DNA extraction method of the standard solution described in Example 2-1.

2-4. Preparation of Spike Samples and DNA Extraction

A spike sample mixture was prepared by adding 495 μl of each recombinant protein sample of Table 4 to a 1.7 mL microfuse tube. 5 μl of the 1,000,000 pg / ml CHO-K1 Genomic DNA standard stock solution prepared in Example 2-1 was added to each tube and mixed thoroughly.

Composition of Spike Sample Mixes Spiked in the sample
DNA concentration CHO Genomic DNA
(1,000,000 pg / ml) Recombinant protein sample 10,000 pg / ml 5 μl 495 μl

DNA of the spike sample was extracted using a DNA extraction kit (Wako Pure Chemical Industries, Cat. No .: 295-50201). 500 μl of each spike sample was dispensed into a 2 ml sterile tube with a lid, and the DNA extraction procedure below was performed in the same manner as the DNA extraction method of the standard solution described in Example 2-1.

2-5. Preparation of the Master Mixture

Mixing as shown in Table 6 prepared a master mixture. (The final concentration of primers and probes in the mixture is 435 nanomolar concentrations). TaqMan 2X Universal PCR Master mix was obtained from Applied Biosystems (Cat. No .: 4304437).

Components, Primers, and Probes of the Master Mixture TagMan Universal PCR Master mix (2X) 1,500 μl Forward primer (10 μM) 75 μl Reverse primer (10 μM) 75 μl Probe (10 μM) 75 μl

2-6. Preparation of DNA Standard Solution for Loading

DNA standard solutions were prepared for loading into 96 well optical reaction plates. 50 μl of master mixture was placed in seven 1.7 mL microfuse tubes. To the first tube was added 50 μl of 100,000 pg / ml standard solution (prepared in Example 2-1) from which DNA was extracted and gently mixed by pipetting up or down six times or vortexing at full speed. The tube was closed and placed aside until all the solution was ready to be loaded into the plate. This process was repeated for the remaining five DNA standard and blank solutions.

2-7. Preparation of QA Control Solution for Loading

QC control solutions were prepared for loading into 96 well optical reaction plates. 50 μl of DNA extracted 5,000 pg / ml QC control solution (prepared in Example 2-2) was placed in a 1.7 mL microfuse tube. 50 μl of master mixture was added to the tube. The solution was pipetted up and down six times gently or vortexed at full speed to mix thoroughly. This procedure was repeated for 50 pg / ml DNA extracted and 5 pg / ml QC control solution. The tube was placed aside until all the solution was ready to be loaded into the plate.

2-8. Preparation of Samples to Load

First DNA samples were prepared for loading into 96 well optical reaction plates. The DNA sample refers to a residual DNA sample extracted from the recombinant protein of Example 2-3. 50 μl of extracted DNA sample was added to a clean 1.7 mL microfuse tube. 50 μl of master mixture was added to the tube and gently pipetteed up and down six times or vortexed at full speed to mix thoroughly. The tube was closed and placed aside until all the solution was ready to be loaded into the plate. This process was repeated for all remaining samples.

2-9. Preparation of Spike Samples for Loading

The first spike sample was prepared for loading into a 96 well optical reaction plate. The spike sample refers to a DNA sample extracted from the spike sample mixture of Example 2-4. 50 μl of DNA extracted spike sample was added to a 1.7 mL microfuse tube. 50 μl of master mixture was added to the tube and gently pipetteed up and down six times or vortexed at full speed to mix thoroughly. The tube was closed and placed aside until all the solution was ready to be loaded into the plate. This process was repeated for all remaining spike sample solutions.

2-10. Preparation of blanks to be loaded (No Extraction)

A blank mixture (No Extraction) mixture was prepared for loading into a 96 well optical reaction plate. 50 μl of nucleated free water was added to a 1.7 mL microfuse tube. 50 μl of master mixture was added to the tube and gently pipetteed up and down six times or vortexed at full speed to mix thoroughly. The tube was closed and placed aside until all the solution was ready to be loaded into the plate.

Example 3 Quantitative Real-Time Polymerase Reaction

25 μl of each standard solution mixture prepared in three wells of each PCR plate 25 μl of QC control solution prepared 25 μl of sample prepared and 25 μl of blank prepared with spike sample solution (No Extraction), followed by optical adhesion The plate was covered with a cover.

Thereafter, a 7500 real time PCR system (Applied Biosystems, USA) for quantitative PCR was set up. Cycling parameters of temperature and time are shown in the table below.

Temperature Cycling Parameters Temperature and time childhood
45 cycles Dissolution Heating / cooling expansion fixing fixing 15 seconds, 95 ℃
60 sec, 55 ℃
60 sec, 72 ℃
2 minutes, 50 ℃ 10 minutes, 95 ℃

96 well plates were loaded in a 7500 real time PCR system and quantitative real time PCR was performed. Data was analyzed after completion of the run.

Example 4: Reaction Result Analysis

4-1. Data Analysis

A standard curve is made by plotting the DNA amount of C _T (y value) against logarithm (x value) for pg per ml. C _T is The median value of C _T for each of the three repeating values is estimated and the concentration of the sample (x value) is calculated using the slope and the y-intercept determined from the standard curve based on the C _T value. The threshold is set at 0.1 and the baseline is set at cycle 3 to cycle 15.

4-2. Response result

end. Linearity

The primer and probe sequences of Table 1 showed a straight line close to 1.00 for detecting Genomic DNA of three CHO cells (CHO-K1, CHO-DG44, CHO-DXB11) (see FIGS. 4A-4C). The CHO-K1 cells were obtained from ATCC (Cat. No .: CCL-61, Lot No .: 3442943), and the CHO-DG44 and CHO-DXB11 cells were obtained from Lawrence Chasin (Department of biological science, University of Columbia, USA). .

I. Recovery

Nearly 100% recovery was obtained when the DNA extraction kit was used to extract the genomic DNA of the host cells remaining in each purified protein sample (Samples 1-3, Table 4) (see Tables 8-10).

Recovery of CHO-DXB11 Genomic DNA from Quality Control Control Samples and Sample 1 Recovery of QA Control Samples DNA concentrations in QA control samples C _T value Measured value
(pg / ml) Theoretical value
(pg / ml) Recovery rate (%) 5,000 pg / ml 25.59 5207.61 5,000 104.15 50 pg / ml 33.21 44.60 50 89.21 5 pg / ml 37.10 3.94 5 78.76 Recovery of Purified Protein Sample 1 from CHO-DXB11 Added to the sample
Amount of DNA C _T value Measured value
(pg / ml) Theoretical value
(pg / ml) Recovery rate (%) N / A Not detected 0 N / A N / A 10,000 pg / ml 24.62 9542.33 10,000 95.42

Recovery of CHO-DG44 Genomic DNA from Quality Control Control Samples and Sample 2 Recovery of QA Control Samples DNA concentrations in QA control samples C _T value Measured value
(pg / ml) Theoretical value
(pg / ml) Recovery rate (%) 5,000 pg / ml 25.55 4923.84 5,000 98.48 50 pg / ml 33.07 43.32 50 86.63 5 pg / ml 36.26 5.83 5 116.54 Recovery of Purified Protein Sample 1 from CHO-DG44 Added to the sample
Amount of DNA C _T value Measured value
(pg / ml) Theoretical value
(pg / ml) Recovery rate (%) N / A Not detected 0 N / A N / A 10,000 pg / ml 24.51 9440.77 10,000 94.41

Recovery of CHO-K1 Genomic DNA from Quality Control Control Samples and Samples 3 Recovery of QA Control Samples DNA concentrations in QA control samples C _T value Measured value
(pg / ml) Theoretical value
(pg / ml) Recovery rate (%) 5,000 pg / ml 24.51 5391.34 5,000 107.83 50 pg / ml 32.06 50.46 50 100.93 5 pg / ml 35.84 4.89 5 97.75 Recovery of Purified Protein Sample 1 Produced from CHO-K1 Added to the sample
Amount of DNA C _T value Measured value
(pg / ml) Theoretical value
(pg / ml) Recovery rate (%) N / A Not detected 0 N / A N / A 10,000 pg / ml 23.51 9970.87 10,000 99.71

All. Specificity

The primer and probe sequences of Table 1 showed no PCR reaction with bacterial ( S. Paucimobilis , B. cereus and S. epidermidis ) Genomic DNA, and showed specific PCR reaction only in CHO cells (see Table 11). The three bacteria are strains that are likely to be contaminated during the recombinant protein culture process.

Recovery of CHO-DG44 DNA from three bacterial DNA mixtures ( S. Paucimobilis , B. cereus and S. epidermidis ) CHO-DG44
Genomic DNA Volume
(pg / ml) Three Bacterial Genomic DNA Mixtures (pg / ml) Measured value
(pg / ml) Theoretical value
(pg / ml) Recovery
(%) 5,000 0 4781.58 5,000 95.63 1,000,000 5224.28 5,000 104.49 1,000 5053.09 5,000 101.06 50 0 55.73 50 111.46 1,000,000 57.31 50 114.62 1,0000 51.08 50 102.16 5 0 5.52 5 110.40 1,000,000 4.85 5 97.00 1,000 5.09 5 101.80

While the present invention has been described with reference to exemplary embodiments, it is understood that those skilled in the art can make various changes without departing from the scope of the present invention, and that elements can be replaced by equivalents. You will know. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out the invention, but that the invention will include all embodiments falling within the scope of the appended claims.

<110> Celltrion Inc. <120> Composition for detecting or measuring CHO cell DNA <160> 3 <170> Kopatentin 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 1 ccctagactt gctgtggatg tg 22 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Backward primer <400> 2 ttagcagaca ctgttgcaga gaca 24 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 3 accagtcagc tgatgtggac acccc 25

Claims (8)

A primer set for detecting CHO (Chinese Hamster Ovary) cell DNA represented by the nucleotide sequences of SEQ ID NOs: 1 and 2. A composition for detecting or quantifying CHO (Chinese Hamster Ovary) cell DNA, comprising a primer set represented by a nucleotide sequence of SEQ ID NOs: 1 and 2 and a probe represented by a nucleotide sequence of SEQ ID NO: 3. The composition of claim 2, wherein the probe has a fluorescent marker inserted at one end and a fluorescent inhibitor inserted at the other end. The composition of claim 2, wherein the CHO cell DNA is genomic DNA of CHO cells remaining in a sample. A kit for the detection or quantification of Chinese Hamster Ovary (CHO) cell DNA comprising the composition of any one of claims 2 to 4. (a) extracting DNA from a sample;
(b) performing PCR (Polymerase chain reaction) on the DNA extracted in step (a) with a primer set represented by a nucleotide sequence of SEQ ID NOs: 1 and 2 and a probe represented by a nucleotide sequence of SEQ ID NO: 3 ; And
(c) measuring the fluorescence signal;
Method of detecting or quantifying DNA of CHO cells. 7. The method of claim 6, wherein said PCR is a quantitative real-time polymerase chain reaction. The method of claim 6, wherein the probe is inserted with a fluorescent marker at one end and a fluorescent inhibitor is inserted at the other end.

Images