KR20110118554A - Ethanol-tolerant yeast strains and genes thereof - Google Patents

Abstract

The present invention relates to an inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Or ethanol-resistant transformed yeast strains comprising the MSN2 gene (Tn-5) and uses thereof. Yeast strains of the present invention are yeast strains that can grow in high concentration ethanol, preferably 10-15% ethanol. Therefore, the yeast strains of the present invention can produce ethanol more efficiently under the high ethanol conditions necessary for the integrated process to overcome the existing inefficient multi-step process.

Description

Ethanol-tolerant yeast strains and genes thereof

The present invention is directed to ethanol-resistant yeast strains and their use.

Yeast S. cerevisiae has been used in a variety of industries, including the production of bioethanol from biomass resources. Yeast cells are always exposed to various environmental stresses such as high concentrations of ethanol that occur during industrial ethanol fermentation, which in turn results in a decrease in cell growth, cell viability and ethanol production (Casey & Ingledew, 1986). Therefore, there has been a need for the development of yeast strains that can overcome the stress caused by high concentrations of ethanol. On the other hand, Consolidated BioProcess (CBP), which intends to develop a strain system so that a woody degrading enzyme production line, a woody degrading line, and a fermentation line occur in one reactor, is proposed as a new technology. Development of yeast strains with high ethanol and heat resistance that meet the conditions to overcome the difference between the proper environment and the fermentation environment of yeast is the most important factor for efficient ethanol production in the future.

To investigate the mechanism of ethanol stress resistance, there have been many studies. In particular, unsaturated fatty acids related to membrane fluidity have been reported and considered as important determinants of ethanol resistance in yeast (Kajiwara, et al. , 2000; You, et al , 2003). In addition, intracellular accumulation of trihalose (Kim, et al. , 1996) or proline (Takagi, et al. , 2005) improves yeast ethanol resistance and ergosterol to ethanol resistance to Saccharomyces cerevisiae. Has been reported to be an important factor associated with (Inoue, et al. , 2000).

Furthermore, the use of genome-wide assays, such as microarrays and comprehensive expression pattern analysis, has been useful in identifying novel ethanol stress related genes (Hirasawa, et al. , 2007; Teixeira, et al. , 2009; Yoshikawa, et al. , 2009). Through this approach, many genes involved in ethanol resistance have been identified as non-essential genes. In addition, results related to ethanol resistance did not match, respectively, and reported that this discrepancy was due to strain and growth conditions (Teixeira, et al. , 2009). Thus, strains constructed from the genetic information described above do not always result in changes to ethanol stress conditions (Yoshikawa, et al. , 2009). In addition, a commercially available Saccharomyces cerevisiae deletion mutant library was used for genome-wide screening of genes involved in ethanol resistance (Fujita, et al. , 2006; Teixeira, et al. , 2009; Yoshikawa, et. al. , 2009). The above studies mainly selected mutants exhibiting ethanol sensitivity to identify the corresponding genes as genes required for growth under high ethanol conditions.

To date, screening of ethanol-sensitive mutations has already been carried out, through which genes responsible for ethanol resistance have been identified (Takahashi, et al. , 2001; Auesukaree et al., 2009), but ethanol resistant yeast by arbitrary transposon insertion There is no report on how to directly construct strains and to identify related target genes.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.

The inventors have tried to develop yeast strains having high ethanol resistance. As a result, the inventors identified ethanol-resistant yeast transformants by inducing mutations in the yeast chromosome by transposon-mediated gene homologous recombination in yeast, which resulted in high concentrations of ethanol (eg, 10%, 12.5%, 15% ethanol). By confirming that it can grow, the present invention was completed.

Accordingly, it is an object of the present invention to provide ethanol-resistant yeast strains and related genes.

Another object of the present invention is to provide a method for producing ethanol.

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

According to an aspect of the present invention, the present invention provides an inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Or an ethanol-resistant transformed yeast strain comprising the MSN2 gene (Tn-5).

The inventors have tried to develop yeast strains having high ethanol resistance. As a result, the inventors identified ethanol-resistant yeast transformants by inducing mutations in the yeast chromosome by transposon-mediated gene homologous recombination in yeast, which resulted in high concentrations of ethanol (eg, 10%, 12.5%, 15% ethanol). It was confirmed that it can grow in.

Ethanol, a flammable, volatile colorless liquid, is the most widely used solvent. Industrially, ethanol is used as a vehicle fuel and fuel additive and also as a perfume, flavorings, colorings and medicines. Ethanol is also the main psychoactive component in alcoholic beverages and has a calming effect on the central nervous system. Ethanol can be produced petrochemically through hydration of ethylene and biologically by fermenting sugars using yeast, which is produced by petrochemical processes that depend on the price of petroleum and grain feed products. Much more economical than Therefore, the development of yeast strains for the production of biological ethanol is very important.

Transposon mutagenesis has been used in several studies to analyze genes involved in cell morphology, and provides an effective means for comprehensive screening for genes whose survival of gene disrupting mutations has been maintained. The purpose of this study was to directly construct ethanol-resistant yeast strains by random transposon insertion and to identify target genes involved therein.

The present invention provides transformed yeast strains with increased ethanol-resistance by transposon-mediated mutations in yeast.

As used herein, the term “transposon” refers to a DNA sequence capable of transposition to another location within the genome of a single cell, and refers to a DNA sequence that causes mutation. Transposons, called jumping genes, are good examples of mobile genetic elements. Various kinds of mobile genetic elements can be classified according to the transposition mechanism as follows: (a) Group I retrotranspozone, transposon transcribed into RNA and then reverse transcribed into DNA; And (b) group II jumping transposons, transposons that are "cut and paste" from one position to another position of the DNA by a transposase. The transposon construct used in the present invention is introduced into the yeast chromosome through homologous recombination into the mTn3- lacZ / LEU2 construct.

The present invention comprises the steps of (a) causing mutations in the yeast chromosome; And (b) culturing the mutated yeast in a medium containing a high concentration of ethanol.

Step (a) is carried out using a variety of methods, preferably using a transposon. The present inventors have found that yeast comprising mTn3- lacZ / LEU2 construct obtained from Yale Genome Analysis Center (New Haven, CT: htt p: //ygac.med.yale.edu/mtn/reagent ) S. cerevisiae ) library pool was used (see FIG. 1). Mutations were induced by cleaving the transposon construct from plasmid DNA using restriction enzymes and transforming the fragment into yeast chromosomes via gene homologous recombination. Homologous recombination, known as the general recombination process, is a form of genetic recombination that refers to the exchange of nucleotide sequences that occur between two similar or identical DNA strands, and is used in most organisms.

Thereafter, the yeast strain transformed in step (b) is cultured in high concentration ethanol to isolate / identify a strain capable of growth. In the present invention, the ethanol-resistant transformed yeast strain is finally selected by performing a growth assay (spot assay) for the transformed yeast strain with a control in various concentrations of ethanol (10%, 12.5%, 15% ethanol). do.

The present invention relates to an inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Or ethanol-resistant yeast strains containing MSN2 gene (Tn-5) were isolated / identified.

As used herein, the term “inactivated” refers to inactivation when the function of the target gene is blocked, eg transpozone-induced mutations, point mutations, nonsense mutations, missense mutations, replacement mutations, deletion mutations. Inactivation of target genes caused by mutations, including, and the like. Preferably, inactivation of the present invention means inactivation through mutations caused by transposons.

According to a preferred embodiment of the invention, the inactivation of the target gene described above is caused by transposon.

The nucleotide sequences and amino acid sequences of the above-described target genes, namely, CMP2, IMD4, DLD3 and MSN2 genes, are described in SEQ ID NO: 1 to SEQ ID NO: 4, and SEQ ID NO: 5 to SEQ ID NO: 8, respectively. It is apparent in the art that nucleotide sequences encoding amino acids of the genes and variants thereof may also be used.

According to a preferred embodiment of the present invention, the above-described yeast strain can be grown at 5-15% ethanol, more preferably 10-15% ethanol, and most preferably 12.5-15% ethanol culture conditions.

According to a preferred embodiment of the present invention, the above-mentioned yeast strain is Saccharomyces spp., Schizosaccharomyces spp., Pichia spp., Papia spp. Paffia spp.), Cluj Vero MRS species (Kluyveromyces spp.), Candida spp (Candida species), Tallahassee in MRS species (Talaromyces spp.), Brescia Gaetano MRS species (Brettanomyces spp.), Parkinson solren species (Pachysolen spp. ) Or Debaryomyces spp. Yeast strain, more preferably Saccharomyces species, most preferably Saccharomyces cerevisiae L3262 ( MAT-αura3-52 leu2-3,112 his4-34 )to be.

According to another aspect of the present invention, the present invention provides the above-described inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Or it provides a method for producing ethanol comprising culturing the yeast strain into which the MSN2 gene (Tn-5) is inserted in a culture medium comprising one or more substrates that can be metabolized into ethanol. More preferably, the above-mentioned inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Alternatively, using a yeast strain in which the MSN2 gene (Tn-5) is inserted, the present invention provides a method for producing ethanol more efficiently under high ethanol conditions necessary for an integrated process that overcomes an existing inefficient multi-step process.

The method of the present invention comprises the aforementioned inactivated CMP2 or IMD4 gene (Tn-1) of the present invention; DLD3 gene (Tn-4); Or because the yeast strain transformed with MSN2 gene (Tn-5) as an active ingredient, the overlapping content between the two is omitted in order to avoid excessive complexity of the present specification according to the duplicate description.

In addition, the present invention can be used as a method for producing an ethanol-resistant yeast strain comprising the step of causing mutation in the above-described yeast strain.

The present invention provides the above-described inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Or a cell infected with a recombinant vector comprising the MSN2 gene (Tn-5) or a transcript thereof and a transformed cell by gene introduction. In addition, the present invention provides the above-described inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Or a recombinant vector comprising an MSN2 gene (Tn-5), or the inactivated CMP2 or IMD4 gene (Tn-1) described above; DLD3 gene (Tn-4); Or a transformant transformed by the MSN2 gene (Tn-5).

According to a preferred embodiment of the invention, the substrate which can be metabolized to ethanol comprises C6 sugars, and according to a more preferred embodiment of the invention, the C6 sugar comprises glucose, but is not limited thereto. no.

Recombinant vectors of the invention include inactivated CMP2 or IMD4 genes (Tn-1); DLD3 gene (Tn-4); Or a nucleotide sequence encoding the amino acid sequence of the MSN2 gene (Tn-5) or a complementary nucleotide sequence thereof. Vectors of the present invention can typically be constructed as vectors for cloning or vectors for expression. In addition, the vector of the present invention can be constructed using prokaryotic and eukaryotic cells as hosts. For example, prokaryotic cells include bacterial cells and archaea, and eukaryotic cells include yeast cells, mammalian cells, plant cells, insect cells, stem cells and fungi, most preferably yeast cells.

Preferably, the recombinant vector of the present invention comprises (i) a nucleotide sequence encoding the above-described expression target of the present invention; (Ii) a promoter operably linked to the nucleotide sequence of (iii) and acting on an animal cell, preferably a yeast cell, to form an RNA molecule, and more preferably (iii) the fire of the invention described above Activated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Or a nucleotide sequence encoding the amino acid sequence of the MSN2 gene (Tn-5) or a complementary nucleotide sequence thereof; (Ii) a promoter operably linked to the nucleotide sequence of (iii) and acting on animal cells, preferably yeast cells, to form RNA molecules; And (iii) a recombinant expression vector comprising a 3'-non-detoxification site that acts on said animal cell, preferably a yeast cell, resulting in 3'-end polyadenylation of said RNA molecule.

Preferably, the above-described expression target material is inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Or MSN2 gene (Tn-5), but is not limited thereto.

As used herein, the term "promoter" refers to a DNA sequence that regulates the expression of a coding sequence or functional RNA. In the synthetic expression vector of the present invention, the expression-coding nucleotide sequence is operably linked to the promoter. As used herein, the term “operatively linked” refers to a functional binding between a nucleic acid expression control sequence (eg, a promoter sequence, a signal sequence, or an array of transcriptional regulator binding sites) and another nucleic acid sequence. Thus, the regulatory sequence will control the transcription and / or translation of the other nucleic acid sequence.

When the vector of the present invention is a prokaryotic cell as a host, powerful promoters capable of promoting transcription (e.g., tac promoter, lac promoter, lac UV5 promoter, lpp promoter, p _L ^λ promoter, p _R ^λ promoter, rac 5 Promoters, amp promoters, recA promoters, SP6 promoters, trp promoters, T7 promoters, etc.), ribosomal binding sites for initiation of translation and transcription / detox termination sequences. Even more preferably, the host cell used in the present invention is E. coli , most preferably E. coli DH5α. In addition, when E. coli is used as the host cell, the promoter and operator site of the E. coli tryptophan biosynthetic pathway (Yanofsky, C., J. Bacteriol. , 158: 1018-1024 (1984)) and the leftward promoter of phage λ (p _L ^λ promoter, Herskowitz, I. and Hagen, D., Ann. Rev. Genet. , 14: 399-445 (1980)) can be used as regulatory sites. On the other hand, vectors that can be used in the present invention are plasmids (eg, pRS316, pSC101, ColE1, pBR322, pUC8 / 9, pHC79, pUC19, pET, etc.), phages (eg, λgt4λB, λ-Charon) which are often used in the art. , λΔz1, M13, etc.) or viruses (eg, SV40, etc.).

In addition, when the recombinant vector of the present invention is applied to eukaryotic cells, preferably yeast cells, the promoters that can be used are those capable of regulating the transcription of the expression target material of the present invention, promoters derived from yeast cells, mammals Promoters derived from animal viruses and promoters derived from genomes of mammalian cells, including, for example, the yeast ( G. cerevisiae ) GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) promoter, the yeast ( S. cerevisiae ) GAL1 to GAL10 promoters, yeast ( Pichia pastoris ) AOX1 or AOX2 promoter, CMV (cytomegalo virus) promoter, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, tk promoter of HSV, RSV promoter, EF1 alpha promoter, metallothionine promoter, beta Actin promoter, promoter of human IL-2 gene, promoter of human IFN gene, human IL-4 gene Promoter, one containing the promoter and the promoter of the human GM-CSF gene of the human lymphotoxin gene, and the like.

Preferably, the expression constructs used in the present invention comprise a polyaninylation sequence (eg, a glial growth hormone terminator and a SV40 derived poly adenylation sequence).

The method of carrying the vector of the present invention into a host cell may use various methods known in the art, for example, when the host cell is a prokaryotic cell, the CaCl ₂ method (Cohen, et al., Proc. Natl. Acac Sci. USA , 9: 2110-2114 (1973)), one method (Cohen, et al., Proc. Natl. Acac. Sci. USA , 9: 2110-2114 (1973); and Hanahan, J. Mol. Biol. , 166: 557-580 (1983)) and electroporation methods (Dower, et al., Nucleic. Acids Res. , 16: 6127-6145 (1988)) and the like. , Transduction, electroporation, lipofection, microinjection, particle bombardment, yeast globular / cell fusion used in YAC, agrobacterium used in plant cells Mediated transformation can be used.

According to a preferred embodiment of the present invention, the expression-encoding nucleotide sequence used in the present invention has a structure of “promoter-expression encoding nucleotide sequence-poly adenylation sequence”.

The vector system of the present invention can be constructed through various methods known in the art, and specific methods thereof are described in Sambrook et al. , Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press (2001), which is incorporated herein by reference.

The production of transformed yeast cells using the recombinant expression vector of the present invention can be carried out by gene transfer methods commonly known in the art. For example, electroporation, lithium acetate / DMSO method (Hill, et al ., (1991), DMSO-enhanced whole cell yeast transformation. Nucleic Acids Res. 19, 5791), liposome-mediated transfer methods ( Wong, et al., 1980), retrovirus-mediated transfer method (Chen, et al., (1990), J. Reprod. Fert. 41: 173-182; Kopchick, et al., (1991) Methods for the introduction of recombinant DNA into chicken embryos.In Transgenic Animals, ed.NL First & FP Haseltine, pp. 275-293, Boston; Butterworth-Heinemann; Lee, M.-R. and Shuman, R. (1990) Proc. 4th World Congr. Genet. Appl. Livestock Prod. 16, 107-110) and the like, most preferably using the lithium acetate / DMSO method.

On the other hand, in order to use the expression target protein of the present invention as an active ingredient to introduce the gene should be able to effectively penetrate into the cell. For example, the above-mentioned inactivated CMP2 or IMD4 protein (Tn-1); DLD3 protein (Tn-4); Or when using MSN2 protein (Tn-5) as an active ingredient, the protein transduction domain (PTD) is inactivated CMP2 or IMD4 protein (Tn-1); DLD3 protein (Tn-4); Or to the MSN2 protein (Tn-5). That is, the inactivated CMP2 or IMD4 protein (Tn-1) of the present invention as an active ingredient; DLD3 protein (Tn-4); Alternatively, a protein transduction domain (PTD) is fused with the protein to form a fusion protein to introduce MSN2 protein (Tn-5) into the cell (permeable peptide transduction). The protein transport domain (PTD) mainly contains basic amino acid residues such as lysine / arginine, and serves to permeate the proteins fused therewith into the cell through the cell membrane. The protein transport domain (PTD) is preferably in the HIV-1 Tat protein, the homeodomain of the drosophila antennafedia, the HSV VP22 transcriptional regulator protein, the MTS peptide derived from vFGF, the penetratin, the transpotane or the Pep-1 peptide. Including but not limited to sequences derived.

The features and advantages of the present invention are summarized as follows:

(a) The present invention relates to an inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Or ethanol-resistant transformed yeast strains comprising the MSN2 gene (Tn-5) and uses thereof.

(b) Yeast strains of the present invention are yeast strains that can grow in high concentration ethanol, preferably 10-15% ethanol.

(c) The yeast strains of the present invention have high ethanol resistance, so that ethanol can be produced more efficiently in a future integrated process.

1 is a diagram showing the transformation process of Saccharomyces cerevisiae L3262 using a yeast DNA library mutated by transposon.
2 is Saccharomyces Growth assay results for investigating the ethanol resistance of the seregivier transposon mutants.
3 is a diagram showing a transposon insertion position. The transposon insertion site was determined through sequencing of transposons recovered from three ethanol-resistant strains. Peripheral genetic loci are shown.
4 is a result showing expression of genes affected by transposon. Northern blot analysis was performed using total RNA extracted from control L3262. Signals were relatively quantified using a scanning densitometer and normalized to ACT1 and presented as a% control.
5 is a growth assay result showing ethanol-resistance of SGKO mutants. SGKO mutants serially diluted 10-fold were spotted on YPD plates containing 0%, 10%, 12.5% and 15% ethanol, followed by 1 day (0%), 3 days (10%) at 30 ° C, This is the result of growing for 4 days (12.5%) or 5 days (15%).
6 is a growth assay result showing recovery of stress sensitivity by complementation. Supplemented strains, serially diluted 10-fold, were spotted on YPD plates containing 0% and 10% ethanol and then grown at 30 ° C. for 1 day (0%) or 4 days (10%). Control strains were prepared by transforming pRS316 to Tn mutants. Since the IMD4 gene is located under the control of the GAPDH promoter, pRS316-GAPDH was transformed into Tn1 as an IMD4 control.
7 shows the results of observing the effect of over-expression on stress sensitivity. 10-fold serially diluted over-expressing strains were spotted on YPD plates containing 0% and 10% ethanol and then grown at 30 ° C. for 1 day (0%) or 4 days (10%). Control strains were prepared by transforming pRS316-GAPDH to L3262.
8 is a graph showing the fermentation profile of Tn mutants. Exponentially growing cells (0.5 OD ₆₀₀ ) were grown in YPD medium supplemented with 30% glucose and 6% ethanol at 30 ° C. Cell growth (FIG. 8A) and ethanol production (FIG. 8B) were monitored during fermentation. Symbol: L3262, empty triangle; Tn1, filled triangle; Tn4, filled diamond; And Tn5, an empty diamond.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example

Materials and Experiments

Strains, Media and Culture Conditions

Strains, disrupted genes and transposon-insertion sites in this study are described in Table 1 and FIG. 3. Saccharomyces cerevisiae L3262 ( MAT-αura3-52 leu2-3, 112 his4-34 : provided by Korea Research Institute of Bioscience and Biotechnology) was used as the host strain. Saccharomyces ceresevier was incubated at 30 ° C. in YPD medium (1% Bacteria yeast extract, 2% Bactobacillus peptone, 2% dextrose, w / v; Difco, MI). Saccharomyces cerevisiae transformants were transformed into SD-Leucine medium [0.67% Difco YNB (yeast nitrogen base; no amino acid), 2% glucose, 0.069% complete supplement mixture (CSM) -leu: MP, OH ). For plasmid construction, E. Coli DH5α (Stratagene, Calif.) was used as a host and incubated at 37 ° C in Luria-Bertani medium (LB): Difco, MI supplemented with 100 mg / l Ampicillin (Sigma-Aldrich, Mo.).

Transposon mutagenesis

Saccharomyces ceresevier genome library pools with mTn3- lacZ / LEU2 by random insertion of transposons were loaded into the Yale Genome Analysis Center (New Haven, CT: htt p: //ygac.med). from .yale.edu / mtn / reagent ). Plasmid DNA extracted from the mTn3-mutated genome library pool was digested with Not I and used for transformation of Saccharomyces cerevisiae L3262. Yeast transformation was carried out by the lithium acetate method. Transformants were selected in SD-Leucine medium (FIG. 1).

Isolation of Ethanol-Tolerant Mutants

Transformants were plated in two pairs on YPD medium and YPD medium plates containing 12.5% ethanol and incubated at 30 ° C. for 48 hours. Mutants were selected that could grow well in all media conditions. These mutants were incubated to OD ₆₀₀ value 1 in YPD medium and then serially diluted 10-fold with sterile water. Aliquots (5 μl) of each dilution were plated in YPD agar (Difco, MI) containing no ethanol or 10%, 12.5%, 15% ethanol and incubated at 30 ° C. for 3-6 days. Growth assays were performed in triplicates. Mutants that could grow well in YPD plates containing ethanol compared to the control strain were finally selected as ethanol-resistant mutants. Mutants were then plated on YPD plates and incubated at 30 ° C.

Identification of genes involved in the ethanol-resistant phenotype

The mTn3- lacZ / LEU2 insertion site was determined by plasmid rescuring using the lacZ sequence adjacent to the lacZ sequence in ethanol-resistant mutants. To introduce the origin of replication ( ori ), a plasmid designated as URA3 (recovery plasmid; pRSQ2-URA3, provided by Yale Genome Analysis Center) was used to recombine between plasmid-borne copies of the lacZ sequence and transposon-derived copies. Replaced by part of the transposon. Yeast DNA was recovered from these transformants and digested with appropriate enzymes ( EcoR I, Sal I, Hind III, Pst I or Kpn I). The cut fragments were then circularized to E. recovery from coli DH5α. The resulting plasmid was sequenced using lacZ primers complementary to the 5 'end of the transposon and the primer sequences used were as follows: 5'-GTTTTCCCAGTCACGAC-3'. The transposon-inserted genes were analyzed using a BLAST server ( http://www.yeastgenome.org/ ) of the Saccharomyces genome database.

Northern blot analysis

Total RNAs were extracted and used 15 μg. DNA fragments used as probes were prepared by PCR using appropriate gene-specific primers from L3263 genomic DNA. Purified PCR fragments were labeled with ³² P-dCTP (GE Healthcare, Buckinghamshire, UK) using random primers. The procedures were then performed as previously described (Adams, A., DE Gottschling, CA Kaiser, and T. Stearns. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (1997)). ACT1 was used as an internal control. Band intensities were quantified using NIH image J, version 1.61. Experiments for each gene were performed three times.

Gene Cloning and Analysis Methods

For overexpression experiments, open reading frames (ORFs) of the identified genes were cloned into glyceraldehyde 3-phosphate dehydrogenase (pRS316-GAPDH). For complementation experiments, ORFs fused with promoter and terminator sequences were subcloned into the pRS316 vector. Amplified products and vectors were digested with suitable restriction enzymes and then transformed into E. coli DH5α. The primer pairs used and the resulting plasmids are listed in Table 2. Clones were identified by sequencing and transformed into S. cerevisiae L3262 or the corresponding transposon mutants.

Genes were PCR-amplified by pfu DNA polymerase using genomic DNA prepared by standard protocols as a template (Adams, A., DE Gottschling, CA Kaiser, and T. Stearns.Methods in yeast genetics.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (1997). PCR fragments were purified with QIAquick gel extraction kit (Qiagen, Valencia, CA). All PCR constructs were verified by sequencing. Due to the introns present in the middle of the ORF, the ORF of IMD4 was prepared via Reverse Transcription (RT) -PCR. Single-stranded cDNA was then synthesized by Avian Myeloblastosis virus (AMV) reverse transcriptase (Promega, Madson, WI) from isolated total RNA. 1 μg total RNA, 1 × reverse transcript buffer [10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100], 1 mM deoxynucleoside triphosphate (dNTPs), 0.5 unit of RNase inhibitor 20 μl reverse transcription reaction mixture containing 100 pmol / μl of specific downstream primer (IMD4-R; Table 1) and 15 units of AMV reverse transcriptase were reacted at 42 ° C. for 15 minutes and 5 minutes at 99 ° C. After the heat was applied, the reaction was carried out at 0-5 ° C. for 5 minutes. PCR conditions were performed as follows: denaturation at 95 ° C. for 3 minutes; Performing 35 cycles (one cycle consisting of denaturation at 95 ° C. for 1 minute, annealing at 65 ° C. for 1 minute, and extending at 72 ° C. for 2 minutes); And finally extending for 10 minutes at 72 ° C. Cell growth was measured at 600 nm using a Beckman DU730 spectrophotometer (Beckman Coulter, Fullerton, Calif.) And monitored by hemocytometry.

Fermentation

Exponentially growing cells were obtained and transferred to 100 ml of YPD30E6 [YP supplemented with 30% glucose and 6% (v / v) ethanol]. Starting cell density was adjusted to an OD ₆₀₀ value of 0.3. The cells were incubated at 30 ° C with shaking at 120 rpm. After samples were taken every 12 hours, cell growth and ethanol concentration were determined using cell density measurements and high-pressure liquid chromatography (HPLC), respectively. Samples were loaded on an Aminex HPX-87H column (Bio-Rad, Hercules, CA, USA) set at 60 ° C. Glucose and ethanol were eluted with 0.5 mM H ₂ SO ₄ at a flow rate of 0.6 ml / min. Peaks were detected by refractory index and identified according to retention time and quantified according to a standard curve. Cell growth was monitored by measuring optical density at 600 nm.

Experiment result

Selection of Ethanol-Resistant Mutants

About 3,000 transformants were selected as leucine prototrophs (FIG. 1) and plated in pairs on YPD medium plates containing YPD medium and 10% ethanol. About 40 mutants selected were incubated at 30 ° C. for 3 days and then the control strain (Saccharomyces). Mutants that grew well on YPD plates containing 10% ethanol as compared to L3262) were selected as ethanol-resistant strains. As a result of identifying 40 mutants selected, three mutants were finally selected as ethanol-resistant mutants and named Tn1, Tn4 and Tn5. These mutants all grew well on YPD plates containing 10%, 12.5% or 15% ethanol compared to the control strain (FIG. 2).

Identification of Transposon Insertion Sites in Resistant Mutants

Yeast chromosomal DNA adjacent to the transposon from each resistant mutant was recovered from E. coli and sequenced (Macrogen, Korea). The transposon insertion position and function of the identified genes are summarized in Table 1 and FIG. 3.

Identified genes that can give rise to an ethanol-resistant phenotype. Strain Destroyed genes Insertion position ^a function ^c Tn-1 YML057W / CMP2
~
YML056C / IMD4
110 bp ^b




90 bp ^b



CMP2: Calcineurin A; The isotype (CNA1) of the catalytic subunit of calcineurin, Ca ⁺⁺ / calmodulin-regulated protein phosphatase, which modulates Crz1p (stress-reactive transcription factor), and the other calcineurin subunit is CNB1.
IMD4: inosine monophosphate dehydrogenase; Saccharomyces, a protein that catalyzes the first stage of GMP biosynthesis In cerevisiae, four gene families are present and always expressed. Tn-4 YEL072W / RMD6
~
YEL071W / DLD3 946 bp ^b

-994 bp




RMD6 : protein required for sporulation

DLD3 : D-lactate dehydrogenase; As part of retrograde regulation, it consists of cytoplasmic genes that are stimulated by mitochondrial damage and are reduced in cells grown under conditions where glutamate is the only nitrogen source. Tn-5 YMR037C / MSN2 1152 bp Transcriptional activators related to Msn4p; It is activated in stress conditions, resulting in translocation from the cytoplasm to the nucleus and binding to and inducing response of stress-reactive genes in the DNA.

a: The insertion position is the position from the starting ATG of each coding sequence.

b: The insertion position is the position from the stop codon of each coding sequence.

c: Annotation of the yeast genome database (YGD).

Identification of destroyed genes

The position at which the transposon was inserted was as follows: Tn1, the termination site of CMP2 and the termination site of IMD4; Tn4, termination site of RMD6 and promoter site of DLD3; And Tn5, ORF site of MSN2. To determine the genes affected at Tn1 and Tn4 and to confirm their disruption at Tn5, expression levels of CMP2, IMD4, RMD6, DLD3 and MSN2 were examined via Northern blot analysis (FIG. 4). Compared to the control, the levels of CMP2 and IMD4 were about 10% and 20% lower, respectively. Compared to the control group, the level of DLD3 was about 25% lower, but RMD6 was excluded from future experiments because the level of RMD6 remained unchanged. As expected, no expression of MSN2 was detected. Thus, transposon insertion partially affected the expression of CMP2, IMD4 and DLD3 and completely inhibited the expression of MSN2.

Contribution to Ethanol-Resistance

According to the above results, it was confirmed that CMP2 and IMD4 are simultaneously down-regulated in Tn1, DLD3 is down-regulated in Tn4, and MSN2 is destroyed in Tn5. To determine the contribution to ethanol- and / or heat-resistance of down-regulation or deletion of CMP2, IMD4, DLD3 and MSN2, single gene knockout to Saccharomyces cerevisiae in the BY4741 background The knock-out mutants for the four genes obtained from the collection library were examined individually. The library was kindly provided by Dr. Hur Won (Seoul National University, Seoul, Korea) and used to identify the genes identified. Saccharomyces cerevisiae BY4741 strain was the mother strain of the deletion mutants described above. When cultures of cmp2 , imd4 , dld3 and msn2 were spot- assayed on YPD plates containing 10%, 12.5% and 15% ethanol, the growth of all deletion mutants was examined compared to the control BY4741 strain. It was increased at all ethanol concentrations (FIG. 5). Therefore, it was confirmed that SGKOs for four genes have ethanol resistance. In addition, further down-regulation of CMP2 and / or IMD4, and DLD3 was important for ethanol resistance. The results mentioned above indicate that RNA expression levels and possibly protein levels (although not identified) are important for conferring ethanol- and heat-resistance.

Confirmation of resistance by supplementation

The fact that Tn1, Tn4 and Tn5 acquire ethanol-resistance through the deletion or simultaneous down-regulation of certain genes means that the supplementation of the genes described above can be represented again by the cell's sensitivity to the stress. To confirm this consideration, amplified DNA fragments containing promoter, ORF and terminator (ORF + / 700 bp) were cloned into pRS316 vector and transformed to the corresponding Tn1, Tn4 and Tn5 mutants, excluding IMD4. Each gene was autonomously expressed (Table 2). For IMD4 with introns present in the middle of the ORF, the entire ORF was obtained by cloning into pRS316-GAPDH by RT-PCT followed by overexpression of the cloned DNA under the control of the GAPDH promoter. The control was constructed by transforming the pRS316 vector. (Control pRS316-GAPDH for IMD4.) When the spot assay was performed on YPD agar containing 10% ethanol, the resistance of the supplemented cells was Tn mutation. It was significantly reduced compared to sieves (FIG. 6).

Oligonucleotides Used in the Study. Oligonucleotides Sequence (5 '-> 3') Over-expression Experiment CMP2-F
CMP2-R
IMD4-F
IMD4-R
DLD3-F
DLD3-R
MSN2-F
MSN2-R CGC GGATCC ATGTCTTCAGACGCTATA
CGC CTTAAG CTATTTGCTATCATTCTT
CGC GGATCC ATGAGTGCTGCTCCATTG
CGGG TCGACT CAATTGTATAGACGTTT
CGC GGATCC ATGACGGCCGCACAT
CGG GTCGAC TCAAATGTACTTGTA
CGC GGATCC ATGACGGTCGACCATGAT
CGC CTTAAG TTAAAAAAATGGGGTCTA Complementation experiment CMP2-FU
CMP2-RL
DLD3-FU
DLD3-RL
MSN2-FU
MSN2-RL CGC GGATCC ATGGCTGAGGTTCCTATGTTGTCT
CG CGGCCG CCTGCCGGTGCCGATGGTTTA
CGC GGATCC CTTTAAAGTGCTATG
CGG GTCGAC TAGTCGCTTTAAAGT
CGC GGATCC CGGCCCGGAACGTACCTAAAG
CG CGGCCG CAAGCGCCATATAAAACATTGA

* Underlined sequences are restriction enzyme positions.

The fact that simultaneous down-regulation of CMP2 (up to 10%) and IMD4 (up to 20%), and down-regulation of DLD3 confer ethanol resistance, suggests that stress resistance is important for the expression level of specific gene (s). Can be. To confirm this, the ORF of each gene except IMD4 was PCR-amplified and cloned into the overexpression pRS316-GAPDH vector and transformed with L3262 strain. The pRS316-GAPDH vector was transformed as a control. When the spot assay for ethanol (FIG. 7) was performed, the overexpressed strains were generally more sensitive to ethanol than the control, indicating a dose effect on ethanol-sensitivity.

Fermentation Ability of Tn Mutants

In general, ethanol-resistant cells are known to produce more ethanol than non-resistive strains because of their high cell viability at high concentrations of ethanol. When fermentation capacity was examined at 30 ° C. in a batch culture containing 30% glucose, no significant differences were found between the control strain and the mutants despite the increased growth of the mutants (about 20%). Did not show results. The control strain is basically capable of producing up to 9% ethanol from 30% glucose, which is hardly seen as an effect of increased ethanol resistance. Thus, it was necessary to establish conditions where the final ethanol titer was greater than 9%. In this regard, we started fermentation in a culture medium containing 6% ethanol and starting cells with an OD ₆₀₀ value of 0.5. As can be seen in Figures 8A and 8B, Tn mutants grew faster and produced more ethanol compared to the control.

Additional discussion

In yeast and other organisms, most intracellular pathways for stress are reprogrammed with many genes that are regulated (K, 2005). Although a large number of related genes have been identified to date, little is known about how resistance to many stressors, including ethanol and heat, is obtained in terms of signaling pathways. In general, the mechanism of ethanol-resistance is considered to be very complex and globally regulated and needs to be understood through a comprehensive view of the pathways involved (Ma, et al. , 2010; Yoshikawa, et al. , 2009). Both ethanol and heat stress similarly alter cell membrane lipid composition (Okuyama, et al. , 1979; Suutari, et al. , 1994) and encode cell membrane H ⁺ -ATPase activity (Coote, et al. , 1994) heat shock proteins . Reduce up-regulation of genes (Ma, et al. , 2010). The above results indicate that the pathways necessary for ethanol-resistance overlap the pathways necessary for heat-resistance. However, strains produced based on genome-wide analysis showed only ethanol- or heat-resistance (Teixeira, et al. , 2009; Yoshikawa, et al. , 2009). In this study, we screened 3,000 transposon-mediated disruption mutations to isolate five strains with increased resistance to ethanol.

We identified four genes responsible for increased ethanol-resistance (CMP2, IMD4, DLD3 and MSN2). Down-regulation of CMP2 and / or IMD4, and DLD3 gave ethanol-resistance. As can be seen in Table 1 and Figure 3, transposons were inserted at the expected regulatory sites of the affected genes. This means that the library generated by transposon mutagenesis consists of more than 4,500 clones, which in theory is similar to the number of clones contained in the SGKO library that only affects ORFs. In this study, we isolated three strains (Tn1, Tn4 and Tn5) with increased ethanol resistance using a library of 3,000 clones which was theoretically less than the number of clones required. Thus, if screening libraries containing appropriate clone counts, it would be possible to isolate a larger number of strains with increased resistance. Isolation of Tn1 and Tn4, indicating down-regulation of affected genes, would not have been possible using the SGKO library, but not the transposon insertion method. To our knowledge, our study was the first to identify that RNA level is a determinant for ethanol-resistance.

In the case of down-regulated Tn1, we were unable to determine whether the gene was actually responsible for stress resistance due to the absence of a strain in which only one gene was down-regulated. The CMP2 gene encodes calcineurin A, an isotype of the active subunit of Ca ²⁺ / calmodulin-dependent phosphatase that regulates Crz1p (stress-responsive transcription factor). Calcineurin dephosphorylates Crz1p, causing rapid translocation from the cytoplasm to the nucleus. Crz1p then activates transcription of genes involved in cell survival (Cyert, 2003; Panadero, et al ., 2007). CRZ1 is important for cell growth under ethanol stress through its function in the ethanol-induced calcineurin / Crz1 pathway (Araki, et al. , 2009). Calcineurin, on the other hand, increases the degradation of Msn2p, causing insufficient induction of genes with stress-response elements (STRE) (Takatsume, et al. , 2010). Thus, whether the calcineurin-Crz1p pathway functions as an ethanol-protective mechanism in yeast is controversial. The results of the invention that CMP2 knock-out results in increased ethanol resistance support the latter. IMD4, on the other hand, encodes an isozyme of inosine monophosphate dehydrogenase (IMPDH), which catalyzes the first step in GMP biosynthesis. There are no reports of IMD4 related to ethanol resistance to Saccharomyces cerevisiae. However, in the lactic acid bacterium Oenococcus oeni , ethanol stress reduces the level of IMPDH and reduces the production of nicotinamide nucleotides, leading to the induction of glutathione reductase, leading to a decrease in NADPH levels (Silveira, et al. , 2004). This means that maintenance of the redox balance plays an important role in ethanol adaptation (Bro, 2006; Silveira, et al. , 2004). Therefore, both CMP2 and IMD4 will be important for ethanol resistance, although the function of IMD4 needs to be identified in Saccharomyces cerevisiae.

DLD3 is part of a retrograde regulator consisting of genes that are stimulated and expressed by mitochondrial damage, encoding D-lactate dehydrogenase. To date, there is no report on the association of this gene with stress resistance.

MSN2 encodes a transcription factor that regulates the general stress response (Mart, et al. , 1996; Schmitt, et al. , 1996). In conjunction with Msn4p, which has 41% identity with Msn2p, Msn2p expresses the expression of about 200 genes that respond to various stresses, including heat and high concentrations of ethanol. Regulation by binding to (Causton, et al. , 2001; Gasch, et al. , 2000; Mart, et al. , 1996). MSN4 gene expression is induced by stress, while MSN2 gene is always expressed (Gasch, et al. , 2000). Single base deletion mutants of msn2 and msn4 do not exhibit any phenotype, but msn2 and msn4 double null mutants are hypersensitive to carbon starvation, thermal shock, osmotic stress and oxidative stress. Over-expression of the MSN2 and MSN4 genes decreases susceptibility to deficiency and heat stress (Estruch, et al. , 1993). Thus, MSN2 and MSN4 function as a team in many biological responses, although depending on specific genes and specific stress conditions, respectively (Fujita, et al. , 2006). In relation to ethanol resistance, over-expression of MSN2 promotes ethanol resistance and enhances fermentation capacity in shake yeast strains (Watanabe, et al. , 2009). In this study, MSN2 knock-out showed a conflicting phenotype (increased ethanol resistance) with previous studies. Msn2p is able to function as a negative regulator of genes associated with ethanol resistance. In addition, Msn2p and Msn4p have a partially redundant function in the stress response (Estruch, et al. , 1993). In this context, we propose that MSN4 modulates the ethanol stress response in place of MSN2 in the MSN2 knock-out strain.

The study revealed four genes responsible for increased ethanol-resistance (CMP2, IMD4, DLD3 and MSN2). There has been no report showing the above phenotype. The interrelationship between the aforementioned hereds could not be inferred from the annotated functions. However, CMP2 and MSN2 are known to be involved in the cellular pathway, which may help to understand the molecular mechanisms involved in ethanol resistance. In particular, Msn2p, the only transcription factor identified, is of interest because it negatively regulates the genes responsible for ethanol resistance.

In conclusion, one of the aims of developing strains with increased resistance to ethanol stress is to provide information on industrial applications in addition to understanding the mechanisms involved in resistance to stress. The novel genes identified in this study will be useful for improving industrial yeast strain in terms of ethanol production capacity. In addition, this study demonstrated that transposon mutagenesis is particularly useful for the identification of genes whose expression levels are resistance determinants.

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that such a specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

references

Araki, Y., H. Wu, H. Kitagaki, T. Akao, H. Takagi, and H. Shimoi. Ethanol stress stimulates the Ca ²⁺ -mediated calcineurin / Crz1 pathway in Saccharomyces cerevisiae. J. Biosci. Bioeng. , 107: 1-6 (2009).

Auesukaree, C., et al. , Genome-wide identification of genes involved in tolerance to various environmental stresses in Saccharomyces cerevisiae. J Appl Genet , 50 (3): 301310 (2009).

Bro, C., B. Regenberg, J. F, and J. Nielsen. In silico aided metabolic engineering of Saccharomyces cerevisiae for improved bioethanol production. Metab. Eng. , 8: 102-111 (2006).

Casey, GP, et al. , ETHANOL TOLERANCE IN YEASTS. Critical Reviews in Microbiology , Vol 13 (3): 219-280 (1986).

Causton, HC, B. Ren, SS Koh, CT Harbison, E. Kanin, EG Jennings, TI Lee, HL True, ES Lander, and RA Young. Remodeling of yeast genome expression in response to environmental changes. Mol. Biol. Cell , 12: 323-337 (2001).

Coote, PJ, MV Jones, IJ Seymour, DL Rowe, DP Ferdinando, AJ McArthur, and MB Cole. Activity of the plasma membrane H ⁺ -ATPase is a key physiological determinant of thermotolerance in Saccharomyces cerevisiae. Microbiology , 140: 1881-1890 (1994).

Cyert, MS Calcineurin signaling in Saccharomyces cerevisiae : how yeast go crazy in response to stress. Biochem. Biophys. Res. Commun. 311 : 1143-1150 (2003).

Estruch, F., and M. Carlson. Two homologous zinc finger genes identified by multicopy suppression in a SNF1 protein kinase mutant of Saccharomyces cerevisiae. Mol. Cell. Biol. 13:13 3872-3881 (1993).

Fujita, K., et al. , The genome-wide screening of yeast deletion mutants to identify the genes required for tolerance to ethanol and other alcohols. FEMS Yeast Research, Vol 6 (5): 744-750 (2006).

Gasch, AP, PT Spellman, CM Kao, O. Carmel-Harel, MB Elisen, G. Storz, D. Botstein, and PO Brown. Genomic expression programs in the response of yeast cells to environmental changes. Mol. Biol. Cell , 11: 4241-4257 (2000).

Hirasawa, T., et al. , Identification of target genes conferring ethanol stress tolerance to Saccharomyces cerevisiae based on DNA microarray data analysis. Journal of Biotechnology , 131: 3444 (2007).

Inoue, T., et al. , Cloning and Characterization of a Gene Complementing the Mutation of an Ethanol-sensitive Mutant of Sake Yeast. Biosci. Biotechnol. Biochem. , 64 (2): 229-236 (2000).

Kajiwara, S., et al. , Overexpression of the OLE1 gene enhances ethanol fermentation by Saccharomyces cerevisiae. Appl Microbiol Biotechnol , 53: 568-574 (2000).

Kim, J., et al. , Disruption of the Yeast ATH1 Gene Confers Better Survival after Dehydration, Freezing, and Ethanol Shock: Potential Commercial Applications. APPLIED AND ENVIRONMENTAL MICROBIOLOGY , Vol 62 (5): 15631569 (1996).

K, D. Molecular and evolutionary basis of the cellular stress response. Annu. Rev. Physiol. 67 : 225 257 (2005).

Ma, M., and ZL Liu. Mechanisms of ethanol tolerance in Saccharomyces cerevisiae . Appl. Microbiol. Biotechnol. 87 : 829-845 (2010).

Mart, MT, G. Marchler, C. Sch, A. Marchler-Bauer, H. Ruis, and F. Estruch. The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress-response element (STRE). EMBO J. , 15: 2227-2235 (1996).

Okuyama, H., and M. Saito. Regulation by temperature of the chain length of fatty acids in yeast. J. Biol. Chem. , 254: 12281-12284 (1979).

Panadero, J., MJ Hern, JA Prieto, and F. Randez-Gil. Overexpression of the calcineurin target CRZ1 provides freeze tolerance and enhances the fermentative capacity of baker's yeast. Appl. Environ. Microbiol. , 73: 4824-4831 (2007).

Schmitt, AP, and K. McEntee. Msn2p, a zinc finger DNA-binding protein, is the transcriptional activator of the multistress response in Saccharomyces cerevisiae . Proc. Natl. Acad. Sci. USA , 93: 5777-5782 (1996).

Schubert, C. Can biofuels finally take center stage? Nat. Biotechnol. 24: 777-784 (2006).

Silveira, MG, M. Baumg, FM Rombouts, and T. Abee. Effects of adaptation to ethanol on cytoplasmic and membrane protein profiles of Oenococcus oeni . Appl. Environ. Microbiol. , 70: 2748-2755 (2004).

Suutari, M., K. Liukkonen, and S. Laakso. Temperature adaptation in yeast: the role of fatty acids. J. Gen. Microbiol. 136 : 1469-1474 (1990).

Suutari, M. and S. Laakso. Microbial Fatty Acids and Thermal Adaptation. Critical Reviews in Microbiology , 20 (4): 255-328 (1994).

Takagi, H., et al. , Effect of L-Proline on Sake Brewing and Ethanol Stress in Saccharomyces cerevisiae. Applied and Environmental Microbiology , Vol 71 (12): 8656-8662 (2005).

Takahashi, T., et al. , Identification of genes required for growth under ethanol stress using transposon mutagenesis in Saccharomyces cerevisiae. Molecular Genetics and Genomics , Vol 265 (6): 1112-1119 (2001).

Takatsume, Y., T. Ohdate, K. Maeta, W. Nomura, S. Izawa, and Y. Inoue. Calcineurin / Crz1 destabilizes Msn2 and Msn4 in the nucleus in response to Ca2 + in Saccharomyces cerevisiae. Biochem. J. , 427: 275-287 (2010).

Teixeira, MC., Et al. , Genome-Wide Identification of Saccharomyces cerevisiae Genes Required for Maximal Tolerance to Ethanol. APPLIED AND ENVIRONMENTAL MICROBIOLOGY , Vol 75 (18): 57615772 (2009).

Watanabe, M., D. Watanabe, T. Akao, and H. Shimoi. Overexpression of MSN2 in a sake yeast strain promotes ethanol tolerance and increases ethanol production in sake brewing. J. Biosci. Bioeng. 107: 516-518 (2009).

Yoshikawa, K., et al. , Genome-Wide Analysis of the Effects of Location and Number of Stress Response Elements on Gene Expression in Saccharomyces cerevisiae. JOURNAL OF BIOSCIENCE AND BIOENGINEERING , vol 106 (5): 507-510 (2008).

Yoshikawa, K., T. Tadamasa, C. Furusawa, K. Nagahisa, T. Hirasawa, and H. Shimizu. Comprehensive phenotypic analysis for identification of genes affecting growth under ethanol stress in Saccharomyces cerevisiae . FEMS Yeast Res , 9 : 32-44 (2009).

You, KM, et al. , Ethanol Tolerance in the Yeast Saccharomyces cerevisiae Is Dependent on Cellular Oleic Acid Content. APPLIED AND ENVIRONMENTAL MICROBIOLOGY , Vol 69 (3): 14991503 (2003).

<110> Ewha Womens University <120> Ethanol-Tolerant Yeast Strains and Genes Thereof <130> PN100242D <150> KR 10-2010-0038140 <151> 2010-04-23 <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 1815 <212> DNA <213> Saccharomyces cerevisiae <400> 1 atgtcttcag acgctataag aaatactgag cagataaacg ccgctattaa aattatagaa 60 aacaaaacag agcgtccgca atcgtccaca acccctatag attcgaaggc tagtacagtt 120 gctgctgcta attccacggc cacagaaact tccagagacc ttacacaata taccctagat 180 gacggaagag tcgtatcgac aaaccgcaga ataatgaata aagtgcccgc catcacgtca 240 catgttccta cagatgaaga gctgttccag cccaatggga tacctcgtca cgaattccta 300 agagatcatt tcaagcgcga gggcaaattg tcggctgcgc aggcggccag gatcgttaca 360 cttgcaacgg aactcttcag caaagaaccc aaccttatat ctgttcccgc cccaatcaca 420 gtttgcggtg atatccatgg ccagtacttt gaccttttga agctattcga agttggcgga 480 gatccggcca ctacatcgta tttgttcttg ggagactatg tcgacagagg gtccttttcg 540 tttgagtgtc ttatttattt atattctttg aagctgaatt ttaacgacca tttctggcta 600 ctgaggggta accacgaatg taagcatcta acgtcatatt tcactttcaa aaatgaaatg 660 ctgcacaagt acaatctaga tatttacgag aaatgctgcg aatcgtttaa caacttgccc 720 ctggctgcgt taatgaacgg acagtatctt tgtgttcatg gtggtatatc tcccgagtta 780 aactctttac aggacattaa caacctaaat agattcaggg agattccctc tcatggcctg 840 atgtgtgatc tgttgtgggc tgacccgatt gaagagtacg acgaagtctt ggataaagac 900 ttgactgagg aagacatagt gaactccaaa accatggttc ctcatcatgg caagatggca 960 ccttcaaggg atatgtttgt cccaaactca gtaaggggct gttcatatgc cttcacgtat 1020 cgtgctgcgt gccattttct gcaagagact ggcctgttgt ccatcatcag ggcacacgag 1080 gctcaagacg ctggttatag aatgtacaaa aataccaaga ctttgggctt tccctctctt 1140 ttgacccttt tcagtgcgcc taactacttg gacacctaca ataataaggc tgccatattg 1200 aaatacgaaa ataatgttat gaatatcaga caattcaaca tgactccaca cccctattgg 1260 ttaccagatt tcatggacgt tttcacgtgg tccttgccat ttgttggtga aaaagttaca 1320 gagatgcttg tcgcaattct aaacatctgt actgaagatg agctggaaaa cgacaccccc 1380 gtcattgaag aattagttgg taccgataaa aaattgccac aagctggtaa gtcggaagca 1440 actccacaac cagccacttc ggcgtcgcct aaacatgctt ccattttaga tgacgaacat 1500 cgaaggaaag ccttacgaaa taagattctg gccgtcgcca aagtttccag aatgtattct 1560 gttctcagag aagaaaccaa taaagttcag tttttaaaag atcacaattc aggcgtgttg 1620 ccacgtggcg ctttatctaa tggtgtaaag ggtttagatg aagccctgtc tacctttgaa 1680 agggcaagaa agcacgattt aattaatgaa aaattaccgc cttcactaga cgaactgaaa 1740 aacgaaaata agaagtacta cgaaaaagtt tggcagaaag tacatgaaca tgatgcaaag 1800 aatgatagca aatag 1815 <210> 2 <211> 1575 <212> DNA <213> Saccharomyces cerevisiae <400> 2 atgagtgctg ctccattgga ttacaaaaag gctttagaac atttgaagac atacagttcc 60 aaggacggtc tttctgtcca ggaattgatg gactccacaa ctagaggtgg gttgacctac 120 aatgattttt tggtcttacc aggcttggtc aatttcccat cttctgctgt cagtttgcaa 180 accaaattga ccaagaaaat cactttgaac actccttttg tctcttctcc tatggacaca 240 gtcactgaag ctgatatggc tatttatatg gctttattgg gtggtattgg tttcatccat 300 cacaactgta ctccaaagga acaggcttcc atggtcaaga aagttaaaat gtttgaaaac 360 ggtttcatca attctccaat agtaatttct ccaaccacca ctgttggtga agttaaggtt 420 atgaagagaa agtttggttt ctctggcttc ccagttactg aagacggtaa gtgtccaggt 480 aagttagttg ggttagtcac ctctcgtgat atacaattct tagaagatga ttctttggtt 540 gtttctgaag tcatgactaa aaatccagtt actggcatca agggtattac tttgaaagaa 600 ggtaatgaaa tcctaaaaca aaccaagaaa ggtaaattgc ttatcgttga tgataacggt 660 aacctcgttt ccatgttgtc aagagcggat ttgatgaaga atcaaaacta cccgttagct 720 tctaaatccg ccaccaccaa gcaattgcta tgtggtgctg caattggtac tatcgaagct 780 gataaggaaa gattaagact attagtcgaa gcaggtttgg atgttgttat cttagattcc 840 tctcaaggta actctgtttt ccaattgaac atgatcaaat ggattaaaga aactttccca 900 gatttggaaa tcattgctgg taacgttgcc accagagaac aagctgctaa cttgattgct 960 gccggtgccg atggtttaag aattggtatg ggttctgggt ctatttgtat cactcaagaa 1020 gttatggctt gtggtagacc acaaggtaca gctgtctaca acgtttgtca atttgctaac 1080 caatttggcg ttccatgtat ggctgatggt ggtgtccaaa acattggcca catcaccaag 1140 gctttggccc ttggttcctc caccgtcatg atgggtggta tgttagctgg tactaccgag 1200 tcaccaggtg aatacttcta caaggatggt aagagattga aggcttatcg tggtatgggg 1260 tccattgacg ccatgcaaaa gaccggtaac aagggtaatg cctctacttc tcgttatttc 1320 tctgagtcag acagtgtctt ggttgcacaa ggtgtttctg gggctgtcgt agacaaaggt 1380 tccatcaaga agtttattcc atatttgtac aacggtttac aacattcttg tcaagacatt 1440 ggttgcgaat ctctaacttc attgaaagag aatgttcaaa atggtgaagt tagatttgaa 1500 ttcagaaccg cttctgctca attagaaggt ggtgtccata atttgcactc ctatgaaaaa 1560 cgtctataca attga 1575 <210> 3 <211> 1491 <212> DNA <213> Saccharomyces cerevisiae <400> 3 atgacggccg cacatcctgt tgctcagtta actgccgagg cataccctaa agtcaagaga 60 aacccaaatt tcaaagttct cgactcggaa gatttggcgt actttcgttc gattttgtca 120 aatgatgaaa tcttaaactc tcaagctcca gaagagcttg cttcgtttaa ccaggactgg 180 atgaaaaaat atagaggcca gtccaattta attctcttgc caaactccac tgataaagtg 240 tccaagatta tgaaatactg taacgataaa aagttggcag tagtaccaca aggtggtaac 300 accgacttgg tcggagcctc tgttccggta tttgatgaga ttgttctttc tctaagaaat 360 atgaacaaag tcagagattt tgatccagtt agcgggactt tcaagtgtga cgcgggtgtc 420 gttatgcgtg atgcgcatca atttttacac gaccatgacc atatcttccc attggatctg 480 ccttctagaa acaactgtca agtgggcggt gtagtttcaa caaatgcagg tggtttgaac 540 tttttaagat atgggtctct acacggtaat gttttgggtt tggaagtggt gctacccaac 600 ggtgagatta tcagcaatat caatgcccta aggaaggaca atactggtta tgacttgaaa 660 caattattca tcggtgcaga gggtactatc ggtgtcgtta ctggtgtatc catagttgca 720 gcagcaaagc caaaagcctt gaatgccgta ttttttggta ttgagaattt cgataccgtt 780 cagaaattat ttgtcaaggc taaaagtgaa ttatctgaga ttttatctgc ttttgaattc 840 atggaccgtg gctccattga atgtacgata gaatacttga aggacttgcc tttccctctg 900 gagaaccaac acaactttta tgttcttatt gaaacgtcag ggtccaataa gagacacgac 960 gatgagaagc tgactgcttt cctcaaagat accacagatt ctaaattaat ttcggagggt 1020 atgatggcta aggacaaagc cgattttgat agactttgga cctggagaaa atctgttcca 1080 acagcttgta attcttacgg tggtatgtac aagtatgaca tgtcacttca attgaaagat 1140 ttatattccg tatctgcggc tgtgacggag agattaaacg cagccggttt gattggtgat 1200 gcaccaaaac cagttgttaa atcatgtggt tatggtcatg tcggtgacgg aaacatccat 1260 ttaaatatcg cggtaagaga atttacaaaa cagattgagg acttactaga accatttgtt 1320 tatgaatata ttgcatcaaa gaaaggttcc atcagtgctg agcatgggat cggtttccat 1380 aagaaaggta agttacacta caccagaagt gatattgaaa ttagatttat gaaggatatc 1440 Aaaaaatcact acgatccaaa tggaatctta aacccataca agtacatttg a 1491 <210> 4 <211> 2115 <212> DNA <213> Saccharomyces cerevisiae <400> 4 atgacggtcg accatgattt caatagcgaa gatattttat tccccataga aagcatgagt 60 agtatacaat acgtggagaa taataaccca aataatatta acaacgatgt tatcccgtat 120 tctctagata tcaaaaacac tgtcttagat agtgcggatc tcaatgacat tcaaaatcaa 180 gaaacttcac tgaatttggg gcttcctcca ctatctttcg actctccact gcccgtaacg 240 gaaacgatac catccactac cgataacagc ttgcatttga aagctgatag caacaaaaat 300 cgcgatgcaa gaactattga aaatgatagt gaaattaaga gtactaataa tgctagtggc 360 tctggggcaa atcaatacac aactcttact tcaccttatc ctatgaacga cattttgtac 420 aacatgaaca atccgttaca atcaccgtca ccttcatcgg tacctcaaaa tccgactata 480 aatcctccca taaatacagc aagtaacgaa actaatttat cgcctcaaac ttcaaatggt 540 aatgaaactc ttatatctcc tcgagcccaa caacatacgt ccattaaaga taatcgtctg 600 tccttaccta atggtgctaa ttcgaatctt ttcattgaca ctaacccaaa caatttgaac 660 gaaaaactaa gaaatcaatt gaactcagat acaaattcat attctaactc catttctaat 720 tcaaactcca attctacggg taatttaaat tccagttatt ttaattcact gaacatagac 780 tccatgctag atgattacgt ttctagtgat ctcttattga atgatgatga tgatgacact 840 aatttatcac gccgaagatt tagcgacgtt ataacaaacc aatttccgtc aatgacaaat 900 tcgaggaatt ctatttctca ctctttggac ctttggaacc atccgaaaat taatccaagc 960 aatagaaata caaatctcaa tatcactact aattctacct caagttccaa tgcaagtccg 1020 aataccacta ctatgaacgc aaatgcagac tcaaatattg ctggcaaccc gaaaaacaat 1080 gacgctacca tagacaatga gttgacacag attcttaacg aatataatat gaacttcaac 1140 gataatttgg gcacatccac ttctggcaag aacaaatctg cttgcccaag ttcttttgat 1200 gccaatgcta tgacaaagat aaatccaagt cagcaattac agcaacagct aaaccgagtt 1260 caacacaagc agctcacctc gtcacataat aacagtagca ctaacatgaa atccttcaac 1320 agcgatcttt attcaagaag gcaaagagct tctttaccca taatcgatga ttcactaagc 1380 tacgacctgg ttaataagca ggatgaagac cccaagaacg atatgctgcc gaattcaaat 1440 ttgagttcat ctcaacaatt tatcaaaccg tctatgattc tttcagacaa tgcgtccgtt 1500 attgcgaaag tggcgactac aggcttgagt aatgatatgc catttttgac agaggaaggt 1560 gaacaaaatg ctaattctac tccaaatttc gatctttcca tcactcaaat gaatatggct 1620 ccattatcgc ctgcatcatc atcctccacg tctcttgcaa caaatcattt ctatcaccat 1680 ttcccacagc agggtcacca taccatgaac tctaaaatcg gttcttccct tcggaggcgg 1740 aagtctgctg tgcctttgat gggtacggtg ccgcttacaa atcaacaaaa taatataagc 1800 agtagtagtg tcaactcaac tggcaatggt gctggggtta cgaaggaaag aaggccaagt 1860 tacaggagaa aatcaatgac accgtccaga agatcaagtg tcgtaataga atcaacaaag 1920 gaactcgagg agaaaccgtt ccactgtcac atttgtccca agagctttaa gcgcagcgaa 1980 catttgaaaa ggcatgtgag atctgttcac tctaacgaac gaccatttgc ttgtcacata 2040 tgcgataaga aatttagtag aagcgataat ttgtcgcaac acatcaagac tcataaaaaa 2100 catggagaca tttaa 2115 <210> 5 <211> 604 <212> PRT <213> Saccharomyces cerevisiae <400> 5 Met Ser Ser Asp Ala Ile Arg Asn Thr Glu Gln Ile Asn Ala Ala Ile   1 5 10 15 Lys Ile Ile Glu Asn Lys Thr Glu Arg Pro Gln Ser Ser Thr Thr Pro              20 25 30 Ile Asp Ser Lys Ala Ser Thr Val Ala Ala Ala Asn Ser Thr Ala Thr          35 40 45 Glu Thr Ser Arg Asp Leu Thr Gln Tyr Thr Leu Asp Asp Gly Arg Val      50 55 60 Val Ser Thr Asn Arg Arg Ile Met Asn Lys Val Pro Ala Ile Thr Ser  65 70 75 80 His Val Pro Thr Asp Glu Glu Leu Phe Gln Pro Asn Gly Ile Pro Arg                  85 90 95 His Glu Phe Leu Arg Asp His Phe Lys Arg Glu Gly Lys Leu Ser Ala             100 105 110 Ala Gln Ala Ala Arg Ile Val Thr Leu Ala Thr Glu Leu Phe Ser Lys         115 120 125 Glu Pro Asn Leu Ile Ser Val Pro Ala Pro Ile Thr Val Cys Gly Asp     130 135 140 Ile His Gly Gln Tyr Phe Asp Leu Leu Lys Leu Phe Glu Val Gly Gly 145 150 155 160 Asp Pro Ala Thr Thr Ser Tyr Leu Phe Leu Gly Asp Tyr Val Asp Arg                 165 170 175 Gly Ser Phe Ser Phe Glu Cys Leu Ile Tyr Leu Tyr Ser Leu Lys Leu             180 185 190 Asn Phe Asn Asp His Phe Trp Leu Leu Arg Gly Asn His Glu Cys Lys         195 200 205 His Leu Thr Ser Tyr Phe Thr Phe Lys Asn Glu Met Leu His Lys Tyr     210 215 220 Asn Leu Asp Ile Tyr Glu Lys Cys Cys Glu Ser Phe Asn Asn Leu Pro 225 230 235 240 Leu Ala Ala Leu Met Asn Gly Gln Tyr Leu Cys Val His Gly Gly Ile                 245 250 255 Ser Pro Glu Leu Asn Ser Leu Gln Asp Ile Asn Asn Leu Asn Arg Phe             260 265 270 Arg Glu Ile Pro Ser His Gly Leu Met Cys Asp Leu Leu Trp Ala Asp         275 280 285 Pro Ile Glu Glu Tyr Asp Glu Val Leu Asp Lys Asp Leu Thr Glu Glu     290 295 300 Asp Ile Val Asn Ser Lys Thr Met Val Pro His His Gly Lys Met Ala 305 310 315 320 Pro Ser Arg Asp Met Phe Val Pro Asn Ser Val Arg Gly Cys Ser Tyr                 325 330 335 Ala Phe Thr Tyr Arg Ala Ala Cys His Phe Leu Gln Glu Thr Gly Leu             340 345 350 Leu Ser Ile Ile Arg Ala His Glu Ala Gln Asp Ala Gly Tyr Arg Met         355 360 365 Tyr Lys Asn Thr Lys Thr Leu Gly Phe Pro Ser Leu Leu Thr Leu Phe     370 375 380 Ser Ala Pro Asn Tyr Leu Asp Thr Tyr Asn Asn Lys Ala Ala Ile Leu 385 390 395 400 Lys Tyr Glu Asn Asn Val Met Asn Ile Arg Gln Phe Asn Met Thr Pro                 405 410 415 His Pro Tyr Trp Leu Pro Asp Phe Met Asp Val Phe Thr Trp Ser Leu             420 425 430 Pro Phe Val Gly Glu Lys Val Thr Glu Met Leu Val Ala Ile Leu Asn         435 440 445 Ile Cys Thr Glu Asp Glu Leu Glu Asn Asp Thr Pro Val Ile Glu Glu     450 455 460 Leu Val Gly Thr Asp Lys Lys Leu Pro Gln Ala Gly Lys Ser Glu Ala 465 470 475 480 Thr Pro Gln Pro Ala Thr Ser Ala Ser Pro Lys His Ala Ser Ile Leu                 485 490 495 Asp Asp Glu His Arg Arg Lys Ala Leu Arg Asn Lys Ile Leu Ala Val             500 505 510 Ala Lys Val Ser Arg Met Tyr Ser Val Leu Arg Glu Glu Thr Asn Lys         515 520 525 Val Gln Phe Leu Lys Asp His Asn Ser Gly Val Leu Pro Arg Gly Ala     530 535 540 Leu Ser Asn Gly Val Lys Gly Leu Asp Glu Ala Leu Ser Thr Phe Glu 545 550 555 560 Arg Ala Arg Lys His Asp Leu Ile Asn Glu Lys Leu Pro Pro Ser Leu                 565 570 575 Asp Glu Leu Lys Asn Glu Asn Lys Lys Tyr Tyr Glu Lys Val Trp Gln             580 585 590 Lys Val His Glu His Asp Ala Lys Asn Asp Ser Lys         595 600 <210> 6 <211> 524 <212> PRT <213> Saccharomyces cerevisiae <400> 6 Met Ser Ala Ala Pro Leu Asp Tyr Lys Lys Ala Leu Glu His Leu Lys   1 5 10 15 Thr Tyr Ser Ser Lys Asp Gly Leu Ser Val Gln Glu Leu Met Asp Ser              20 25 30 Thr Thr Arg Gly Gly Leu Thr Tyr Asn Asp Phe Leu Val Leu Pro Gly          35 40 45 Leu Val Asn Phe Pro Ser Ser Ala Val Ser Leu Gln Thr Lys Leu Thr      50 55 60 Lys Lys Ile Thr Leu Asn Thr Pro Phe Val Ser Ser Pro Met Asp Thr  65 70 75 80 Val Thr Glu Ala Asp Met Ala Ile Tyr Met Ala Leu Leu Gly Gly Ile                  85 90 95 Gly Phe Ile His His Asn Cys Thr Pro Lys Glu Gln Ala Ser Met Val             100 105 110 Lys Lys Val Lys Met Phe Glu Asn Gly Phe Ile Asn Ser Pro Ile Val         115 120 125 Ile Ser Pro Thr Thr Thr Val Gly Glu Val Lys Val Met Lys Arg Lys     130 135 140 Phe Gly Phe Ser Gly Phe Pro Val Thr Glu Asp Gly Lys Cys Pro Gly 145 150 155 160 Lys Leu Val Gly Leu Val Thr Ser Arg Asp Ile Gln Phe Leu Glu Asp                 165 170 175 Asp Ser Leu Val Val Ser Glu Val Met Thr Lys Asn Pro Val Thr Gly             180 185 190 Ile Lys Gly Ile Thr Leu Lys Glu Gly Asn Glu Ile Leu Lys Gln Thr         195 200 205 Lys Lys Gly Lys Leu Leu Ile Val Asp Asp Asn Gly Asn Leu Val Ser     210 215 220 Met Leu Ser Arg Ala Asp Leu Met Lys Asn Gln Asn Tyr Pro Leu Ala 225 230 235 240 Ser Lys Ser Ala Thr Thr Lys Gln Leu Leu Cys Gly Ala Ala Ile Gly                 245 250 255 Thr Ile Glu Ala Asp Lys Glu Arg Leu Arg Leu Leu Val Glu Ala Gly             260 265 270 Leu Asp Val Val Ile Leu Asp Ser Ser Gln Gly Asn Ser Val Phe Gln         275 280 285 Leu Asn Met Ile Lys Trp Ile Lys Glu Thr Phe Pro Asp Leu Glu Ile     290 295 300 Ile Ala Gly Asn Val Ala Thr Arg Glu Gln Ala Ala Asn Leu Ile Ala 305 310 315 320 Ala Gly Ala Asp Gly Leu Arg Ile Gly Met Gly Ser Gly Ser Ile Cys                 325 330 335 Ile Thr Gln Glu Val Met Ala Cys Gly Arg Pro Gln Gly Thr Ala Val             340 345 350 Tyr Asn Val Cys Gln Phe Ala Asn Gln Phe Gly Val Pro Cys Met Ala         355 360 365 Asp Gly Gly Val Gln Asn Ile Gly His Ile Thr Lys Ala Leu Ala Leu     370 375 380 Gly Ser Ser Thr Val Met Met Gly Gly Met Leu Ala Gly Thr Thr Glu 385 390 395 400 Ser Pro Gly Glu Tyr Phe Tyr Lys Asp Gly Lys Arg Leu Lys Ala Tyr                 405 410 415 Arg Gly Met Gly Ser Ile Asp Ala Met Gln Lys Thr Gly Asn Lys Gly             420 425 430 Asn Ala Ser Thr Ser Arg Tyr Phe Ser Glu Ser Asp Ser Val Leu Val         435 440 445 Ala Gln Gly Val Ser Gly Ala Val Val Asp Lys Gly Ser Ile Lys Lys     450 455 460 Phe Ile Pro Tyr Leu Tyr Asn Gly Leu Gln His Ser Cys Gln Asp Ile 465 470 475 480 Gly Cys Glu Ser Leu Thr Ser Leu Lys Glu Asn Val Gln Asn Gly Glu                 485 490 495 Val Arg Phe Glu Phe Arg Thr Ala Ser Ala Gln Leu Glu Gly Gly Val             500 505 510 His Asn Leu His Ser Tyr Glu Lys Arg Leu Tyr Asn         515 520 <210> 7 <211> 496 <212> PRT <213> Saccharomyces cerevisiae <400> 7 Met Thr Ala Ala His Pro Val Ala Gln Leu Thr Ala Glu Ala Tyr Pro   1 5 10 15 Lys Val Lys Arg Asn Pro Asn Phe Lys Val Leu Asp Ser Glu Asp Leu              20 25 30 Ala Tyr Phe Arg Ser Ile Leu Ser Asn Asp Glu Ile Leu Asn Ser Gln          35 40 45 Ala Pro Glu Glu Leu Ala Ser Phe Asn Gln Asp Trp Met Lys Lys Tyr      50 55 60 Arg Gly Gln Ser Asn Leu Ile Leu Leu Pro Asn Ser Thr Asp Lys Val  65 70 75 80 Ser Lys Ile Met Lys Tyr Cys Asn Asp Lys Lys Leu Ala Val Val Pro                  85 90 95 Gln Gly Gly Asn Thr Asp Leu Val Gly Ala Ser Val Pro Val Phe Asp             100 105 110 Glu Ile Val Leu Ser Leu Arg Asn Met Asn Lys Val Arg Asp Phe Asp         115 120 125 Pro Val Ser Gly Thr Phe Lys Cys Asp Ala Gly Val Val Met Arg Asp     130 135 140 Ala His Gln Phe Leu His Asp His Asp His Ile Phe Pro Leu Asp Leu 145 150 155 160 Pro Ser Arg Asn Asn Cys Gln Val Gly Gly Val Val Ser Thr Asn Ala                 165 170 175 Gly Gly Leu Asn Phe Leu Arg Tyr Gly Ser Leu His Gly Asn Val Leu             180 185 190 Gly Leu Glu Val Val Leu Pro Asn Gly Glu Ile Ile Ser Asn Ile Asn         195 200 205 Ala Leu Arg Lys Asp Asn Thr Gly Tyr Asp Leu Lys Gln Leu Phe Ile     210 215 220 Gly Ala Glu Gly Thr Ile Gly Val Val Thr Gly Val Ser Ile Val Ala 225 230 235 240 Ala Ala Lys Pro Lys Ala Leu Asn Ala Val Phe Phe Gly Ile Glu Asn                 245 250 255 Phe Asp Thr Val Gln Lys Leu Phe Val Lys Ala Lys Ser Glu Leu Ser             260 265 270 Glu Ile Leu Ser Ala Phe Glu Phe Met Asp Arg Gly Ser Ile Glu Cys         275 280 285 Thr Ile Glu Tyr Leu Lys Asp Leu Pro Phe Pro Leu Glu Asn Gln His     290 295 300 Asn Phe Tyr Val Leu Ile Glu Thr Ser Gly Ser Asn Lys Arg His Asp 305 310 315 320 Asp Glu Lys Leu Thr Ala Phe Leu Lys Asp Thr Thr Asp Ser Lys Leu                 325 330 335 Ile Ser Glu Gly Met Met Ala Lys Asp Lys Ala Asp Phe Asp Arg Leu             340 345 350 Trp Thr Trp Arg Lys Ser Val Pro Thr Ala Cys Asn Ser Tyr Gly Gly         355 360 365 Met Tyr Lys Tyr Asp Met Ser Leu Gln Leu Lys Asp Leu Tyr Ser Val     370 375 380 Ser Ala Ala Val Thr Glu Arg Leu Asn Ala Ala Gly Leu Ile Gly Asp 385 390 395 400 Ala Pro Lys Pro Val Val Lys Ser Cys Gly Tyr Gly His Val Gly Asp                 405 410 415 Gly Asn Ile His Leu Asn Ile Ala Val Arg Glu Phe Thr Lys Gln Ile             420 425 430 Glu Asp Leu Leu Glu Pro Phe Val Tyr Glu Tyr Ile Ala Ser Lys Lys         435 440 445 Gly Ser Ile Ser Ala Glu His Gly Ile Gly Phe His Lys Lys Gly Lys     450 455 460 Leu His Tyr Thr Arg Ser Asp Ile Glu Ile Arg Phe Met Lys Asp Ile 465 470 475 480 Lys Asn His Tyr Asp Pro Asn Gly Ile Leu Asn Pro Tyr Lys Tyr Ile                 485 490 495 <210> 8 <211> 704 <212> PRT <213> Saccharomyces cerevisiae <400> 8 Met Thr Val Asp His Asp Phe Asn Ser Glu Asp Ile Leu Phe Pro Ile   1 5 10 15 Glu Ser Met Ser Ser Ile Gln Tyr Val Glu Asn Asn Asn Pro Asn Asn              20 25 30 Ile Asn Asn Asp Val Ile Pro Tyr Ser Leu Asp Ile Lys Asn Thr Val          35 40 45 Leu Asp Ser Ala Asp Leu Asn Asp Ile Gln Asn Gln Glu Thr Ser Leu      50 55 60 Asn Leu Gly Leu Pro Pro Leu Ser Phe Asp Ser Pro Leu Pro Val Thr  65 70 75 80 Glu Thr Ile Pro Ser Thr Thr Asp Asn Ser Leu His Leu Lys Ala Asp                  85 90 95 Ser Asn Lys Asn Arg Asp Ala Arg Thr Ile Glu Asn Asp Ser Glu Ile             100 105 110 Lys Ser Thr Asn Asn Ala Ser Gly Ser Gly Ala Asn Gln Tyr Thr Thr         115 120 125 Leu Thr Ser Pro Tyr Pro Met Asn Asp Ile Leu Tyr Asn Met Asn Asn     130 135 140 Pro Leu Gln Ser Pro Ser Pro Ser Ser Val Pro Gln Asn Pro Thr Ile 145 150 155 160 Asn Pro Pro Ile Asn Thr Ala Ser Asn Glu Thr Asn Leu Ser Pro Gln                 165 170 175 Thr Ser Asn Gly Asn Glu Thr Leu Ile Ser Pro Arg Ala Gln Gln His             180 185 190 Thr Ser Ile Lys Asp Asn Arg Leu Ser Leu Pro Asn Gly Ala Asn Ser         195 200 205 Asn Leu Phe Ile Asp Thr Asn Pro Asn Asn Leu Asn Glu Lys Leu Arg     210 215 220 Asn Gln Leu Asn Ser Asp Thr Asn Ser Tyr Ser Asn Ser Ile Ser Asn 225 230 235 240 Ser Asn Ser Asn Ser Thr Gly Asn Leu Asn Ser Ser Tyr Phe Asn Ser                 245 250 255 Leu Asn Ile Asp Ser Met Leu Asp Asp Tyr Val Ser Ser Asp Leu Leu             260 265 270 Leu Asn Asp Asp Asp Asp Asp Thr Asn Leu Ser Arg Arg Arg Phe Ser         275 280 285 Asp Val Ile Thr Asn Gln Phe Pro Ser Met Thr Asn Ser Arg Asn Ser     290 295 300 Ile Ser His Ser Leu Asp Leu Trp Asn His Pro Lys Ile Asn Pro Ser 305 310 315 320 Asn Arg Asn Thr Asn Leu Asn Ile Thr Thr Asn Ser Thr Ser Ser Ser                 325 330 335 Asn Ala Ser Pro Asn Thr Thr Thr Met Asn Ala Asn Ala Asp Ser Asn             340 345 350 Ile Ala Gly Asn Pro Lys Asn Asn Asp Ala Thr Ile Asp Asn Glu Leu         355 360 365 Thr Gln Ile Leu Asn Glu Tyr Asn Met Asn Phe Asn Asp Asn Leu Gly     370 375 380 Thr Ser Thr Ser Gly Lys Asn Lys Ser Ala Cys Pro Ser Ser Phe Asp 385 390 395 400 Ala Asn Ala Met Thr Lys Ile Asn Pro Ser Gln Gln Leu Gln Gln Gln                 405 410 415 Leu Asn Arg Val Gln His Lys Gln Leu Thr Ser Ser His Asn Asn Ser             420 425 430 Ser Thr Asn Met Lys Ser Phe Asn Ser Asp Leu Tyr Ser Arg Arg Gln         435 440 445 Arg Ala Ser Leu Pro Ile Ile Asp Asp Ser Leu Ser Tyr Asp Leu Val     450 455 460 Asn Lys Gln Asp Glu Asp Pro Lys Asn Asp Met Leu Pro Asn Ser Asn 465 470 475 480 Leu Ser Ser Ser Gln Gln Phe Ile Lys Pro Ser Met Ile Leu Ser Asp                 485 490 495 Asn Ala Ser Val Ile Ala Lys Val Ala Thr Thr Gly Leu Ser Asn Asp             500 505 510 Met Pro Phe Leu Thr Glu Glu Gly Glu Gln Asn Ala Asn Ser Thr Pro         515 520 525 Asn Phe Asp Leu Ser Ile Thr Gln Met Asn Met Ala Pro Leu Ser Pro     530 535 540 Ala Ser Ser Ser Ser Thr Ser Leu Ala Thr Asn His Phe Tyr His His 545 550 555 560 Phe Pro Gln Gln Gly His His Thr Met Asn Ser Lys Ile Gly Ser Ser                 565 570 575 Leu Arg Arg Arg Lys Ser Ala Val Pro Leu Met Gly Thr Val Pro Leu             580 585 590 Thr Asn Gln Gln Asn Asn Ile Ser Ser Ser Ser Val Asn Ser Thr Gly         595 600 605 Asn Gly Ala Gly Val Thr Lys Glu Arg Arg Pro Ser Tyr Arg Arg Lys     610 615 620 Ser Met Thr Pro Ser Arg Arg Ser Ser Val Val Ile Glu Ser Thr Lys 625 630 635 640 Glu Leu Glu Glu Lys Pro Phe His Cys His Ile Cys Pro Lys Ser Phe                 645 650 655 Lys Arg Ser Glu His Leu Lys Arg His Val Arg Ser Val His Ser Asn             660 665 670 Glu Arg Pro Phe Ala Cys His Ile Cys Asp Lys Lys Phe Ser Arg Ser         675 680 685 Asp Asn Leu Ser Gln His Ile Lys Thr His Lys Lys His Gly Asp Ile     690 695 700

Claims (9)

Inactivated CMP2 or IMD4 gene (Tn-1); DLD3 gene (Tn-4); Or an ethanol-resistant transformed yeast strain comprising the MSN2 gene (Tn-5).
2. The yeast strain of claim 1, wherein said inactivation is caused by transposon.
The yeast strain of claim 1, wherein the transformed yeast strain is capable of growing at 5-15% ethanol concentration conditions.
4. The yeast strain of claim 3, wherein the transformed yeast strain is capable of growing at 12.5-15% ethanol concentration conditions.
The method of claim 1, wherein the transformation is Saccharomyces spp., Schizosaccharomyces spp., Pichia spp., Paffia spp. , Cluj Vero MRS species (Kluyveromyces spp.), Candida species (Candida spp.), Tallahassee in MRS species (Talaromyces spp.), Brescia Gaetano MRS species (Brettanomyces spp.), Parkinson solren species (Pachysolen spp.) or Deva Rio Yeast strain, characterized in that carried out in the yeast strain Debaryomyces spp.
6. The yeast strain according to claim 5, wherein the transformation is carried out in Saccharomyces spp.
The ethanol production method comprising culturing the transformed yeast strain of claim 1 in a culture medium comprising one or more substrates that can be metabolized to ethanol.
8. The method of claim 7, wherein the substrate capable of metabolizing ethanol comprises C6 sugars.
9. The method of claim 8, wherein said C6 sugar is glucose.

Images