KR20120047345A - A composition for preventing or treating diseases mediated by il-6 comprising a compound for inhibiting il-6 activity or pharmaceutically acceptable salts thereof as an active ingredient - Google Patents

Abstract

PURPOSE: A composition containing a compound or pharmaceutically acceptable salt thereof is provided to prevent or treat IL-6-mediated diseases. CONSTITUTION: A composition for preventing or treating IL-6-mediated diseases contains a compound of chemical formula 1 or pharmaceutically acceptable salt thereof as an active ingredient. The compound is isolated from Thymus quinquecostatus. The composition additionally contains pharmaceutically acceptable carrier. An external use skin formulation contains the composition. The skin formulation is manufactured in the form of an ointment, lotion, spray, patch, cream, powder, suspension, or gel.

Description

A composition for preventing or treating diseases mediated by IL-6 comprising IL-6-mediated disease comprising a compound having an IL-6 activity inhibitory activity or a pharmaceutically acceptable salt thereof as an active ingredient. a compound for inhibiting IL-6 activity or 黄 acceptable salts approximately as an active ingredient}

The present invention relates to a composition for the prevention or treatment of diseases mediated by IL-6, comprising as an active ingredient a compound of formula 1 having a IL-6 activity inhibitory activity or a pharmaceutically acceptable salt thereof. The present invention also relates to an external preparation for skin comprising the composition, and relates to a composition for preventing or ameliorating a disease mediated by IL-6 comprising a compound represented by the following formula (1). In another aspect, the present invention provides a composition for inhibiting IL-6 activity comprising the compound represented by the formula (1) as an active ingredient, IL-6 activity in vitro using the compound represented by the formula (1) It is about how to suppress.

[Formula 1]

Interleukin-6 (IL-6) is a non-glycosylated peptide chain consisting of 185 amino acids, a cytokine known as B cell stimulator or interferon-β2. IL-6 was discovered as a differentiation factor involved in activation of B lymphocyte cell system (Hirano, T. et al., Complementary DNA for a novel human interleukin (BSF-2) that induces B lymphocytes to produce immunoglobulin. Nature 1986, 324 (6092), 73-6), and subsequently found to be multifunctional cytokines affecting the differentiation and proliferation of T cells, differentiation of neurons, osteoclast formation, and production of acute phase proteins in hepatocytes (Akira, S . et al., Interleukin-6 in biology and medicine. Adv Immunol 1993, 54, 1-78). In addition, IL-6 is secreted from various cells such as T cells and phagocytes, induces an immune response or inhibits TNF-α, IL-1 and the like to maintain homeostasis of the body. It has been shown to regulate the expression of certain genes in time and to control the survival of normal plasmablasts (Ishihara, K. et al., IL-6 in autoimmune disease and chronic inflammatory proliferative disease. Cytokine Growth Factor Rev 2002, 13 (4-5), 357-68).

IL-6 has been reported to reduce insulin sensitivity and is also involved in the induction of insulin-resistant diabetes, promotes the secretion of cell adhesion factors, and the secretion of fibrinogen in liver tissues, inducing blood coagulation and increasing cholesterol synthesis. Reduce cholesterol secretion and induce allergic sclerosis by upregulating the lecithin cholesterol acyltransferase (LCAT) and apolipoprotein A-1 (apo-I) genes (Omoigui, S., Cholesterol synthesis is the trigger and isoprenoid dependent interleukin-6 mediated inflammation is the common causative factor and therapeutic target for atherosclerotic vascular disease and age-related disorders including osteoporosis and type 2 diabetes. Med Hypotheses 2005, 65 (3), 559-69; Yudkin, JS et al., Inflammation, obesity, stress and coronary heart disease: is interleukin-6 the link Atherosclerosis 2000, 148 (2), 209-14).

In addition, studies have shown that increased levels of IL-6, which are involved in inflammation, increase the risk of heart disease and mortality from these diseases. Increased production of IL-6 includes Alzheimer's disease, rheumatoid arthritis, inflammation, myocardial infarction, Paget's disease, osteoporosis, solid cancer (RCC), bladder cancer, prostate cancer, and Castleman disease (Ishihara, K. et al., IL-6 in autoimmune disease and chronic inflammatory proliferative disease. Cytokine Growth Factor Rev 2002, 13 (4-5), 357-68; Lindmark, E. et al., Relationship between interleukin 6 and mortality in patients with unstable coronary artery disease: effects of an early invasive or noninvasive strategy. JAMA 2001, 286 (17), 2107-13). Inflammation-related diseases caused by IL-6 activity abnormalities, such as rheumatoid arthritis, Casttleman's disease, Croh's disease, osteoporosis, cancer cachexia, arteriosclerosis, diabetes, etc., have recently increased rapidly. It is a trend. Therefore, there are many studies around the world on the development of therapeutic drugs for metabolic diseases represented by rheumatoid arthritis, osteoporosis, arteriosclerosis and diabetes mellitus. Recently, the development and progress of these metabolic diseases are related to the inflammatory response and are important causes. IL-6 is attracting attention as a factor.

On the other hand, IL-6 receptor (IL-6R) is known as a type I cytokine receptor called CD126 (Cluster of Differentiation 126) and transmits its biological activity through two kinds of proteins in cells. Each protein is known to consist of a polypeptide chain of α-subunit and β-subunit. First, α-subunit has a molecular weight of about 80 kDa as a ligand binding chain and is named gp80 or CD126, and exists as a soluble IL-6 R mainly composed of its extracellular domain in addition to the membrane-bound type that penetrates the cell membrane and expresses it on the cell membrane. . The β-subunit is called gp130 or CD130 and is known to have a molecular weight of 130 kDa. It has been reported that membrane-binding proteins involved in signal transduction in (Taga, T. et al., Receptors for B cell stimulatory factor 2. Quantitation, specificity, distribution, and regulation of their expression. J Exp Med 1987, 166 (4), 967-81). Oncostatin M (OSM), leukemia inhibitory factor (LIF), IL-11, cardiotrophin-1 (CT-1), ciliary neurotrophic factor Domains shared by cytokine families such as CNTF are found in most organs such as heart, kidney, spleen, liver, lung, placenta and brain (Kang, BS et al., Inhibitory effects of anti-inflammatory drugs) on interleukin-6 bioactivity. Biol Pharm Bull 2001, 24 (6), 701-3; Jones, SA et al., The soluble interleukin 6 receptor: mechanisms of production and implications in disease. FASEB J 2001, 15 (1), 43-58). In order to show activity, IL-6 and IL-6 receptors must be bound to β-subunit gp130 after formation of the IL-6 / IL-6R complex. do.

The signaling system of IL-6 was found to be based on the Jak family of tyrosine kinases and the STAT family of transcription factors as the primary mediators of signal transduction. This signaling system is shared by various cytokines, IFNs and growth factors other than IL-6. At the onset of stimulation, gp130-related kinases Jak1, Jak2 and Tyk2 are activated and the cytoplasmic tail of gp130 is phosphorylated. The phosphotyrosine residues of gp-130 pair primarily with the STAT3 and SH2 domains of STAT1 as docking sites. The STAT is then phosphorylated and dimerized and then moved to the nucleus to regulate transcription of the target gene (Heinrich, PC et al., Interleukin-6-type cytokine signaling through the gp130 / Jak / STAT pathway. Biochem J 1998, 334 ( Pt 2), 297-314). The Ras-Raf pathway allows tyrosine phosphatase SHP2 to bind to phosphorylated gp130 and to be linked to mitogen-activated protein kinase (MAPK) pathways. Finally, the transcription factors NF-IL-6 (C / EBP family member) and AP-1 (c-Jun, c-Fos) activate the biological response and a series of MAPK pathways involved in Ras signaling are IL-6. Is expected to play a significant role in cell differentiation and proliferation.

Many researchers are working on a more detailed role in the series of signal transduction systems induced by IL-6, and little information is available on each step. The complexity of this series of complex inflammatory reactions has been revealed one after another, and more targeted drug development targets for inflammatory diseases are emerging. Therefore, the development of IL-6 inhibitors by targeting IL-6-induced signal transduction systems will not only help to elucidate the mechanisms of signal transduction systems but also enable the development of targeted drugs with definite mechanisms of action.

So far, studies of inhibitors of IL-6 activity have been directed to antibodies to IL-6 (anti-IL-6 antibodies), antibodies to IL-6R (anti-IL-6 receptor antibodies) and antibodies to gp130 (anti-gp130 antibodies). IL-6 modified, IL-6 or IL-6R partial peptides have been reported (Heinrich, PC et al., Principles of interleukin (IL) -6-type cytokine signaling and its regulation. Biochem J 2003, 374 (Pt 1), 1-20; Novick, D. et al., Rubinstein, M., Monoclonal antibodies to the soluble human IL-6 receptor: affinity purification, ELISA, and inhibition of ligand binding.Hybridoma 1991, 10 (1 ), 137-46; Huang, YW et al, A monoclonal anti-human IL-6 receptor antibody inhibits the proliferation of human myeloma cells Hybridoma 1993, 12 (5), 621-30;.. Mihara, M, Preventives or remedies for sensitized T cell-related diseases containing IL-6 antagonists as the active ingredient. WO9842377, 1998). In particular, tocilizumab, a neutralizing antibody (MRA) of IL-6R, has been reported to alleviate the symptoms of patients with Casttleman, Crohn's and rheumatoid arthritis (Nishimoto, N., Clinical studies in patients with Castleman's disease, Crohn's disease, and rheumatoid arthritis in Japan.Clin Rev Allergy Immunol 2005, 28 (3), 221-30).

As such, although the activity has been confirmed in protein neutralizing antibodies, when it is used as a medicine, the active substance is a protein, so it should be used as an injection and limited to oral use. Many researchers have been searching for IL-6 expression inhibitory active materials and searching for active substances from natural resources as well as chemical synthesis products.

During many research attempts, Kitasato Laboratories in Japan was the first to successfully search for small molecule active substances. The IL-6 activity inhibitor detected was a noncytotoxic indole alkaloid family isolated from the fermentation broth of soil-derived Streptomyces nitrosporeus K930711, and this small molecule active compound, named Madindoline A, was competitively noncovalent with the extracellular domain of gp130. It has been reported to form a bond. Madindoline A inhibited JAK / STAT signaling by inhibiting homoisomerization of gp130, and Madindoline A inhibited IL-6-induced osteoclast formation by evaluating biological activity in model animals. It became. In particular, it was found that IL-6 plays an important role in osteoporosis in women prone to hormonal abnormalities by alleviating the symptoms of osteoporosis induced in postmenopausal mice. Therefore, various researches are underway to obtain Madindoline A in large quantities, and research to presynthesize Madindoline A is underway, but the synthesis process is complicated and it is still difficult to secure a large amount. situation is still too little capacity (Hayashi, M. et al., Suppression of bone resorption by madindoline a, a novel nonpeptide antagonist to gp130. Proc Natl Acad Sci USA 2002, 99 (23), 14728-33).

In addition, IL-6R inhibitors were also discovered by Kitasato Laboratories in Japan during the search for small molecule active substances that inhibited IL-6 activity. 20S, (ERBF) 21-epoxy-resibufogenin-3-formate was found by screening natural products. The bufadienolide was detected in toad shells. This active substance, like Madindoline A, does not bind to gp-130, but rather to IL-6 receptor, and has been reported to inhibit cancer cachexia induced by Colon-26. However, even in the case of ERBF, the method of presynthesizing the active substance by organic synthesis method has not yet been developed because of the complicated structure, and it is difficult to secure the active substance from natural resources (Enomoto, A. et al. , Suppression of cancer cachexia by 20S, 21-epoxy-resibufogenin-3-acetate-a novel nonpeptide IL-6 receptor antagonist. Biochem Biophys Res Commun 2004, 323 (3), 1096-102).

As described above, basic research on various diseases that can be caused by abnormal IL-6 activity has been conducted, but the pathogenesis of the disease is still unclear, and various life phenomena caused by the inhibition of IL-6 activity There is a lack of research on. This is due to the lack of development of low molecular weight substances that specifically inhibit IL-6 activity. Therefore, in order to more accurately correlate IL-6 with related diseases, there is an urgent need for the development of small molecule compounds capable of mass synthesis and specifically inhibiting IL-6 activity.

Accordingly, the present inventors have endeavored to develop a low-molecular substance that can be synthesized in a large amount and specifically inhibit the activity of IL-6. As a result, the compound represented by Formula 1 of the present invention isolated from thyme is IL-6-mediated. It is confirmed that it is effective in the disease and inhibits IL-6 activity, and completed the present invention.

One object of the present invention is a composition for the prevention or treatment of diseases mediated by IL-6 (Interleukin-6) comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient To provide.

[Formula 1]

Another object of the present invention to provide an external preparation for skin comprising the composition.

Another object of the present invention to provide a composition for the prevention or improvement of diseases mediated by IL-6 containing the compound as an active ingredient.

Yet another object of the present invention is to provide a method for preventing or treating an IL-mediated disease comprising the compound as an active ingredient.

Another object of the present invention to provide a composition for inhibiting IL-6 activity comprising the compound as an active ingredient.

Another object of the present invention is to provide a method of inhibiting IL-6 activity in vitro using the compound.

As one embodiment for achieving the above object, the present invention is mediated by IL-6 (Interleukin-6; Interleukin-6) comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient It relates to a composition for preventing or treating a disease.

[Formula 1]

The compound represented by Formula 1 of the present invention is a compound named thymol.

In the present invention, the term "Thymol" is also called isopropylmethylphenol, and the chemical formula is C ₁₀ H ₁₄ O, which refers to a compound that is slightly soluble in water but soluble in organic solvents such as ethanol and ether. Naturally, it is contained in musk colostrum and is the main ingredient of Lamiaceae and plant essential oils. Although it has been known to be used as a synthetic raw material of menthol, as an antiseptic or disinfectant, in toothpaste, soap, etc., it has not been reported to be related to the activity of IL-6. Such inhibition of IL-6 activity was first identified in the present invention. Such thymol can be purchased by using a commercially available product, or can be synthesized by reacting m-cresol with isopropyl chloride in the presence of aluminum chloride, or by other known methods. Or it can extract and use from plants, such as thyme.

Preferably the compound of the present invention is Thymus quinquecostatus ). The thyme is widely distributed in Asian continents such as Korea, Japan, China, India, and grows mainly on mountain tops, highlands, and seaside rocks. It is 3 ~ 15cm in size, the main stem spreads out on the ground, young branches stand obliquely, fragrance, leaves are long oval, 5 ~ 12mm long, 3 ~ 8mm wide. It is characterized by wavy teeth and hairs.

In a specific embodiment of the present invention, the present inventors screened thyme while searching for an active substance that inhibits IL-6 expression from natural resources, to prepare an ethanol extract from it, and concentrated under reduced pressure to obtain a fraction. By performing high performance liquid chromatography on the obtained product, an active fraction having IL-6 signaling system inhibitory activity was obtained. Thereafter, the physicochemical characteristics of the active fractions were analyzed to confirm the identity of the active compound, which was found to be thymol, a compound represented by Chemical Formula 1.

The compounds of the present invention can be used in the form of pharmaceutically acceptable salts, and include all salts, hydrates and solvates prepared by conventional methods.

Salts are useful as acid addition salts formed by pharmaceutically acceptable free acids. Acid addition salts are prepared by conventional methods, for example by dissolving a compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. Equivalent molar amounts of the compound and acid or alcohol (eg, glycol monomethyl ether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.

In this case, organic acids and inorganic acids may be used as the free acid, and hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, and the like may be used as the inorganic acid, and methanesulfonic acid, p -toluenesulfonic acid, acetic acid, trifluoroacetic acid, and maleic acid may be used as the organic acid. (maleic acid), succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid (gluconic acid), galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanic acid, hydroiodic acid, and the like. It doesn't happen.

In addition, bases can be used to make pharmaceutically acceptable metal salts. Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and then evaporating and drying the filtrate. In this case, as the metal salt, it is particularly suitable to prepare sodium, potassium or calcium salt, but is not limited thereto. Corresponding silver salts may also be obtained by reacting alkali or alkaline earth metal salts with a suitable silver salt (eg, silver nitrate).

As used herein, the term "IL-6" is a cytokine, also called B cell stimulating factor 2 (BSF2) or interferon-β2 (INF-β2). IL-6 is a differentiation factor involved in the activation of B lymphocytes and is a multifunctional cytokine that affects the function of various cells. IL-6 transfers its biological activity through two kinds of proteins on cell membranes. One is the IL-6 receptor, a protein to which IL-6 binds, which is a membrane-bound protein with a molecular weight of about 80 kD expressed through the cell membrane. The other is the membrane protein gp130, which has a molecular weight of about 130 kD, which belongs to the signal transfer of nonligand binding. IL-6 and IL-6 receptor form an IL-6 / IL-6 receptor complex, which then binds to gp130. After binding of ligand and receptors, JAK2 is activated by transphosphorylation in cells. Activated JAK2 phosphorylates several tyrosine residues in the receptor cytoplasmic domain and acts as a docking site for cytoplasmic proteins such as signal transducers and activators of transcription 3 (STAT3) with SH2 or other phosphate-tyrosine binding motifs. STAT3 bound to the cytoplasmic domain of the receptor is released from the receptor after phosphorylation by JAK2. Activated STAT3s bind to each other in the cytoplasm to form a homo or heterodimer and then enter the nucleus to bind to the recognition sequence of the gene of interest to increase transcription. That is, inhibition of IL-6 activity may be achieved by inhibiting phosphorylation of STAT3, JAK3, gp130, as well as IL-6 mediated signaling system. Such inhibition of IL-6 activity suggests that it is also effective in the treatment of diseases mediated by IL-6, and it was confirmed in the present invention to suppress edema mediated by IL-6.

The IL-6 mediated disease of the present invention is Alzheimer's disease, rheumatoid arthritis, inflammation, myocardial infarction, Paget's disease, osteoporosis, solid cancer, bladder cancer, prostate cancer, Castelman disease, Crohn's disease (Cronh's disease), arteriosclerosis, or diabetes, but is not limited to these, commonly known IL-6 mediated diseases can be included.

Preferably it may be edema, rheumatoid arthritis, Casttleman's disease, Crohn's disease, Paget's disease, myocardial infarction, atherosclerosis, or Alzheimer's disease.

The disease mediated by IL-6 of the present invention may preferably be edema, and the edema refers to a condition in which excess liquid such as lymph fluid or tissue exudate is present in the tissue, and edema in the skin and soft tissue. When this happens, it is clinically swollen, has a crumbly feeling, and when pressed, the skin temporarily dents.

In a specific embodiment of the present invention, as a result of mouse experiments on the thymol IL-6 activity, the foot thickness of the mouse was inflamed by Zamosan A and swelled to 8.5, 7.0, 6.5, 5.5, and 5.6 mm. In the case of treating thymol of the present invention, it was confirmed that the degree of pouring was reduced to 6.0, 3.0, 2.0, 1.9, 1.8 mm (Fig. 5).

The disease mediated by IL-6 of the present invention may preferably be an autoimmune disease. Autoimmune diseases are caused by direct or indirect immune response to autoantigens. The presence of antibodies to autoantigens, ie, autoantibodies or autologous immune cells (lymphocytes), is an important indicator of autoimmune diseases. It is divided into organ-specific autoimmune diseases and systemic autoimmune diseases specific to specific organs. In the former case, there are autoimmune hemolytic anemia, thrombocytopenic purpura, Hashimoto's disease (chronic thyroiditis), myasthenia gravis, autoimmune gastritis, etc. Directly. The latter case includes collagen diseases such as systemic lupus erythematosus and rheumatoid arthritis and is characterized by pathological conditions and the appearance of various autoantibodies in almost all tissues of the system.

As used herein, the term "prevention" means any action that prevents or delays IL-6 mediated disease by administration of a composition. As used herein, the term "treatment" means any action that improves or advantageously alters the symptoms of an IL-6 mediated disease by administration of the composition.

The compound represented by Chemical Formula 1 of the present invention is characterized by inhibiting IL-6 activity. In a specific embodiment of the present invention, 1, 3, 10, 30, 100 using thymol of the compound represented by the formula (1) in the STAT3 phosphorylation inhibitory activity test to confirm that the compound inhibits IL-6 activity When the sample was treated at a concentration of μg / ml and 10 ng / ml of IL-6, it was confirmed that the degree of STAT3 phosphorylation induced by IL-6 was suppressed depending on the concentration of thymol (FIG. 3).

The composition of the present invention may further comprise a pharmaceutically acceptable carrier. In the present invention, the pharmaceutically acceptable carrier is meant to be commonly used in the medical and pharmaceutical industry.

The composition comprising the compound of the present invention may include additives such as acceptable diluents, binders, disintegrants, lubricants, pH adjusting agents, antioxidants, dissolution aids and the like.

Diluents can be used in sugar, starch, microcrystalline cellulose, lactose, glucose, mannitol, alginate, alkaline earth metal salts, clay, polyethylene glycol, anhydrous calcium hydrogen phosphate, or some mixture thereof. As binders, starch, microcrystalline cellulose, highly dispersible silica, mannitol, sucrose, lactose monohydrate, polyethylene glycol, polyvinylpyrrolidone, polyvinylpyrrolidone copolymer, hypromellose, hydroxypropyl cellulose, natural gum, synthetic Gum, copovidone, gelatin alone or a mixture thereof can be used.

Disintegrants include starch or modified starches such as sodium starch glycolate, corn starch, potato starch or pregelatinized starch, cellulose sodium alginate such as bentonite, montmorillonite, bum, clay, microcrystalline cellulose, hydroxypropyl cellulose or carboxymethyl cellulose. Or crosslinked celluloses such as algins such as alginic acid and sodium croscarmellose; Gums such as guar gum and xanthan gum, crosslinked polymers such as crosslinked polyvinylpyrrolidone (crospovidone), and boiling agents such as sodium bicarbonate and citric acid may be used alone or in a mixture thereof.

Lubricants include talc, stearic acid, magnesium stearate, calcium stearate, sodium lauryl sulfate, hydrogenated vegetable oils, sodium benzoate, colloidal silicon dioxide sodium stearyl fumarate, glyceryl behenate, glyceryl monorate, glyceryl monostearate , Glyceryl palmitostearate alone or a mixture thereof can be used.

pH adjusters include acidifying agents such as acetic acid, adipic acid, ascorbic acid, sodium ascorbic acid, sodium ether, malic acid, succinic acid, tartaric acid, fumaric acid, citric acid (citric acid), precipitated calcium carbonate, ammonia water, meglumine, Basic agents, such as sodium carbonate, magnesium oxide, magnesium carbonate, sodium citrate, and calcium tribasic phosphate, etc. can be used.

The antioxidant may be dibutyl hydroxy toluene, butylated hydroxyanisole, tocopherol acetate, tocopherol, propyl gallate, sodium hydrogen sulfite, sodium pyrosulfite, etc. In the pre-release compartment of the present invention, the dissolution aid is Polyoxyethylene sorbitan fatty acid esters such as sodium lauryl sulfate and polysorbate, sodium docusate, poloxamer and the like.

It may also include enteric polymers, water insoluble polymers, hydrophobic compounds, and hydrophilic polymers to make release delaying formulations. The enteric polymer is insoluble or stable under acidic conditions of less than pH5, and refers to a polymer that is dissolved or decomposed under specific pH conditions of pH5 or higher. For example, hypromellose phthalate (hydroxypropylmethylcellulose phthalate), methyl Hydroxyethyl cellulose, cellulose acetate maleate, hydroxy methylethyl cellulose phthalate, cellulose acetate phthalate hypromellose acetate succinate, cellulose acetate succinate, cellulose benzoate phthalate, cellulose propionate phthalate, methylcellulose phthalate, carboxymethyl Enteric cellulose derivatives and styrene-acrylic acid copolymers such as ethyl cellulose and ethyl hydroxy ethyl cellulose phthalate, methyl hydroxyethyl cellulose The above enteric acrylic acid copolymers such as methyl acrylate-acrylic acid copolymer, methyl methacrylate acrylate, butyl styrene-acrylic acid copolymer, and methyl acrylate-methacrylic acid-octyl acrylate copolymer; Poly (methacrylate methyl methacrylate) copolymer (e.g. Eudragit L, Eudragit S, Evonik, Germany), poly (methacrylate acrylate) copolymer (e.g. Eudragit L100- Enteric polymethacrylate copolymers such as 55); Vinyl acetate-maleic anhydride copolymer, styrene-maleic anhydride copolymer, styrene-maleic acid monoester copolymer, vinylmethyl ether-maleic anhydride copolymer, ethylene-maleic anhydride copolymer, vinylbutyl ether-maleic anhydride copolymer, acrylic Enteric maleic acid copolymers such as ronitrile-methyl methacrylate-maleic anhydride copolymer and butyl styrene-styrene-maleic anhydride copolymer; And enteric polyvinyl derivatives such as polyvinyl alcohol phthalate, polyvinyl acetal phthalate, polyvinyl butyrate phthalate and polyvinylacetacetal phthalate.

The water insoluble polymer refers to a polymer that is not soluble in pharmaceutically acceptable water that controls the release of the drug. For example, the water insoluble polymer may be polyvinylacetate (e.g. colicoat SR30D), water insoluble polymethacrylate copolymer [e.g. poly (ethylacrylate-methyl methacrylate) copolymer (e.g. Eudragit NE30D) , Poly (ethylacrylate-methyl methacrylate-trimethylaminoethyl methacrylate) copolymer (e.g., Eudragit RSPO) and the like], ethyl cellulose, cellulose ester, cellulose ether, cellulose acylate, cellulose dicylate, Cellulose triacylate, cellulose acetate, cellulose diacetate and cellulose triacetate.

The hydrophobic compound refers to a substance that does not dissolve in pharmaceutically acceptable water that controls the release of the drug. Fatty acids and fatty acid esters such as, for example, glyceryl palmitostearate, glyceryl stearate, glyceryl bihenate, cetyl palmitate, glyceryl monooleate and threric acid; Fatty acid alcohols such as cetostearyl alcohol, cetyl alcohol and stearyl alcohol; Waxes such as carnauba wax, beeswax, and microcrystalline wax; Inorganic materials such as talc, precipitated calcium carbonate, calcium dihydrogen phosphate, zinc oxide, titanium oxide, kaolin, bentonite, montmorillonite, and gum.

The hydrophilic polymer refers to a polymeric material that is dissolved in pharmaceutically acceptable water that controls the release of the drug. Sugars such as, for example, dextrins, polydextrins, dextrans, pectins and pectin derivatives, alginates, polygalacturonic acids, xylans, arabinoxylans, arabinogalactans, starches, hydroxypropylstarches, amylose, and amylopectins ; Cellulose derivatives such as hypromellose, hydroxypropyl cellulose , hydroxymethyl cellulose, hydroxyethyl cellulose, methyl cellulose and carboxymethyl cellulose sodium; Gums such as guar gum, locust bean gum, tragacantha, carrageenan, acacia gum, gum arabic, gellan gum, and xanthan gum; Proteins such as gelatin, casein, and zein; Polyvinyl derivatives such as polyvinyl alcohol, polyvinyl pyrrolidone, and polyvinyl acetal diethylamino acetate; Poly (butyl methacrylate- (2-dimethylaminoethyl) methacrylate-methylmethacrylate) copolymer (e.g. Eudragit E100, Evonik, Germany), poly (ethyl acrylate-methyl methacrylate- Hydrophilic polymethacrylate copolymers such as triethylaminoethyl- methacrylate chloride) copolymers (eg, Eudragit RL, RS, Evonik, Germany); Polyethylene derivatives such as polyethylene glycol, and polyethylene oxide; Carbomer and the like.

In addition, the composition of the present invention may be formulated by selecting and using a pharmaceutically acceptable additive as various additives selected from colorants and fragrances. Such formulation methods can use, for example, methods disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA, and the like.

In the present invention, the range of the additives is not limited to the use of the above additives, and the above-mentioned additives may be formulated by containing a dose in a normal range by selection.

The compositions according to the invention can be used in the form of oral formulations, external preparations, suppositories, or sterile injectable solutions, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups or aerosols, respectively, according to conventional methods. have. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactants are usually used. Solid form preparations for oral administration include tablets, pills, powders, granules and capsules, and the like form at least one excipient such as starch, calcium carbonate, sucrose in the extract or fraction. (sucrose), lactose (lactose), gelatin, etc. are mixed and prepared. In addition to simple excipients, glidants such as magnesium stearate or talc are also used. Liquid preparations for oral use may include various excipients, such as wetting agents, sweeteners, fragrances or preservatives, in addition to water and liquid paraffin, which are commonly used as simple suspensions, solvents, emulsions or syrups. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations or suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, or injectable esters such as ethyl oleate may be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter or glycerogelatin may be used.

As another aspect, the present invention relates to an external preparation for skin comprising a composition for the prevention or treatment of diseases mediated by IL-6 comprising the compound represented by the formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient will be.

The external preparation for skin containing the prophylactic or therapeutic composition of the present invention as an active ingredient may be preferably in the form of an ointment, a lotion, a spray, a patch, a cream, a powder, a suspension, a gel or a gel. It is not.

As another aspect, the present invention is to provide a composition for the prevention or improvement of diseases mediated by IL-6 comprising the compound represented by the formula (1) as an active ingredient. The food composition of the present invention may be added to food as it is or used with other foods or food ingredients, and may be appropriately used according to a conventional method. The amount of the active ingredient to be mixed can be suitably determined according to its use purpose (for prevention or improvement).

The food composition of the present invention may contain various flavors or natural carbohydrates as additional ingredients. Such natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like.

There is no particular limitation on the kind of food. Examples of foods to which the above-mentioned substances may be added include dairy products including drinks, meat, sausages, breads, biscuits, rice cakes, chocolates, candy, snacks, confectionery, pizza, ramen, other noodles, gums and ice cream, various soups, Beverages, alcoholic beverages, vitamin complexes, and the like, and include all healthy foods in the conventional sense. In addition to the above, the composition for food of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, Alcohols, carbonating agents used in carbonated drinks, and the like. In addition to the food composition of the present invention, the health food may contain fruit flesh for the production of natural fruit juice, fruit juice beverage and vegetable beverage. These components can be used independently or in combination.

As another aspect, the present invention is to provide a method for preventing or treating IL-mediated diseases comprising the compound represented by the formula (1) as an active ingredient.

The prophylactic and therapeutic method of the present invention is a disease mediated by IL-6 by administering thymol of the compound represented by Chemical Formula 1 to mammals, edema, rheumatoid arthritis, Casttleman's disease, Crohn's disease, Paget's disease, myocardial infarction, It is to prevent and treat diseases such as atherosclerosis or Alzheimer's disease.

As used herein, the term "administration" means introducing a prophylactic and therapeutic composition of the present invention to a patient by any suitable method, and the route of administration of the composition is administered via any general route as long as the target tissue can be reached. Can be. The prophylactic and therapeutic composition of the present invention can be administered to mammals such as rats, mice, livestock, humans by various routes. All modes of administration can be expected, for example, but not limited to, oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection, and the like.

The method of treatment of the present invention includes the pharmaceutically effective amount of the prophylactic and therapeutic compositions of the present invention. The pharmaceutical composition of the present invention may be administered once or twice a day at regular time intervals.

The dosage of the prophylactic and therapeutic compositions of the present invention is preferably 0.1 to 100 mg / kg per day. This may vary depending on the severity, age, sex, etc. of the patient, and thus the dosage does not limit the scope of the invention in any aspect. The specific therapeutically effective amount for a particular patient may be based on the specific composition, including the type and severity of the reaction to be achieved, whether or not other agents are used in some cases, the age, weight, general health, sex and diet of the patient, time of administration, It is desirable to apply differently depending on the route of administration and the rate of release of the composition, the duration of treatment, and the various factors and similar factors well known in the medical arts, including drugs used with or concurrent with the specific composition.

As another aspect, the present invention is to provide a composition for inhibiting IL-6 activity comprising the compound represented by the formula (1) as an active ingredient. Such inhibition of IL-6 activity may be achieved by inhibiting signaling induced by IL-6. For the purposes of the present invention may be achieved by inhibiting the phosphorylation of the receptor IL-6 gp130, intracellular JAK2 or STAT3. Such thymol, a composition that inhibits IL-6 activity, can be used as a biochemical reaction reagent in basic mechanism studies that require signaling inhibition induced by IL-6 and as a standard for inhibiting IL-6 activity. Can be.

The present inventors tested through specific examples to investigate whether the composition comprising the compound represented by the formula (1) as an active ingredient to inhibit IL-6 activity, the composition inhibits the induced STAT3 phosphorylation to IL-6 It was confirmed that the activity (Fig. 3).

As another aspect, the present invention is to provide a method for inhibiting IL-6 activity in vitro using the compound represented by the formula (1).

In a method of inhibiting IL-6 activity in vitro, the sample may be treated with an appropriate amount of thymol to inhibit IL-6 activity in the sample. As used herein, the term "sample" includes, but is not limited to, samples such as tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine, which are to be tested by inhibiting IL-6 activity.

The method of inhibiting IL-6 activity in vitro can be achieved by inhibiting IL-6-induced signaling, and for the purposes of the present invention, phosphorylation of gp130, the receptor of IL-6, intracellular JAK2 or STAT3 It can be done by suppression. This can also be achieved by inhibiting IL-6 induced STAT3 phosphorylation, as confirmed through specific examples of the present invention.

Biochemical reaction of thymol of the compound represented by Formula 1 of the present invention in a basic mechanism study requiring the inhibition of signaling induced by IL-6 when using the above method of inhibiting IL-6 activity in vitro It can be used as a reagent to inhibit IL-6 activity.

In addition, when using the method of inhibiting IL-6 activity in vitro, if the unknown substance has IL-6 activity inhibitory activity similar to the thymol of the compound represented by Formula 1 of the present invention, the unknown substance May be selected as an inhibitor of IL-6 activity, and thymol of the present invention may be used as a standard to inhibit IL-6 activity.

For the prevention or treatment of existing IL-6-mediated diseases, the active substance used as a medicine is a protein, so it should be used as an injection and limited to oral use. Meanwhile, since the compound of the present invention is a non-protein low molecular compound, the composition of the present invention can be used orally for the prevention or treatment of diseases mediated by IL-6 through the inhibition of the activity of IL-6, and also in large quantities. It is expected that it will be easy to use as a medicine because it can be synthesized. In addition, it is expected that the compound represented by Chemical Formula 1 of the present invention may be used as an indicator material for selecting an IL-6 activity inhibitor.

1 is a diagram showing the structure of a compound represented by formula 1 showing the activity of the present invention
FIG. 2 is a diagram showing the degree of activity inhibition of the IL-6-responsive STAT3 reporter gene to thymol, the compound represented by FIG. 1.
Figure 3 is a diagram showing the results of Western blot test for IL-6 induced STAT3 phosphorylation inhibitory activity to thymol, the compound represented by FIG.
Figure 4 is a graph showing the change in the weight of the experimental animal by the thymol treatment of the compound represented by FIG.
5 is a graph showing the degree of inflammation reduction by thymol treatment, a compound represented by FIG. 1.
6 is a photograph showing the degree of inflammation reduction by the thymol treatment of the compound represented by FIG. 1.

Hereinafter, the present invention will be described in more detail with reference to the following examples. These examples are only for illustrating the present invention, and the scope of the present invention is not to be construed as being limited by these examples.

Example  1: Separation of active substance and determination of structure from thyme

Thyme leaves were purchased at Daejeon Yangnyeong Market, and the plant classification was certified by Dr. Lee Joo-gu of the Korea Institute of Bioscience and Biotechnology. Wash 1 kg of thyme leaves with water, air dry at room temperature, dry it, cut it into fine pieces of 0.5 ~ 1㎝ size, and mix ethanol in a weight ratio of 1: 1 to the powder ground to a particle size of 50 ~ 300 mesh. The mixture was stirred for 4-5 hours, filtered, and then concentrated carefully while adding ethyl ether under reduced pressure to obtain 2.9 gdmf of crude extract.

Pure separation of the active substance having IL-6 expression inhibitory activity was performed by high performance liquid chromatography. HPLC column was YMC Jsphere ODS H-80 (250 x 20 mm) and the elution solvent was water: methanol: acetonitrile. The solvent flow rate was set to (34:64; 2) at 5 ml / min, and the active material was detected at UV 276 nm. The IL-6 inhibitory substance was dried under reduced pressure at 22 min to obtain 878 mg of the compound represented by the formula (1).

[Formula 1]

The physicochemical characteristics of the active substance having the inhibitory effect of IL-6 activity isolated by the above method were analyzed. Electrospray ionization mass spectrometry (Fisons VG Quattro 400 mass spectrometer, USA) was used to measure the molecular weight. Nuclear magnetic resonance method was used to investigate the structure of the active material. NMR experiments each sample CDCl ₃ Hydrogen and carbon nuclear magnetic resonance spectra were measured in a 5 mm NMR tube, and the peaks of each solvent were measured based on the peaks of Ttetramethylsilane. The active compound was solid at room temperature and melted at 51 ° C. Molecular weight, molecular formula and mass were analyzed to estimate the mass of the compound to be 150.22 and high resolution mass spectrometry to estimate the molecular formula of C ₁₀ H ₁₄ O. Referring to the physicochemical properties, 14 hydrogens in the hydrogen magnetic resonance spectra analyzed by dissolving the active substance in CDCl ₃ protons (1.20ppm, 1.20ppm, 2.34ppm, each 3H, s), (3.05ppm, 1H, m ), (6.71ppm, 7.12ppm (F), each 1H, d), (6.89ppm, 1H, s), (5.35ppm, 1H, s). 10 carbons in the carbon nuclear magnetic resonance spectrum: 21.6 ppm (C-10), 23.6 ppm (C-8), 23.6 ppm (C-9), 27 ppm (C-7), 116.3 ppm (C-5), 121.3 ppm (C-1), 126.1 ppm (C-2), 131.1 ppm (C-3), 137.0 ppm (C-6), and 153.1 ppm (C-4).

As a result of estimating the structure of the active substance, it was confirmed that the active compound having the function of inhibiting the activity of IL-6 was known thymol.

Example  2 : pSTAT3 - TA - Luc6  Fabrication of the Structure

In order to further reflect the activity in the reporter gene analysis, pSTAT3-TA-Luc6 constructs were constructed to include 8 copies of the STAT3 DNA binding sequence rather than pSTAT-3-TA-Luc to favor the STAT3 reporter gene analysis. pSTAT3-TA-Luc plasmid (Clontech, Palo Alto, Calif.) is used as a template, oligonucleotide (AGAGGGTAA CGGTACC GTGCTTCCCGAACGTTGCTTCC (containing Kpn I site), SEQ ID NO: 1) and oligonucleotide (GTACGCAAGG CTCGAG CTACGTTCGGGAAGCAACGTTC (Xho I site) Containing) and SEQ ID NO: 2) as forward and reverse primers, respectively, to amplify the STAT3 DNA binding sequence with a thermocycler. DNA strands complementary with DNA strands containing Kpn I and Xho I restriction sites at the 5 'and 3' ends, respectively, and 8 copies of the STAT3 cis acting enhancer element were synthesized. The synthesized two strands were heated at 90 ° C. for 5 minutes, slowly cooled to room temperature, annealed, and treated with Kpn I and Xho I (37 ° C. overnight). Two stranded DNA was isolated using SDS-PAGE and cloned into pGL3 basic vector (Promega, Madision, WI). The amplified PCR product was cloned, isolated and inserted into the Kpn I / Xho I site of pSTAT3-TA-Luc plasmid.

Example  3: IL -6 reaction STAT3  Reporter Gene Analysis

Human liver cancer cell lines (HepG2 cells) were cultured in MEM (Minimal Essential Medium, WelGENE Inc, Daegu, Korea) medium at 37 ℃, 5% CO ₂ , water-saturated conditions. 10% (v / v) fetal bovine serum, streptomycin (100 U / mL) and penicillin (100 U / mL) were added to the medium, and the cells were grown to 80% of 6-well cell culture plates. It was. Carefully remove the medium from the plate, exchange it with 50 μl of serum-free medium, and add a mixture of 0.1 μg pSTAT3-TA-Luc6 construct and 0.3 μl lipofectamine reagent to each well for 3 hours to react. The Luc6 construct was infected. The cells were changed to fresh medium and incubated for 24 hours for transient transfection. Infected cells were serum starved with 1% BSA / DMEM, the samples to be tested were diluted to different concentrations, treated for 1 hour, and then incubated for 3 hours with the addition of IL-6. After washing with PBS, 50 μl of lysis buffer (promega luciferase assay system) was added thereto, and vigorously shaken for 1 minute. Then, 30-100 μl of luciferase substrate (Promega luciferase assay system) was added thereto and measured in 5 minutes using a luminometer.

To determine the degree of inhibition of IL-6-responsive STAT3 reporter genes, we examined the inhibitory effects of IL-6-responsive STAT3 reporter genes when 20 ㎍ / ml of each sample was treated. was shown to inhibit the concentration-dependent activity, as measured the inhibition degree in density when the sought concentration i.e. IC ₅₀ to 50% inhibition value was calculated, in view of the thymol molecular weight confirmed that the IC ₅₀ value of 18.9 μM (Fig. 2).

Example  4 : IL -6 induced STAT3  Inhibitory activity test of reporter gene

HepG2 cells were divided into 6 well plates at 5 × 10 4 cells / well, grown to 80% confluence, exchanged with serum-free medium containing no fetal bovine serum, and the samples were pretreated for 1 hour after 6 hours of incubation. After treatment with 20 ng / ml IL-6 and reacted for 10 minutes, lysis buffer (20 mM Tris-HCl, pH 8, 137 mM NaCl, 10% glycerol, 1% Triton X-100, 1 mM Na3VO4, 2 mM EDTA Cells were lysed using 1 mM PMSF, 20 mM leupeptin, 20 mg / ml aprotonin, and then centrifuged (13,000xg, 15 minutes) to obtain the supernatant as lysate. At this time, HepG2 cells not treated with IL-6 were used as a control. Protein concentration was quantified using the Bio-Rad DC protein analysis kit, and loaded on a 10% SDS-polyacrylamide gel (SDS-PAGE) and electrophoresed at 30 mA for 2 hours. After electrophoresis, the protein of the gel was transferred to a PVDF membrane (Weatran® S, pore size 0.2 mm) for 90 minutes at 90 V and the transferred membrane was tris-buffered solution (T-TBS; 50 mM Tri-HCl, pH 7.6, 150 mM NaCl, 0.2% Tween-20, 5% skim milk) was blocked at 4 ° C for 12 hours and washed 5 times with T-TBS. The membrane was treated with a polyclonal antibody of phospho-STAT3 (1: 1000 dilution, respectively) as the primary antibody for 2 hours. After washing 5 times with T-TBS, HRP-conjugated anti-rabbit antibody (1: 5000 dilution) was reacted with secondary antibody for 1 hour. After washing with T-TBS the film was developed using ECL in the dark.

IL-6-reactive STAT3 reporter gene test with thymol, which showed a high degree of activity inhibition, and IL-6-induced IL-6-induced STST3 phosphorylation inhibitory activity at concentrations of 1, 3, 10, 30, and 100 ㎍ / ml HepG2 After addition to the cells, the samples were treated with 10 μg / ml of IL-6. The test results confirmed that thymol concentration-dependently inhibits IL-6 expression (FIG. 3).

Example  5: cytotoxicity assay

Each cell line was maintained in a 96 well cell culture plate in medium containing 10% FBS with 1% penicillin G / streptomycin. Cells were cultured under 37 ° C., 5% CO ₂ conditions. All experiments were repeated three times. 10% (v / v) 5 mg / mL 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetra-zolium bromide (MTT; Sigma diluted in PBS 48 h after sample treatment ) Was added to the cell culture. After 3 hours of incubation, the medium was aspirated and washed with PBS. DMSO (100 μL) was added and gently shaken for 5 minutes. Absorbance was measured at 570 nm using a VERSA Max micro plate reader (Molecular Devices Inc.). Mean absorbance (± SEM) values from three experiments were compared statistically with t-test, P <0.05.

As a result, thymol showed 90.90, 93.74, and 96.92% survival rate when HepG2 cells were treated with 50 μg / ml, 25 μg / ml, and 12.5 μg / ml at the final concentration.

Example  6: In vivo Effect of thymol in

In Among the candidates that had good activity by measuring the degree of STAT3 binding inhibition in vitro , thymol, a relatively less toxic candidate, was selected in the MTT test. Inflammatory activity was evaluated in vivo . C57BL / 6 mice were obtained from the central experimental animals and allowed to acclimate for 1 week before being used for the experiment. The sex of the animals was female and 3 control groups and 4 test groups (dose group) were used, and Saccharomyces was used as a control group. Zymosan A (Sigma-Aldrich, St. Louis, MO, USA) isolated from cereviciae was prepared at 3 mg / ml, 50 μl was injected intraperitoneally and thymol at 30 mg / kg daily at 4 pm, daily Once administration was carried out for 5 days. Body weights were measured on days 1, 3, 4 and 5 and foot thicknesses were measured daily. On day 6 after administration, the size of lymph nodes in the right and left knee joints was measured. Animal experiments were set at a temperature of 23 ± 3 ° C, a relative humidity of 50 ± 10%, an illumination time of 12 hours (6 AM-6 PM), 10-20 ventilation times / hour, and an illumination intensity of 150-300 Lux. Breeding in place. Animal activity evaluation The testers were all dressed in high-pressure steam sterilization (121 ℃, 20 minutes) wearing work clothes, hoods, masks and gloves. During the purifying and quarantine periods, three animals were housed in polycarbonate shoeboxes (260 W x 410 L x 200 H mm). During the administration and observation period, one animal was housed in a wire breeding box (205 W x 350 L x 175 H mm). The breeding box was identified by labeling the test number and animal number during the test period. The feed was radiosterilized (25 kGy, Picolab) solid animal feed for experimental animals, the negative water sterilized tap water with autoclave and then freely ingested using a water bottle.

As a result of comparing the body weight of the control group and the thymol treated group (30 mg / kg) at a daily interval, there was no change in the body weight of the thymol treated group compared to the control. No apparent signs of toxicity were observed in the experimental animals 6 days after the end of the test. In the control group, Zymosan A (Sigma-Aldrich, St. Louis, MO, USA) isolated from Saccharomyces cereviciae was prepared at 3 mg / ml, 50 μl was injected into the right foot, and 30 mg / kg of thymol of Formula 1 was injected daily in the abdominal cavity. 4 pm, once a day for 5 days. It was confirmed that the change in the weight of the experimental animal is almost no by the thymol measured on the 1, 2, 3, 4, 5 days (Fig. 4).

In In vitro inflammatory activity was assessed by measuring the degree of inhibition of STAT3 binding in vitro , and the animals used were obtained from C57BL / 6 mice obtained from a central experimental animal and allowed to acclimate for one week. The sex of the animals was female and 4 control groups and 4 test groups (dose group) were used, and 50 μl of Zymosan A (Sigma-Aldrich, St. Louis, MO, USA) was prepared at 3 mg / ml. The right foot was injected and thymol 30 mg / kg was administered at 4 pm daily, once daily for 6 days. When the foot thickness was measured every day, the paw reaction of the animals was 8.5, 7.0, 6.5, 5.5, and 5.6 mm due to the inflammatory response induced by Zymosan A. As a result, it was confirmed that the inflammatory response and swelling degree were reduced (FIG. 5). The difference was also confirmed in the actual pictures of the Zymosan A treatment group, Zymosan A + thymol treated group of the formula 1, the group treated nothing at day 6 (Fig. 6).

These results demonstrate that thymol of the present invention not only effectively inhibits the activity of IL-6, but also has an excellent therapeutic effect in edema mediated by IL-6.

<110> Korea Research Institute of Bioscience and Biotechnology <120> A composition for preventing or treating disease mediated by IL-6          comprising a compound for inhibiting IL-6 activity or          pharmaceutically acceptable salts approximately as an active ingredient <130> PA100592KR <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 agagggtaac ggtaccgtgc ttcccgaacg ttgcttcc 38 <210> 2 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 gtacgcaagg ctcgagctac gttcgggaag caacgttc 38

Claims (11)

A composition for preventing or treating a disease mediated by IL-6 (interleukin-6) comprising a compound represented by the following Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[Formula 1]
The method of claim 1, wherein the compound is Thymus quinquecostatus ).
The composition of claim 1, wherein the compound inhibits IL-6 activity.
According to claim 1, wherein the disease is in the group consisting of edema, rheumatoid arthritis, Castleman disease, Crohn's disease, Paget's disease, myocardial infarction, arteriosclerosis and Alzheimer's disease The composition selected.
The composition of claim 1, further comprising a pharmaceutically acceptable carrier.
An external preparation for skin comprising the composition of claim 1.
The external preparation for skin according to claim 6, which is in the form of an ointment, lotion, spray, patch, cream, powder, suspension, gel or gel.
Food composition for the prevention or improvement of diseases mediated by IL-6 comprising the compound represented by Formula 1 as an active ingredient.
A composition for inhibiting IL-6 activity comprising the compound represented by Formula 1 as an active ingredient.

[Formula 1]
10. The composition of claim 9, wherein the compound inhibits signaling induced by IL-6.
A method of inhibiting IL-6 activity in vitro using a compound represented by the following formula (1).

[Formula 1]

Images