KR20130060246A - Composition for detecting or measuring sp2/0 cell dna - Google Patents

Abstract

PURPOSE: A composition for detecting or quantitating Sp2/0 cell DNA is provided to specifically detect only Sp2/0 cell DNA and to effectively detect and quantitate Sp2/0 cell DNA contained in a cell culture or purified material thereof. CONSTITUTION: A primer set for detecting Sp2/0 cell DNA contains base sequences of sequence numbers 1 and 2. A composition for detecting or quantitating Sp2/0 cell DNA contains the primer set and a probe of sequence number 3. A method for detecting or quantitating Sp2/0 cell DNA comprises: a step of isolating DNA from a sample; a step of performing PCR using the primer set and the probe; and a step of measuring fluorescent signal.

Description

Composition for detecting or quantifying SPL2/0 cell DNA {Composition for detecting or measuring Sp2/0 cell DNA}

The present invention relates to a composition for detecting or quantifying Sp2/0 cell DNA, and more specifically, to a primer and a probe capable of specifically detecting Sp2/0 cell DNA.

Sp2/0 cells are widely used as host cells for producing purified protein drugs, and have been approved by many management agencies. Purified protein produced from Sp2/0 cells Contamination of host cell DNA in pharmaceuticals is not considered a significant risk factor, but must be controlled to the lowest level, so the World Health Organization (WHO) has determined 10 ng of host cell DNA per dose in pharmaceuticals. It is recommended as follows.

Methods for detecting residual DNA in purified protein pharmaceuticals include the blot hybridization method, the THRESHOLD (Molecular Devices Corporation) method using an enzymatic reaction, and the quantitative Real Time Polymerase Chain Reaction (PCR) method. However, the blot hybridization method has a high limit of detection and quantification compared to other methods, and the THRESHOLD method has a disadvantage in that the experimental material is expensive and detects all DNA contained in the sample. On the other hand, quantitative Real Time Polymerase Chain Reaction (PCR) method can be accurately quantified in a short time with lower detection and quantification limits than other methods, and is currently used to detect bacterial, fungal, and viral DNA. have.

However, until now, a technique for a quantitative real-time polymerase chain reaction method for measuring the DNA of Sp2/0 cells remaining in a sample of a recombinant protein produced in Sp2/0 cells has not been developed.

Accordingly, the present inventors made a primer and a probe specific for Sp2/0 cells, and confirmed that the host cell DNA remaining in the purified protein can be accurately detected and quantified by performing quantitative real-time polymerase chain reaction using this. The invention was completed.

Accordingly, an object of the present invention is to provide a primer set for detection of Sp2/0 cell DNA represented by the nucleotide sequences of SEQ ID NOs: 1 and 2.

It is also an object of the present invention to provide a composition for detecting or quantifying Sp2/0 cell DNA, comprising a primer set represented by the nucleotide sequence of SEQ ID NO: 1 and 2 and a probe represented by the nucleotide sequence of SEQ ID NO: 3.

It is also an object of the present invention to provide a kit for detection or quantification of Sp2/0 cell DNA comprising the composition. In addition, the object of the present invention is (a) extracting DNA from a sample; (b) performing PCR (polymerase chain reaction) on the DNA extracted in step (a) with a primer set represented by the nucleotide sequence of SEQ ID NO: 1 and 2 and a probe represented by the nucleotide sequence of SEQ ID NO: 3 ; And (c) to provide a method for detecting or quantifying the DNA of Sp2/0 cells comprising the step of measuring the fluorescence signal.

In order to achieve the above object, the present invention provides a primer set for detection of Sp2/0 cell DNA represented by the nucleotide sequences of SEQ ID NOs: 1 and 2.

In addition, the present invention provides a composition for detecting or quantifying Sp2/0 cell DNA, comprising a primer set represented by the nucleotide sequence of SEQ ID NO: 1 and 2 and a probe represented by the nucleotide sequence of SEQ ID NO: 3.

In addition, the present invention provides a kit for detection or quantification of Sp2/0 cell DNA comprising the composition.

In addition, the present invention comprises the steps of: (a) extracting DNA from a sample; (b) performing PCR (polymerase chain reaction) on the DNA extracted in step (a) with a primer set represented by the nucleotide sequence of SEQ ID NO: 1 and 2 and a probe represented by the nucleotide sequence of SEQ ID NO: 3 ; And (c) it provides a method for detecting or quantifying the DNA of Sp2/0 cells comprising the step of measuring the fluorescence signal.

Hereinafter, the present invention will be described in more detail.

In the present invention, the'Sp2/0 cell' is Mus It is a cell made by fusion of B cells of musculus and myeloma cells.

In the present invention, the'sample' may be a culture obtained as a result of culturing using Sp2/0 cells as host cells for the production of biopharmaceuticals or a purified product of the culture, but is not limited thereto, but preferably a recombinant protein or a monoclonal In order to produce an antibody, it may be a culture of transformed Sp2/0 cells, or a purified product thereof. A method for preparing the culture or purified product is widely known in the art. The biopharmaceutical is not limited thereto, but may be a purified protein, and the purified protein includes a purified protein having pharmaceutical, diagnostic properties, or properties useful for commercial, experimental or other uses. In addition, the purified protein may be a therapeutic protein, and the therapeutic protein is not limited thereto, but may be a therapeutic antibody. The antibodies include monoclonal antibodies and polyclonal antibodies. In addition, the above antibodies include non-human animal antibodies, humanized antibodies, chimeric antibodies, human antibodies, modified antibodies in which other molecules (eg, polymers such as PEG) are bound, antibodies with altered amino acid sequence, antibodies with altered sugar chains, etc. Also includes antibodies.

In the present invention, the'probe' specifically binds to the target sequence of Sp2/0 cell DNA, preferably Sp2/0 cell genomic DNA, more preferably Sp2/0 cell genomic DNA (blue portion in FIG. 2). As a nucleic acid molecule capable of, at least one selected from the group consisting of radioactive isotopes, ligands, fluorescent substances, chemiluminescent agents, and enzymes may be attached, and more preferably, a fluorescent labeling factor is inserted at one end and at the opposite end. It may be that the fluorescence inhibitor is inserted. Specifically, 6-FAM (6-carboxyfluorescein), TET (5'-Tetrachloro-Fluorescein), VIC, 6-JOE (6-carboxy-4', 5'-dichloro- 2',7'-dimethoxyfluorescein), NED, ROX (6-carboxy-X-rhodamine), Texas Red, Cy3, Cy5 and HEX (2',4',5',7'-tetrachloro-6-carboxy-4 ,7-dichlorofluorescein) can be labeled, and 6-TAMRA (6-carboxytetramethylrhodamine), BHQ-1,2,3 (Black Hole Quencher) at the opposite end (preferably 3'end) ) And DABCYL dark fluorescence inhibitor (DABCYL Dark Quencher) can be labeled any one selected from the group consisting of.

The probe may preferably be represented by the nucleotide sequence of SEQ ID NO: 3, but if it can form a hybrid with the target sequence, even if there is some change (deletion, substitution or addition) of the sequence, the probe of the present invention Included. For example, even if there is 80%, preferably 90%, more preferably 95%, even more preferably 99% homology with the nucleotide sequence of SEQ ID NO: 3, it is included in the primer set of the present invention.

The primer set of the present invention is represented by the nucleotide sequence of SEQ ID NO: 1 and 2, and has a characteristic capable of specifically detecting Sp2/0 cell DNA. Specifically, the primer set of the present invention is used in the sample to be Sp2/0 cell DNA. Can be specifically detected, in particular, the sample is bacteria, preferably Sphingomonas Paucimobilis , Bacillus cereus or Staphylococcus epidermidis may be easily contaminated with one or more types of bacteria selected from the group consisting of epidermidis, but the primer set of the present invention has the characteristic that it is capable of specifically detecting only the DNA of Sp2/0 cells in distinction from the bacteria.

The primer set of the present invention is specific to the target sequence of Sp2/0 cell DNA, preferably Sp2/0 cell genomic DNA, more preferably Sp2/0 cell genomic DNA (red and green portions in FIG. 2). It has a feature that can be annealed to form a hybrid. The primer set is capable of initiating DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different deoxynucleoside triphosphates at an appropriate buffer and temperature.

The primer set of the present invention is preferably represented by the nucleotide sequence of SEQ ID NO: 1 and 2, but the Sp2/0 cell DNA, preferably Sp2/0 cell genomic DNA, more preferably Sp2/0 cell genomic DNA If a hybrid can be formed by specifically annealing the target sequence (red, green part of Fig. 2), even if there is some change (deletion, substitution or addition) of the sequence, the primer set of the present invention Included in For example, even if there is 80%, preferably 90%, more preferably 95%, even more preferably 99% homology with the nucleotide sequences of SEQ ID NOs: 1 and 2, it is included in the primer set of the present invention. do.

On the other hand, the composition for detecting or quantifying Sp2/0 cell DNA of the present invention is characterized in that it comprises a primer set represented by the nucleotide sequence of SEQ ID NO: 1 and 2 and a probe represented by the nucleotide sequence of SEQ ID NO: 3.

The composition of the present invention includes a primer set represented by the nucleotide sequence of SEQ ID NO: 1 and 2 and a probe represented by the nucleotide sequence of SEQ ID NO: 3, and thus Sp2/0 cell DNA can be specifically detected and quantified.

The Sp2/0 cell DNA is not limited thereto, but preferably may be the genomic DNA of Sp2/0 cells remaining in the sample, and the sample is a Sp2/0 cell capable of easily infecting bacteria as described above. It may be a culture or a purified product thereof. Therefore, the composition of the present invention has the characteristic of being able to specifically detect and quantify only the DNA of Sp2/0 cells in distinction from the bacteria.

The composition of the present invention may additionally contain reagents, DNA polymerase, and dNTP necessary for the hybridization reaction of the primer set and probe, and stabilize the primer set and probe, and a buffer and a solvent serving as a reaction medium And the like may be further included.

On the other hand, the kit for detection or quantification of Sp2/0 cell DNA of the present invention is characterized in that it comprises the composition of the present invention.

Since the kit of the present invention contains a composition containing the primers and probes of the present invention, Sp2/0 cell DNA can be specifically detected and quantified.

The kit of the present invention may additionally include components commonly used in a microorganism detection kit, preferably PCR (polymerase chain reaction), more preferably RT-PCR (Real Time-Polymerase chain reaction) It may further include commonly used components and support. The support is not limited thereto, but is preferably one selected from the group consisting of a nitrocellulose membrane, a 96 well plate synthesized from polyvinyl resin, a 96 well plate synthesized from polystyrene resin, or a slide glass made of glass. I can.

On the other hand, the method of detecting or quantifying the DNA of Sp2/0 cells of the present invention comprises the steps of: (a) extracting DNA from a sample; (b) performing PCR (polymerase chain reaction) on the DNA extracted in step (a) with a primer set represented by the nucleotide sequence of SEQ ID NO: 1 and 2 and a probe represented by the nucleotide sequence of SEQ ID NO: 3 ; And (c) measuring a fluorescence signal.

In step (a), DNA can be extracted from the sample by using a method commonly known in the art, but DNA can be easily extracted from the sample using a commercially available DNA extraction kit.

As described above, the sample may be a culture of Sp2/0 cells or a purified product of the host cell, and these may be easily contaminated with bacteria, except for the bacteria by using the quantification or detection method of the present invention. Only the DNA of Sp2/0 cells can be specifically detected or quantified.

By performing PCR (polymerase chain reaction) in step (b), a fluorescence signal can be generated only when DNA of Sp2/0 cells is present. Specifically, the primer set represented by the nucleotide sequence of SEQ ID NO: 1 and 2 specifically hybridizes to the DNA of the Sp2/0 cell, and the probe represented by the nucleotide sequence of SEQ ID NO: 3 is also hybridized to the DNA of the Sp2/0 cell and PCR While performing (polymerase chain reaction), although not limited thereto, the fluorescent labeling factor and the fluorescent suppressing factor attached to the probe may be separated to generate a fluorescent signal.

The PCR in step (b) is not limited thereto, but may preferably be a quantitative real-time polymerase chain reaction (qRT-PCR). For the qRT-PCR method and device, methods and devices known in the art may be used, but are not limited thereto, but preferably, SLAN real time PCR detection system (LG Life Science, Korea), LightCyclerTM (Roche, Germany), ABI PRISMTM 7000/7700, 7500 (Applied Biosystems, USA), iCyclerTM (Bio-Rad, USA), Rotor-GeneTM (Corbett, Australia) or OpticonTM (PharmaTech, USA).

In the step (b), PCR may be performed by additionally including reagents, DNA polymerase, and dNTP necessary for the primer set and probe to perform a hybridization reaction, and also stabilize the primer set and probe, and It may be carried out by further including a buffer, a solvent, etc. as a medium.

The measurement of the fluorescence signal in step (c) can be easily measured by a person skilled in the art using the apparatus described in step (b), and specifically, a fluorescent label attached to the probe and a fluorescent inhibitor are subjected to a PCR reaction. It is possible to measure the fluorescence signal generated separately during the process.

Substituting the fluorescence signal intensity measured in step (c) into a standard curve measured through a standard sample (a sample in which the content of Sp2/0 cell DNA is specified), the Sp2/0 cell DNA contained in an actual unknown sample Can be quantified.

In an embodiment of the present invention, a standard curve for Sp2/0 was secured using the primer and probe of the present invention and described in FIG. 4, and it was confirmed that the standard curve has linearity. It was confirmed that the contained Sp2/0 cell DNA can be quantified.

The primer of the present invention and the composition containing the same can specifically detect only Sp2/0 cell DNA, so that the cells are used as host cells to be used in culture or purified products of the cells produced in the process of manufacturing biopharmaceuticals. It can be easily used to effectively detect or quantify contained Sp2/0 cell DNA.

1 schematically shows a process of detecting and quantifying residual DNA through real-time PCR by extracting DNA remaining in the purified protein after purifying a recombinant protein cultured in Sp2/0 cells.
2 shows the sequence of a genomic DNA fragment extracted from Sp2/0 cells.
3 is a result of performing real-time PCR by concentration using genomic DNA extracted from Sp2/0 cells as a template.
Figure 4 shows the linearity of the standard curve of Sp2/0 genomic DNA.

Hereinafter, the present invention will be described in detail according to examples. The following examples are intended to specifically illustrate the present invention, and the present invention is not limited thereto.

Example One: primer And Of the probe making

The present inventors Rnr2 16S ribosomal RNA [Mus] registered in GenBank of NCBI (National Center for Biotechnology Information) musculus ] (Accession No. NC_005089) from the sequence (FIG. 2), forward and reverse primer sets and probes as shown in Table 1 below were devised.

Primer and Probe Sequence Primers and probes order Sequence number Forward primer 5'- GCCTGCCCAGTGACTAAAGTTT -3' One Reverse primer 5'- CCGTTCATGCTAGTCCCTAATTAAG -3' 2 Probe sequence FAM 5'- CCGCGGTATCCTGACCGTGCA -3' TAMRA 3

Methods for preparing and using probes and primers are described, for example, in Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992; And Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990.

Example 2: Preparation process before quantitative real-time polymerase reaction

2-1. Sp2 /0 Genomic DNA Preparation of standard solutions and DNA extraction

To use as a standard material for drawing a standard curve, Sp2/0 cell genomic DNA was extracted using the QIAGEN (Cat. No. 13343) kit and diluted to 1 µg/ml. A standard solution was prepared from the above Sp2/0 cells (obtained from ATCC, catalog number: CRL-1581, lot number: 7390622) genomic DNA standard stock solution (1 μg/ml). First, to prepare a standard solution (No.1), a Sp2/0 genomic DNA standard stock solution (1 μg/ml) was prepared by diluting 10 times, and a DNA extraction kit (Wako Pure Chemical Industries, catalog number: 295-50201) After extraction with, each standard solution (No.2-5) was sequentially diluted 10 times to prepare. The standard solution (No. 6) was prepared by diluting the standard solution (No. 5) twice. The 2-fold dilution and 10-fold dilution were prepared using nuclease-free water (Ambion, catalog number: 9937) as shown in Table 2 below, and simply vortexed at the highest speed. Finally, Sp2/0 genomic DNA standard solutions were prepared at 100,000 pg/ml, 10,000 pg/ml, 1,000 pg/ml, 100 pg/ml, 10 pg/ml, and 5 pg/ml.

Dilution of Sp2/0 genomic DNA standard solution Standard solution
number Sp2/0 gDNA concentration
(pg/ml) Dilution method One 100,000 Using Wako DNA Kit
100,000 pg/ml Sp2/0 genomic DNA extraction 2 10,000 100 µl of standard solution #1 + 900 µl of nuclease-free water 3 1,000 100 µl of standard solution #2 + 900 µl of nuclease-free water 4 100 100 µl of standard solution 3 + 900 µl of nuclease-free water 5 10 100 µl of standard solution 4 + 900 µl of nuclease-free water 6 5 300 µl of standard solution #5 + 300 µl of nuclease-free water 7 0 Nuclease-free water extraction using a DNA kit

The standard solution of DNA (100,000 pg/ml) and nuclease-free water were extracted as follows using a DNA extraction kit (Wako Pure Chemical Industries, catalog number: 295-50201).

65 [mu]l glycogen solution was placed in 26 ml sodium iodide solution. 2 µl of the glycogen solution was added to the 40 ㎖ washing solution and immediately mixed. 100,000 pg/ml Sp2/0 genomic DNA standard solution and 500 µl each of nuclease-free water as a blank were dispensed into a 2 ml sterile tube. 20 µl sodium N-lauoyl sarcosinate was added to the tube and mixed. (If a white precipitate occurs, incubation was performed at 60±5° C. for 10 minutes using a heating block and a digital thermometer.) 10 μl proteolytic enzyme K (20 mg/ml) (New England Biolabs, catalog number: P8102S) was added. I mixed it up. And it was incubated for 20 minutes at 60 ± 5 ℃ in a heating block. After vortexing 500 µl of NaI solution containing glycogen, it was incubated for 15 minutes at 50±5°C in a heating block. After adding 900 µl isopropanol (Sigma-Aldrich, catalog number: I9782), it was allowed to stand at room temperature for 30±5 minutes at room temperature. After simple centrifugation (13,000RPM X 15 minutes), a white precipitate was confirmed. The supernatant and the solution remaining on the tube wall were removed using a pipette. 800 µl of the washing solution was put into the tube and vortexed so that the precipitate fell off the tube wall. After centrifugation (13,000RPM X 10 minutes), the supernatant was removed using a micropipette. 1,500 µl of a washing solution containing glycogen was put into a tube and vortexed. After centrifugation (13,000RPM X 10 minutes), the supernatant was removed. The remaining precipitate contains DNA and carrier glycogen. After the precipitate was air-dried at room temperature for about 30 minutes, the precipitate was dissolved in 500 µl nuclease-free water.

2-2. Sp2 /0 Genomic DNA Preparation of a control solution for quality control and DNA extraction

Control solutions for quality control of Sp2/0 genomic DNA were prepared as Sp2/0 genomic DNA stock solution (1 μg/ml) prepared in Example 2-1. Sp2/0 genomic DNA solutions of 10,000 pg/ml and 1,000 pg/ml were prepared by diluting 10-fold from Sp2/0 genomic DNA stock solution (1 µg/ml). A 10-fold dilution was prepared by mixing 100 µl gDNA solution and 900 µl water. Each of the three quality control solutions was prepared by diluting a standard solution of 1,000,000 pg, 10,000 pg, and 100 pg per ml by 20 times. The 20-fold dilution was prepared by adding 50 µl of DNA to 950 µl of water and simply vortexing at the highest speed. Finally, Sp2/0 genomic DNA control solutions were prepared to be 50,000 pg, 500 pg, and 50 pg per ml.

Dilution of control solution for Sp2/0 genomic DNA quality control sample
number Sp2/0 gDNA concentration (pg/ml) Dilution method One 50,000 Sp2/0 genomic DNA standard stock solution (1µg/ml) 50µl +
900 µl of nuclease-free water 2 500 50 µl of standard solution No. 2 in Table 2 + 900 µl of nuclease-free water 3 50 50 µl of standard solution No. 3 in Table 2 + 900 µl of nuclease-free water

DNA of the control solution for quality control was extracted using a DNA extraction kit (Wako Pure Chemical Industries, catalog number: 295-50201). Each of 500 µl of each Sp2/0 genomic DNA quality control control solution was dispensed into a 2 ml sterile tube with a lid, and the following DNA extraction procedure was performed in accordance with the DNA extraction method of the standard solution described in Example 2-1. It was done in the same way.

2-3. Preparation of recombinant protein samples and DNA extraction

The composition of the recombinant protein sample used in this example is shown in the following table.

Composition of the recombinant protein sample sample Furtherance Sample 1 Monoclonal antibody A (17 mg/ml), 10 mM sodium hydrogen phosphate, 10% sucrose,
0.01% Tween 80, pH 7.2 Sample 2 Monoclonal antibody B (5 mg/ml), 100 mM glycine, 10 mM hydrated citric acid,
100 mM sodium chloride, 0.01% Tween 80, pH 5.5

Residual DNA present in the recombinant protein was extracted using a DNA extraction kit (Wako Pure Chemical Industries, catalog number: 295-50201). 500 μl of the recombinant protein sample was dispensed into a 2 ml sterile tube with a lid. Hereinafter, the DNA extraction process was performed in the same manner as the DNA extraction method of the standard solution described in Example 2-1.

2-4. Preparation of spike samples and DNA extraction

A spike sample mixture was prepared by adding 490 µl of each of the recombinant protein samples shown in Table 4 to a 1.7 ml microfuse tube. In each tube, 10 µl of the 1,000,000 pg/ml Sp2/0 genomic DNA standard stock solution prepared in Example 2-1 was added at a time and mixed thoroughly.

Composition of Spike Sample Mixture Concentration of DNA spiked in the sample Sp2/0 genomic DNA
(1,000,000 pg/ml) Recombinant protein sample 10,000 pg/ml 10 μl 490 μl

The DNA of the spike sample was extracted using a DNA extraction kit (Wako Pure Chemical Industries, catalog number: 295-50201). 500 μl of each spike sample was dispensed into a 2 ml sterile tube with a lid, and the following DNA extraction procedure was performed in the same manner as the DNA extraction method of the standard solution described in Example 2-1.

2-5. Preparation of the master mixture

A master mixture was prepared by mixing as shown in Table 6. (The final concentration of primer and probe in the mixture is 435 nanomolar concentration). TaqMan 2X Universal PCR Master mix was obtained from Applied Biosystems (catalog number: 4304437).

Components of Master Mixture, Primers, and Probes TagMan Universal PCR Master mix (2X) 1,500 μl Forward primer (10 μM) 75 μl Reverse primer (10 μM) 75 μl Probe (10 μM) 75 μl

2-6. To load DNA Preparation of standard solution

A DNA standard solution to be loaded into a 96 well optical reaction plate was prepared. 50 [mu]l of the master mixture was placed in seven 1.7 ml microfuse tubes. To the first tube, 50 µl of a 100,000 pg/ml standard solution (prepared in Example 2-1 above) from which DNA was extracted was added and gently pipetted up and down 6 times or vortexed at full speed to thoroughly mix. The tube was closed and set aside until all solutions were ready to be loaded onto the plate. This process was repeated for the remaining 5 DNA standard solutions and blank solutions.

2-7. Preparation of the quality control control solution to be loaded

A quality control control solution to be loaded into a 96 well optical reaction plate was prepared. In a 1.7 ml microfuse tube, 50 µl of DNA extracted 5,000 pg/ml of a quality control control solution (prepared in Example 2-2) was added. 50 μl of the master mixture was added to the tube. The solution was gently pipetted up and down 6 times or vortexed at full speed to mix thoroughly. This process was repeated for the DNA-extracted 50 pg/ml and 5 pg/ml concentrations of the quality control control solution. The tube was set aside until all solutions were ready to be loaded onto the plate.

2-8. Preparation of the sample to be loaded

The first DNA sample to be loaded into a 96 well optical reaction plate was prepared. The DNA sample refers to a residual DNA sample extracted from the recombinant protein of Example 2-3. 50 μl of the extracted DNA sample was added to a clean 1.7 ml microfuse tube. 50 [mu]l of the master mixture was added to the tube and gently pipetted up and down 6 times or vortexed at full speed to thoroughly mix. The tube was closed and set aside until all solutions were ready to be loaded onto the plate. This process was repeated for all remaining samples.

2-9. Preparation of spike samples to be loaded

The first spike sample to be loaded into a 96 well optical reaction plate was prepared. The spike sample refers to a DNA sample extracted from the spike sample mixture of Example 2-4. 50 µl of a DNA extracted spike sample was added to a 1.7 ml microfuse tube. 50 [mu]l of the master mixture was added to the tube and gently pipetted up and down 6 times or vortexed at full speed to thoroughly mix. The tube was closed and set aside until all solutions were ready to be loaded onto the plate. This process was repeated for all remaining spike sample solutions.

2-10. Blank to be loaded ( No Extraction ) Of the preparation

A blank (No Extraction) mixture to be loaded into a 96 well optical reaction plate was prepared. To a 1.7 ml microfuse tube was added 50 μl of nuclease free water. 50 [mu]l of the master mixture was added to the tube and gently pipetted up and down 6 times or vortexed at full speed to thoroughly mix. The tube was closed and set aside until all solutions were ready to be loaded onto the plate.

Example 3: quantitative real-time polymerase reaction

* 25 µl of each standard solution mixture prepared in each of the three wells on the PCR plate, 25 µl of the prepared quality control control solution, 25 µl of the prepared sample and spike sample solution, and the prepared 25 µl of blank (No Extraction) were added. Then, the plate was covered with an optical adhesive cover.

Then, a 7500 real-time PCR system (Applied Biosystems, USA) for quantitative PCR was set up. Cycling parameters of temperature and time are shown in the table below.

Temperature cycling parameters Temperature and time childhood
45 cycles Dissolution Heating/cooling expansion fixing fixing 15 seconds, 95℃
60 seconds, 58℃
60 seconds, 68℃
2 minutes, 50℃ 10 minutes, 95℃

A 96-well plate was loaded into a 7500 real-time PCR system, and quantitative real-time PCR was performed. Data was analyzed after completion of the run.

Example 4: Analysis of reaction results

4-1. Data analysis

A standard curve is made by plotting the DNA amount of _{C T} (y value) versus logarithm (x value) for pg per ml. C _T is _{The median value of C T} for each of the three repetitions is calculated, and the concentration (x value) of the sample is calculated using the y-intercept determined from the standard curve based on the _{slope and C T value.} The threshold is set to 0.1, and the baseline is set from Cycle 3 to Cycle 15.

4-2. Reaction result

end. Linearity

The primer and probe sequences in Table 1 showed a straight line close to 1.00 in detecting the genomic DNA of Sp2/0 cells (see FIG. 4). The Sp2/0 cells were obtained from ATCC (Cat. No.: CRL-1581, Lot No.: 7390622).

I. Recovery rate

When the DNA extraction kit was used to extract the genomic DNA of the host cells remaining in each of the purified protein samples (see Samples 1 and 2, Table 4), the recovery rate was close to 100% (see Tables 8 and 9).

Recovery rate from the control sample and sample 1 for quality control of Sp2/0 genomic DNA Recovery rate of the quality control control sample DNA concentration of the quality control control sample C _T value Measured value
(pg/ml) Theoretical value
(pg/ml) Recovery rate (%) 50,000 pg/ml 22.42 60139.03 50,000 120.28 500 pg/ml 29.81 587.66 500 117.53 50 pg/ml 33.86 46.65 50 93.29 Recovery rate of purified protein sample 1 produced from Sp2/0 Added to the sample
Amount of DNA C _T value Measured value
(pg/ml) Theoretical value
(pg/ml) Recovery rate (%) N/A Not detected 0 N/A N/A 20,000 pg/ml 23.87 24227.46 20,000 121.14

Recovery rate of Sp2/0 genomic DNA quality control control sample and sample 2 Recovery rate of the quality control control sample DNA concentration of the quality control control sample C _T value Measured value
(pg/ml) Theoretical value
(pg/ml) Recovery rate (%) 50,000 pg/ml 22.39 58743.93 50,000 117.49 500 pg/ml 29.65 512.27 500 102.45 50 pg/ml 33.25 48.63 50 97.27 Recovery rate of purified protein sample 2 produced from Sp2/0 Added to the sample
Amount of DNA C _T value Measured value
(pg/ml) Theoretical value
(pg/ml) Recovery rate (%) N/A Not detected 0 N/A N/A 20,000 pg/ml 23.99 20722.03 20,000 103.61

All. Specificity

The primers and probe sequences of Table 1 did not show a PCR reaction with bacterial (S. Paucimobilis , B. cereus, and S. epidermidis ) genomic DNA, and only showed a specific PCR reaction in Sp2/0 cells (see Table 10). These three bacteria are strains that are highly likely to be contaminated during the recombinant protein culture process.

Recovery of Sp2/0 DNA from three bacterial DNA mixtures ( S. Paucimobilis , B. cereus and S. epidermidis) Sp2/0
Genomic DNA amount
(pg/ml) Mixture of Three Bacterial Genomic DNA (pg/ml) Measured value
(pg/ml) Theoretical value
(pg/ml) Recovery rate
(%) 50,000 0 50624.59 50,000 101.25 1,000,000 52645.72 50,000 105.29 1,000 47716.30 50,000 95.43 500 0 454.26 500 90.85 1,000,000 651.06 500 130.21 1,0000 522.13 500 104.43 50 0 55.17 50 110.33 1,000,000 63.17 50 126.33 1,000 47.06 50 94.11

Although the present invention has been described with reference to exemplary embodiments so far, those skilled in the art to which the present invention pertains can make various changes without departing from the scope of the present invention, and that elements thereof can be replaced with equivalents. You will know. Accordingly, the present invention is not to be limited to the specific embodiments disclosed as the best mode contemplated for carrying out the present invention, but it is to be construed that the present invention encompasses all embodiments falling within the scope of the appended claims.

<110> Celltrion Inc. <120> Composition for detecting or measuring Sp2/0 cell DNA <130> CPD2013009KR <160> 3 <170> KopatentIn 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 1 gcctgcccag tgactaaagt tt 22 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 2 ccgttcatgc tagtccctaa ttaag 25 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Probe <400> 3 ccgcggtatc ctgaccgtgc a 21

Claims (8)

A primer set for detecting Sp2 / 0 cell DNA represented by the nucleotide sequences of SEQ ID NOs: 1 and 2. A composition for detecting or quantifying Sp2 / 0 cell DNA, comprising a primer set represented by a nucleotide sequence of SEQ ID NO: 1 and 2 and a probe represented by a nucleotide sequence of SEQ ID NO: 3. The composition of claim 2, wherein the probe has a fluorescent marker inserted at one end and a fluorescent inhibitor inserted at the other end. The composition of claim 2, wherein the Sp2 / 0 cell DNA is a genomic DNA of Sp2 / 0 cells remaining in a sample. A kit for the detection or quantification of Sp2 / 0 cell DNA comprising the composition of any one of claims 2 to 4. (a) extracting DNA from a sample;
(b) performing PCR (Polymerase chain reaction) on the DNA extracted in step (a) with a primer set represented by a nucleotide sequence of SEQ ID NOs: 1 and 2 and a probe represented by a nucleotide sequence of SEQ ID NO: 3 ; And
(c) measuring the fluorescence signal;
Method for detecting or quantifying DNA of Sp2 / 0 cells. 7. The method of claim 6, wherein said PCR is a quantitative real-time polymerase chain reaction. The method of claim 6, wherein the probe is inserted with a fluorescent marker at one end and a fluorescent inhibitor is inserted at the other end.

Images