KR20110090537A - Activation method for natural killer cell via regulating microrna expression - Google Patents

Abstract

PURPOSE: A method for activating NK cells using a composition is provided to negatively control target cytocidability of NK cells. CONSTITUTION: A method for preparing NK cells with enhanced cytotoxicity comprises a step of transducing an expression vector to NK cells under in vitro condition. The expression vector contains a nucleic acid sequence encoding miR-27a* inhibitor having a base sequence of sequence number 17. The method additionally comprises a step of confirming increase of Prf1 and GzmB protein expression in the NK cells. A pharmaceutical composition for preventing or treating cancer contains the NK cells with enhanced cytotoxicity as an active ingredient.

Description

Activation method for Natural killer cell via regulating microRNA expression

The present invention relates to anticancer agents that regulate protein expression.

Among the cells constituting the immune system, NK cells (natural killer cells, hereinafter abbreviated as NK cells) have been extensively studied because their ability to kill cancer cells has been unspecifically identified. the breast (breast Cancer Res . Treat . , 66: 255-263, 2003), Melanoma Res ., 13: 349-356, 2003), Lung Cancer Cancer , 35: 23-18,2002). Based on these studies, NK cell therapy using NK cells for cancer treatment is emerging. To date, the focus is mainly on developing techniques for understanding and regulating signaling mechanisms in a variety of processes, such as priming, activation, immune synapse formation, and trafficking. lost. Efficient immune cell therapy using NK cells is an urgent need to identify new mechanisms that regulate NK cell cytotoxicity, as well as existing techniques, and to search for new molecules that regulate it.

NK cells play an important role in the innate immune response and the adaptive immune response through cytokine secretion against host-infected pathogens or cancers.Nat Immunol ., 9: 495-502, 2008;Nat Immunol, 9: 486-494, 2008;Annu Rev Immunol., 22: 405-429, 2004;Immunity 26: 798-811, 2007). The main mechanism NK cells use to kill target cells is to secrete cell lytic granules, such as perforin and granzyme B, to the target cells via immune synapse. (Immunity 26: 798-811, 2007). Secreted perforin makes pores in the target cell wall, and granzyme entering the target cells through the pores causes apoptosis of the target cells (I Voskoboiniket al ., Nat Rev Immunol ., 6: 940-952, 2006). In addition, NK cells have the ability to produce and secrete IFN-γ. IFN-γ plays an important role in activating macrophages, is a link from the innate immune response to an acquired immune response, and is a cytokine that inhibits the proliferation of cancer cells and virus-infected cells (CA Biron).et al ., Annu Rev Immunol ., 17: 189-220, 1999). In order for NK cells to have this capability, priming is required before they encounter target cells. Therefore, primary cultured NK cells isolated from mouse and human are significantly reduced cancer cell killing ability and IFN-γ production ability. IL-2 and IL-15 are differentiation stimulating cytokines that can maximize the ability of these NK cells, and IL-15 has been reported to be an essential cytokine for NK cell activity (M Lucas).et al ., Immunity, 26: 503-517, 2007). Therefore, it is important to search for molecules that regulate the expression of Prf1 and Gzms, which are effector molecules essential for cytotoxicity of NK cells.

MicroRNA is a primary miRNA made by two types of ribonuclease called Dicer1 in the cytoplasm and Drosha in the nucleus. It is a small untranslated RNA (19-22 nt). Matured miRNAs in animal cells create RNA-induced silencing complexes at the 3 'untranslated sites (UTRs) of specific target mRNAs, resulting in decreased gene expression due to target mRNA degradation or translational suppression of target proteins ( Nat Rev Immunol . , 8: 120-130, 2008; Cell 136: 26-36, 2009; J Exp Med . , 205: 585-594, 2008).

The association of miRNAs in immune response and hematopoietic differentiation from hematopoietic stem cells is reported by Argonaute ( Genes Dev . , 21: 1999-2004, 2007), Drosha ( Exp Med ., 205: 2005-2017, 2008), Dicer ( J Exp Med ., 203: 2519-2527, 2006; J Exp Med . , 202: 261-269, 2005; J Exp Med ., 205: 1993-2004, 2008), has been widely identified through the lack of molecules involved in miRNA synthesis or regulation of specific miRNA levels. These results support that miRNA plays an important role in immune cell differentiation and function ( Nat Rev Immunol . , 8: 120-130, 2008; Cell 136: 26-36, 2009; Nat Immunol ., 9: 839 145, 2008). However, the biological significance of miRNAs in NK cells is not clear. The application of NK cell therapies has led to the discovery of new target molecules that regulate the cytotoxicity of NK cells ( Nat Immunol ., 9: 486-494, 2008; Nat Rev Immunol ., 7: 329-339, 2007).

Thus, the present inventorsin vitroHuman miR-27a^*Specifically binds to the 3'UTR sequences of Prf1 and GzmB, which are closely related to the cytotoxicity of NK cells, thereby reducing the amount of target protein expression.in vivoMiR-27a in xenograft model mice artificially induced human cancer^*MiR-27a by confirming that the size of the cancer rapidly increased or decreased due to the injection of NK cells that increased or inhibited the expression of^* The present invention was completed by activating NK cells through inhibitors and revealing that cancer can be treated using the same.

The present invention intends to apply a microRNA as a new target molecule of anticancer immune cell therapy by identifying a mechanism of regulating cytotoxicity of NK cells by regulating expression of Prf1 and GzmB, which are target proteins of MicroRNA-27a ^* .

In order to achieve the above object, the present invention comprises the step of transducing the expression vector containing the nucleic acid sequence encoding the inhibitor of miR-27a ^* having a nucleotide sequence set forth in SEQ ID NO: 17 to NK cells under in vitro conditions To provide a method for producing NK cells with increased cytotoxicity.

The present invention also includes transducing an NK cell under in vitro conditions with an expression vector comprising the nucleic acid sequence set forth in SEQ ID NO: 37 or SEQ ID NO: 40 comprising a mutation at a site to which miR-27a ^* binds. It provides a method for producing NK cells with increased cytotoxicity.

In addition,

1) treating the test compound to a cell expressing miR-27a ^* ;

2) measuring the expression level of miR-27a ^* in the treated cells of step 1); And,

3) provides a method for screening an anticancer agent comprising the step of selecting a test compound having a reduced expression level of miR-27a ^* in step 2) compared to a control.

The present invention also provides NK cells activated by the above method.

The present invention also provides a pharmaceutical composition for preventing or treating cancer containing the NK cells as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for NK cell activation containing an inhibitor of miR-27a ^* having the nucleotide sequence set forth in SEQ ID NO: 17 as an active ingredient.

In the present invention, it was confirmed that the expression of Prf1 and GzmB protein regulated by the miR-27a ^* in NK cells, and when the inhibiting miR-27a ^* The expression of increased expression of Prf1 and GzmB protein, as well as in vitro in vivo In addition, since the activity of natural killer cells was confirmed to increase, miR-27a ^* inhibitors can be usefully used as a pharmaceutical composition for NK cell activation, NK cells activated with the composition is useful for the prevention or treatment of cancer Can be used.

Figure 1a is a human mNK cells treated with IL-15 (30 ng / ㎖), and then the Prf1 and GzmB protein expression level is plotted via immunoblot, and the ratio shown in the bar graph,
Figure 1b is treated with IL-15 (30 ng / ㎖) to human mNK cells, the cells are recovered and graphically measured by cytotoxicity through Cr release assay,
FIG. 1C is a graph showing the amount of Prf1 and GzmB mRNA expression through real-time qPCR after treatment of human mNK cells with IL-15 (30 ng / ml),
FIG. 1D shows the mRNA expression level of IFN-γ as a white bar graph through real-time qPCR after treatment of human mNK cells with IL-15 (30 ng / ml), and shows the amount of IFN-γ protein released from the cell. It is represented by black bar graph through ELISA,
Figure 1e shows the mRNA expression levels of Prf1, GzmB, GzmA, GAPDH and IFN-γ through microarray signal intensity (mean ± SD) using Agilent Human whole genome 4 × 44K gene-expression microarray in NK cells without cytotoxicity. Notation,
FIG. 1F shows that human mNK cells were treated with IL-15 (30 ng / ml) for 24 hours, followed by semi-quantitative PCR, mRNA expression levels of Prf1, GzmB, GzmA and GAPDH (top), and immunoblot. Shows protein expression levels of Prf1, GzmB, GzmA and GAPDH (bottom),
Figure 2a is treated with IL-15 (30 ng / ㎖) for 24 hours in human mNK cells, and then transduced with a control siRNA (Consi) or Dicer1 siRNA through the immunoblot Dicer1, Prf1, GzmB, GzmA and GAPDH Shows the amount of protein expression,
Figure 2b is treated with IL-15 (30 ng / ㎖) in human mNK cells, and then transduced with a control siRNA or Dicer1 siRNA and incubated for 24 hours after Dicer1, Prf1, GzmB, GzmA and GAPDH through real-time qPCR MRNA expression level of the bar graph
Figure 2c is treated with IL-15 (30 ng / ㎖) in human mNK cells, and then transduced with a control siRNA or Dicer1 siRNA and cultured for 24 hours, the cells were recovered by measuring the cytotoxicity through Cr release analysis As a line graph,
Figure 3a is a line graph of the expression level of miRNAs (miR-15a, miR-204, miR-27a ^* ) over time through real-time qPCR treatment by treating IL-15 (30 ng / ㎖) to human mNK cells Shown,
Figure 3b shows the portion of the miRNAs (miR-15a, miR-204, miR-27a ^* ) is expected to bind to the 3'UTR portion of the target proteins Prf1 and GzmB,
Figure 3c shows the miRNAs (miR-15a, miR-204, miR-27a ^* ) transduced in human mNK cells to regulate the expression of Prf1 and GzmB protein, the target proteins Prf1, GzmB, GAPDH It shows the protein expression level of the (top), the cells were recovered and the cytotoxicity was measured by Cr release analysis as a bar graph (bottom),
Figure 3d shows the expression level of the Prf1, GzmB, GAPDH through the immunoblot to see the expression of the target proteins Prf1 and GzmB protein by transducing miRNAs (miR-27a ^* ) to human mNK cells (top), MiRNAs (miR-27a ^* ) inhibitors were introduced into human mNK cells to show the expression levels of Prf1, GzmB, and GAPDH through immunoblot (bottom) to see the expression of Prf1 and GzmB proteins, the target proteins (bottom).
3E shows that miRNAs (miR-27a ^* ), miRNAs (miR-27a ^* ) inhibitors, and control miRNAs (Ctrl-miR) transduced in human mNK cells are NK cell target proteins without affecting cytotoxicity of NK cells. In order to control the expression of Prf1 and GzmB proteins, the immunoblot shows the amount of protein expression of Prf1, GzmB, p-ERK, ERK and GAPDH (top), and the expression of IFN-γ is expressed as a bar graph by ELISA. (Bottom), cells were collected and the cytotoxicity was measured by Cr release assay (bottom).
Figure 4a shows the nucleotide sequence of the miR-27a ^* and the mutated (M) nucleotide sequence to the 3'UTR portion of the target proteins Prf1 and GzmB, miRNAs (miR-27a ^* ), miR-27a miR-27a ^* the region (WT), combine the deletion region (D1 and D2) portion of stably binding to a target portion of the 3'UTR of the protein, and Prf1 GzmB of ^*, a part that combines mutation site ( M) (bottom),
Figure 4b is a site (WT) that miR-27a ^* stably binds to the 3'-UTR portion of the target proteins Prf1 and GzmB of miR-27a ^* to the pcAANAT reporter vector (D1 and sequential deletion of 3'-UTR D2) shows a form in which the binding site is mutated (M),
Figure 4c shows the transduction of miR-27a ^* and miR-27a ^* or miR-27a ^* inhibitors at the same time where miR-27a ^* is stably bound to the 3′-UTR moiety of Prf1 and GzmB bound to the pcAANAT reporter vector in HEK293T cells. Then, to see the expression level of the reporter gene AANAT, the expression level of the AANAT and GAPDH proteins was expressed through an immunoblot (top), and the amount of AANAT mRNA expression was represented by the bar graph through the real-time qPCR (bottom).
FIG. 4D shows miR-27a ^* stable binding sites (WT) or sites where binding sites are deleted (D1 and D2) and miR to 3'-UTR moieties of Prf1 and GzmB bound to pcAANAT reporter vectors in HEK293T cells Simultaneous transduction of -27a ^* followed by immunoblot showing the expression levels of AANAT and GAPDH proteins in the immunoblot (top) and the bar graph (middle) Real-time qPCR shows the AANAT mRNA expression in a bar graph (bottom),
FIG. 4E shows the miR-27a ^* or miR-27a ^* mutations in the mutated site (M) where miR-27a ^* is stably bound to 3′-UTR moieties of Prf1 and GzmB bound to the pcAANAT reporter vector in HEK293T cells. Simultaneously transduction, the expression of AANAT and GAPDH protein was expressed through an immunoblot to see the expression level of the reporter gene AANAT,
Figure 5a is treated with a control miRNA (Ctrl-miR), miR-27a ^* or miR-27a ^* inhibitor (inhi) to NK cells in the absence of IL-15 immunization to see the protein expression levels of Prf1 and GzmB The blot shows the protein expression levels of Prf1, GzmB, and GAPDH (top), and the cells are recovered and the cytotoxicity is measured by Cr release assay (bottom).
FIG. 5b shows that IL-15 was treated in human mNK cells by concentration (0, 30, 60 ng / ml) for 6 hours, and then miR-27a ^* expression was expressed by histogram through miRNA PCR (FIG. Top) shows histograms of mRNA expression levels of Prf1 and GzmB through real-time qPCR (bottom),
FIG. 5C shows that human mNK cells were treated with IL-15 at different concentrations (0, 30, 60 ng / ml) for 6 hours, and then the protein expression levels of Prf1 and GzmB were analyzed by immunoblot for Prf1, GzmB and GAPDH. It shows the protein expression level (top), and recovered the cells and measured the cytotoxicity through Cr release assay as a bar graph (bottom),
FIG. 5D shows the expression levels of Prf1, GzmB, and GAPDH in human mNK and NK92 cells with IL-15 (30 ng / ml) for 6 hours, followed by immunoblot of the expression levels of Prf1 and GzmB. (Top) shows the mRNA expression levels of Prf1, GzmB and GAPDH through semi-quantitative PCR (middle), miR-27a ^* expression is indicated by the histogram via miRNA PCR (bottom),
Figure 6a shows the primary NK cells extracted from umbilical cord blood (UCB) derived from human umbilical cord (CDB) and CD16 marker markers of NK cells for the total cell number through a fluorescence cytometer (Flow Cytometer, FACS) It is a schematic diagram showing the number of cells at the same time in%,
Figure 6b shows the protein expression levels of Prf1, GzmB, ERK and GAPDH via immunoblot, to see that miR-27a ^* itself transduced in primary NK cells regulates protein expression of Prf1 and GzmB (top). , The cells are recovered and the cytotoxicity is measured by Cr release analysis as a bar graph (bottom),
FIG. 7A is a diagram that miR-27a ^* negatively regulates protein expression of target proteins Prf1 and GzmB,
Figure 7b is a control miRNA (Ctrl-miR) transduced mNK cells by intravenous injection into human tumor xenografts mice (n = 5) artificially injected subcutaneously with human colon cancer cells SW620, miR-27a ^* or miR-27a ^* inhibitor (miR-27a ^* inhi) is injected, compared to the negative control (PBS), positive control (Doxorubicin) is a schematic diagram showing the comparison of the change in tumor size,
FIG. 7C is a graph of a line graph of tumor size change in mice by day until the treatment period as shown in FIG. 7B is 22 days,
FIG. 7D shows the average of tumor size change in each of 5 mice at 22 days of treatment as in FIG. 7B,
Figure 7e is a control miRNA (Ctrl-miR), miR-27a ^* or miR-27a ^* inhibitor (miR-27a ^* inhi) transduced in mNK cells compared to the negative control PBS after treatment as shown in Figure 7b Is a line graph representing the inhibition rate (%) of tumor size in mice injected with
FIG. 7F is a graph showing a comparison of body weight with time following treatment as in FIG. 7B.

Hereinafter, the present invention will be described in detail.

The present invention includes the step of transducing an NK cell under in vitro conditions with an expression vector comprising a nucleic acid sequence encoding an inhibitor of miR-27a ^* having the nucleotide sequence set forth in SEQ ID NO: 17, wherein cytotoxicity is increased. Provided are methods for preparing NK cells.

The present invention also includes transducing an NK cell under in vitro conditions with an expression vector comprising the nucleic acid sequence set forth in SEQ ID NO: 37 or SEQ ID NO: 40 comprising a mutation at a site to which miR-27a ^* binds. It provides a method for producing NK cells with increased cytotoxicity.

In a specific embodiment of the present invention, the inventors confirmed the expression of GzmA, GzmB, Prf1 in order to elucidate the regulatory mechanism of Prf1 and GzmB inherent in resting and activated mNK cells. In contrast to GzmA, which has high levels in both resting and activated mNK cells, Prf1 and GzmB significantly increased protein expression levels 24 hours after IL-15 treatment (see FIGS. 1A and 1F). The killing ability also increased (see FIG. 1B). Surprisingly, the expression levels of Prf1 and GzmB mRNA increased at 6 hours after IL-15 treatment, showing a time difference from protein expression (see FIG. 1C). As a result of the experiment, the present inventors confirmed that there is a time lag between increased mRNA expression and increased protein expression of Prf1 and GzmB (see FIGS. 1A and 1C). However, in contrast to the time intervals in which effector proteins Prf1 and GzmB were induced, interferon-gamma (IFN-γ) protein increased at 6 hours after IL-15 treatment in mNK cells and NK92 cells, similar to the mRNA expression increase time (Fig. 1d). Next, the inventors confirmed that Prf1 and GzmB are inhibited in resting NK cells by using the signal intensity of Agilent Human whole genome 4 × 44K gene-expression microarray. Interestingly, the expression levels of Prf1 and GzmB mRNA in resting NK cells were higher than the expression levels of GzmA and GAPDH (see FIG. 1E). Semi-quantitative RT-PCR confirmed the microarray by showing that mRNA expression is high despite little Prf1 and GzmB protein expression in resting NK cells (see FIG. 1F). Based on the experimental results, the present inventors have suggested that Prf1 and GzmB protein expression is inhibited by a post-transcriptional regulation mechanism that is not well known at both resting and activation periods.

In addition, in a specific embodiment of the present invention, the present inventors attempt to prove the hypothesis that the expression of Prf1 and GzmB proteins is suppressed due to gene silencing caused by miRNA, which is one of the inhibitory mechanisms of translation. In addition, the expression of Dicer, an enzyme essential for the production of miRNA in mNK cells, was suppressed. MNK cells transduced with Dicer1 siRNA were found to increase the amount of Prf1 and GzmB protein expression despite the difference in mRNA expression (see FIGS. 2A and 2B). Surprisingly, it was consistent with an increase in cytotoxicity of NK cells (see FIG. 2C). However, GzmA mRNA and protein expression did not change despite inhibiting miRNA production (see Figure 2a). Inhibition of Dicer1 in NK cells increased Prf1 and GzmB protein expression and increased cytotoxicity in NK92 cells. In addition, increased protein expression of Prf1 and GzmB was also observed in resting mNK cells that inhibited Dicer, suggesting that intracellular miRNA regulates the expression levels of Prf1 and GzmB in both resting and active phases. However, in order to escape from the possibility that the result of increasing the expression of Prf1 and GzmB may be due to general stress, the present inventors inhibited Dicer1 which interferes with all miRNA production. It was confirmed that it is controlled by.

To search for miRNAs that inhibit the expression of Prf1 and GzmB, we used microarray techniques for analyzing miRNAs from activated NK cells. Based on the kinetic analysis of Prf1 and GzmB (see FIG. 1), we found that candidate miRNAs involved in the inhibition of Prf1 and GzmB expression are highly expressed in the resting state and when NK cells are activated, similar to their target mRNAs or Or hypoxic expression. Initial screening identified ˜25 miRNAs that increased or decreased expression in response to IL-15. In order to identify what miRNAs affect Prf1 and GzmB inhibition, we used miRNA target prediction algorithms to focus the important seed sequences in miRNAs for Prf1 and GzmB mRNA. silico sequence complementarity analysis was performed. As a result, miRNAs of miR-15a, miR-204 and miR-27a ^* induced by IL-15 were selected, and kinetic induction was confirmed using qPCR (see FIG. 3A). Hourly analysis showed a peak increase within 12 hours, similar to the time course of the target mRNA. The increased amount of miRNA was inhibited by actinomycin D, which could show that it is transcriptional induction.

In addition, in a specific embodiment of the present invention, in order to confirm whether three miRNAs with identical sequences in the 3'UTRs of Prf1 and GzmB can actually inhibit the expression of Prf1 and GzmB, the present inventors have identified IL-15. Synthetic miRNA mimics (mimics) matching these miRNAs were transduced into mNK cells during processing (see FIG. 3B). miR-27a ^* transduced in mNK cells reduced the amount of Prf1 and GzmB protein expression by ˜60% without altering mRNA expression. At the same time, cytotoxicity of the cells was reduced by ~ 50%. In contrast, miR-15a and miR-204 had no effect on the protein expression levels and cellular cytotoxicity of Prf1 and GzmB (see FIG. 3C).

miRNA function can be transiently regulated by hairpin inhibitors, chemically modified oligonucleotides complementary to each miRNA. In addition, to confirm whether the expression of Prf1 and GzmB is regulated by miR-27a ^* present in the cells in a specific embodiment of the present invention, we transduced miR-27a ^* inhibitors in mNK cells. The present inventors confirmed that the expression of Prf1 and GzmB is strongly increased, as suggested by miR-27a ^* present in mNK cells will inhibit the expression of Prf1 and GzmB. In addition, transduction of miR-27a ^* and miR-27a ^* inhibitors reduced and increased the expression of Prf1 and GzmB, respectively (see FIG. 3D) and was associated with cytotoxicity of NK cells in a concentration dependent manner. Next, the present inventors confirm whether miR-27a ^* regulates cytotoxicity of NK cells by negative regulation rather than inducing genes related to cytotoxicity of NK cells rather than inducing expression of Prf1 and GzmB. It was set as. Transduction of miR-27a ^* and miR-27a ^* inhibitors did not affect the amount or phosphorylation of ERK, which is an indicator of NK cell activity, and INF-γ production. However, reduced and increased expression of Prf1 and GzmB were consistent with the killing capacity of NK cells, respectively (see FIG. 3E). Based on these experimental results, we suggested that miR-27a ^* negatively targets Prf1 and GzmB to modulate cytotoxicity of NK cells.

In addition, to find out whether miR-27a ^* targets both Prf1 and GzmB in a specific embodiment of the present invention, we performed a reporter analysis (see FIGS. 4A and 4B). Overexpression of miR-27a ^* in HEK293T cells significantly reduces the expression of AANAT reporter gene containing wild-type Prf1 3'-UTR or GzmB 3'-UTR, but expression of the reporter gene is expressed when control miRNA is expressed. There was no significant effect. However, point mutations in miR-27a ^* induced significant recovery in the expression of reporter proteins without alteration of AANAT mRNA expression (see FIG. 4C). In these experiments, the reporter AANAT mRNA expression level was defined as Neo ^R as an internal control. mRNA was used and showed little difference between samples. In order to explain that in AANAT reporter gene, the effect of miR-27a ^* depends on the miR-27a ^* binding sites, the inventors have found that the reporter construct comprising a deletion or mutation in the 3'UTR to be inferred that miR-27a ^* will bond Was prepared (see FIG. 4A). Although Prf1_D1 reporter decreased reporter gene expression compared to Prf1_WT, Prf1_D2 without any miR-27a ^* -binding site allegedly reduced the inhibitory effect of reporter gene expression by 3 times (see FIG. 4D). In addition, 3'UTR mutations (Prf1_M and GzmB_M) complementary to miR-27a ^* mutations (miR-27a ^* M) were inhibited by miR-27a ^* M, but miR-27a ^* was not inhibited as expected (FIG. 4E). Reference). As a result of these experiments, the present inventors confirmed that miR-27a ^* specifically targets the nucleotide sequence of 3'-UTR to inhibit the expression of both Prf1 and GzmB.

In addition, in a specific embodiment of the present invention, the inventors performed knockdown and concentration-dependent experiments in NK cells activated by resting phase and IL-15, in order to confirm the biological function of miR-27a ^* in NK cells. In resting mNK cells, transduction of miR-27a ^* inhibitors showed a two-fold increase in the amount of Prf1 and GzmB expression, and correspondingly increased cytotoxicity of NK cells, compared to mNK cells transduced with control miRNAs. Confirmed. However, resting mNK cells transduced with miR-27a ^* showed little change in Prf1 and GzmB expression and cytotoxicity of cells (see FIG. 5A).

When stimulated with IL-15, mNK cells increased the expression of Prf1 mRNA, GzmB mRNA, miR-27a ^* as the concentration of IL-15 increased (see FIG. 5B). However, once the expression of Prf1 and GzmB was increased, there was little change following (see FIG. 5C). This was consistent with the cytotoxicity of NK cells. As a result of these experiments, the inventors confirmed that miR-27a ^* induced by IL-15 inhibited the expression of the target protein. The expression of Prf1 and GzmB in NK cells was regulated by miR-27a ^* , compared to other cells. Compared to mNK cells, NK92 cells showed similar or decreased mRNA expression, while Prf1 and GzmB expressions were high. As expected, NK92 cells had less miR-27a ^* present intracellularly than mNK cells (see FIG. 5D).

In addition, in a specific embodiment of the present invention a negative role in the expression of Prf1 and GzmB is in in vitro In order to rule out the possibility of limited development in differentiated human mNK cells and NK92 cells, we isolated the primary NK cells (CD3 ^- CD56 ⁺ CD16 ⁺ ) from cord blood cells (UBC) extracted from human umbilical cord and miR- 27a ^* was transduced (see FIG. 6A). Similar to mNK cells, miR-27a ^* -transduced primary NK cells were found to decrease cytotoxicity simultaneously with specific inhibition of Prf1 and GzmB (see FIG. 6B). As expected, primary NK cells transduced with miR-27a ^* inhibitors showed contrasting results. Based on these experimental results, the present inventors suggested that miR-27a ^* plays a major role in regulating the expression of Prf1 and GzmB in post-transcriptional regulation.

In addition, in a specific embodiment of the present invention in In vivo , to confirm that miR-27a ^* targets both Prf1 and GzmB to perform a negative function on the cytotoxicity of mNK cells (see FIG. 7A), the inventors of the present study We investigated the effects of NK cells transduced with miR-27a ^* and miR-27a ^* inhibitors. SW620 cells injected subcutaneously rapidly formed cancer. The mean size of the cancer was 240 ± 28 mm ³ at day 22.

Cancer growth was significantly reduced due to mNK cells transduced with miR-27a ^* . In contrast, mNK cells transduced with miR-27a ^* inhibitors increased cytotoxicity against cancer (see FIGS. 7B-7D). Rats with mNK cells transduced with control miRNAs inhibited cancer growth by 46% on day 22, whereas mNK cells transduced with miR-27a ^* or miR-27a ^* inhibitors inhibited cancer growth by 27.2% and 65.1%, respectively. (See FIG. 7E). The effect of mNK cells transduced with miR-27a ^* inhibitors on cancer growth was compared with doxorubicin, a cytotoxic substance currently used for chemotherapy (see FIGS. 7B-7E). Inhibitory effects of mNK cells transduced with miR-27a ^* inhibitors in cancer growth persisted longer than control miRNAs or mNK cells transduced with miR-27a ^* . The extent of cancer growth inhibition effect by mNK cells transduced with control miRNA or miR-27a ^* was gradually reduced after 5 second days (see FIG. 7E). However, in vitro miR-27a ^* The miR-27a ^* inhibitor, as proposed in both the introduction of the inhibitor (introduction) to the level of cytotoxicity of mNK cells against the rising arm (degree) and the period (duration) that is assuming the effect of transfection on the Cancer growth inhibitory effects on the introduced mNK cells were maintained and increased up to 22 days. Body weight was not changed by mNK cell treatment, but the weight of doxorubicin-treated mice was significantly reduced (see FIG. 7F). Based on these experimental results, the present inventors in We confirmed that miR-27a ^* is an essential inhibitor of cytotoxicity of NK cells against cancer in vivo , suggesting that miRNA is an important target molecule for chemotherapy with NK cells.

miR-27a ^* The combined introduction of sequence containing the mutation site by the NK cells in the intracellular miR-27a ^* present in the 3'UTR of the target gene miR-27a ^* in competition with binding sequence miR-27a ^* cells in which the The effect of inhibiting the activity can be expected. The sequence including the mutation at the site where the miR-27a ^* binds to the NK cell is preferably SEQ ID NO: 37 or SEQ ID NO: 40, but the site binding to the target gene of miR-27a ^* is mutated to 3 'of the target mRNA. Any sequence capable of competing with the miR-27a ^* binding sequence present in the UTR is possible.

The method may further include determining whether the expression of Prf1 and GzmB proteins is increased in the NK cells, and whether the expression of the Prf1 and GzmB proteins is increased, and Western blot, immunostaining, fluorescence staining, and reporter assay may be performed. It can be confirmed by performing any one method selected from the group consisting of) but is not limited now, it can be made through all known methods known in the art.

The method may further include checking whether the activity of NK cells is actually increased, and whether the activity of the NK cells is increased

Iii) a method of confirming that IFN-γ production in the experimental group was increased compared to the control group when the cells were stimulated with IL-15; or,

Ii) It can be confirmed by a method of confirming that the target cell killing ability of the experimental group is increased compared to the control group, but is not limited thereto. Those skilled in the art will readily know a method for measuring the target cell killing ability of the NK cells.

The transduction was carried out from the group consisting of Lipofectamine, Hejinmax, Fugene, JetPEI, Effectene and DreamFect from Dojindo. Any one of the commercialized transduction reagents selected; Calcium-phosphate, positively charged polymers, liposomes, nanoparticles, nucleofection, electroporation, heat shock, magnetofection; And it can be carried out using any one selected from the group consisting of a method using a retrovirus.

In addition,

1) treating the test compound to a cell expressing miR-27a ^* ;

2) measuring the expression level of miR-27a ^* in the treated cells of step 1); And,

3) provides a method for screening an anticancer agent comprising the step of selecting a test compound having a reduced expression level of miR-27a ^* in step 2) compared to a control.

The test compound may be any one selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, bacteria or fungi metabolites and bioactive molecules, but is not limited thereto. If not anti-cancer activity is known in the art, all is possible.

The expression level of miR-27a ^* is RT-PCR, quantitative or semi-quantitative RT-PCR (Quentitative or semi-Quentitative real-time PCR), Northern It can be confirmed by performing any one method selected from the group consisting of a blot (northern blot) and DNA or RNA chip (chip), but is not limited now, it can be made through any known method known in the art.

The present invention also provides NK cells activated by the above method.

The present invention also provides a pharmaceutical composition for preventing or treating cancer containing the NK cells as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for NK cell activation containing an inhibitor of miR-27a ^* having the nucleotide sequence set forth in SEQ ID NO: 17 as an active ingredient.

The inhibitor of miR-27a ^* is preferably a polynucleotide as set forth in SEQ ID NO: 20, but is not limited thereto, and may be any antisense nucleotide complementary to miR-27a ^* .

The inhibitor of miR-27a ^* activates NK cells by increasing the expression of Prf1 and GzmB proteins to increase cell killing ability.

The natural killer cell activating pharmaceutical composition of the present invention can be treated in vitro, in vivo or ex vivo. Activating natural killer cells treated in vitro with the pharmaceutical composition of the present invention and then administering to the individual, or activating the natural killer cells in vivo by directly administering the pharmaceutical composition into the individual (in vivo), or natural killer cells in the individual Collecting and treating and activating the pharmaceutical composition of the present invention and then returning back to the subject (ex vivo) are all possible, but are not limited to these methods are those skilled in the art according to the disease, age, sex and weight of the individual, etc. Can be easily selected and implemented. The subject is preferably a mammal . Typical mammals include, but are not limited to, for example, humans, nonhuman primates, mice, rats, dogs, cats, horses, or cattle. The disease is a variety of diseases associated with tumors, for example, lung cancer, liver cancer, stomach cancer, colon cancer, bladder cancer, prostate cancer, breast cancer, ovarian cancer, cervical cancer, thyroid cancer, melanoma, as well as various solid cancers, including leukemia Preferably, but not limited to colorectal cancer or hematologic cancer. The pharmaceutical composition of the present invention may be administered orally or parenterally, and when parenteral administration is selected by external skin or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection injection method. desirable.

The pharmaceutical composition may further include conventionally used excipients, disintegrants, sweeteners, lubricants, flavoring agents and the like. The disintegrants include sodium starch glycolate, crospovidone, croscarmellose sodium, alginic acid, calcium carboxymethyl cellulose, sodium carboxymethyl cellulose, chitosan, guar gum, low-substituted hydroxypropyl cellulose, magnesium aluminum silicate, and polyacryline Potassium and the like. In addition, the pharmaceutical composition may further include a pharmaceutically acceptable additive, wherein the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate , Lactose, mannitol, malt, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, opadry, sodium starch glycolate, carnauba lead, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, Calcium stearate, sucrose, dextrose, sorbitol, talc and the like can be used. The pharmaceutically acceptable additive according to the present invention is preferably included 0.1 to 90 parts by weight based on the pharmaceutical composition.

Solid form preparations for oral administration include powders, granules, tablets, capsules, soft capsules, and the like. Oral liquid preparations include suspensions, solvents, emulsions, syrups, and aerosols.In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. Can be. Formulations for parenteral administration include powders, granules, tablets, capsules, sterile aqueous solutions, solutions, non-aqueous solutions, suspensions, emulsions, syrups, suppositories, aerosols, etc. It may be used in the form of a formulation, and preferably, an external skin pharmaceutical composition of cream, gel, patch, spray, ointment, warning agent, lotion agent, linen agent, pasta agent or cataplasma agent may be prepared and used. It is not limited to this. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

The preferred dosage of the pharmaceutical composition depends on the absorbency, inactivation rate and rate of excretion of the active ingredient in the body, the age, sex and condition of the individual, and the severity of the disease to be treated, but may be appropriately selected by those skilled in the art. For the desired effect, however, in the case of oral administration, it is generally advisable to administer the composition of the present invention to an adult at 0.0001 to 100 mg / kg per day, preferably at 0.001 to 100 mg / kg, per kg of body weight per day. good. Administration may be administered once a day or may be divided several times. The dose is not intended to limit the scope of the invention in any way.

Hereinafter, the present invention will be described in detail by the following examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited by the following examples.

Cell Culture and Differentiation

<1-1> invite NK  Cell Separation and Differentiation

Primary natural killer cells were obtained from umbilical cord blood (UCB) derived from human umbilical cord using ACCUSPIN System-HISTOPAQUE-1077 (sigma-aldrich, USA), followed by MACS NK cell isolation KIT ( Miltenyi Biotec, Germany) was isolated by negative selection (negative selection) according to the manual. At this time, the NK cell population was more than 93% of CD56 (NK cell marker) ⁺ / CD3 (mature T cell marker) -cells and less than CD3 ⁺ 5% when analyzed by fluorescence cytometer (Flow Cytometer, FACS).

All antibodies for FACS analysis in the present invention were purchased from Becton, Dickinson and Company and BD Pharmingen unless otherwise noted. The cells to be analyzed were stained with each designated antibody at 4 ° C. for 20 minutes in staining buffer [PBS containing 1% FBS (Hyclone) and 0.01% NaN 3 (Sigma)], followed by FACS analysis.

<1-2> mature NK  Cell differentiation

Mononuclear cells (MNC) were isolated from UCB by Ficoll-Hypaque density gradient centrifugation. CD56 ⁺ , CD3 ⁺ , CD14 ⁺ , CD19 ⁺ , CD2 ⁺ , CD11b ⁺ , CD15 ⁺ and CD123 ⁺ cells were removed from the MNC using a lineage cell depletion kit (MiltenyiBiotec), and then a CD34 cell isolation kit (MiltenyiBiotec) was used. CD34 (Pluripotent Stem Cell Marker) ⁺ cells were isolated. Purity of the isolated CD34 ⁺ cells was greater than 97% as measured by FACS. The isolated CD34 ⁺ cells were differentiated into mature natural killer (mNK) cells matured in vitro through the following procedure. That is, CD34 ⁺ cells were 106 M helical cytokine (HC) (Sigma), stem cell factor (SCF) (30 ng / ml), fl (flk2 / flt3 ligand) (50 ng / ml) and IL-7 (Interleukin). -7) (5 ng / ㎖) containing MyeloCult H5100 (Stem Cell Technologies, Canada) was incubated for 14 days in a cell incubator at 37 ℃, 5% CO ₂ conditions. In order to differentiate into complete mNK cells, human-derived IL-15 (30 ng / ml, R & D Systems, USA) was added and incubated for two more weeks. The purity of CD56 ⁺ / CD3 ⁻ cells was greater than 90% when analyzed by FACS.

<1-3> cell line culture

NK92 malignant lymphoma NK cells, K562 erythroleukemia cells, HEK293T cells, and human SW620 cells purchased from ATCC were IL-2 (100 units / ml, PetroTech, Inc. USA), 10% FBS and 1% streptomycin, respectively. Alpha-MEM medium with penicillin, Iscove's Modified Dulbecco's Medium (IMDM) medium, alpha-MEM medium with 10% FBS and 1% streptomycin / penicillin, and 10% FBS, 2 mM L-glutamine, 100 U Incubated in a cell incubator at 37 ° C., 5% CO ₂ with RPMI1640 (GibcoBRL) medium supplemented with / ml penicillin and 100 μg / ml streptomycin.

Activated mNK  In a cell GzmA , GzmB  And Prf1  Confirmation of expression

Although expression of Prf1 (perforin1) (SEQ ID NO: 1) and GzmB (granzymeB) (SEQ ID NO: 2) in activated NK cells is known, little is known about the regulatory mechanism of arming NK cells in cells. The present inventors confirmed the expression of GzmA (granzymeA), GzmB and Prf1 in resting and activated mNK cells and thus cell killing ability of NK cells.

<2-1> mNK  According to the degree of cell activation Prf1  And GzmB  Protein expression confirmation

MNK cells obtained in Example 1-2 were not treated with 30 ng / ml IL-15, or treated for 6, 12, 24 or 48 hours, followed by 1% NP-40 and complete proteinase inhibitor (Roche). Treated with PBS (phosphate-buffer saline) containing to obtain a cell lysate. The cell lysate was subjected to SDS-PAGE to separate proteins and then transferred to an Immobilon-P membrane (Millipore Corporation, USA). The transfer membrane was then blocked with 5% skim milk for 30 minutes, followed by anti-Prf antibody (abcam), anti-GzmB antibody (polyclonal antibody, SantaCruz Biotechnology) and anti-GAPDH antibody (monoclonal antibody) as primary antibodies. , Ab FRONTIER) was treated at 4 ° C. for one day. The membrane treated with the primary antibody was identified using an Immobilon Western kit (MILLIPORE). At this time, the protein expression level of GAPDH was used as a quantitative control. The immunoblot results are shown in Figure 1a.

As a result, as shown in FIG. 1A, the expression levels of Prf1 and GzmB proteins were the highest when 24 hours after IL-15 treatment.

<2-2> mNK  Target cell according to the degree of cell activation Death  Confirm

We activated mNK cells through IL-15 treatment and then performed ⁵¹ Cr-release assay to confirm NK cell cytotoxicity. Specifically, K562 cells (target cells) of Examples 1-3 were labeled by reacting 1.5 Cr of ⁵¹ Cr in a 37 ° C. cell incubator for 1 hour. The labeled K562 cells were washed twice with PBS and then aliquoted into 96 well plates at 10,000 cells per well. The ratio of mNK cells (effect cells) obtained in Example 1-2, which was not treated with 30 ng / ml IL-15 or treated for 6, 24 or 48 hours to the 96 well plate, was the ratio of effect cells to target cells. The cells were dispensed from 5: 1 to 1.5: 1 and then reacted for 4 hours in a cell incubator at 37 ° C. and 5% CO ₂ . After the reaction was completed, the supernatant was recovered, and radioactivity was measured using a scintillation counter (RACTOBETA; LKB Instruments). The target cell killing capacity of mNK cells according to IL-15 treatment time was graphically shown in FIG. 1B.

As a result, as shown in Figure 1b after 24 hours of treatment with IL-15 was the highest cell killing capacity.

<2-3> mNK  According to the degree of cell activation Prf1  And GzmB mRNA  Expression

MNK cells obtained in Example 1-2 were not treated with 30 ng / ml IL-15, or treated for 6, 12, 24, or 48 hours, followed by total RNA using Trizol Reagent (Invitrogen, USA). 1 g of the total RNA was reacted with Moloney murine leukemia virus (M-MLV) reverse transcriptase (Roche Diagnostics, Switzerland) and oligo-dT for 1 hour at 42 ° C according to the manufacturer's manual. Synthesized. As a template, real-time PCR (real-time PCR) was performed using primer pairs for 2 × SYBRPremix Ex TaqTM (TaKaRa, Japan), Prf1 or GzmB in Table 1 (Dice TP800 Thermal Cycler (TakaraBio). Real-time PCR was performed together with GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) as a control using the GAPDH primer pairs of Table 1. The PCR conditions were denatured at 95 ° C for 10 minutes, followed by 95 ° C 30 seconds, 55 ° C 30 seconds. After rotating 40 revolutions at 72 ° C. for 30 seconds, stretched for 8 minutes at 72 ° C., and cooled down to room temperature 2 Real-time PCR results corrected expression of Prf1 or GzmB for each sample to the amount of GAPDH expression ^- after analysis the ^{△△ Ct} method of comparison, are shown graphically in Figure 1c the relative expression level of Prf1 or GzmB in mNK cells of the IL-15 treatment time.

As a result, as shown in Fig. 1c, the expression levels of Prf1 and GzmB mRNAs were the highest when 6 hours after IL-15 treatment. This suggests that there is a time interval between increased mRNA expression and increased protein expression of Prf1 and GzmB.

gene Sense primer (5 '→ 3') Antisense Primer (5 '→ 3') Prf1 SEQ ID NO: 3 gctggacgtgactcctaagc SEQ ID NO: 4 gatgaagtgggtgccgtagt GzmA SEQ ID NO: 5 agctgacggaaaaagcaaaa SEQ ID NO: 6 agggcttccagaatctccat GzmB SEQ ID NO: 7 gtaagggggaaacaacagca SEQ ID NO: 8 ccccaaggtgacatttatgg GAPDH SEQ ID NO: 9 gccatcaatgaccccttcatt SEQ ID NO: 10 gctcctggaagatggtgatgg Dicer1 SEQ ID NO: 11 atgaatggaaaatgcccaaa SEQ ID NO: 12 cagaaccccaccacaaagtc

<2-4> mNK  According to the degree of cell activation IFN -γ production

The present inventors confirmed the amount of IFN-γ produced by IL-15 treatment time in mNK cells. Specifically, mNK cells obtained in Example 1-2 were not treated with 30 ng / ml IL-15, or treated for 6, 12, 24, or 48 hours, followed by a sense primer of SEQ ID NO: 13 (5 '). cDNA synthesis and real-time PCR were performed in the same manner as in Example 2-3 using primer pairs for IFN-γ of -tccaacgcaaagcaatacat-3 ') and antisense primer of SEQ ID NO: 14 (5'-gcaggcaggacaaccattac-3'). It was. In addition, the IFN-γ concentration in the supernatant obtained from cells treated with or without IL-15 was measured according to the manufacturer's manual using an enzyme-linked immunosorbent assay (ELISA) kit (R & D systems, USA). It was. The real-time PCR results and ELISA results are shown together graphically in Figure 1d.

As a result, as shown in Figure 1d, the interferon-gamma (IFN-γ) production was the highest when 6 hours after the IL-15 treatment, similar to the increased expression time of Prf1 and GzmB mRNA.

<2-5> rest period mNK  In a cell Prf1  And GzmB Protein and mRNA  Confirmation of expression

We confirmed the expression of Prf1 and GzmB in inactivated resting NK cells. The inventors analyzed the Agilent Human whole genome 4 × 44K gene-expression microarray (GenoSensor Corporation) according to the manufacturer's manual, and found that the mRNA expression levels of Prf1 and GzmB in resting NK cells were higher than those of GzmA and GAPDH. (FIG. 1E). In order to confirm this directly, cDNA was synthesized in the same manner as in Example 2-3 in the mNK cells of Example 1-2, which were not treated with 30 ng / ml of IL-15 or treated for 24 hours. Semi-quantitative PCR was performed using the synthesized cDNA and primer pairs for each gene in Table 1. The PCR conditions were repeated 22 cycles under the conditions of 30 seconds at 95 ℃, 30 seconds at 55 ℃, 30 seconds at 72 ℃, and further reacted for 5 minutes at 72 ℃ to complete the complete extension. The PCR product was identified by EtBr (ethidium bromide) staining by electrophoresis.

In addition, the immunoblot was performed in the same manner as in Example 2-1 in the cells treated with or without the IL-15. The semi-quantitative PCR and western blot results are shown in FIG. 1F.

Based on these experimental results, the present inventors have suggested that Prf1 and GzmB protein expression is inhibited by a post-transcriptional regulation mechanism that is not well known at both resting and activation periods.

As a result, as shown in FIG. 1E, the expression levels of Prf1 and GzmB mRNA in resting NK cells were higher than those of GzmA and GAPDH in microarray results. In addition, as shown in FIG. 1F, microarray data was confirmed by confirming that the mRNA expression was high even though the Prf1 and GzmB protein expression levels were little in the resting NK cells in the semi-quantitative RT-PCR results. As such, the inventors have suggested that Prf1 and GzmB protein expression is inhibited by a post-transcriptional regulation mechanism that is not well known at both resting and activation time.

miRNA On by NK  Cell Prf1  And GzmB  Expression regulation confirmation

The inventors of the present invention have shown that gene silencing by microRNA (miRNA), which is one of the mechanisms by which translation is inhibited, is because the expression of Prf1 and GzmB proteins is regulated according to activation of NK cells identified in Example 2 above. I thought it was, and I wanted to prove it.

<3-1> miRNA  On creation NK  Cell Prf1  And GzmB  Protein expression confirmation

The present inventors measured the protein expression levels of Prf1 and GzmB in mNK cells which inhibited Dicer expression, an enzyme essential for miRNA production. Specifically, premade siRNA for human Dicer1 (DICER1 ON-TARGETplus SMARTpool) or control siRNA purchased from Thermo Fisher Scientific in mNK cells of Example 1-2 treated with 30 ng / ml IL-15 for 24 hours. Was transduced using nucleofection Ahhnology (Amaxa) according to the manufacturer's manual. 24 hours after transduction, anti-Dicer1 (monoclonal antibody, abcam), anti-Prf antibody, anti-GzmA antibody (polyclonal antibody, SantaCruz Biotechnology), anti The immunoblot was performed in the same manner as in Example 2-1 using the -GzmB antibody and the anti-GAPDH antibody to confirm the expression of Dicer1, Prf1, GzmA, GzmB and GAPDH proteins. The results are shown in Figure 2a.

As a result, as shown in FIG. 2a, it was confirmed that the expression levels of Prf1 and GzmB proteins were increased in mNK cells transduced with Dicer1 siRNA.

<3-2> miRNA  On creation NK  Cell Prf1  And GzmB mRNA  Confirmation of expression

The present inventors measured mRNA expression levels of Prf1 and GzmB in mNK cells which inhibited Dicer expression, an enzyme essential for miRNA production. Specifically, real time PCR was performed in the same manner as in Example 2-3 using primers for the respective genes of Table 1 in mNK cells treated in the same manner as in Example 3-1, Dicer1, Prf1, and GzmA. And GzmB mRNA expression was confirmed. The results are shown in Figure 2b.

As a result, as shown in Figure 2b it was confirmed that there is no significant difference in the amount of Prf1 and GzmB mRNA expression in mNK cells transduced with Dicer1 siRNA.

<3-3> miRNA  On creation NK  Target cell of the cell Death  Confirm

The present inventors measured cell killing ability in mNK cells that inhibited Dicer expression, an enzyme essential for miRNA production. Specifically, ⁵¹ Cr-release analysis was performed in the same manner as in Example 2-2 using mNK cells treated in the same manner as in Example 3-1 as effect cells. The results are shown in Figure 2c.

As a result, as shown in FIG. 2c, cytotoxicity of NK cells was reduced in mNK cells transduced with Dicer1 siRNA. It also coincided with the increase of (Fig. 2c). However, GzmA mRNA and protein expression did not change despite inhibiting miRNA production (FIG. 2A). Inhibition of Dicer1 in NK cells increased Prf1 and GzmB protein expression and increased cytotoxicity in NK92 cells. In addition, increased protein expression of Prf1 and GzmB was also observed in resting mNK cells that inhibited Dicer, suggesting that intracellular miRNA regulates the expression of Prf1 and GzmB in both resting and active phases.

Prf1  And GzmB To regulate the expression of miRNA  Screening and Confirmation

The inventors conducted the following experiment to determine whether the regulation of Prf1 and GzmB by the miRNAs identified above is regulated by miRNAs in real cells, not because of general stress caused by inhibiting Dicer1 expression and interfering with all miRNA production. Was performed.

<4-1> Prf1  And GzmB To regulate the expression of miRNA  Selection

We analyzed miRNA using microarray technology from activated mNK cells to search for miRNAs that inhibit the expression of Prf1 and GzmB. Based on the analysis of Prf1 and GzmB in FIG. 1, miRNAs that inhibit the expression of Prf1 and GzmB are expected to be highly expressed at rest and show similar or reduced expression to their target mRNA when NK cells are activated. Screening selects 25 miRNAs whose expression levels are increased or decreased in IL-15-stimulated NK cells and then identifies which miRNAs affect the inhibition of expression of Prf1 and GzmB among the selected miRNAs (seed) In silico sequence complementarity analysis of miRNAs against Prf1 and GzmB mRNAs with emphasis on sequencing was performed using miRNA target prediction algorithm. As a result, miR-15a, miR-204 and miR-27a ^* were selected.

The present inventors confirmed the expression of the miRNA by real-time PCR to confirm whether the expression level of the miRNA is actually increased by IL-15 stimulation in mNK cells. Specifically, the mNK cells obtained in Example 1-2 were not treated with 30 ng / ml IL-15, or treated for 6, 12, or 24 hours, and then the same method as in Example 2-3. After synthesizing cDNA, real-time PCR was performed according to the manufacturer's manual using primer pairs and TaqMan MicroRNA Assay kits for each miRNA included in TaqMan MicroRNA Assays Kit (Applied biosystems). In this case, U6 snRNA (U6 small nuclear RNA) was performed with each sample using a U6 snRNA primer pair included in the TaqMan MicroRNA Assays Kit as a quantitative control. Real-time PCR results were analyzed by 2 ^{-ΔΔ Ct} comparison method that corrects the expression level of each miRNA to U6 snRNA expression level, and then miR-15a, miR-204 or miR- in mNK cells according to IL-15 treatment time. The relative expression level of 27a ^* is shown graphically in Figure 3a.

As a result, as shown in Figure 3a, the relative expression level of miR-15a, miR-204 or miR-27a ^* according to IL-15 treatment time was confirmed to increase the expression level 12 hours before, similar to the target mRNA. In addition, this induction of miRNA was inhibited by actinomycin D (actinomycin D) it was found that the increase in the expression level of the miRNA was increased at the level of transcription.

<4-2> Prf1  And GzmB To regulate the expression of miR -27a ^*  Selection

The present inventors attempted to determine whether three miRNAs with identical sequences in the 3'UTR of Prf1 and GzmB can actually inhibit the expression of Prf1 and GzmB. That is, the mNK cells of Example 1-2 were treated with 30 ng / ml IL-15 for 24 hours, and then each miRNA synthesized identically with the sequence of miR-15a, miR-204 and miR-27a ^*, respectively. Mimix (miR-15a mimix: SEQ ID NO: 15 (5'-UAGCAGCACAUAAUGGUUUGUG-3 '), miR-204 mimix: SEQ ID NO: 16 (5'-UUCCCUUUGUCAUCCUAUGCCU-3'), miR-27a ^* mimix : SEQ ID NO: 17 (5'-AGGGCUUAGCUGCUUGUGAGCA-3 '), Thermo Scientific Life Science Research (FIG. 3B) was transduced in the same manner as in Example 3-1. Using the anti-Prf1 antibody, anti-GzmB antibody and anti-GAPDH antibody in the transduced cells, an immunoblot for Prf1, GzmB and GAPDH in the same manner as in Example 2-1, Example 2-2 ⁵¹ Cr-emission analyzes were performed in the same manner. The results are shown in Figure 3c.

As a result, as shown in Figure 3c miR-27a ^* transduced in mNK cells reduced the amount of protein expression of Prf1 and GzmB of about 60% or less without changing mRNA expression. At the same time, cytotoxicity of the cells was reduced by less than 50%. In contrast, miR-15a and miR-204 had no effect on Prf1 and GzmB protein expression and cellular cytotoxicity.

<4-3> miR -27a ^*  By suppression Prf1  And GzmB  Reduction of expression

In order to further verify whether miR-27a ^* identified in Example 4-2 is a miRNA regulating Prf1 and GzmB, the control group miRNA and miR-27a ^* or miR-27a ^* were applied to mNK cells of Example 1-2. Hairpin inhibitors [miR-15a inhibitor: SEQ ID NO: 18 (5'-CACAAACCATTATGTGCTGCTA-3 '), miR-204 inhibitor: SEQ ID NO: 19 (5'-AGGCATAGGATGACAAAGGGAA-3'), an oligonucleotide having a sequence complementary to ), miR-27a ^* inhibitor: SEQ ID NO: 20 (5'-TGCTCACAAGCAGCTAAGCCCT-3 '), Thermo Scientific Life Science Research] was transduced in the same manner as in Example 3-1, followed by Example 2-1 In the same way, immunoblots for Prf1, GzmB and GAPDH were performed. The results are shown in Figure 3d.

As a result, the present inventors strongly my present miR-27a ^* The expression of Prf1 and GzmB by Prf1 and that the proposed bar as, miR-27a ^* to inhibit expression of GzmB to cells in mNK cells, as indicated at 3d It was confirmed that the increase. In addition, transduction of miR-27a ^* and miR-27a ^* inhibitors decreased and increased the expression of Prf1 and GzmB, respectively.

<4-4> miR -27a ^*  Confirmation of protein expression and cytotoxicity change according to expression

The inventors next confirmed that the reduction of cytotoxicity of NK cells by miR-27a ^* was due to the inhibition of expression of Prf1 and GzmB, not by inducing gene expression related to cytotoxicity of NK cells. In order to perform the following experiment. Specifically, the control miRNA, miR-27a ^* and miR-27a ^* inhibitors were transduced into the mNK cells of Example 1-2 in the same manner as in Example 3-1, followed by anti-Prf1 antibody, anti-GzmB Prf1 in the same manner as in Example 2-1 using an antibody, anti-phosphorylation-ERK antibody (monoclonal antibody, Cell Signaling), anti-ERK antibody (monoclonal antibody, Cell Signaling) and anti-GAPDH antibody Immunoblots for, GzmB, phosphorylated-ERK, ERK and GAPDH were performed. In addition, INF-γ production was measured in the same manner as in Example 2-4 in the transduced cells, and ⁵¹ Cr-release analysis was performed in the same manner as in Example 2-2. The results are shown in FIG. 3E together.

As a result, as shown in Figure 3e transduction of miR-27a ^* and miR-27a ^* inhibitors did not affect the amount or phosphorylation state of ERK and INF-γ production indicative of the activity of NK cells. However, reduced and increased expression of Prf1 and GzmB were consistent with the target cell killing capacity of NK cells, respectively. As such, the present inventors have suggested that miR-27a ^* targets Prf1 and GzmB to negatively regulate cytotoxicity of NK cells.

miR -27a ^*  Binding site dependent Prf1  And GzmB  Expression regulation confirmation

<5-1> 3 ' UTR on miR -27a ^*  Preparation of Reporter Vectors Including Binding Sites

We constructed a construct for reporter analysis (FIGS. 4A and 4B) to identify if miR-27a ^* targets both Prf1 and GzmB and named them "pcAANAT-Prf1_WT" and "pcAANAT-GzmB_WT", respectively. . Specifically, the construction of the construct was performed as follows. First, total RNA was extracted from human mNK cells using High Pure RNA Isolation Kit (Roche). 1 g of the total RNA was subjected to RT-PCR using a Transcriptor First Strand cDNA Synthesis Kit (Roche) at 55 ° C for 30 minutes and 85 ° C for 5 minutes to obtain cDNA. Using the cDNA as a template, a primer pair of a sense primer of SEQ ID NO: 21 (5'-aaGAATTCtgagaacagtgagcttgg-3 ') and an antisense primer of SEQ ID NO: 22 (5'-aaTCTAGAcaccataacatcatatt-3') or a sense primer of SEQ ID NO: 23 (5'- primer pair of aaGAATTCctacaggaagcaaacta-3 ') and antisense primer of SEQ ID NO: 24 (5'-aTCTAGAccactcagctaagaggt-3'), and Pfu Polymerase (SolGent) amplifies the Prf1 or GzmB each with the following, restriction of EcoR I and Xba confirm the nucleotide sequence of Prf1_WT and GzmB_WT amplified by the restriction position of the I present, respectively, and the EcoR I and Xba I Reporter vector pcAANAT (Kim TD et al., Mol) using an enzyme Cell Biol . 25 (8), 3232-3246, 2005). At this time, the PCR reaction was initially denatured at 94 ° C. for 4 minutes, followed by ① cycle of 35 seconds at 94 ° C., annealing at 55 ° C. for 40 seconds, and ③ 1 minute extension at 72 ° C. (① → ② → ③). Repeated this time, the last extension was carried out by reaction at 72 ° C. for 5 minutes. At this time, the amplified product was quantified by correcting with glycidaldehyde-3-phosphate dehydrogenase (GAPDH) using a 2 ^{-ΔΔ CT} method (Livak et al., Methods , 25 (4), 402-408, 2001).

In addition, "pcAANAT-Prf1_M" and "pcAANAT-GzmB_M" and Prf1 3 including a point mutation at the miR-27a ^* binding site in the Prf1 3'UTR site (SEQ ID NO: 25) or the GzmB 3'UTR site (SEQ ID NO: 26). 'miR-27a ^* the region containing a deletion downstream (downstream) site or miR-27a ^* binding site of the binding site "pcAANAT-Prf1_D1" and "pcAANAT-Prf1_D2" in the UTR region also was prepared with. Specifically, referring to the Prf1 and GzmB 3'UTR of pcAANAT-Prf1_WT and pcAANAT-GzmB_WT prepared above, the sense primer of SEQ ID NO: 27 (5'-aaGAATTCtgagaacaacagtgagcttgg-3 ') and the antisense primer of SEQ ID NO: 28 (5) A pair of primers for Prf1_D1 of the '-aaTCTAGActgcagggcttgagaatg-3' (delete downstream of the miR-27a ^* binding site at the Prf1 3'UTR site) and the sense primer of SEQ ID NO: 29 (5'-aaGAATTCtgagaacagtgagcttgg-3 ' ) And primer pairs for Prf1_D2 (deleted at the Prf1 3'UTR site including the miR-27a ^* binding site at the Prf1 3'UTR site) of the antisense primer of SEQ ID NO: 30 (5'-aaTCTAGAttgcgaatttgcgttggg-3 '). Prf1_D1 and Prf1_D2 were PCR using the primer pairs, and then cloned into pcAANAT in the same manner as above.

pcAANAT-Prf1_M was used for double-step PCR. To obtain the primary DNA fragment, pcAANAT-Prf1_WT was used as a template for the sense primer of SEQ ID NO: 31 (5'-aGAATTCtgagaacagtgagcttgg-3 ') and the antisense primer of SEQ ID NO: 32 (5'- amplified using a primer pair of gaatggcgga c g cg ttac g cagtttgg-3 '), and in order to obtain a secondary DNA fragment, pcAANAT-Prf1_WT as a template, the sense primer of SEQ ID NO: 33 (5'-ccaaactg c gtaa cg c) g tccgccattc-3 ') and a primer pair of antisense primer of SEQ ID NO: 34 (5'-aaTCTAGAcaccataacatcatatt-3'). The primary PCR product and the secondary PCR product obtained above were purified and combined, and then used as a template, the sense primer of SEQ ID NO: 35 (5'-aGAATTCtgagaacagtgagcttgg-3 ') and the antisense primer of SEQ ID NO: 36 (5'- Using a primer pair of aaTCTAGAcaccataacatcatatt-3 '), the final PCR product (Prf1_M, SEQ ID NO: 37: miR-27a ^* binding site was mutated at Prf1 3'UTR site) was cloned in the same manner as above. In addition, pcAANAT-GzmB_M is a template of pcAANAT-GzmB_WT of the sense primer of SEQ ID NO: 38 (5'-aaGAATTCtacaggaagcaaa g taa cg c g ccgc-3 ') and the antisense primer of SEQ ID NO: 39 (5'-aaTCTAGAccactcagctaagaggt-3') GzmB_M (SEQ ID NO: 40: miR-27a ^* binding site was mutated at GzmB 3′UTR site) was amplified using a primer pair, and then cloned in the same manner as above.

<5-2> miR -27a ^* By Prf1  And GzmB Confirm that all of the expressions are controlled

To see if miR-27a ^* targets both Prf1 and GzmB, we performed a reporter assay as follows (FIGS. 4A and 4B).

The present inventors transduced the pcAANAT-Prf1_WT and pcAANAT-GzmB_WT to the HEK293T cells of Examples 1-3 with miR-27a ^* or miR-27a ^* inhibitors in the same manner as in Example 3-1, and then -AANAT antibody (Santa Cruz Biotechnology) and anti-GAPDH antibody using an immunoblot in the same manner as in Example 2-1 to confirm the expression of the reporter protein AANAT (Arylalkylamine N-acetyltransferase). At this time, GAPDH was used as a quantitative control. In addition, in the transduced cells in the same manner as described above using a primer pair of the sense primer of SEQ ID NO: 41 (5'-CCCAAGCTGCGCACTTGG-3 ') and the antisense primer of SEQ ID NO: 42 (5'-GGGAACATAGCTGCTTTA-3') Real-time PCR was performed in the same manner as in Example 2-3 to confirm the expression level of AANAT mRNA. At this time, NeoR mRNA is performed in real time PCR simultaneously with AANAT mRNA using a primer pair of a sense primer of SEQ ID NO: 43 (5'-ATGACTGGGCACAACAGACA-3 ') and an antisense primer of SEQ ID NO: 44 (5'-AGTGACAACGTCGAGCACAG-3') It was. In order to correct the transduction efficiency, the expression of the AANAT mRNA was corrected and expressed with NeoR mRNA, which is a vector internal control. The results are shown in Figure 4c.

As a result, when miR-27a ^* was overexpressed in HEK293T cells as shown in FIG. 4C, the expression of wild-type Prf1 3'-UTR or GzmB 3'-UTR significantly reduced the expression of AANAT reporter gene, but the control miRNA was expressed. There was no significant effect on reporter gene expression. However, the introduction of a miR-27a ^* point mutation did not show a significant difference in AANAT mRNA expression, but it was confirmed that the expression of the reporter protein was remarkably recovered.

<5-3> miR -27a ^*  Confirmation of binding site-specific reporter gene expression

The present inventors have found that the embodiment 5-2 of the effect of miR-27a ^* determined in a reporter gene contained in the 3'UTR of the miR-27a ^* combine to ensure that depends on the area, miR-27a ^* binding site of 3'UTR The following experiment was performed using the vector (FIG. 4A) prepared in Example 5-1 containing a deletion or mutation.

First, miR-27a ^* and pcAANAT-Prf1_WT, pcAANAT-Prf1_D1 or pcAANAT-Prf1_D2 were simultaneously transduced into the HEK293T cells of Example 1-3 in the same manner as in Example 3-1, and then Example 5- Immunoblot was performed in the same manner as 2 to confirm the expression levels of AANAT and GAPDH proteins. In addition, real-time PCR was performed on the cells transduced in the same manner as in Example 5-2 to confirm the AANAT mRNA expression level. The results are shown in Figure 4d.

As a result, as shown in Figure 4d, although the reporter pcAANAT-Prf1_D1 reporter decreased the expression of the reporter gene compared to pcAANAT-Prf1_WT, pcAANAT-Prf1_D2 without any miR-27a ^* -binding site is supposed to suppress the reporter gene expression Was observed to be reduced by about three times.

In addition, the inventors transduced the pcAANAT-Prf1_M and pcAANAT-GzmB_M at the same time with the control miRNA, miR-27a ^* or miR-27a ^* M (mutant miR-27a ^* ), respectively, in the HEK293T cells of Examples 1-3 Immunoblot was performed in the same manner as in Example 5-2, and the expression levels of AANAT and GAPDH proteins were confirmed.

As a result, the 3'UTR mutations (Prf1_M and GzmB_M) complementary to miR-27a ^* mutations (miR-27a ^* M), as shown in Figure 4E, are inhibited by miR-27a ^* M, but miR-27a ^* as expected Was not suppressed. From the above results, the present inventors confirmed that miR-27a ^* targets a specific nucleotide sequence of 3′-UTR to inhibit both Prf1 and GzmB expression.

miR -27a ^* of NK  Confirmation of Biological Function in Cells

<6-1> NK  By cell activation miR -27a ^*  Identify differences in response to expression

We have found that miR-27a ^* inhibits the expression of Prf1 and GzmB, which are essential for cytotoxicity of NK cells. Next, in NK cells to determine the biological function of miR-27a ^*, it was carried out in the resting and activated NK cells, miR-27a ^* knockdown (knockdown) experiments.

First, the control miRNA, miR-27a ^* or miR-27a ^* inhibitors were transduced in the same manner as in Example 3-1 to the mNK cells of Example 1-2, and then in the transduced cells Immunoblot was performed in the same manner as in 2-1, and ⁵¹ Cr-release assay was performed in the same manner as in Example 2-2. The results are shown in FIG. 5A together.

As a result, as shown in FIG. 5A, when the miR-27a ^* inhibitor was transduced, the expression levels of Prf1 and GzmB increased by 2 times as compared with mNK cells transduced with control miRNAs in resting mNK cells. It was confirmed that the cytotoxicity of NK cells is also increased. However, resting mNK cells transduced with miR-27a ^* showed little change in Prf1 and GzmB expression and cytotoxicity.

<6-2> NK  Cell activation miR -27a ^* Increased expression of

To confirm the biological function of miR-27a ^* in NK cells, we performed IL-15 dose-dependency experiments in resting and activated NK cells.

First, primer pairs for miR-27a ^* or U6 snRNA included in the TaqManMicroRNA Assays Kit were prepared in the mNK cells of Example 1-2, which were not treated with IL-15 or treated with 330 ng / ml or 60 ng / ml. Semi-quantitative PCR was carried out in the same manner as in Example 2-5, and real-time PCR for GzmB and Prf1 mRNA was performed in the same manner as in Example 2-3. It shows the relative amount of the miR-27a ^* Relative value (miR-27a ^* / U6) and GzmB and Prf1 mRNA for the snRNA U6 in Figure 5b to the result in each graph.

As a result, as shown in Figure 5b, when stimulated with IL-15, mNK cells increased the expression of Prf1 mRNA, GzmB mRNA and miR-27a ^* with increasing IL-15 (dose)

In addition, the immunoblot was performed in the same manner as in Example 2-1 in the cells treated in the same manner as described above, and the ⁵¹ Cr-release assay was performed in the same manner as in Example 2-2. The results are shown in FIG. 5C together.

As a result, as shown in FIG. 5C, once the expression of Prf1 and GzmB proteins was increased, there was little change. This was consistent with the cytotoxicity of NK cells. As a result of the experiment, the present inventors found that miR-27a ^* induced by IL-15 inhibits the expression of the target protein.

<6-3> NK  In a cell miR -27a ^* On by Prf1  And GzmB Check the adjustment of

In order to verify that the expression of Prf1 and GzmB in NK cells is regulated by miR-27a ^* , we performed immunoblot in the same manner as in Example 2-1 in mNK cells and NK92 cell lines, Example 2-5. Semi-quantitative PCR was performed in the same manner as. The results are shown in FIG. 5D together.

As a result, as shown in FIG. 5D, NK92 cells showed similar or decreased mRNA expression, compared with mNK cells, whereas Prf1 and GzmB expressions were high. As expected, NK92 cells had less miR-27a ^* present intracellularly than mNK cells.

<6-4> invite NK  In a cell miR -27a ^* On by Prf1  And GzmB Check the adjustment of

In order to determine whether miR-27a ^* decreases the expression of Prf1 and GzmB occurs in human mNK cells and NK92 cell lines differentiated in vitro, primary NK isolated from umbilical cord blood cells extracted from human umbilical cord The function of miR-27a ^* was confirmed in the cell. The primary NK cells of Example 1-1 were FACS analyzed by the method of Example 1-1 to indicate the number of cells simultaneously having CD56 and CD16, which are marker markers of NK cells, as a percentage in FIG. 6A. In the first NK cells (CD3 ⁻ , CD56 ⁺ , CD16 ⁺ ) of Example 1-1, a control miRNA or miR-27a ^* was transduced in the same manner as in Example 3-1, followed by anti-Prf1 antibody, anti The immunoblot was performed in the same manner as in Example 2-1 using the -GzmB antibody, the anti-ERK antibody and the anti-GAPDH antibody, and the ⁵¹ Cr-release assay was performed in the same manner as in Example 2-2, respectively. The results are shown together in Figure 6b.

As a result, as shown in FIG. 6B, primary NK cells transduced with miR-27a ^* similarly to mNK cells confirmed that cytotoxicity was reduced simultaneously with specific inhibition of Prf1 and GzmB. As expected, primary NK cells transduced with miR-27a ^* inhibitors showed contrasting results. Based on the experimental results, the present inventors suggested that miR-27a ^* plays a major role in regulating the expression of Prf1 and GzmB in post-transcriptional regulation.

Human cancer xenograft mouse model in vivo )in miR -27a ^* end NK  Determine the effect on cell cytotoxicity

The present inventors confirmed that miR-27a ^* plays a role in reducing cytotoxicity of mNK cells by targeting both Prf1 and GzmB to inhibit protein expression. In order to confirm that the function of this miR-27a ^* is maintained in vivo, the following experiment was performed (FIG. 7A).

<7-1> Preparation of Xenograft Mouse

We prepared a xenograft mouse model to examine the effect of miR-27a ^* on cytotoxicity of NK cells in human cancer xenograft models. Specifically, female BALB / c nude mice (BALB / c-nu / nu, 5 weeks old, SLC, Japan) were purchased from SLC (Hamahatsu). The mice were kept at 21 ± 2 ° C. for 12 hours with a light-dark cycle and acclimated to the environment for 1 week before entering the experiment. All animal experiments of the present invention were approved by the Institutional Animal Care and Use Committee of the Korea Research Institute of Bioscience and Biotechnology. The mouse was injected subcutaneously with ^six SW480 610 of Examples 1-3.

<7-2> miR -27a ^* The effects on cancer

Seven days after injection, the mice were intravenously injected with mNK cells (2.8 × 10 ⁶ ) transduced with PBS, control miRNA, miR-27a ^* or miR-27a ^* inhibitor in the same manner as in Example 3-1. Injected twice in two hours by injection. Doxorubicin (Sigma) (2 mg / kg) was administered intraperitoneally every other day. Then, the size of the cancer generated in the mouse was measured using a caliper (caliper), the size was calculated according to the following equation (1). The body weight of each mouse was measured three times a week throughout the experiment. Cancer size, cancer tissue size change, average size of cancer, cancer size inhibition rate, and weight change for each group are shown in FIGS. 7B to 7F, respectively.

As a result, as shown in Figs. 7b to 7f, the average size of the cancer of the cancer xenograft model mouse was 240 ± 28 mm ³ on day 22. Cancer growth was significantly reduced due to mNK cells transduced with miR-27a ^* . In contrast, mNK cells transduced with miR-27a ^* inhibitors increased cytotoxicity against cancer. MNK cells transduced with control miRNAs inhibited 46% cancer growth on day 22, whereas mNK cells transduced with miR-27a ^* or miR-27a ^* inhibitors showed cancer growth of 27.2% and 65.1%, respectively. Was suppressed. The effect of mNK cells transduced with miR-27a ^* inhibitors on cancer growth was compared to doxorubicin, a cytotoxic drug currently used for cancer chemotherapy. The inhibitory effect of mNK cells transduced with miR-27a ^* inhibitors in cancer growth was longer than that of control miRNAs or mNK cells transduced with miR-27a ^* . The extent of cancer growth inhibition by mNK cells transduced with control miRNA or miR-27a ^* was gradually decreased after 5 days. However, the introduction of miR-27a ^* inhibitors in vitro suggests that miR-27a ^* inhibitors will be effective in both the degree and duration of cytotoxicity of mNK cells against cancers that grow. The cancer growth inhibitory effect in the mNK cells maintained until 22 days. The weight of cancer xenograft model mice was not changed by mNK cell treatment, but the weight of doxorubicin-treated mice was significantly reduced. Based on the experimental results, the present inventors confirmed that miR-27a ^* is an essential inhibitor of cytotoxicity of NK cells against cancer in vivo, suggesting that microRNA is an important target molecule for anticancer treatment using NK cells.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Activation method for Natural killer cell via regulating microRNA          expression <130> 9p-12-09 <160> 44 <170> KopatentIn 1.71 <210> 1 <211> 2529 <212> RNA <213> Homo sapiens perforin 1 (pore forming protein) (PRF1), transcript <400> 1 gaagugaugu gagugguggc uggugcaagg agccacagug ggcugccugg ggggcugaug 60 ccaccauucc aggagccucg gugaagagag gauauccauc uguguagccg cuucucuaua 120 cgggauucca gcuccauggc agcccgucug cuccuccugg gcauccuucu ccugcugcug 180 ccccugcccg ucccugcccc gugccacaca gccgcacgcu cagagugcaa gcgcagccac 240 aaguucgugc cuggugcaug gcuggccggg gagggugugg acgugaccag ccuccgccgc 300 ucgggcuccu ucccagugga cacacaaagg uuccugcggc ccgacggcac cugcacccuc 360 ugugaaaaug cccuacagga gggcacccuc cagcgccugc cucuggcgcu caccaacugg 420 cgggcccagg gcucuggcug ccagcgccau guaaccaggg ccaaagucag cuccacugaa 480 gcuguggccc gggaugcggc ucguagcauc cgcaacgacu ggaaggucgg gcuggacgug 540 acuccuaagc ccaccagcaa ugugcaugug ucuguggccg gcucacacuc acaggcagcc 600 aacuuugcag cccagaagac ccaccaggac caguacagcu ucagcacuga cacgguggag 660 ugccgcuucu acaguuucca ugugguacac acucccccgc ugcacccuga cuucaagagg 720 gcccucgggg accugcccca ccacuucaac gccuccaccc agcccgccua ccucaggcuu 780 aucuccaacu acggcaccca cuucauccgg gcuguggagc uggguggccg cauaucggcc 840 cucacugccc ugcgcaccug cgagcuggcc cuggaagggc ucacggacaa cgagguggag 900 gacugccuga cugucgaggc ccaggucaac auaggcaucc acggcagcau cucugccgaa 960 gccaaggccu gugaggagaa gaagaagaag cacaagauga cggccuccuu ccaccaaacc 1020 uaccgggagc gccacucgga agugguuggc ggccaucaca ccuccauuaa cgaccugcug 1080 uucgggaucc aggccgggcc cgagcaguac ucagccuggg uaaacucgcu gcccggcagc 1140 ccuggccugg uggacuacac ccuggaaccc cugcacgugc ugcuggacag ccaggacccg 1200 cggcgggagg cacugaggag ggcccugagu caguaccuga cggacagggc ucgcuggagg 1260 gacugcagcc ggccgugccc accagggcgg cagaagagcc cccgagaccc augccagugu 1320 gugugccaug gcucagcggu caccacccag gacugcugcc cucggcagag gggccuggcc 1380 cagcuggagg ugaccuucau ccaagcaugg ggccuguggg gggacugguu cacugccacg 1440 gaugccuaug ugaagcucuu cuuugguggc caggagcuga ggacgagcac cgugugggac 1500 aauaacaacc ccaucugguc agugcggcug gauuuugggg augugcuccu ggccacaggg 1560 gggccccuga gguugcaggu cugggaucag gacucuggca gggacgauga ccuccuuggc 1620 accugugauc aggcucccaa gucugguucc caugagguga gaugcaaccu gaaucauggc 1680 caccuaaaau uccgcuauca ugccaggugc uugccccacc ugggaggagg caccugccug 1740 gacuaugucc cccaaaugcu ucugggggag ccuccaggaa accggagugg ggccgugugg 1800 ugagaacagu gagcuuggaa aggaccagua ugcuuggacu gaagggguuc ucacaguggg 1860 agccagggcu gucuucguau ucccauuaga ccaagcuugu ccaacccgag gcccgcaugc 1920 ggcccaggau ggcuuugaau gcggcccaac gcaaauucgc aaacuuucuu aaaacauuau 1980 gaguuucuuu uugcuauuuu uuuuuuuuuu uuagcucauc ggcuaucguu agugcuagug 2040 gauuuuacau guggcccaac acaauucuuc uuccaacgug gcccagagaa gccaaaagau 2100 uggauacgca ucagacagau ggaaaaggga gauucagacu guuuuucagg gagguggcug 2160 gguuuacacg cuaaucccga uucacccugu ccaaacugcc uaagcccucc gccauucuca 2220 agcccugcag ucacagcuac acagaucaca gcuucagcca ggagcugggc agaaggccaa 2280 gaggcuguuc ccaccaggcu gcucagggcu ggucuuuuag gacccuuccc uugagcccuc 2340 uauggugugg caaagccuuc auugccuuaa cuggagcccc aucagcucca gcugcucugu 2400 cuucuuugcc cacaaugcuu ugccccugag acaaauggag gccuguccug accugucuca 2460 ccauguacau agcuugauaa agggccaaua aauaugaugu uauggugaaa aaaaaaaaaa 2520 aaaaaaaaa 2529 <210> 2 <211> 941 <212> RNA Homo sapiens granzyme B mRNA. <400> 2 ccaagagcua aaagagagca aggaggaaac aacagcagcu ccaaccaggg cagccuuccu 60 gagaagaugc aaccaauccu gcuucugcug gccuuccucc ugcugcccag ggcagaugca 120 ggggagauca ucgggggaca ugaggccaag ccccacuccc gccccuacau ggcuuaucuu 180 augaucuggg aucagaaguc ucugaagagg ugcgguggcu uccugauacg agacgacuuc 240 gugcugacag cugcucacug uuggggaagc uccauaaaug ucaccuuggg ggcccacaau 300 aucaaagaac aggagccgac ccagcaguuu aucccuguga aaagacccau cccccaucca 360 gccuauaauc cuaagaacuu cuccaacgac aucaugcuac ugcagcugga gagaaaggcc 420 aagcggacca gagcugugca gccccucagg cuaccuagca acaaggccca ggugaagcca 480 gggcagacau gcaguguggc cggcuggggg cagacggccc cccugggaaa acacucacac 540 acacuacaag aggugaagau gacagugcag gaagaucgaa agugcgaauc ugacuuacgc 600 cauuauuacg acaguaccau ugaguugugc gugggggacc cagagauuaa aaagacuucc 660 uuuaaggggg acucuggagg cccucuugug uguaacaagg uggcccaggg cauugucucc 720 uauggacgaa acaauggcau gccuccacga gccugcacca aagucucaag cuuuguacac 780 uggauaaaga aaaccaugaa acgcuacuaa cuacaggaag caaacuaagc ccccgcugua 840 augaaacacc uucucuggag ccaaguccag auuuacacug ggagaggugc cagcaacuga 900 auaaauaccu cuuagcugag uggaaaaaaa aaaaaaaaaa a 941 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Prf1 sense primer <400> 3 gctggacgtg actcctaagc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Prf1 antisense primer <400> 4 gatgaagtgg gtgccgtagt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GzmA sense primer <400> 5 agctgacgga aaaagcaaaa 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GzmA antisense primer <400> 6 agggcttcca gaatctccat 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GzmB sense primer <400> 7 gtaaggggga aacaacagca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GzmB antisense primer <400> 8 ccccaaggtg acatttatgg 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH sense primer <400> 9 gccatcaatg accccttcat t 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH antisense primer <400> 10 gctcctggaa gatggtgatg g 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Dicer1 sense primer <400> 11 atgaatggaa aatgcccaaa 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Dicer1 antisense primer <400> 12 cagaacccca ccacaaagtc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IFN-gamma sense primer <400> 13 tccaacgcaa agcaatacat 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> IFN-gamma antisense primer <400> 14 gcaggcagga caaccattac 20 <210> 15 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-15a mimics <400> 15 uagcagcaca uaaugguuug ug 22 <210> 16 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-204 mimics <400> 16 uucccuuugu cauccuaugc cu 22 <210> 17 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-27a * mimics <400> 17 agggcuuagc ugcuugugag ca 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-15a inhibitor <400> 18 cacaaaccat tatgtgctgc ta 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-204 inhibitor <400> 19 aggcatagga tgacaaaggg aa 22 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> miR-27a * inhibitor <400> 20 tgctcacaag cagctaagcc ct 22 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Prf1_WT sense primer <400> 21 aagaattctg agaacagtga gcttgg 26 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Prf1_WT antisense primer <400> 22 aatctagaca ccataacatc atatt 25 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GzmB_WT sense primer <400> 23 aagaattcct acaggaagca aacta 25 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GzmB_WT antisense primer <400> 24 atctagacca ctcagctaag aggt 24 <210> 25 <211> 707 <212> DNA <213> human Pfr1 3UTR_WT <400> 25 tgagaacagt gagcttggaa aggaccagta tgcttggact gaaggggttc tcacagtggg 60 agccagggct gtcttcgtat tcccattaga ccaagcttgt ccaacccgag gcccgcatgc 120 ggcccaggat ggctttgaat gcggcccaac gcaaattcgc aaactttctt aaaacattat 180 gagtttcttt ttgctatttt tttttttttt ttagctcatc ggctatcgtt agtgctagtg 240 gattttacat gtggcccaac acaattcttc ttccaacgtg gcccagagaa gccaaaagat 300 tggatacgca tcagacagat ggaaaaggga gattcagact gtttttcagg gaggtggctg 360 ggtttacacg ctaatcccga ttcaccctgt ccaaactgcc taagccctcc gccattctca 420 agccctgcag tcacagctac acagatcaca gcttcagcca ggagctgggc agaaggccaa 480 gaggctgttc ccaccaggct gctcagggct ggtcttttag gacccttccc ttgagccctc 540 tatggtgtgg caaagccttc attgccttaa ctggagcccc atcagctcca gctgctctgt 600 cttctttgcc cacaatgctt tgcccctgag acaaatggag gcctgtcctg acctgtctca 660 ccatgtacat agcttgataa agggccaata aatatgatgt tatggtg 707 <210> 26 <211> 113 <212> DNA <213>> human Gzmb 3 UTR_WT <400> 26 ctacaggaag caaactaagc ccccgctgta atgaaacacc ttctctggag ccaagtccag 60 atttacactg ggagaggtgc cagcaactga ataaatacct cttagctgag tgg 113 <210> 27 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Prf1_D1 sense primer <400> 27 aagaattctg agaacagtga gcttgg 26 <210> 28 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Prf1_D1 antisense primer <400> 28 aatctagact gcagggcttg agaatg 26 <210> 29 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Prf1_D2 sense primer <400> 29 aagaattctg agaacagtga gcttgg 26 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Prf1_D2 antisense primer <400> 30 aatctagatt gcgaatttgc gttggg 26 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Prf1_M 1st sense primer <400> 31 agaattctga gaacagtgag cttgg 25 <210> 32 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Prf1_M 1st antisense primer <400> 32 gaatggcgga cgcgttacgc agtttgg 27 <210> 33 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Prf1_M 2nd sense primer <400> 33 ccaaactgcg taacgcgtcc gccattc 27 <210> 34 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Prf1_M 2nd antisense primer <400> 34 aatctagaca ccataacatc atatt 25 <210> 35 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Prf1_M final sense primer <400> 35 agaattctga gaacagtgag cttgg 25 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Prf1_M final antisense primer <400> 36 aatctagaca ccataacatc atatt 25 <210> 37 <211> 707 <212> DNA <213> Artificial Sequence <220> <223> Prf1_M <400> 37 tgagaacagt gagcttggaa aggaccagta tgcttggact gaaggggttc tcacagtggg 60 agccagggct gtcttcgtat tcccattaga ccaagcttgt ccaacccgag gcccgcatgc 120 ggcccaggat ggctttgaat gcggcccaac gcaaattcgc aaactttctt aaaacattat 180 gagtttcttt ttgctatttt tttttttttt ttagctcatc ggctatcgtt agtgctagtg 240 gattttacat gtggcccaac acaattcttc ttccaacgtg gcccagagaa gccaaaagat 300 tggatacgca tcagacagat ggaaaaggga gattcagact gtttttcagg gaggtggctg 360 ggtttacacg ctaatcccga ttcaccctgt ccaaactgcg taacgcgtcc gccattctca 420 agccctgcag tcacagctac acagatcaca gcttcagcca ggagctgggc agaaggccaa 480 gaggctgttc ccaccaggct gctcagggct ggtcttttag gacccttccc ttgagccctc 540 tatggtgtgg caaagccttc attgccttaa ctggagcccc atcagctcca gctgctctgt 600 cttctttgcc cacaatgctt tgcccctgag acaaatggag gcctgtcctg acctgtctca 660 ccatgtacat agcttgataa agggccaata aatatgatgt tatggtg 707 <210> 38 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> GzmB_M sense primer <400> 38 aagaattcta caggaagcaa agtaacgcgc cgc 33 <210> 39 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GzmB_M antisense priemr <400> 39 aatctagacc actcagctaa gaggt 25 <210> 40 <211> 113 <212> DNA <213> GzmB_M <400> 40 ctacaggaag caaagtaacg cgccgctgta atgaaacacc ttctctggag ccaagtccag 60 atttacactg ggagaggtgc cagcaactga ataaatacct cttagctgag tgg 113 <210> 41 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> AANAT sense priemr <400> 41 cccaagctgc gcacttgg 18 <210> 42 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> AANAT antisense priemr <400> 42 gggaacatag ctgcttta 18 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NeoR sense priemr <400> 43 atgactgggc acaacagaca 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NeoR antisense priemr <400> 44 agtgacaacg tcgagcacag 20

Claims (16)

NK cell production with increased cytotoxicity comprising transducing an NK cell under in vitro conditions with an expression vector comprising a nucleic acid sequence encoding an inhibitor of miR-27a ^* having the nucleotide sequence set forth in SEQ ID NO: 17 Way.
An increase in cytotoxicity comprising transducing an NK cell under in vitro conditions with an expression vector comprising the nucleic acid sequence set forth in SEQ ID NO: 37 or SEQ ID NO: 40 comprising a mutation at the site to which miR-27a ^* binds NK cell preparation method.
The method of claim 1 or 2, further comprising the step of identifying whether the expression of Prf1 and GzmB proteins in said NK cells is increased.
The method of claim 1 or 2, further comprising the step of identifying whether said NK cell activity is increased.
The method of claim 4, wherein the activity of the NK cells is increased
Iii) a method of confirming that IFN-γ production in the experimental group was increased compared to the control group when the cells were stimulated with IL-15; or,
Ii) a method of confirming whether the target cell killing ability of the experimental group is increased compared to the control group.
1) treating the test compound to a cell expressing miR-27a ^* ;
2) measuring the expression level of miR-27a ^* in the treated cells of step 1); And,
3) A screening method for an anticancer agent comprising the step of selecting a test compound having a reduced expression level of miR-27a ^* in step 2) compared to a control.
The method of claim 6, wherein the test compound is any one selected from the group consisting of natural compounds, synthetic compounds, RNA, DNA, polypeptides, enzymes, proteins, ligands, antibodies, antigens, metabolites of bacteria or fungi and bioactive molecules. Method characterized in that.
According to claim 6, wherein the miR-27a ^* expression level is RT-PCR, quantitative or semi-quantitative RT-PCR (Quentitative or semi-Quentitative RT-PCR), quantitative or semi-quantitative real-time PCR (Quentitative or semi-Quentitative real -time PCR), Northern blot (northern blot) and DNA or RNA chip (chip) characterized in that any one method selected from the group consisting of.
NK cells activated by the method of claim 1.
NK cells activated by the method of claim 2.
A pharmaceutical composition for preventing or treating cancer, comprising the NK cell of claim 1 or 2 as an active ingredient.
The method of claim 11, wherein the cancer is any one selected from the group consisting of lung cancer, liver cancer, stomach cancer, colon cancer, bladder cancer, prostate cancer, breast cancer, ovarian cancer, cervical cancer, thyroid cancer, melanoma and hematologic cancer. Pharmaceutical compositions.
The pharmaceutical composition of claim 12, wherein the cancer is any one selected from the group consisting of colorectal cancer and hematologic cancer.
A pharmaceutical composition for NK cell activation comprising an inhibitor of miR-27a ^* having the nucleotide sequence set forth in SEQ ID NO: 17 as an active ingredient.
15. The method of claim 14, wherein the inhibitor of miR-27a ^* is a pharmaceutical composition, characterized in that the miR-27a ^* of antisense nucleotides that bind complementarily.
The pharmaceutical composition of claim 15, wherein the inhibitor of miR-27a ^* is a polynucleotide set forth in SEQ ID NO: 20.

Images