KR101182752B1 - Ethanol- and Thermo-Tolerant Yeast Strains and Genes Thereof - Google Patents

Abstract

The present invention relates to ethanol- and heat-resistant transformed yeast strains comprising the inactivated SSK2 or PPG1 gene, or the PAM1 gene and their use. Yeast strains of the present invention are yeast strains that can grow in high concentration ethanol, preferably 10-15% ethanol and at the same time grow at high temperatures (eg 42 ° C.). Therefore, yeast strains of the present invention can produce ethanol more efficiently at high temperature and high concentration ethanol conditions required for the integrated process overcoming the existing inefficient multi-step process.

Description

ethanol? And heat-resistant yeast strains, and genes thereof [Ethanol? and Thermo? Tolerant Yeast Strains and Genes Thereof}

The present invention is ethanol? And heat-resistant yeast strains and uses thereof.

Yeast S. cerevisiae has been used in a variety of industries, including the production of bioethanol from biomass resources (Schubert, 2006). Yeast cells are always exposed to various environmental stresses such as high concentrations of ethanol that occur during industrial ethanol fermentation, which in turn leads to a decrease in cell growth, cell viability and ethanol production (Casey & Ingledew, 1986; Suutari and Laakso, 1994). Therefore, there has been a need for the development of yeast strains that can overcome the stress caused mainly by high concentrations of ethanol. On the other hand, Consolidated BioProcess (CBP), which intends to develop a strain system so that a woody degrading enzyme production line, a woody degrading line, and a fermentation line occur in one reactor, is proposed as a new technology. Development of yeast strains with high ethanol and heat resistance that meet the conditions to overcome the difference between the proper environment and the fermentation environment of yeast is the most important factor for efficient ethanol production in the future.

To investigate the mechanism of ethanol stress resistance, there have been many studies. In particular, unsaturated fatty acids related to membrane fluidity have been reported and considered as important determinants of ethanol resistance in yeast (Kajiwara, et al. , 2000; You, et al , 2003). In addition, intracellular accumulation of trihalose (Kim, et al. , 1996) or proline (Takagi, et al. , 2005) improves yeast ethanol resistance and ergosterol to ethanol resistance to Saccharomyces cerevisiae. Has been reported to be an important factor associated with (Inoue, et al. , 2000).

Furthermore, the use of genome-wide assays, such as microarrays and comprehensive expression pattern analysis, has been useful in identifying novel ethanol stress related genes (Hirasawa, et al. , 2007; Teixeira, et al. , 2009; Yoshikawa, et al. , 2009). Through this approach, many genes involved in ethanol resistance have been identified as non-essential genes. In addition, results related to ethanol resistance did not match, respectively, and reported that this discrepancy was due to strain and growth conditions (Teixeira, et al. , 2009). Thus, strains constructed from the genetic information described above do not always result in changes to ethanol stress conditions (Yoshikawa, et al. , 2009). In addition, a commercially available Saccharomyces cerevisiae deletion mutant library was used for genome-wide screening of genes involved in ethanol resistance (Fujita, et al. , 2006; Teixeira, et al. , 2009; Yoshikawa, et. al. , 2009). The above studies mainly selected mutants exhibiting ethanol sensitivity to identify the corresponding genes as genes required for growth under high ethanol conditions. On the other hand, in high temperature conditions, heat shock protein (HSP) is mainly induced to induce growth (Sanchez, et al., 1990), and yeast gene mutants constructed by the Saccharomyces genome deletion project. Genes required for several stress sensitive conditions, including temperature, were screened (Auesukaree et al., 2009).

As mentioned above, genes responsible for ethanol resistance have been identified through the screening of ethanol- and heat-sensitive mutations (Takahashi , et al. , 2001; Auesukaree , et al., 2009), but ethanol or by optional transposon insertion There is no report on how to directly construct heat-resistant yeast strains and identify target genes involved therein.

Meanwhile, there is an increasing demand for bioethanol as a continuous alternative fuel. Yeast Saccharomyces cerevisiae is widely used in ethanol-related industries due to its strong ethanol production and resistance (Schubert 2006). Yeast cells are always exposed to various environmental stresses such as high concentrations of ethanol, high temperatures or high osmotic pressures and inhibitors that occur during industrial ethanol fermentation, resulting in decreased cell growth, survival and ethanol production (Casey & Ingledew 1986; Suutari & Laakso). 1994). Therefore, the development of yeast strain that can withstand a variety of stress is urgently required.

One of the most powerful technologies for fuel ethanol production is consolidated bio-processing (CBP), which can be characterized by saccharification and fermentation of lignocellulosic biomass simultaneously in the same reactor. Lynd, et al. , 2005). Since the optimal temperature for saccharification (4550 ° C.) differs from the temperature for fermentation (25-35 ° C.) in CBP, the use of heat-resistant strains is essential (Edgardo, et al. , 2008; Weber, et al. , 2010). In addition, the use of heat-resistant yeast strains is useful for reducing cooling costs, distillation costs, and faster onset efficiency and helps to reduce the chance of contamination during fermentation. UV mutagenesis (Sridhar, et al. , 2002), error-prone polymerase chain reaction (Shimoda, et al. , 2006) and long-term adaptation to high temperatures; Edgardo, et al. , 2008) report on the development of heat-resistant strains.

The use of ethanol-resistant yeast strains in itself is important for high ethanol production rates, since ethanol concentration constantly increases to levels that are harmful to cells and even fatal during fermentation. Several physiological changes, including intracellular accumulation of trihalose (Kim, et al. , 1996), proline (Takagi, et al. , 2005) and ergosterol (Inoue, et al. , 2000), Occurs in resistant yeast strains. To develop ethanol resistant strains, classical adaptations such as evolutionary adaptation (Stanley, et al. , 2010), random chemical mutagenesis (Mobini-Dehkordi, et al. , 2008), and gene shuffling (Hou, 2010) In addition to strategies, several strategies have been used recently. Alternative strategies described above may include genome-wide DNA microarray analysis (Hirasawa, et al. , 2007), transposon-mediated deletion mutant libraries (Takahashi, et al. , 2001) or single gene knockout, SGKO) library (Auesukaree, et al. , 2009; Fujita, et al. , 2006; Kubota, et al. , 2004; Teixeira, et al. , 2009; van Voorst, et al. , 2006; Yoshikawa, et al. , 2009) screening and gTME (global transcriptional machinery engineering; Alper, et al. , 2006). Although gTME is of interest as a means of positively selecting ethanol resistant strains, its utility is controversial (Araki, et al ., 2009). In contrast, the other three alternative strategies are mostly indirect: additional identification steps are required following identification of the target gene, which helps to understand the molecular basis of ethanol resistance, although the identification of ethanol sensitive genes helps to produce ethanol resistant strains. It is not to make sure. Moreover, a large number of identified target genes must be complicated, since 5-10% of the genes encoded in the yeast genome may be other stressors.

Several studies have shown that disruption of specific gene (s) leads to the creation of resistance strains against various strain factors, including ethanol (Kubota, et al. , 2004; Yazawa, et al. , 2007). Recently, two clones and 10 osmo-resistant clones showing increased growth in 8% ethanol have been identified through screening of the SGKO library (Yoshikawa, et al. , 2009). In particular, this study used a deletion mutant library constructed using transposon or SGKO for positive (or direct) isolation of strains that were resistant (not sensitive) to specific stressors.

The use of any library is currently a major issue. Each library has contrasting advantages and disadvantages, and transposon mutant libraries can be easily built on strains with various genetic backgrounds. Mutants with up- or down-regulated genes can be generated by transposon insertion into regulatory sites, especially sites important for expression levels (eg, lethal genes). On the other hand, this method requires additional steps (eg, recovery of transposon flanked by genome DNAs) for final identification of the gene of interest. Often, one or more genes can be affected.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

We sought to develop yeast strains possessing high ethanol- and heat-resistance. As a result, we identified ethanol- and heat-resistant yeast transformants by inducing mutations in the yeast chromosome by transposon-mediated gene homologous recombination in yeast, and they identified high concentrations of ethanol (eg, 10%, 12.5%, 15). % Ethanol) and at high temperature (eg 42 ° C.) to complete the invention.

Accordingly, it is an object of the present invention to provide ethanol- and heat-resistant yeast strains and related genes.

Another object of the present invention is to provide a method for producing ethanol.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to an aspect of the present invention, the present invention provides ethanol- and heat-resistant transformed yeast strains comprising an inactivated SSK2 or PPG1 gene.

According to an aspect of the present invention, the present invention provides ethanol- and heat-resistant yeast strains comprising an inactivated PAM1 gene.

We sought to develop yeast strains possessing high ethanol- and heat-resistance. As a result, we identified ethanol- and heat-resistant yeast transformants by inducing mutations in the yeast chromosome by transposon-mediated gene homologous recombination in yeast, and they identified high concentrations of ethanol (eg, 10%, 12.5%, 15). % Ethanol) and at high temperature (eg 42 ° C.).

Ethanol, a flammable, volatile colorless liquid, is the most widely used solvent. Industrially, ethanol is used as a vehicle fuel and fuel additive and also as a perfume, flavorings, colorings and medicines. Ethanol is also the main psychoactive component in alcoholic beverages and has a calming effect on the central nervous system. Ethanol can be produced petrochemically through hydration of ethylene and biologically by fermenting sugars using yeast, which is produced by petrochemical processes that depend on the price of petroleum and grain feed products. Much more economical than Therefore, the development of yeast strains for the production of biological ethanol is very important.

The present invention provides transformed yeast strains having increased ethanol- and heat-resistance by transposon-mediated mutations in yeast.

As used herein, the term “transposon” refers to a DNA sequence capable of transposition to another location within the genome of a single cell, and refers to a DNA sequence that causes mutation. Transposons, called jumping genes, are good examples of mobile hereditary elements. Various kinds of mobile genetic elements can be classified according to transposition mechanisms as follows: (a) Group I retrotranspozone, transposon transcribed into RNA and then reverse transcribed into DNA; And (b) group II jumping transposons, transposons that are "cut and paste" from one position to another position of the DNA by a transposase. The transposon construct used in the present invention is introduced into the yeast chromosome through homologous recombination into the mTn3- lacZ / LEU2 construct.

The present invention comprises the steps of (a) causing mutations in the yeast chromosome; And (b) culturing the mutated yeast in a medium containing high concentration of ethanol or at a high temperature, thereby providing a method for screening transformed yeast strains with increased ethanol- and heat resistance.

Step (a) is carried out using a variety of methods, preferably using a transposon. The inventors have found that yeast ( S) comprising mTn3- lacZ / LEU2 construct obtained from Yale Genome Analysis Center (New Haven, CT: http://ygac.med.yale.edu/mtn/reagent ) cerevisiae ) library pool was used (see FIG. 1). Mutations were induced by cleaving the transposon construct from plasmid DNA using restriction enzymes and transforming the fragment into yeast chromosomes via gene homologous recombination. Homologous recombination, known as the general recombination process, is a form of genetic recombination that refers to the exchange of nucleotide sequences that occur between two similar or identical DNA strands, and is used in most organisms.

Transformed yeast strains are cultured in high concentration ethanol to isolate / identify strains capable of growth. In the present invention, a growth assay (spot assay) of yeast strains was performed in various concentrations of ethanol (10%, 12.5%, 15% ethanol). Selected ethanol-resistant strains were incubated at 30 ° C. or 42 ° C. with the control to select strains capable of growing even at high temperatures (42 ° C.) as ethanol- and heat-resistant transformed yeast strains.

The present invention isolated / identified ethanol- and heat-resistant yeast strains comprising the inactivated SSK2 or PPG1 gene, or the PAM1 gene.

As used herein, the term “inactivated” refers to inactivation when the function of the target gene is blocked, eg transpozone-induced mutations, point mutations, nonsense mutations, missense mutations, replacement mutations, deletion mutations. Inactivation of target genes caused by mutations, including, and the like. Preferably, inactivation of the present invention means inactivation through mutations caused by transposons.

According to a preferred embodiment of the invention, the inactivation of the target gene described above is caused by transposon. The nucleotide sequence and amino acid sequence of the above-described target genes, namely, SSK2, PPG1 and PAM1 genes are described in SEQ ID NO: 1 to SEQ ID NO: 3, and SEQ ID NO: 4 to SEQ ID NO: 6, respectively. It is apparent in the art that nucleotide sequences encoding amino acids of the genes and variants thereof may also be used.

According to a preferred embodiment of the present invention, the above-described yeast strain can be grown at 5-15% ethanol, more preferably 10-15% ethanol and most preferably 12.5-15% ethanol culture conditions.

According to a preferred embodiment of the present invention, the above-described yeast strains are grown at temperature conditions of 30-43 ° C, more preferably 37-43 ° C, even more preferably 40-43 ° C and most preferably 42-43 ° C. Can be.

According to a preferred embodiment of the present invention, the above-mentioned yeast strain is Saccharomyces spp., Schizosaccharomyces spp., Pichia spp., Papia spp. Paffia spp.), Cluj Vero MRS species (Kluyveromyces spp.), Candida spp (Candida species), Tallahassee in MRS species (Talaromyces spp.), Brescia Gaetano MRS species (Brettanomyces spp.), Parkinson solren species (Pachysolen spp. ) Or Debaryomyces spp. Yeast strain, more preferably Saccharomyces species, most preferably Saccharomyces cerevisiae L3262 ( MAT-αura3-52 leu2-3,112 his4-34 )to be.

According to another aspect of the present invention, the present invention is cultured in a culture medium comprising at least one substrate capable of metabolizing the above-mentioned inactivated SSK2 or PPG1 gene, or yeast strain into which the PAM1 gene is inserted into ethanol It provides a ethanol production method comprising the step of. More preferably, the above-mentioned inactivated SSK2 or PPG1 gene, or yeast strain into which the PAM1 gene is inserted, is more efficient in the high temperature and high ethanol conditions required for the integrated process to overcome the existing inefficient multi-step process. It provides a method for producing ethanol.

Since the method of the present invention includes the above-described yeast strain of the present invention as an active ingredient, the overlapping contents between the two are omitted in order to avoid excessive complexity of the present specification according to the overlapping description.

In addition, the present invention can be used as a method for producing ethanol- and heat-resistant yeast strain comprising the step of causing mutation in the above-described yeast strain.

According to a preferred embodiment of the invention, the substrate which can be metabolized to ethanol comprises C6 sugars, and according to a more preferred embodiment of the invention, the C6 sugar comprises glucose, but is not limited thereto. no.

The present invention provides a cell infected by a recombinant vector or a transcript thereof comprising the inactivated SSK2 or PPG1 gene, or PAM1 gene described above, and a transformed cell by gene introduction. The present invention also provides a recombinant vector comprising the inactivated SSK2 or PPG1 gene, or PAM1 gene described above, or a transformant transformed with the inactivated SSK2 or PPG1 protein, or PAM1 protein described above.

The recombinant vector of the present invention comprises a nucleotide sequence encoding an amino acid sequence of an inactivated SSK2 or PPG1 gene, or PAM1 gene, or a complementary nucleotide sequence thereof. Vectors of the present invention can typically be constructed as vectors for cloning or vectors for expression. In addition, the vector of the present invention can be constructed using prokaryotic and eukaryotic cells as hosts. For example, prokaryotic cells include bacterial cells and archaea, and eukaryotic cells include yeast cells, mammalian cells, plant cells, insect cells, stem cells and fungi, most preferably yeast cells.

Preferably, the recombinant vector of the present invention comprises (i) a nucleotide sequence encoding the above-described expression target of the present invention; (Ii) a promoter operably linked to the nucleotide sequence of (iii) and acting on an animal cell, preferably a yeast cell, to form an RNA molecule, and more preferably (iii) the fire of the invention described above A nucleotide sequence encoding an amino acid sequence of an activated SSK2 or PPG1 gene, or PAM1 gene, or a complementary nucleotide sequence thereof; (Ii) a promoter operably linked to the nucleotide sequence of (iii) and acting on animal cells, preferably yeast cells, to form RNA molecules; And (iii) a recombinant expression vector comprising a 3'-non-detoxification site that acts on said animal cell, preferably a yeast cell, resulting in 3'-end polyadenylation of said RNA molecule.

Preferably, the above-described expression target material includes, but is not limited to, inactivated SSK2 or PPG1 gene, or PAM1 gene.

As used herein, the term "promoter" refers to a DNA sequence that regulates the expression of a coding sequence or functional RNA. In the synthetic expression vector of the present invention, the expression-coding nucleotide sequence is operably linked to the promoter. As used herein, the term “operatively linked” refers to a functional binding between a nucleic acid expression control sequence (eg, a promoter sequence, a signal sequence, or an array of transcriptional regulator binding sites) and another nucleic acid sequence. Thus, the regulatory sequence will control the transcription and / or translation of the other nucleic acid sequence.

When the vector of the present invention is a prokaryotic cell as a host, powerful promoters capable of promoting transcription (e.g., tac promoter, lac promoter, lac UV5 promoter, lpp promoter, p _L ^λ promoter, p _R ^λ promoter, rac 5 Promoters, amp promoters, recA promoters, SP6 promoters, trp promoters, T7 promoters, etc.), ribosomal binding sites for initiation of translation and transcription / detox termination sequences. Even more preferably, the host cell used in the present invention is E. coli , most preferably E. coli DH5α. In addition, when E. coli is used as the host cell, the promoter and operator site of the E. coli tryptophan biosynthetic pathway (Yanofsky, C., J. Bacteriol. , 158: 1018-1024 (1984)) and the leftward promoter of phage λ (p _L ^λ promoter, Herskowitz, I. and Hagen, D., Ann. Rev. Genet. , 14: 399-445 (1980)) can be used as regulatory sites. On the other hand, vectors that can be used in the present invention are plasmids (eg, pRS316, pSC101, ColE1, pBR322, pUC8 / 9, pHC79, pUC19, pET, etc.), phages (eg, λgt4λB, λ-Charon) which are often used in the art. , λΔz1, M13, etc.) or viruses (eg, SV40, etc.).

In addition, when the recombinant vector of the present invention is applied to eukaryotic cells, preferably yeast cells, the promoters that can be used are those capable of regulating the transcription of the expression target material of the present invention, promoters derived from yeast cells, mammals Promoters derived from animal viruses and promoters derived from genomes of mammalian cells, including, for example, the yeast ( G. cerevisiae ) GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) promoter, the yeast ( S. cerevisiae ) GAL1 to GAL10 promoters, yeast ( Pichia pastoris ) AOX1 or AOX2 promoter, CMV (cytomegalo virus) promoter, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, tk promoter of HSV, RSV promoter, EF1 alpha promoter, metallothionine promoter, beta Actin promoter, promoter of human IL-2 gene, promoter of human IFN gene, human IL-4 gene Promoter, one containing the promoter and the promoter of the human GM-CSF gene of the human lymphotoxin gene, and the like.

Preferably, the expression constructs used in the present invention comprise a polyaninylation sequence (eg, a glial growth hormone terminator and a SV40 derived poly adenylation sequence).

The method of carrying the vector of the present invention into a host cell may use various methods known in the art, for example, when the host cell is a prokaryotic cell, the CaCl ₂ method (Cohen, et al., Proc. Natl. Acac Sci. USA , 9: 2110-2114 (1973)), one method (Cohen, et al., Proc. Natl. Acac. Sci. USA , 9: 2110-2114 (1973); and Hanahan, J. Mol. Biol. , 166: 557-580 (1983)) and electroporation methods (Dower, et al., Nucleic. Acids Res. , 16: 6127-6145 (1988)) and the like. , Transduction, electroporation, lipofection, microinjection, particle bombardment, yeast globular / cell fusion used in YAC, agrobacterium used in plant cells Mediated transformation can be used.

According to a preferred embodiment of the present invention, the expression-encoding nucleotide sequence used in the present invention has a structure of “promoter-expression encoding nucleotide sequence-poly adenylation sequence”.

The vector system of the present invention may be constructed through various methods known in the art, and specific methods thereof are disclosed in Sambrook et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press (2001), This document is incorporated herein by reference.

The production of transformed yeast cells using the recombinant expression vector of the present invention can be carried out by gene transfer methods commonly known in the art. For example, electroporation, lithium acetate / DMSO method (Hill, et al., (1991), DMSO-enhanced whole cell yeast transformation. Nucleic Acids Res. 19, 5791), liposome-mediated transfer methods ( Wong, et al., 1980), retrovirus-mediated transfer method (Chen, et al., (1990), J. Reprod. Fert. 41: 173-182; Kopchick, et al., (1991) Methods for the introduction of recombinant DNA into chicken embryos.In Transgenic Animals, ed.NL First & FP Haseltine, pp. 275-293, Boston; Butterworth-Heinemann; Lee, M.-R. and Shuman, R. (1990) Proc. 4th World Congr. Genet. Appl. Livestock Prod. 16, 107-110) and the like, most preferably using the lithium acetate / DMSO method.

On the other hand, in order to use the expression target protein of the present invention as an active ingredient to introduce the gene should be able to effectively penetrate into the cell. For example, when using the above-described inactivated SSK2 or PPG1 protein or PAM1 protein as an active ingredient, attaching a protein transduction domain (PTD) to the inactivated SSK2 or PPG1 protein or PAM1 protein. desirable. That is, in order to introduce the inactivated SSK2 or PPG1 protein, or PAM1 protein of the present invention as an active ingredient into cells, a protein transduction domain (PTD) is fused with the protein to form a fusion protein. . The protein transport domain (PTD) mainly contains basic amino acid residues such as lysine / arginine, and serves to permeate the proteins fused therewith into the cell through the cell membrane. The protein transport domain (PTD) is preferably in the HIV-1 Tat protein, the homeodomain of the drosophila antennafedia, the HSV VP22 transcriptional regulator protein, the MTS peptide derived from vFGF, the penetratin, the transpotane or the Pep-1 peptide. Including but not limited to sequences derived.

The features and advantages of the present invention are summarized as follows:

(a) The present invention relates to ethanol- and heat-resistant transformed yeast strains comprising the inactivated SSK2 or PPG1 gene, or PAM1 gene and uses thereof.

(b) Yeast strains of the present invention are yeast strains that can grow in high concentration ethanol, preferably 12.5-15% ethanol, and can grow at high temperatures (eg, 42 ° C.).

(c) The yeast strains of the present invention possess high ethanol and heat resistance, so that ethanol can be produced more efficiently in a future integrated process.

1 is a diagram showing the transformation process of Saccharomyces cerevisiae L3262 using a yeast DNA library mutated by transposon.
Figure 2 is a growth assay result for investigating the ethanol- and heat-resistance of Saccharomyces cerevisiae transposon mutants. 2A is a growth assay result for investigating ethanol-resistance. 2B is a growth assay result for investigating heat-resistance.
3 is a diagram showing a transposon insertion position. Transposon insertion sites were determined through sequencing of transposons recovered from two ethanol- and heat-resistant strains. Peripheral genetic loci are shown.
4 is a result showing expression of genes affected by transposon. Northern blot analysis was performed using total RNA extracted from control L3262. Signals were relatively quantified using a scanning densitometer and normalized to ACT1 and presented as a% control.
5 is a growth assay result showing ethanol- and heat-resistance of SGKO mutants. FIG. 5A shows spotting SGKO mutants serially diluted 10-fold in YPD plates containing 0%, 10%, 12.5% and 15% ethanol, followed by 1 day (0%), 3 days (30%) at 30 ° C. %), 4 days (12.5%) or 5 days (15%). 5B shows the result of growing spotted YPD plates for 1 day (30 ° C.) or 3 days (43 ° C.).
6 is a growth assay result showing recovery of stress sensitivity by complementation. FIG. 6A shows that 10-fold serially diluted supplemented strains were spotted on YPD plates containing 0% and 10% ethanol and then grown at 30 ° C. for 1 day (0%) or 4 days (10%). to be. 6B is the result of growing spotted YPD plates for 1 day (30 ° C.) or 4 days (42 ° C.). Control strains were prepared by transforming pRS316 to Tn mutants.
7 shows the results of observing the effect of over-expression on stress sensitivity. FIG. 7A shows that over-expressing strains diluted 10-fold in succession were spotted on YPD plates containing 0% and 10% ethanol and then grown at 30 ° C. for 1 day (0%) or 4 days (10%). The result is. 7B shows the result of growing spotted YPD plates for 1 day (30 ° C.) or 4 days (42 ° C.). Control strains were prepared by transforming pRS316-GAPDH to L3262.
8 is a graph showing the fermentation profile of Tn mutants. Exponentially growing cells (0.5 OD ₆₀₀ ) were grown in YPD medium supplemented with 30% glucose and 6% ethanol at 30 ° C. Cell growth (FIG. 8A) and ethanol production (FIG. 8B) were monitored during fermentation. Similar experiments conducted in the absence of ethanol were conducted at 42 ° C. to monitor cell growth (FIG. 8C) and ethanol production (FIG. 8D) during fermentation. Symbol: L3262, empty triangle; Tn2, filled circle; And Tn3, filled rectangles.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Materials and Experiments

Strains, Media and Culture Conditions

The strains, disrupted genes and transposon-insertion sites in this study are listed in Table 1. Saccharomyces cerevisiae L3262 ( MAT-αura3-52 leu2-3,112 his4-34 : provided by Korea Research Institute of Bioscience and Biotechnology) was used as the host strain. Saccharomyces ceresevier was incubated at 30 ° C. in YPD medium (1% Bacteria yeast extract, 2% Bactobacillus peptone, 2% dextrose, w / v; Difco, MI). Saccharomyces cerevisiae transformants were transformed into SD-Leucine medium [0.67% Difco YNB (yeast nitrogen base; no amino acid), 2% glucose, 0.069% complete supplement mixture (CSM) -leu: MP, OH ). For plasmid construction, E. Coli DH5α (Stratagene, Calif.) was used as a host and incubated at 37 ° C in Luria-Bertani medium (LB): Difco, MI supplemented with 100 mg / l Ampicillin (Sigma-Aldrich, Mo.).

Transposon mutagenesis

Saccharomyces ceresevier genome library pool with mTn3- lacZ / LEU2 by random insertion of transposons was loaded into the Yale Genome Analysis Center, New Haven, CT: http://ygac.med. yale.edu/mtn/reagent ). Saccharomyces by digesting plasmid DNA extracted from mTn3-mutated genome library pool with Not I Serezivi was used for transformation of L3262. Yeast transformation was carried out by the lithium acetate method. Transformants were selected in SD-Leucine medium (FIG. 1).

Isolation of Ethanol- and Heat-resistant Mutants

For isolation of ethanol resistant mutants, transformants were plated in two pairs on YPD medium and YPD medium plates containing 10% ethanol and incubated at 30 ° C. for 2 days. Mutants were selected that could grow well in all media conditions. The mutants were then incubated at 42 ° C. for 4 days and well growing mutants were selected. To identify these mutants, the mutants were incubated in YPD medium to an OD ₆₀₀ value of 1 and then serially diluted 10-fold in sterile water. Aliquots (5 μl) of each dilution were plated on YPD agar plates free of ethanol or containing 10%, 12.5%, 15% ethanol and incubated at 30 ° C. or 42 ° C. for 3-6 days. Growth assays were performed in triplicates. Representative experimental results are presented. YPD agar plates containing 10%, 12.5% and 15% ethanol and mutants capable of growing well at 42 ° C. compared to the control strain were finally selected as ethanol- and heat-resistant mutants.

Identification of genes involved in the ethanol-resistant phenotype

The mTn3- lacZ / LEU2 insertion site was determined by plasmid rescuring using the lacZ sequence adjacent to the lacZ sequence in ethanol-resistant mutants. To introduce the origin of replication ( ori ), a plasmid designated as URA3 (recovery plasmid; pRSQ2-URA3, provided by Yale Genome Analysis Center) was used to recombine between plasmid-borne copies of the lacZ sequence and transposon-derived copies. Replaced by part of the transposon. Yeast DNA was recovered from these transformants and digested with appropriate enzymes ( EcoR I, Sal I, Hind III, Pst I or Kpn I). The cut fragments were then circularized to E. recovery from coli DH5α. The resulting plasmid was sequenced using lacZ primers complementary to the 5 'end of the transposon and the primer sequences used were as follows: 5'-GTTTTCCCAGTCACGAC-3'. The transposon-inserted genes were analyzed using a BLAST server ( http://www.yeastgenome.org/ ) of the Saccharomyces genome database.

Northern blot analysis

Total RNAs were extracted and used 15 μg. DNA fragments used as probes were prepared by PCR using appropriate gene-specific primers from L3263 genomic DNA. Purified PCR fragments were labeled with ³² P-dCTP (GE Healthcare, Buckinghamshire, UK) using random primers. The procedures were then performed as previously described (Adams, A., DE Gottschling, CA Kaiser, and T. Stearns. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (1997)). ACT1 was used as an internal control. Band intensities were quantified using NIH image J, version 1.61. Experiments for each gene were performed three times.

Gene Cloning and Analysis Methods

For overexpression experiments, open reading frames (ORFs) of the identified genes were cloned into glyceraldehyde 3-phosphate dehydrogenase (pRS316-GAPDH). For complementation experiments, ORFs fused with promoter and terminator sequences were subcloned into the pRS316 vector. Amplified products and vectors were digested with suitable restriction enzymes and then transformed into E. coli DH5α. The primer pairs used and the resulting plasmids are listed in Table 2. Clones were identified by sequencing and transformed into S. cerevisiae L3262 or the corresponding transposon mutants.

Genes were PCR-amplified by pfu DNA polymerase using genomic DNA prepared by standard protocols as a template (Adams, A., DE Gottschling, CA Kaiser, and T. Stearns.Methods in yeast genetics.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. (1997). PCR fragments were purified with QIAquick gel extraction kit (Qiagen, Valencia, CA). All PCR constructs were verified by sequencing. Due to the introns present in the middle of the ORF, the ORF of IMD4 was prepared via Reverse Transcription (RT) -PCR. Single-stranded cDNA was then synthesized by Avian Myeloblastosis virus (AMV) reverse transcriptase (Promega, Madson, WI) from isolated total RNA. 1 μg total RNA, 1 × reverse transcript buffer [10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100], 1 mM deoxynucleoside triphosphate (dNTPs), 0.5 unit of RNase inhibitor 20 μl reverse transcription reaction mixture containing 100 pmol / μl of specific downstream primer (IMD4-R; Table 1) and 15 units of AMV reverse transcriptase were reacted at 42 ° C. for 15 minutes and 5 minutes at 99 ° C. After the heat was applied, the reaction was carried out at 0-5 ° C. for 5 minutes. PCR conditions were performed as follows: denaturation at 95 ° C. for 3 minutes; Performing 35 cycles (one cycle consisting of denaturation at 95 ° C. for 1 minute, annealing at 65 ° C. for 1 minute, and extending at 72 ° C. for 2 minutes); And finally extending for 10 minutes at 72 ° C. Cell growth was measured at 600 nm using a Beckman DU730 spectrophotometer (Beckman Coulter, Fullerton, Calif.) And monitored by hemocytometry.

Fermentation

Exponentially growing cells were obtained and transferred to 100 ml of YPD30E6 [YP supplemented with 30% glucose and 6% (v / v) ethanol]. Starting cell density was adjusted to an OD ₆₀₀ value of 0.3. The cells were incubated at 30 ° C with shaking at 120 rpm. After samples were taken every 12 hours, cell growth and ethanol concentration were determined using cell density measurements and high-pressure liquid chromatography (HPLC), respectively. Samples were loaded on an Aminex HPX-87H column (Bio-Rad, Hercules, CA, USA) set at 60 ° C. Glucose and ethanol were eluted with 0.5 mM H ₂ SO ₄ at a flow rate of 0.6 ml / min. Peaks were detected by refractory index and identified according to retention time and quantified according to a standard curve. Cell growth was monitored by measuring optical density at 600 nm.

Experiment result

Selection of Ethanol-Resistant Mutants

About 3,000 transformants were selected as leucine prototrophs (FIG. 1) and plated in pairs on YPD medium plates containing YPD medium and 10% ethanol. About 40 mutants selected were incubated at 30 ° C. for 3 days and then the control strain (Saccharomyces). Mutants that grew well on YPD plates containing 10% ethanol as compared to L3262) were selected as ethanol-resistant strains. As a result of identifying 40 selected mutants, two mutants were finally selected as ethanol-resistant mutants and named Tn-2 and Tn-3. These mutants all grew well on YPD plates containing 10%, 12.5% or 15% ethanol compared to the control strain (FIG. 2A).

Selection of Ethanol and Heat-resistant Mutants

We investigated the growth of ethanol-resistant mutants at high temperature (42 ° C.). As can be seen in Figure 2b, two mutants (Tn-2 and Tn-3) were able to grow on 42 ° C. YPD plates compared to the control strain. Therefore, these two mutants could simultaneously resist both 15% ethanol stress and high temperature stress up to 42 ° C.

Identification of Transposon Insertion Sites in Resistant Mutants

Yeast chromosomal DNA adjacent to the transposon from each resistant mutant was recovered from E. coli and sequenced (Macrogen, Korea). The transposon insertion position and function of all identified genes are summarized in Table 1 and FIG. 3.

Identified genes that can give rise to ethanol- and heat-resistant phenotypes. Strain Destroyed genes Insertion position ^a function ^b Tn-2 YNR031C / SSK2
~
YNR032W / PPG1
-552 bp






-25 bp


SSK2: Interacts with Ssk1p, which phosphorylates Pbs2p with a mitogen-activated protein (MAP) kinase kinase kinase of the HOG1 mitogen-activated signaling pathway, resulting in autophosphorylation and activation of Ssk2p and recovery of actin cytoskeleton from osmotic stress ) Also mediates.
PPG1: A potential serine / threonine protein phosphatase required for glycogen accumulation, which interacts with Tap42p to bind and regulate other protein phosphatase. Tn-3 PAM1 778 bp PAM1: essential protein whose function is unknown; Various expression patterns during colony formation, and overexpression, allow survival even with protein phosphatase 2A deficiency, inhibit growth and induce fibrotic phenotype.

a: The insertion position is the position from the starting ATG of each coding sequence.

b: Comments in the Yeast Genome Database (YGD).

Identification of destroyed genes

The position at which the transposon was inserted was as follows: the promoter region of Tn2, SSK2 and the promoter region of PPG1; And Tn3, ORF site of PAM1. To determine the genes affected at Tn2 and to confirm their disruption at Tn3, expression levels of SSK2, PPG1 and PAM1 were examined via Northern blot analysis (FIG. 4). Compared to the control, the levels of SSK2 and PPG1 were about 20% and 50% lower, respectively, meaning that PPG1 was affected to a greater extent than SSK2. As expected, no expression of PAM1 was detected. Thus, transposon insertion partially affected the expression of SSK2 and PPG1 and completely inhibited the expression of PAM1.

Contribution to Ethanol- and Heat-Resistance

According to the above results, it was confirmed that SSK2 and PPG1 were simultaneously down-regulated at Tn2 and PAM1 was destroyed at Tn3. In order to determine the contributions to ethanol- and heat-resistance of down-regulation or deletion of SSK2, PPG1 and PAM1, single gene knockout in Saccharomyces cerevisiae in the BY4741 background SGKO) were individually examined using knock-out mutants for three genes obtained from a collection library. The library was kindly provided by Dr. Hur Won (Seoul National University, Seoul, Korea) and used to identify the genes identified. Saccharomyces cerevisiae BY4741 strain was the mother strain of the deletion mutants described above. When cultures of ssk2 , ppg1 and pam1 were spot- assayed on YPD plates containing 10%, 12.5% and 15% ethanol, the growth of all deletion mutants was examined in all ethanol investigated compared to the control BY4741 strain. Increased in concentration (FIG. 5A). When the spotted YPD plates were grown at 43 ° C., ssk2 , ppg1 and pam1 showed increased growth at temperatures where Tn2 and Tn3 could not grow (FIG. 5B). However, the mutants did not grow at 44 ° C. (results not shown). The difference of 1 degree at the maximum temperature for growth may be because BY4741 is a more heat-resistant strain than L3262 (no results shown). Therefore, SGKOs for SSK2, PPG1 and PAM1 exhibited heat-resistance as well as ethanol-resistance. It is important that down-regulation of SSK2 or PPG1, or both genes, imparted resistance to both ethanol and heat. The results mentioned above indicate that RNA expression levels and possibly protein levels (although not identified) are important for conferring ethanol- and heat-resistance.

Confirmation of resistance by supplementation

The fact that Tn2 and Tn3 acquire ethanol- and heat-resistance through the deletion or simultaneous down-regulation of certain genes means that the supplementation of the genes described above can be represented by the cell's sensitivity to the stress. To confirm this consideration, amplified DNA fragments containing the promoter, ORF and terminator (ORF + / 700 bp) were cloned into the pRS316 vector and transformed into the corresponding Tn2 and Tn3 mutants so that each gene was autonomously. Expressed as. Controls were constructed by transforming the pRS316 vector. When the spot assay was performed on YPD agar containing 10% ethanol, the resistance of supplemented cells was significantly reduced compared to Tn mutants (FIG. 6A). Reduced heat-resistance was observed when Tn2 individually supplemented with SSK2 or PPG1 and Tn3 supplemented with PAM1 were incubated at 42 ° C. (FIG. 6B).

Oligonucleotides Used in the Study. Oligonucleotides Sequence (5 '-> 3') Over-expression Experiment SSK2-F
SSK2-R
PPG1-F
PPG1-R
PAM1-F
PAM1-R CGC GGATCC ATGTCGCATTCAGACTACTTC
CGG GTCGAC CTACTCTCTTTCCTCAGTATC
CGC GGATCC ATGGAATTGGACGAATGT
CGG GTCGAC CTACAAGAAGTAATCAAC
CGC GGATCC ATGACATCTGCATTAAGG
CGG GTCGAC AAAGACAAGGGCTCGCGT Complementation experiment SSK2-FU
SSK2-RL
PPG1-FU
PPG1-RL
PAM1-FU
PAM1-RL C GCGGCCGC CATGCATATCCCCCACGACTG
CGG GTCGAC AGCCAACCGCCTCTCAAT
CGC GGATCC CGCCCTAAACTTTCCGACCTT
CGG GTCGAC TCCTGGGCCAACAACGATAGC
CGC GGATCC CAAGATGAAACGCGCTGTATG
CGG GTCGAC CTTCGGCAACGTTTTCAATGG

* Underlined sequences are restriction enzyme positions.

The fact that simultaneous down-regulation of SSK2 (up to 20%) and PPG1 (up to 50%) confers heat-resistance as well as ethanol resistance may suggest that stress resistance is important for the expression level of specific gene (s). . To this end, the ORF of each gene was PCR-amplified and cloned into the overexpression pRS316-GAPDH vector and transformed with L3262 strain. The pRS316-GAPDH vector was transformed as a control. When spot assays on ethanol (FIG. 7A) and heat (FIG. 7B) were performed, the overexpressed strains were generally more sensitive to both ethanol and heat than to the control, which was responsible for ethanol- and / or heat-sensitivity. Means a dose effect.

Fermentation Ability of Tn Mutants

In general, ethanol-resistant cells are known to produce more ethanol than non-resistive strains because of their high cell viability at high concentrations of ethanol. When fermentation capacity was examined at 30 ° C. in a batch culture containing 30% glucose, no significant differences were found between the control strain and the mutants despite the increased growth of the mutants (about 20%). Did not show results. The control strain is basically capable of producing up to 9% ethanol from 30% glucose, which is hardly seen as an effect of increased ethanol resistance. Thus, it was necessary to establish conditions where the final ethanol titer was greater than 9%. In this regard, we started fermentation in a culture medium containing 6% ethanol and starting cells with an OD ₆₀₀ value of 0.5. As can be seen in Figures 9A and 9B, Tn mutants grew faster and produced more ethanol compared to the control (Figures 8A and 8B). Among them, Tn2 was confirmed to be the most efficient strain for producing ethanol. Thus, the ethanol production efficiency of Tn2 was improved by 22% compared to the control.

The inventors investigated the ethanol production capacity of the heat-resistant strains Tn2 and Tn3 at 42 ° C. Since ethanol evaporation at this temperature may affect the final titer, the amount of ethanol evaporated during batch fermentation was calculated according to a calibration curve made with 4-10% ethanol as standard (Abdel-Banat, et al. , 2010). When the concentration of ethanol was 4%, it evaporated slowly, whereas when it exceeded 4%, it evaporated rapidly. For example, 8% ethanol decreased to 3.7% on day 2 and 10% ethanol decreased even more significantly (no results shown). When the fermentation profile was calculated at 42 ° C., Tn2 and Tn3 grew faster than the control (FIG. 8C). Tn2 and Tn3 showed about 1.6 times higher ethanol production than the control group (FIG. 8D). Due to heat evaporation and impaired growth, the concentration of ethanol continued to decrease after 3 days.

Additional discussion

In yeast and other organisms, most intracellular pathways for stress are reprogrammed with many genes that are regulated (K, 2005). Although a large number of related genes have been identified to date, little is known about how resistance to many stressors, including ethanol and heat, is obtained in terms of signaling pathways. In general, it is accepted that the mechanism of ethanol- or heat-resistance is very complex and globally regulated and needs to be understood through a comprehensive view of the pathways involved (Ma, et al. , 2010; Yoshikawa, et al. , 2009). Both ethanol and heat stress similarly alter cell membrane lipid composition (Okuyama, et al. , 1979; Suutari, et al. , 1994) and encode cell membrane H ⁺ -ATPase activity (Coote, et al. , 1994) heat shock proteins . Reduce up-regulation of genes (Ma, et al. , 2010). The above results indicate that the pathways necessary for ethanol-resistance overlap the pathways necessary for heat-resistance. However, strains produced based on genome-wide analysis showed only ethanol- or heat-resistance (Teixeira, et al. , 2009; Yoshikawa, et al. , 2009). In this study, we screened 3,000 transposon-mediated disruption mutations to isolate five strains with increased resistance to ethanol. Later, two mutations were found to have increased resistance to heat. The two strains will be useful for explaining possible interconnections between ethanol-resistance and heat-resistance.

We identified three genes responsible for increased ethanol-resistance (SSK2, PPG1 and PAM1) and confirmed that they had increased heat-resistance through the combination of transposon mutagenesis and SGKO mutants. In addition, down-regulation of SSK2 and / or PPG1 conferred resistance to both ethanol and heat. As can be seen in FIG. 4, the transposon was inserted at the expected regulatory site of the affected genes. This means that the library generated by transposon mutagenesis consists of more than 4,500 clones, which in theory is similar to the number of clones contained in the SGKO library that only affects ORFs. In this study, we isolated five strains (Tn1-5) with increased ethanol resistance using a library of 3,000 clones that was less than the theoretically required number of clones. Thus, if screening libraries containing appropriate clone counts, it would be possible to isolate a larger number of strains with increased resistance. Isolation of Tn2, indicating down-regulation of affected genes, would not have been possible using the SGKO library, but not the transposon insertion method. To our knowledge, our study was the first to identify that RNA level is a determinant for ethanol- and / or heat-resistance.

In the case of down-regulated Tn2, we could not determine whether the gene was actually responsible for stress resistance due to the absence of a strain in which only one gene was down-regulated.

SSK2 encodes the mitogen-activated protein kinase kinase kinase (MAPKKK) of the HOG1 pathway (Posas, et al. , 1998), which is essential for yeast survival against a variety of environmental stresses, including hyperosmotic pressure (Albertyn, 1994; Brewster, et al. , 1993). The HOG1 pathway is regulated independently of each other by two membrane-bound osmosensor proteins, Sln1p and Sho1p. Signals generated by Sln1p are delivered to S or 2p, while signals generated by Sho1p are directed to Ste11p, which is MAPKKK, and then the two pathways merge into downstream Pbs2p (Winkler, et al. , 2002). . The inclusion of SSK2 in ethanol stress is rarely described. Heat stress, on the other hand, involves the SHO1 pathway independent of SSK2 (Winkler, et al. , 2002). In view of the above, the main concern is how destruction of SSK2 induces ethanol- and heat-resistance. Our hypothesis is that blocking of the SLN1 pathway caused by SSK2 disruption increases the signaling function of the SHO1 pathway, another pathway to heat. Whether ethanol resistance is mediated by the SHO1 pathway would be an interesting topic. PPG1 encodes a potential serine / threonine protein phosphatase required for glycogen accumulation (Posas, et al. , 1993). Glycogen biosynthesis genes are highly expressed in response to ethanol shock (Hirasawa, et al. , 2007). Since the relevant data for PPG1 are not presented in this study, it is premature to take into account inconsistencies with the inventors' data that destruction of PPG1 confers resistance to both ethanol and heat.

Knock-out of PAM1 conferred resistance to both ethanol and heat. PAM1 encodes an essential protein of unknown function, which is presumably a protein phosphatase 2A multicopy suppressor. Over-expression of this gene causes a fibrous phenotype by inhibiting growth and disrupting regulatory pathways regulating cell morphology (Hu, et al., 1994). So far, there is no evidence that the genes described above are associated with stress resistance.

The study revealed three genes responsible for increased ethanol- and heat-resistance (SSK2, PPG1 and PAM1). There has been no report showing the above phenotype. The interrelationship between the aforementioned hereds could not be inferred from the annotated functions. However, SSK2 is known to be involved in the cellular pathway, which may help understand molecular mechanisms involved in ethanol and heat resistance. In addition, research on SSK2, PPG1 and PAM1 may help to understand at the molecular level how ethanol- and heat-resistance can be obtained simultaneously.

In conclusion, one of the aims of developing strains with increased resistance to ethanol and heat stress is to provide information on industrial applications in addition to understanding the mechanisms involved in resistance to stress. The novel genes identified in this study will be useful for improving industrial yeast strain in terms of ethanol production capacity. In addition, this study demonstrated that transposon mutagenesis is particularly useful for the identification of genes whose expression levels are resistance determinants.

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that such a specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

references

Abdel-Banat, BM, H. Hoshida, A. Ano, S. Nonklang, and R. Akada. 2010.High-temperature fermentation: how can process for ethanol production at high temperatures become superior to the traditional process using mesophilic yeast? Appl. Microbiol. Biotechnol. 85: 861-867 (2010).

Albertyn, J., S. Hohmann, JM Thevelein, and BA Prior. GPD1, which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolarity glycerol response pathway. Mol. Cell. Biol. 14: 4135-4144 (1994).

Alper, H., J. Moxley, E. Nevoigt, GR Fink, and G. Stephanopoulos. Engineering yeast transcription machinery for improved ethanol tolerance and production. Science , 314: 1565-1568 (2006).

Araki, Y., H. Wu, H. Kitagaki, T. Akao, H. Takagi, and H. Shimoi. Ethanol stress stimulates the Ca ²⁺ -mediated calcineurin / Crz1 pathway in Saccharomyces cerevisiae. J. Biosci. Bioeng. , 107: 1-6 (2009).

Auesukaree, C., et al. , Genome-wide identification of genes involved in tolerance to various environmental stresses in Saccharomyces cerevisiae. J Appl Genet , 50 (3): 301310 (2009).

Brewster, JL, T. de Valoir, ND Dwyer, E. Winter, and MC Gustin. An osmosensing signal transduction pathway in yeast. Science , 259: 1760-1763 (1993).

Casey, GP, et al. , ETHANOL TOLERANCE IN YEASTS. Critical Reviews in Microbiology , Vol 13 (3): 219-280 (1986).

Coote, PJ, MV Jones, IJ Seymour, DL Rowe, DP Ferdinando, AJ McArthur, and MB Cole. Activity of the plasma membrane H ⁺ -ATPase is a key physiological determinant of thermotolerance in Saccharomyces cerevisiae. Microbiology , 140: 1881-1890 (1994).

Edgardo, A., P. Carolina, R. Manuel, F. Juanita, and B. Jaime. Selection of thermotolerant yeast strains Saccharomyces cerevisiae for bioethanol production. Enzyme Microb. Technol. 43: 120-123 (2008).

Fujita, K., A. Matsuyama, A. Kobayashi, and H. Iwahashi. The genome-wide screening of yeast deletion mutants to identify the genes required for tolerance to ethanol and other alcohols. FEMS Yeast Res. , 6: 744-750 (2006).

Hirasawa, T., et al. , Identification of target genes conferring ethanol stress tolerance to Saccharomyces cerevisiae based on DNA microarray data analysis. Journal of Biotechnology , 131: 3444 (2007).

Hou, L. Improved production of ethanol by novel genome shuffling in Saccharomyces cerevisiae. Appl. Biochem. Biotechnol. 160: 1084-1093 (2010).

Hu, GZ, and H. Ronne. Overexpression of yeast PAM1 gene permits survival without protein phosphatase 2A and induces a filamentous phenotype. J. Biol. Chem. 269: 3429-3435 (1994).

Inoue, T., et al. , Cloning and Characterization of a Gene Complementing the Mutation of an Ethanol-sensitive Mutant of Sake Yeast. Biosci. Biotechnol. Biochem. , 64 (2): 229-236 (2000).

Kajiwara, S., et al. , Overexpression of the OLE1 gene enhances ethanol fermentation by Saccharomyces cerevisiae. Appl Microbiol Biotechnol , 53: 568-574 (2000).

Kim, J., et al. , Disruption of the Yeast ATH1 Gene Confers Better Survival after Dehydration, Freezing, and Ethanol Shock: Potential Commercial Applications. APPLIED AND ENVIRONMENTAL MICROBIOLOGY , Vol 62 (5): 15631569 (1996).

Kubota, S., I. Takeo, K. Kume, M. Kanai, A. Shitamukai, M. Mizunuma, T. Miyakawa, H. Shimoi, H. Lefuji, and D. Hirata. Effect of ethanol on cell growth of budding yeast: genes that are important for cell growth in the presence of ethanol. Biosci. Biotechnol. Biochem. 68: 968972 (2004).

K, D. Molecular and evolutionary basis of the cellular stress response. Annu. Rev. Physiol. 67: 225 257 (2005).

Lynd, LR, WH van Zyl, JE McBride, and M. Laser. Consolidated bioprocessing of cellulosic biomass: an update. Curr. Opin. Biotechnol. , 16: 577-583 (2005)

Ma, M., and ZL Liu. Mechanisms of ethanol tolerance in Saccharomyces cerevisiae . Appl. Microbiol. Biotechnol. 87: 829-845 (2010).

Mobini-Dehkordi, M., I. Nahvi, H. Zarkesh-Esfahani, K. Ghaedi, M. Tavassoli, and R. Akada. Isolation of a novel mutant strain of Saccharomyces cerevisiae by an ethyl methane sulfonate-induced mutagenesis approach as a high producer of bioethanol. J. Biosci. Bioeng. 105: 403-408 (2008).

Okuyama, H., and M. Saito. Regulation by temperature of the chain length of fatty acids in yeast. J. Biol. Chem. , 254: 12281-12284 (1979).

Posas, F., J. Clotet, MT Muns, J. Corominas, A. Casamayor, and J. Arino. The gene PPG encodes a novel yeast protein phosphate involved in glycogen accumulation. J. Biol. Chem. 268: 1349-1354 (1993).

Posas, F., and H. Saito. Activation of the yeast SSK2 MAP kinase kinase kinase by the SSK1 two-component response regulator. EMBO J. , 17: 1385-1394 (1998).

Sanchez, Y., et al. , Hsp104 is required for tolerance to many forms of stress. EMBO J. , 11 (6): 23572364 (1992).

Schubert, C. Can biofuels finally take center stage? Nat. Biotechnol. 24: 777-784 (2006).

Shimoda, C., A. Itadani, A. Sugino, and M. Furusawa. Isolation of thermotolerant mutants by using proofreading-deficient DNA polymerase as an effective mutator in Saccharomyces cerevisiae. Genes Genet. Syst. , 81: 391-397 (2006).

Sridhar, M., N. Kiran Sree, and L. Venkateswar Rao. Effect of UV radiation on thermotolerance, ethanol tolerance and osmotolerance of Saccharomyces cerevisiae VS1 and VS3 strains. Bioresource Technol. 83: 199-202 (2002).

Stanley, D., S. Fraser, PJ Chambers, P. Rogers, and GA Stanley. Generation and characterization of stable ethanol-tolerant mutants of Saccharomyces cerevisiae. J. Ind. Microbiol. Biotechnol. 37: 139-149 (2010).

Suutari, M. and S. Laakso. Microbial Fatty Acids and Thermal Adaptation. Critical Reviews in Microbiology , 20 (4): 255-328 (1994).

Takagi, H., M. Takaoka, A. Kawaguchi, and Y. Kubo. Effect of L-proline on sake brewing and ethanol stress in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 71: 8656-8662 (2005).

Takahashi, T., H. Shimoi, and K. Ito. Identification of genes required for growth under ethanol stress using transposon mutagenesis in Saccharomyces cerevisiae. Mol. Genet. Genomics , 265: 1112-1119 (2001).

Teixeira, MC., Et al. , Genome-Wide Identification of Saccharomyces cerevisiae Genes Required for Maximal Tolerance to Ethanol. APPLIED AND ENVIRONMENTAL MICROBIOLOGY , Vol 75 (18): 57615772 (2009).

van Voorst, F., J. Houghton-Larsen, L. Jønson, MC Kielland-Brandt, and A. Brandt. 2006. Genome-wide identification of genes required for growth of Saccharomyces cerevisiae under ethanol stress. Yeast , 23: 351-359 (2006).

Weber, C., A. Farwick, F. Benisch, D. Brat, H. Dietz, T. Subtil, and E. Boles. Trends and challenges in the microbial production of lignocellulosic bioalcohol fuels. Appl. Microbiol. Biotechnol. 87: 1303-1315 (2010).

Winkler, A., C. Arkind, CP Mattison, A. Burkholder, K. Knoche, and I. Ota. Heat stress activates the yeast high-osmolarity glycerol mitogen-activated protein kinase pathway, and protein tyrosine phosphatases are essential under heat stress. Eukaryot. Cell , 1: 163-173 (2002).

Yazawa, H., H. Iwahashi, and H. Uemura. Disruption of URA7 and GAL6 improves the ethanol tolerance and fermentation capacity of Saccharomyces cerevisiae. Yeast , 24: 551-560 (2007).

Yoshikawa, K., et al. , Genome-Wide Analysis of the Effects of Location and Number of Stress Response Elements on Gene Expression in Saccharomyces cerevisiae. JOURNAL OF BIOSCIENCE AND BIOENGINEERING , vol 106 (5): 507-510 (2008).

Yoshikawa, K., T. Tadamasa, C. Furusawa, K. Nagahisa, T. Hirasawa, and H. Shimizu. Comprehensive phenotypic analysis for identification of genes affecting growth under ethanol stress in Saccharomyces cerevisiae. FEMS Yeast Res. 9: 32-44 (2009).

You, KM, et al. , Ethanol Tolerance in the Yeast Saccharomyces cerevisiae Is Dependent on Cellular Oleic Acid Content. APPLIED AND ENVIRONMENTAL MICROBIOLOGY , Vol 69 (3): 14991503 (2003).

Attach an electronic file to a sequence list

Claims (17)

Ethanol- and heat-resistant transformed yeast strains comprising the inactivated SSK2 gene.
The yeast strain of claim 1, wherein the inactivation of the SSK2 gene is induced by transposon.
The yeast strain according to claim 1, wherein the yeast strain can grow under 5-15% ethanol culture conditions.
4. The yeast strain according to claim 3, wherein the yeast strain can grow under 12.5-15% ethanol culture conditions.
According to claim 1, wherein the yeast strain is characterized in that the yeast strain can grow at 30-43 ℃ temperature conditions.
According to claim 1, wherein the yeast strain Saccharomyces spp ( Saccharomyces spp.), Schizosaccharomyces spp., Pichia spp., Paffia spp. , Cluj Vero MRS species (Kluyveromyces spp.), Candida species (Candida spp.), Tallahassee in MRS species (Talaromyces spp.), Brescia Gaetano MRS species (Brettanomyces spp.), Parkinson solren species (Pachysolen spp.) or Deva Rio Yeast strain, characterized in that the yeast strain Debaryomyces spp.
7. The yeast strain according to claim 6, wherein the yeast strain is Saccharomyces species.
delete delete delete delete delete delete delete The ethanol production method comprising the step of culturing the yeast strain of claim 1 in a culture medium comprising one or more substrates that can be metabolized to ethanol.
16. The method of claim 15, wherein the substrate capable of metabolizing ethanol comprises C6 sugars.
The method of claim 16, wherein the C6 sugar is glucose.

Images