KR20110084487A - Method for detecting methylation of colorectal cancer specific methylation marker gene for colorectal cancer diagnosis - Google Patents

Abstract

PURPOSE: A method for detecting methylation of a marker is provided to detect methylation of CpG island of a marker gene and to diagnose intestinal cancer. CONSTITUTION: A method for detecting methylation of a marker comprises a step of detecting CpG island of SORCS3(NM_014978, sortilin-related VPS10 domain containing receptor 3) gene or CpG island of a promoter of the gene from DNAs of a clinical sample. The clinical sample is selected from the group consisting of a tissue, blood, serum, feces, and urine. A composition for diagnosing intestinal cancer contains the SORCS3 gene CpG island or CpG island of the promoter thereof.

Description

Method for Detecting Methylation of Colorectal Cancer Specific Methylation Marker Gene for Colorectal Cancer Diagnosis}

The present invention relates to a method for detecting methylation of a bowel cancer-specific methylation marker gene for diagnosis of bowel cancer, and more specifically, to detect methylation of a bowel cancer-specific marker gene that is specifically methylated in bowel cancer cells to provide information for diagnosis of bowel cancer. It's about how to do it.

Even today, when medicine is developed, human cancers, especially solid tumors, which account for the majority, have a 5-year survival rate of less than 50%. About two-thirds of all cancer patients are found in advanced stages, and most of them die within two years after diagnosis. This is because the poor therapeutic effect of cancer is not only a problem of the treatment, but it is not easy to accurately diagnose advanced cancer and follow-up after treatment, as well as a method for early diagnosis of actual cancer.

Currently, cancer diagnosis in clinical practice is carried out through a history taking, physical examination, and clinical pathology examination, and once suspected, it is proceeded with radiographic examination and endoscopy, and finally, it is confirmed with a biopsy. However, it is possible to diagnose cancer only when the number of cancer cells is 1 billion cells and the diameter of the cancer is more than 1 cm by the existing clinical test method. In this case, cancer cells already have metastatic ability, and in fact, more than half of the cancer has already metastasized. On the other hand, tumor markers that search for substances produced by cancer directly or indirectly in the blood are used for cancer screening, which is limited in accuracy and appears to be up to half normal even when cancer is present. Even in the absence of it, it often appears positive and causes confusion. In addition, in the case of an anticancer agent mainly used for the treatment of cancer, there is a problem that the effect is shown only when the volume of the cancer is small.

As described above, both diagnosis and treatment of cancer are difficult because there are many differences from normal cells, and they are very complex and diverse. Cancer continues to grow arbitrarily in excess, is freed from death and continues to survive, invades surrounding tissues and spreads (metastases) to distal organs, causing human death. It survives the attack of immune mechanisms or chemotherapy, constantly evolves, and the cell group (clone) that is most advantageous for survival selectively proliferates. Cancer cells are living organisms with high viability caused by mutations in a number of genes. In order to transform a single cell into a cancer cell and develop into a malignant cancer mass seen in clinical practice, mutations in a number of genes must occur. Therefore, in order to diagnose and treat cancer fundamentally, it is necessary to approach it at the genetic level.

Recently, genetic testing has been actively attempted to diagnose cancer. The simplest and most representative method is to find the presence or absence of the ABL:BCR fusion gene, a genetic indicator of leukemia, in the blood by PCR. It has an accuracy of more than 95%, and is a simple and easy test that is useful for diagnosis of chronic myelogenous leukemia, evaluation of results after treatment, and follow-up. However, this method is applicable only for a small number of hematologic cancers.

In addition, a method of diagnosing cancer cells coexisting in blood cells has also been attempted by grasping the presence of genes expressed by cancer cells by RT-PCR and blotting. However, this method is applicable only to some cancers such as prostate cancer and melanoma, has many false positive rates, it is difficult to standardize test and reading methods, and its usefulness is also limited (Kopreski, MS et al ., Clin . Cancer Res . , 5:1961, 1999; Miyashiro, I. et al ., Clin . Chem . , 47:505, 2001).

Genetic testing using DNA in serum or plasma has been actively attempted in recent years. This is a method of finding cancer-related genes that are separated from cancer cells and come out of the blood to exist as free DNA in the serum. In fact, in cancer patients, the DNA concentration in the serum is increased to 5-10 times that of normal people, and it has been found that most of this increased DNA is released from cancer cells. Cancer can be diagnosed by analyzing gene abnormalities specific to cancer, such as mutations, loss, and loss of function of oncogenes and tumor suppressor genes with DNA free from these cancers. In actual serum, lung cancer, head and neck cancer, breast cancer, colon cancer, and the like by examining mutant K-Ras oncogene, p53 tumor suppressor gene, promoter methylation of p16 gene, and microsatellite labeling and instability, etc. It has been actively attempted to diagnose liver cancer, etc. (Chen, XQ et al ., Clin . Cancer Res . , 5:2297, 1999; Esteller, M. et al ., Cancer Res . , 59:67, 1999; Sanchez-Cespedes, M. et al ., Cancer Res . , 60:892, 2000; Sozzi, G. et al ., Clin . Cancer Res . , 5:2689, 1999).

On the other hand, cancer DNA can be tested in samples other than blood. In lung cancer patients, a method of finding the presence of cancer cells and cancer genes in sputum or bronchoalveolar lavage by genetic or antibody tests has been attempted (Palmisano, WA et. al ., Cancer Res . , 60:5954, 2000; Sueoka, E. et al ., Cancer Res . , 59:1404, 1999), a method of finding cancer genes present in stool in bowel cancer (Ahlquist, DA et al ., Gastroenterol . , 119:1219-27, 2000) and a method for examining promoter methylation abnormalities present in urine and prostate fluid (Goessl, C. et al. al ., Cancer Res . , 60:5941, 2000) are also being tried. However, in order to accurately diagnose cancers accompanying multiple gene abnormalities and showing various mutations for each individual cancer, a method of simultaneously and accurately automatic analysis of multiple genes is required, but such a method has not been established yet.

Accordingly, recently, methods for diagnosing cancer through DNA methylation measurement have been proposed. When the promoter CpG island of a specific gene is hypermethylated, the expression of that gene is blocked (gene silencing). This is the main mechanism in which the function of the gene is lost even without mutation in the protein-specific coding sequence of the gene in vivo, and the function of a number of tumor suppressor genes is lost in human cancer. It is interpreted as a cause. Therefore, searching the methylation of the promoter CpG island of the tumor suppressor gene is of great help in cancer research, and it is used for diagnosis and screening of cancer by testing it by methylation-specific PCR (hereinafter referred to as MSP) or automatic base analysis. Attempts to do this have been actively made in recent years.

Many diseases are caused by genetic abnormalities, and the most common form of genetic abnormalities is a change in the coding sequence of a gene, and such genetic changes are called mutations. When there is a mutation in a gene, the protein that the gene encodes changes structure and function, resulting in disorders and defects, and these mutant proteins cause disease. However, even without mutations in a specific gene, an abnormality in the expression of that gene can cause disease. A typical example is methylation in which a methyl group is attached to the regulatory site of gene transcription, that is, the cytosine base site of the promoter CpG island. In this case, the gene is blocked from expression. This is called an extragenetic change, and it is transmitted to progeny cells like a mutation, and causes the same effect, that is, loss of expression of the corresponding protein. The most representative is that the expression of tumor suppressor genes is blocked by methylation of the promoter CpG island in cancer cells, which is an important mechanism for carcinogenesis (Robertson, KD et al. al ., Carcinogensis , 21:461, 2000).

In order to accurately diagnose cancer, it is important not only to identify the mutant gene, but also to understand the mechanism by which the mutation occurs. Previously, studies have focused on mutations in the coding sequence of genes, that is, micro-changes such as point mutations, deletions, and insertions, and macroscopic chromosomal abnormalities. However, in recent years, it has been reported that extragenic changes are as important as these, and a representative one is methylation of the promoter CpG island.

In the genomic DNA of mammalian cells, in addition to A, C, G, and T, the fifth base is present, which is 5-methylcytosine (5-mC) with a methyl group attached to the fifth carbon of the cytosine ring. 5-mC always comes only to the C of the CG dinucleotide (5'-mCG-3'), and this CG is often referred to as CpG. Most of C in CpG is methylated with a methyl group attached. This methylation of CpG inhibits the expression of repetitive sequences in the genome, such as alu and transposon, and is the most common site of extragenic changes in mammalian cells. The 5-mC of CpG is naturally deaminated to change to T, and accordingly, CpG in the mammalian genome only has a frequency of 1%, which is much lower than the normal frequency (1/4 x 1/4 = 6.25%). Show.

Some of the CpGs appear exceptionally densely, and they are called CpG islands. CpG islands are 0.2~3kb in length, the distribution percentage of C and G bases exceeds 50%, and the distribution percentage of CpG is higher than 3.75%. About 45,000 CpG islands appear in the entire human genome, and they appear especially concentrated in the promoter region that controls the expression of genes. In fact, CpG islands appear in the promoters of housekeeping genes, which account for about half of human genes (Cross, S. et al., Curr . Opin . Gene). Develop . , 5:309, 1995).

On the other hand, in the somatic cells of normal humans, the CpG islands of these important gene promoter regions are not methylated, but the imprinted genes and inactivated genes on the X chromosome are methylated so that they are not expressed during development.

During the carcinogenesis process, methylation appears on the promoter CpG island, and the expression of the corresponding gene is impaired. In particular, when methylation occurs in the promoter CpG island of tumor suppressor genes that regulate cell cycle or apoptosis, repair DNA, participate in cell adhesion and intercellular coordination, and inhibit invasion and metastasis, this Like mutations, it blocks the expression and function of these genes, and as a result, the development and progression of cancer is promoted. In addition, methylation may appear partially on CpG islands with aging.

Interestingly, mutations are the cause of carcinogenesis in congenital cancers, but in the case of genes that do not show mutations in acquired cancers, methylation of the promoter CpG island appears instead of mutations. Representative examples include promoter methylation of genes such as VHL (von Hippel Lindau) in acquired kidney cancer, BRCA1 in breast cancer, MLH1 in colorectal cancer, and E-CAD in gastric cancer. In addition, about half of all cancers exhibited promoter methylation of p16 or mutation of Rb, and the other half showed a mutation of p53 or promoter methylation of p73, p14, etc. as its family.

It is important to note that the extragenic change caused by methylation of the promoter causes gene change, that is, mutation of the coding sequence, and carcinogenesis proceeds by combining these genes and extragenic changes. For example, in colorectal cancer cells, one allele of the MLH1 gene has lost its function due to mutation or deletion, and the other allele has a failure due to promoter methylation. In addition, when the function of the DNA repair gene, MLH1, is lost due to promoter methylation, it promotes carcinogenesis by facilitating mutations in other important genes.

Most cancers show three common characteristics for CpG: hypermethylation of the promoter CpG island of the tumor suppressor gene, undermethylation of the remaining CpG base sites, and increased activity of the methylation enzyme, DNA cytosine methyltransferase (DNMT). (Singal, R. & Ginder, GD, Blood , 93:4059, 1999; Robertson, K. et al. al ., Carcinogensis , 21:461, 2000; Malik, K. & Brown, KW, Brit . J. Cancer , 83:1583, 2000).

When the promoter CpG island is methylated, the reason why the expression of the gene is blocked is not clear, but methyl CpG adhesion protein (MECP), CpG adhesion domain protein (MBD), and histone DNA are found in methylated cytosine. It is presumed that this is because acetylase (histone deacetylase) changes the chromatin structure of the chromosome and changes the histone.

Whether methylation of the promoter CpG islet directly induces carcinogenesis, or whether this is a secondary change in carcinogenesis, is controversial, but it is clear that promoter methylation of tumor-associated genes is an important indicator of cancer, and therefore it is possible to diagnose cancer and early It can be used in a variety of ways, such as diagnosis, prediction of cancer risk, prediction of cancer prognosis, follow-up after treatment, and response to chemotherapy. In fact, attempts have been made to investigate the methylation of promoters of tumor-related genes in blood, sputum, saliva, feces, urine, etc., and use them in various cancer treatments (Esteller, M. et al. al ., Cancer Res . , 59:67, 1999; Sanchez-Cespedez, M. et al ., Cancer Res . , 60:892, 2000; Ahlquist, DA et al., Gastroenterol . , 119:1219, 2000).

In order to maximize the accuracy of cancer diagnosis using promoter methylation, analyze carcinogenesis step by step, and discriminate changes according to cancer and aging, a test that can accurately analyze all the methylation of all cytosine bases of the promoter CpG island is required. Currently, the standard method for this is the bisulfite genome sequencing method. This is to treat the sample DNA with sodium bisulfite, amplify the entire region of the CpG island to be tested of the target gene by PCR, and then analyze the base sequence. However, this test has a limitation in the number of genes or samples that can be tested at one time, it is difficult to automate, and it takes a lot of time and cost.

At Johns Hopkins Medical School, MD Anderson Cancer Center, and Berlin Medical University, studies on promoter methylation of cancer-related genes are actively underway. The basic data obtained in this way are being exchanged by the DNA Methylation Society (DMS), and the data of MethDB (http://www.methdb.de) are being stored. Meanwhile, EpiGenX Pharmaceuticals is developing a therapeutic agent related to methylation of CpG islands, and Epigenomics is conducting research to apply it to cancer diagnosis by testing promoter methylation using techniques such as DNA chip and MALDI-TOF.

Accordingly, the present inventors have made diligent efforts to develop effective bowel cancer-specific methylation markers capable of early diagnosis, carcinogenic risk, or predicting the prognosis of cancer.As a result, SDC2 (NM_002998, Syndecan 2, Syndecan 2), SIM1 (NM_05068, single minded Homolog 1 (Drosophila), Single-minded homolog 1) and SORCS3 (NM_014978, sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3) genes are specifically methylated in intestinal cancer cells. , Using this as a biomarker, it was confirmed that bowel cancer can be diagnosed by measuring the degree of methylation, and the present invention was completed.

The main object of the present invention is to provide a bowel cancer-specific methylation biomarker that is specifically methylated in bowel cancer that can be effectively used for the diagnosis of bowel cancer, and to provide information for early diagnosis of bowel cancer using this.

Another object of the present invention is a bowel cancer specific methylation marker gene SDC2 (NM_002998, Syndecan 2, Syndecan 2), SIM1 (NM_05068, single minded homolog 1 (Drosophila), Single-minded homolog 1) and SORCS3 (NM_014978, To provide a method for detecting methylation of a sotilin-related VPS10 domain containing receptor 3 and a Sortilin-related VPS10 domain containing receptor 3) gene, and a kit for diagnosing bowel cancer and a nucleic acid chip using the same.

In order to achieve the above object, the present invention provides a method for detecting methylation of a specific methylation marker gene for bowel cancer, comprising the following steps:

(a) preparing a clinical sample containing DNA; And

(b) detecting methylation of the CpG island of any one or more of the following genes or the CpG island of the promoter from the DNA of the clinical sample:

(I) SDC2 (NM_002998, Syndecan 2, Syndecan 2);

( Ii) SIM1 (NM_05068, single-minded homolog 1 (Drosophila), Single-minded homolog 1); And

( Iii ) SORCS3 (NM_014978, sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3).

The present invention also provides a composition for diagnosing bowel cancer comprising a CpG island of any one or more of the following genes or a CpG island of its promoter:

(I) SDC2 (NM_002998, Syndecan 2, Syndecan 2);

( Ii) SIM1 (NM_05068, single-minded homolog 1 (Drosophila), Single-minded homolog 1); And

( Iii ) SORCS3 (NM_014978, sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3).

The present invention also provides a PCR primer pair for amplifying a fragment containing the CpG island of any one or more of the following genes or the CpG island of the promoter, and sequencing for pyrosequencing the PCR product amplified by the primer pair. A kit for diagnosis of bowel cancer containing a primer is provided:

(I) SDC2 (NM_002998, Syndecan 2, Syndecan 2);

( Ii) SIM1 (NM_05068, single-minded homolog 1 (Drosophila), Single-minded homolog 1); And

( Iii ) SORCS3 (NM_014978, sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3).

The present invention also provides a nucleic acid chip for diagnosing bowel cancer in which a CpG island of any one or more of the following genes or a fragment containing a CpG island of the promoter thereof and a probe capable of hybridizing under stringent conditions are immobilized:

(I) SDC2 (NM_002998, Syndecan 2, Syndecan 2);

( Ii) SIM1 (NM_05068, single-minded homolog 1 (Drosophila), Single-minded homolog 1); And

( Iii ) SORCS3 (NM_014978, sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3).

The present invention has an effect of providing a method of providing information for diagnosing bowel cancer by detecting methylation of CpG islands of a bowel cancer-specific marker gene.

Using the methylation detection method and diagnostic composition, kit, and nucleic acid chip according to the present invention, it is possible to diagnose bowel cancer in the early transformation stage, enabling early diagnosis, and is useful because it can diagnose bowel cancer more accurately and faster than conventional methods. Do.

1 is a schematic diagram showing a process of discovering a methylated biomarker for diagnosis of bowel cancer through CpG microarray analysis from urine cells of a normal person and a bowel cancer patient.
Figure 2 is a schematic diagram showing a process of selecting a bowel cancer specific hypermethylated gene from the intestinal cancer CpG microarray data.
3 is a graph showing the degree of methylation of 7 biomarker candidate genes in bowel cancer cell lines and normal human bowel tissues by pyrosequencing.
FIG. 4 is a graph of the degree of methylation in the intestinal cancer tissues of three methylated biomarkers and normal tissues connected thereto by a pyro-sequencing method.
FIG. 5 is a graph in which the sensitivity and specificity for the diagnosis of bowel cancer were measured by performing ROC curve analysis in order to evaluate the bowel cancer diagnostic ability of three methylated biomarkers.
6 is a methylation-specific PCR method for verifying whether the SDC2 biomarker gene is methylated in fecal tissues of normal persons and intestinal cancer patients (Circles: methylation specific PCR product).

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by an expert skilled in the art to which the present invention belongs. In general, the nomenclature used in this specification is well known and commonly used in the art.

The present invention is a gene specifically methylated in bowel cancer, SDC2 (NM_002998, Syndecan 2, Syndecan 2), SIM1 (NM_05068, single minded homolog 1 (Drosophila), Single-minded homolog 1) and SORCS3 (NM_014978, Sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3) As using the CpG island of the gene as a biomarker, the present invention is the CpG of any one or more of the following genes in one aspect. It relates to a composition for diagnosing bowel cancer containing islets or CpG islets of their promoters:

(I) SDC2 (NM_002998, Syndecan 2, Syndecan 2);

( Ii) SIM1 (NM_05068, single-minded homolog 1 (Drosophila), Single-minded homolog 1); And

( Iii ) SORCS3 (NM_014978, sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3).

In the present invention, the CpG island may be characterized in that it is located at the intron site of the gene. At this time, SDC2 The intron region of the gene is a sequence ranging from +681 to +1800 nt, based on the start of transcription, and may be characterized by including the nucleotide sequence of SEQ ID NO: 1. In addition, the intron region of the SORCS3 gene is a sequence ranging from +851 to +2000 nt, based on the transcription initiation point, and may be characterized by including the nucleotide sequence of SEQ ID NO: 3.

In addition, the CpG island may be characterized in that it is located at the promoter region of the gene, in which case, the promoter region of the SIM1 gene is a sequence from -1500 to -501 nt based on the transcription initiation point, and SEQ ID NO: It may be characterized by including the nucleotide sequence of 2.

* In the present invention, 7 biomarker candidate genes with the greatest difference in methylation degree between normal and intestinal cancer patients were selected, and among them, SDC2 , SIM1 and SORCS3 genes were confirmed to be useful for diagnosis of intestinal cancer, and methylation markers according to the present invention The method of screening for a gene includes the following steps: (a) isolating genomic DNA from transformed and non-transfected cells; (b) separating the methylated DNA by reacting with a protein that binds to the methylated DNA from the separated genomic DNA; And (c) amplifying the methylated DNA, hybridizing to a CpG microarray, and selecting a gene having the largest difference in methylation degree between normal cells and cancer cells as a methylation marker gene.

By the method of selecting the methylated biomarker gene, it is possible to find genes that are methylated in various stages of not only intestinal cancer, but also in various dysmorphic stages that are progressing to intestinal cancer, and the selected genes are intestinal cancer screening, risk assessment, prediction, disease name identification, disease stage. It can also be used for diagnosis and selection of therapeutic targets.

Identifying genes that are methylated in intestinal cancer and various stages of abnormalities enables early diagnosis of intestinal cancer accurately and effectively, and it is possible to establish a methylation list using multiple genes and identify new targets for treatment. In addition, when the methylation data according to the present invention is linked with other non-methylation-associated biomarker detection methods, a more accurate bowel cancer diagnosis system can be established.

With the above method of the present invention, it is possible to diagnose the progression of bowel cancer at various stages or stages including determining the methylation stage of one or more nucleic acid biomarkers obtained from a specimen. By comparing the methylation step of the nucleic acid isolated from the sample at each stage of intestinal cancer with the methylation step of one or more nucleic acids obtained from a sample that does not have abnormal cell proliferation of intestinal tissue, the specific stage of intestinal cancer in the sample can be identified, and the methylation The step can be hypermethylation.

In one example of the present invention, the nucleic acid may be methylated at the regulatory site of the gene. As another example, since methylation starts from the outside of the regulatory region of the gene and proceeds to the inside, it is possible to early diagnose a gene involved in cell transformation by detecting methylation at the outside of the regulatory region.

In another embodiment of the present invention, early diagnosis of cells that may form intestinal cancer can be performed using the methylated gene marker. When a gene confirmed to be methylated in cancer cells is methylated in cells that appear to be clinically or morphologically normal, the cells that appear to be normal are undergoing cancer. Therefore, by confirming the methylation of a bowel cancer-specific gene in cells that appear to be normal, bowel cancer can be diagnosed early.

Using the methylation marker gene of the present invention, it is possible to detect abnormal cell growth (progression of dysmorphism) in intestinal tissue in a specimen. The method includes contacting a sample containing one or more nucleic acids isolated from the sample with an agent capable of determining one or more methylation states. The method includes checking the methylation status of one or more sites in one or more nucleic acids, and the methylation status of the nucleic acid is the methylation status of the same site in the nucleic acid of a specimen that does not have abnormal cell growth (dysplasia progression) of intestinal tissue. It can be characterized by differences.

In another embodiment of the present invention, it is possible to evaluate the possibility of developing a tissue into intestinal cancer by examining the frequency of methylation of a gene that is specifically methylated in intestinal cancer and determining the frequency of methylation of a tissue having a potential for progression of intestinal cancer.

Accordingly, in another aspect, the present invention relates to a method for detecting methylation of a bowel cancer-specific methylation marker gene for diagnosis of bowel cancer, comprising the following steps:

(a) preparing a clinical sample containing DNA; And

(b) detecting methylation of the CpG island of any one or more of the following genes or the CpG island of the promoter from the DNA of the clinical sample:

(I) SDC2 (NM_002998, Syndecan 2, Syndecan 2);

( Ii) SIM1 (NM_05068, single-minded homolog 1 (Drosophila), Single-minded homolog 1); And

( Iii ) SORCS3 (NM_014978, sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3).

In the present invention, the step (b) may be characterized in that the methylation of the CpG island of the intron region of the gene is detected. At this time, at this time, SDC2 The intron region of the gene is a sequence ranging from +681 to +1800 nt, based on the start of transcription, and may be characterized by including the nucleotide sequence of SEQ ID NO: 1. In addition, the intron region of the SORCS3 gene is a sequence ranging from +851 to +2000 nt, based on the transcription initiation point, and may be characterized by including the nucleotide sequence of SEQ ID NO: 3.

In addition, the CpG island may be characterized in that it is located at the promoter region of the gene, in which case, the promoter region of the SIM1 gene is a sequence from -1500 to -501 nt based on the transcription initiation point, and SEQ ID NO: It may be characterized by including the nucleotide sequence of 2.

In the present invention, the methylation detection step of step (b) is PCR, methylation specific PCR, real time methylation specific PCR, PCR using methylated DNA-specific binding protein, and quantitative PCR. , DNA chip, pyrosequencing, and bisulfite sequencing. In addition, the clinical sample may be characterized by being selected from the group consisting of tissues, cells, blood, plasma, feces, and urine derived from a patient suspected of cancer or a diagnosis target, but is not limited thereto.

In the present invention, as an example, the method of detecting whether the gene is methylated may include the following steps: (a) preparing a clinical sample containing DNA; (b) separating DNA from the clinical sample; (c) SDC2 , SIM1 of the isolated DNA And amplifying a fragment including the promoter of any one or more genes of the SORCS3 gene or the CpG island of the intron using a primer capable of amplifying. And (d) determining whether the intron is methylated based on whether or not the resultant amplified in step (c) is generated.

In another embodiment, in the present invention, SDC2 (NM_002998, Syndecan 2, Syndecan 2), SIM1 (NM_05068, single-minded homolog 1 (Drosophila), Single-minded homolog 1) and SORCS3 (NM_014978, sotilin-related VPS10 domain By detecting the methylation status of the containing receptor 3, Sortilin-related VPS10 domain containing receptor 3) gene using the kit, it is possible to diagnose cell growth abnormalities (dysplasia) of intestinal tissues present in the specimen.

Accordingly, in another aspect, the present invention provides a PCR primer pair for amplifying a fragment including the CpG island of any one or more of the following genes or the CpG island of the promoter and the PCR product amplified by the primer pair. It relates to a kit for diagnosing bowel cancer containing sequencing primers for sequencing:

(I) SDC2 (NM_002998, Syndecan 2, Syndecan 2);

( Ii) SIM1 (NM_05068, single-minded homolog 1 (Drosophila), Single-minded homolog 1); And

( Iii ) SORCS3 (NM_014978, sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3).

In the present invention, the PCR primer pair is SEQ ID NO: 12 and 13; SEQ ID NOs: 14 and 15; And a primer pair selected from the group consisting of nucleotide sequences represented by SEQ ID NOs: 16 and 17.

In the present invention, the sequencing primer may be selected from the group consisting of nucleotide sequences represented by SEQ ID NOs: 22 to 24.

In another embodiment, in the present invention, SDC2 (NM_002998, Syndecan 2, Syndecan 2), SIM1 (NM_05068, single-minded homolog 1 (Drosophila), Single-minded homolog 1) and SORCS3 (NM_014978, sotilin-related VPS10 domain By detecting the methylation status of the gene (containing receptor 3, Sortilin-related VPS10 domain containing receptor 3) using a nucleic acid chip, it is possible to diagnose cell growth abnormalities (dysplasia) of intestinal tissues present in the specimen.

Accordingly, in another aspect, the present invention relates to a nucleic acid chip for diagnosing bowel cancer in which a fragment containing a CpG island of any one or more of the following genes or a promoter thereof and a probe capable of hybridizing under stringent conditions are immobilized. :

(I) SDC2 (NM_002998, Syndecan 2, Syndecan 2);

( Ii) SIM1 (NM_05068, single-minded homolog 1 (Drosophila), Single-minded homolog 1); And

( Iii ) SORCS3 (NM_014978, sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3).

In the present invention, the CpG island may be characterized in that it is located at the intron site of the gene. At this time, SDC2 The intron region of the gene is a sequence ranging from +681 to +1800 nt, based on the start of transcription, and may be characterized by including the nucleotide sequence of SEQ ID NO: 1. In addition, the intron region of the SORCS3 gene is a sequence ranging from +851 to +2000 nt, based on the transcription initiation point, and may be characterized by including the nucleotide sequence of SEQ ID NO: 3. In addition, the CpG island may be characterized in that it is located at the promoter region of the gene, in which case, the promoter region of the SIM1 gene is a sequence from -1500 to -501 nt based on the transcription initiation point, and SEQ ID NO: It may be characterized by including the nucleotide sequence of 2.

In the present invention, the probe may be characterized in that it is selected from the group consisting of nucleotide sequences represented by SEQ ID NOs: 33 to 44, and the specific sequence thereof is as follows.

SDC2

1) 5'-tgggtcgggc ccgcgaggga acggc-3' (SEQ ID NO: 33)

2) 5'-ggggggagcc tgggtcgggc ccgcgaggga acggctccac-3' (SEQ ID NO: 34)

3) 5'-tcgccctcgg cgggtcttgc tgcgtggtct gggaaggacg gaggggaaag-3' (SEQ ID NO: 35)

4) 5'-ggggtccctt cctccgcaca ccatcccccc cgcgccagct ttcctgtttg actgcatgca agttctgggg agatgggggc cagatttaag agacccgcga-3' (SEQ ID NO: 36)

SIM1

1) 5'-gatgggcgcc cccgaaacct ctgcc-3' (SEQ ID NO: 37)

2) 5'-gccccgcgcc cgcccagcag ccccgcagct ccgcggtggt-3' (SEQ ID NO: 38)

3) 5'-gggaagcgga gaggccggcg gtgtcgctgg gttggacggt aggcatgaga-3' (SEQ ID NO: 39)

4) 5'-gggaagcgga gaggccggcg gtgtcgctgg gttggacggt aggcatgaga acagttaaga

gatgggcgcc cccgaaacct ctgccgcttg tggggactga-3' (SEQ ID NO: 40)

SORCS3

1) 5'-cgagaggtgg cgtcgttgag cccgg-3' (SEQ ID NO: 41)

2) 5'-cgtcgttgag cccggtctgg cctactccgg cattccgaac-3' (SEQ ID NO: 42)

3) 5'-cgagaggtgg cgtcgttgag cccggtctgg cctactccgg cattccgaac-3' (SEQ ID NO: 43)

4) 5'-cgtcgttgag cccggtctgg cctactccgg cattccgaac tgggcgcccg actgagcatc gcgcctgcct ggcagctgca gcggcccgca gcgcgtgccc ggaggggctc-3' (SEQ ID NO: 44)

Using the diagnostic kit or nucleic acid chip of the present invention, it is possible to determine the propensity of abnormal cell growth (dysplasia progression) of intestinal tissue in a specimen. The method includes determining the methylation status of one or more nucleic acids isolated from a specimen, and the methylation step of the one or more nucleic acids is compared with the methylation step of a nucleic acid isolated from a specimen without a tendency for abnormal cell growth (dysplasia) of intestinal tissue. It can be characterized by that.

In another embodiment of the present invention, transformed intestinal cancer cells can be identified by testing the methylation of a marker gene using the kit or a nucleic acid chip.

In another embodiment of the present invention, intestinal cancer may be diagnosed by examining the methylation of a marker gene using the kit or a nucleic acid chip.

In another embodiment of the present invention, the possibility of progressing to intestinal cancer may be diagnosed by examining the methylation of a marker gene using the kit or a nucleic acid chip using a sample exhibiting a normal phenotype. The sample may be solid or liquid tissue, cells, feces, urine, serum or plasma.

Definitions of main terms used in the detailed description of the present invention are as follows.

As used herein, "cell transformation" refers to a change in the characteristics of a cell from one form to another, such as from normal to abnormal, from non-neoplastic to neoplastic, from undifferentiated to differentiation, and from stem cells to non-stem cells. Means that. Additionally, the transformation can be recognized by cell morphology, phenotype, and biochemical properties.

As used herein, "early identification" of cancer refers to finding the possibility of cancer before metastasis, preferably before morphological changes are observed in a tissue or cell of a specimen. Additionally, "early identification" of cell transformation refers to a high likelihood of transformation occurring at an early stage before the cell becomes a transformed form.

As used herein, "hypermethylation" refers to methylation of CpG islands.

As used herein, “sample” or “sample sample” refers to a wide range of bodily fluids including all biological body fluids obtained from individuals, body fluids, cell lines, tissue cultures, etc., depending on the type of analysis being performed. Methods of obtaining bodily fluids and tissue biopsies from mammals are generally well known. A preferred source is a biopsy of the intestine.

Bio for bowel cancer Marker -Use of cancer cells for comparison with normal cells

In this example, “normal” cells refer to cells that have not exhibited abnormal cell morphology or change in cytological properties. "Tumor" cells refer to cancer cells, and "non-tumor" cells refer to cells that are part of the diseased tissue, but are judged not to be tumor sites.

In one aspect, the present invention, bowel cancer and SDC2 (NM_002998, Syndecan 2, Syndecan 2); SIM1 (NM_005068, single-minded homolog 1 (Drosophila), Single-minded homolog 1); It is based on the discovery of an association between hypermethylation of the SORCS3 (NM_014978, sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3) gene.

For other uses of the diagnostic kit and nucleic acid chip of the present invention, an abnormality in cell growth of the intestinal tissue of the specimen can be diagnosed early by determining the methylation step of one or more nucleic acids isolated from the specimen. The methylation step of the one or more nucleic acids may be characterized by comparing the methylation status of one or more nucleic acids isolated from a specimen that does not have abnormal cell growth in intestinal tissue. The nucleic acid is preferably a CpG-containing nucleic acid such as CpG island.

As another use of the diagnostic kit and nucleic acid chip of the present invention, it is possible to diagnose pruritus of abnormal cell growth of intestinal tissue of a specimen, including determining methylation of one or more nucleic acids isolated from the specimen. The nucleic acid is SDC2 (NM_002998, Syndecan 2, Syndecan 2); SIM1 (NM_005068, single-minded homolog 1 (Drosophila), Single-minded homolog 1); SORCS3 (NM_014978, sotilin-related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3) gene; And a combination thereof, and the methylation step of the one or more nucleic acids may be characterized in that the methylation state of the one or more nucleic acids isolated from a specimen that does not have a pruritus for abnormal cell growth of intestinal tissue. have.

The "pruritus" refers to a property that is susceptible to abnormalities in cell growth. A specimen with pruritus refers to a specimen that does not have cell growth abnormalities yet, but has a cell growth abnormality or has an increased tendency to exist.

In another aspect, the present invention provides cell growth properties of intestinal tissue of a sample comprising contacting a sample containing a nucleic acid of the sample with an agent capable of determining the methylation state of the sample, and confirming methylation of one or more sites of one or more nucleic acids. Provides a method for diagnosing abnormalities. Here, the methylation of one or more sites of the one or more nucleic acids may be characterized in that it is different from the methylation step of the same site of the same nucleic acid of the specimen having no abnormality in cell growth.

The method of the present invention includes determining methylation of one or more sites of one or more nucleic acids isolated from a subject. Here, "nucleic acid" or "nucleic acid sequence" means an oligonucleotide, a nucleotide, a polynucleotide, or a fragment thereof, a single-stranded or double-stranded DNA or RNA of genomic origin or synthetic origin, and the genomic origin or synthesis of the sense or antisense strand. DNA or RNA of origin, peptide nucleic acid (PNA), or a DNA amount or RNA of natural origin or synthetic origin. It is apparent to those of ordinary skill in the art that if the nucleic acid is RNA, it is replaced with ribonucleotides A, G, C and U, respectively, in place of deoxynucleotides A, G, C and T.

Any nucleic acid capable of detecting the presence of different methylated CpG islands can be used. The CpG island is a CpG-rich site in the nucleic acid sequence.

Methylation ( methylation )

Any nucleic acid in purified or unpurified form in the present invention may be used, and any nucleic acid containing or suspected of containing a nucleic acid sequence containing a target site (e.g., a CpG-containing nucleic acid) may be used. . The nucleic acid site that can be differentially methylated is the CpG island, which is a nucleic acid sequence with a high CpG density compared to other dinucleotide CpG nucleic acid sites. Doublet CpG appears with a probability of only 20% in vertebrate DNA when predicted by the ratio of G*C base pairs. At certain sites, the density of double CpGs is 10 times higher compared to other sites in the genome. CpG islands have an average G*C ratio of about 60%, and that of normal DNA represents an average of 40%. CpG islands are typically about 1-2 kb long, and there are about 45,000 CpG islands in the human genome.

In several genes, the CpG island starts upstream of the promoter and extends to the transcription site downstream. Methylation of CpG islands in the promoter usually inhibits the expression of the gene. The CpG island may also surround the 3'site of the gene coding site as well as the 5'site of the gene coding site. Therefore, CpG islands are found in several sites, including the coding sequence upstream of the regulatory region, including the promoter region, the coding region (e.g., exon region), downstream of the coding region, e.g., enhancer regions and introns. do.

Typically, the CpG-containing nucleic acid is DNA. However, the method of the present invention may apply, for example, a sample containing DNA or RNA including DNA and mRNA, wherein the DNA or RNA may be single-stranded or double-stranded, or a DNA-RNA hybrid It may be characterized in that it is a containing sample.

Mixtures of nucleic acids can also be used. The specific nucleic acid sequence to be detected may be a fraction of a large molecule, and the specific sequence may exist in the form of an isolated molecule constituting the entire nucleic acid sequence from the beginning. The nucleic acid sequence need not be a nucleic acid present in its pure form, and the nucleic acid may be a small fraction in a complex mixture, such as containing whole human DNA. The nucleic acid contained in the sample used to measure the degree of methylation of the nucleic acid contained in the sample or used to detect the methylated CpG island is Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY., 1989). It can be extracted by several methods described in.

The nucleic acid isolated from the sample is obtained by the biological sample of the sample. If you want to diagnose bowel cancer or the progression stage of bowel cancer, you need to isolate nucleic acids from intestinal tissue by scrap or biopsy. Such samples can be obtained by several medical procedures known in the art.

In one embodiment of the present invention, the degree of methylation of a nucleic acid in a sample obtained from a specimen is measured by comparing it with a portion of the same nucleic acid in a specimen having no abnormality in cell growth of intestinal tissue. Hypermethylation refers to the presence of a methylated allele in one or more nucleic acids. When the same nucleic acid is tested for a sample without abnormal cell growth in intestinal tissue, the methylated allele does not appear.

Individual genes and panels

In the present invention, each gene can be used individually as a diagnostic or predictive marker, or a combination of several marker genes can be used in the form of a panel display, and several marker genes can be used to improve reliability and efficiency through an overall pattern or a list of methylated genes. It can be seen that it improves. The genes identified in the present invention may be used individually or as a gene set in which the genes mentioned in this example are combined. Alternatively, genes can be ranked according to the number of genes methylated together and their importance, weighted, and the level of likelihood of developing cancer can be selected. This algorithm belongs to the present invention.

Method for detecting methylation

Methylation specific PCR ( methylation specific PCR )

When bisulfite is treated on genomic DNA, when the cytosine at the 5'-CpG'-3 site is methylated, it remains as cytosine, and when it is unmethylated, it turns into uracil. Therefore, a PCR primer corresponding to a site in which the 5'-CpG-3' nucleotide sequence is present was prepared for the nucleotide sequence converted after bisulfite treatment. At this time, PCR primers corresponding to the methylated case and two types of primers corresponding to the unmethylated case were prepared. When the genomic DNA is converted to bisulfite and then PCR is performed using the above two types of primers, in the case of methylation, a PCR product is made from the primers corresponding to the methylated nucleotide sequence, and conversely, in the case of non-methylation. PCR products are made from those using primers corresponding to non-methylation. Whether methylation can be determined qualitatively by an agarose gel electrophoresis method.

Real-time methylation specificity PCR ( real time methylation specific PCR )

Real-time methylation-specific PCR is a conversion of the methylation-specific PCR method to a real-time measurement method. After bisulfite is treated on genomic DNA, PCR primers corresponding to methylation are designed, and real-time PCR is performed using these primers. Is to perform. At this time, there are two methods of detection using the amplified nucleotide sequence and the complementary TanMan probe and the detection using Sybergreen. Therefore, real-time methylation-specific PCR can selectively quantitatively analyze only methylated DNA. At this time, in A standard curve was prepared using an in vitro methylated DNA sample, and for standardization, a gene without a 5'-CpG-3' sequence in the nucleotide sequence was amplified together as a negative control group and the degree of methylation was quantitatively analyzed.

Pyro Sequencing

The pyrosequencing method is a method that converts the bisulfite sequencing method to quantitative real-time sequencing. Similar to bisulfite sequencing, genomic DNA was converted by treatment with bisulfite, and then PCR primers corresponding to regions without a 5'-CpG-3' base sequence were prepared. Genomic DNA was treated with bisulfite, amplified with the PCR primers, and then real-time sequencing was performed using sequencing primers. The amount of cytosine and thymine at the 5'-CpG-3' site was quantitatively analyzed, and the degree of methylation was expressed as a methylation index.

Methylation DNA Using specific binding proteins PCR Or quantitative PCR And DNA chip

In the PCR or DNA chip method using methylated DNA-specific binding proteins, if a protein that specifically binds only to methylated DNA is mixed with DNA, only methylated DNA can be selectively isolated because the protein binds specifically to methylated DNA . After mixing the genomic DNA with a methylated DNA-specific binding protein, only methylated DNA was selectively isolated. These isolated DNAs were amplified using PCR primers corresponding to the intron site, and then methylation was measured by agarose electrophoresis.

In addition, methylation can be measured by quantitative PCR method. The methylated DNA isolated with a methylated DNA-specific binding protein is labeled with a fluorescent dye and hybridized to a DNA chip in which a complementary probe is integrated to measure the methylation status. I can. Here, the methylated DNA specific binding protein is not limited to MBD2bt.

Detection of differential methylation-limited methylation sensitivity Endonuclease

The detection of differential methylation can be performed by contacting a nucleic acid sample with a methylation-sensitive restriction endonuclease that cleaves only the unmethylated CpG site to cleave the unmethylated nucleic acid.

In a separate reaction, the sample was contacted with an isochizomer of a methylation sensitive restriction endonuclease that cleaves both methylated and unmethylated CpG sites to cleave the methylated nucleic acid.

Specific primers were added to the nucleic acid sample, and the nucleic acid was amplified by a conventional method. If the amplification product is present in the sample treated with the methylation-sensitive endonuclease, and the amplification product is not present in the sample treated with the isokisomer of the methylation-sensitive endonuclease that cleaves both methylated and unmethylated CpG sites , Methylation occurred at the analyzed nucleic acid site. However, the amplification product did not exist in the sample treated with the methylation-sensitive endonuclease, and the amplification product was also obtained in the sample treated with the isokisomer of the methylation-sensitive endonuclease that cleaves both methylated and unmethylated CpG sites. Absence means that no methylation has occurred at the analyzed nucleic acid site.

Here, the "methylation-sensitive restriction endonuclease" is a restriction enzyme that contains CG at the recognition site and has activity when C is methylated compared to when C is not methylated (eg, Sma I). Non-limiting examples of methylation sensitive restriction endonucleases include Msp I, Hpa II, Bss HII, Bst UI and Not I. These enzymes may be used alone or in combination. Other methylation-sensitive limiting endonucleotides include, but are not limited to , Sac II and Eag I.

The isokisomer of the methylation-sensitive restriction endonuclease is a restriction endonuclease having the same recognition site as the methylation-sensitive restriction endonuclease, but cleaves both methylated and unmethylated CGs, for example, Msp I can be mentioned.

The primers of the present invention are constructed to have "substantially" complementarity with each strand of the locus to be amplified, and, as described above, contain appropriate G or C nucleotides. This means that the primer has sufficient complementarity to hybridize with the corresponding nucleic acid strand under the conditions of performing the polymerization reaction. The primers of the present invention are used in an amplification process, and the amplification process is an enzymatic continuous reaction that increases in an exponential number while passing through a reaction step having many target locus, such as PCR. Typically, one primer (antisense primer) has homology to the negative (-) strand of the locus, and the other primer (sense primer) has homology to the positive (+) strand. When the primer is annealed to the denatured nucleic acid, the chain is elongated by enzymes and reactants such as DNA polymerase I (Klenow) and nucleotides, and as a result, + and-strands containing the target locus sequence are newly synthesized. When the newly synthesized target locus is also used as a template and the cycles of denaturation, primer annealing, and chain extension are repeated, exponential synthesis of the target locus sequence proceeds. The product of the continuous reaction is an independent double-stranded nucleic acid having an end corresponding to the end of the specific primer used in the reaction.

The amplification reaction is preferably a PCR commonly used in the art. However, alternative methods such as real-time PCR or linear amplification using isothermal enzymes can be used, and multiplex amplification reactions can also be used.

Detection of differential methylation- Bisulfite Sequencing method

Other methods of detecting methylated CpG-containing nucleic acids include contacting a sample containing the nucleic acid with an agent that modifies unmethylated cytosine and amplifying the CpG-containing nucleic acid of the sample using a CpG-specific oligonucleotide primer. Includes. Here, the oligonucleotide primer may be characterized in that it detects methylated nucleic acids by distinguishing between modified methylated and unmethylated nucleic acids. The amplification step is optional and is preferred, but not essential. The method relies on a PCR reaction to differentiate between modified (eg, chemically modified) methylated and unmethylated DNA. Such a method is disclosed in US Pat. No. 5,786,146, which describes bisulfite sequencing for detection of methylated nucleic acids.

Kit( Kit )

According to the present invention, a kit useful for detecting abnormal cell growth in a specimen is provided. The kit of the present invention comprises a compartmentalized carrier means containing a sample, a second container containing a PCR primer pair capable of amplifying a 5'-CpG-3' nucleotide sequence site for pyrosequencing the sample, and an amplified PCR product. And one or more vessels comprising a third vessel containing sequencing primers for pyrosequencing.

The carrier means are suitable for containing one or more containers such as bottles, tubes, and each container contains independent components used in the method of the present invention. In the specification of the present invention, a person of ordinary skill in the art can easily dispense the required agent in a container.

temperament

When the target nucleic acid site is amplified, in order to detect the presence of the nucleic acid sequence, the nucleic acid amplification product may be hybridized with a known gene probe immobilized on a solid support (substrate).

Here, "substrate" is a substance, structure, surface or material, non-biological, synthetic, inanimate, planar, spherical or specific binding, a mixture means including a substance of a flat surface, hybridization or enzyme recognition site Or a number of other recognition sites beyond the majority of other recognition sites or numerous other molecular species composed of surfaces, structures or materials. The substrates include, for example, semiconductors, (organic) synthetic metals, synthetic semiconductors, insulators and dopants; Metals, alloys, elements, compounds and minerals; Synthesized, disassembled, etched, lithographed, printed and microfabricated slides, devices, structures and surfaces; Industrial, polymers, plastics, membranes, silicones, silicates, glass, metals and ceramics; It may be wood, paper, cardboard, cotton, wool, cloth, woven and non-woven fibers, materials and fabrics, but is not limited thereto.

Some types of membranes are known in the art to have adhesion to nucleic acid sequences. Specific and non-limiting examples of such membranes include nitrocellulose or polyvinyl chloride, diazotized paper, and commercially used membranes such as ^{GENESCREEN TM} , ZETAPROBE ^TM (Biorad) and NYTRAN ^{TM for detecting gene expression.} Can be mentioned. Beads, glasses, wafers and metal substrates are also included. Methods for attaching nucleic acids to such targets are well known in the art. Alternatively, screening can also be performed in the liquid phase.

Hybridization Condition

In nucleic acid hybridization reactions, the conditions used to achieve stringent specific levels vary depending on the nature of the nucleic acid to be hybridized. For example, the length of the nucleic acid site to be hybridized, the degree of homology, the nucleotide sequence composition (e.g., GC/AT composition ratio), and the nucleic acid type (e.g., RNA, DNA), etc., select hybridization conditions. Is considered. An additional consideration condition is whether or not the nucleic acid is immobilized, for example, on a filter or the like.

Examples of very stringent conditions are as follows: 2X SSC/0.1% SDS at room temperature (hybridization conditions); 0.2X SSC/0.1% SDS at room temperature (low stringency conditions); 0.2X SSC/0.1% SDS at 42° C. (conditions with moderate stringency); 0.1X SSC at 68°C (high stringency conditions). The washing process can be performed using one of these conditions, for example, conditions having high stringency, or each of the above conditions, each of 10 to 15 minutes in the order described above, all of the conditions described above, or It can be done with some iterations. However, as described above, the optimum conditions vary depending on the specific hybridization reaction involved, and can be determined through experimentation. In general, conditions with high stringency are used for hybridization of critical probes.

sign( Label )

The probes of interest are labeled to be detectable and, for example, can be labeled with radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. Appropriately labeling such a probe is a technique well known in the art, and can be performed through a conventional method.

Example

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Intestinal cancer specific methylation gene discovery

To select specifically methylated biomarkers in bowel cancer, genomic DNA from two normal non-cancer patients (Biochain), cancer tissue obtained from surgical tissues from 12 bowel cancer patients, and 500 ng of normal tissue genomic DNA connected thereto are ultrasonically crushed. (Vibra Cell, SONICS), a genomic DNA fragment of about 200 to 300 bp was prepared.

In order to obtain only methylated DNA from genomic DNA, a methyl binding domain (MBD) known to bind methylated DNA (Fraga et al., Nucleic Acid Res ., 31: 1765, 2003) was used. That is, 2 μg of MBD2bt tagged with 6X His was pre-incubated with 500 ng genomic DNA of E. coli JM110 (Korea Research Institute of Bioscience and Biotechnology, No. 2638), and then bound to Ni-NTA magnetic beads (Qiagen, USA). Here, 500 ng of genomic DNA isolated from tissue cells of the normal human and bowel cancer patients subjected to ultrasonic pulverization was combined with a reaction solution (10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 3 mM MgCl ₂ , 0.1% Triton-X100). , 5% glycerol, 25 mg/ml BSA) at 4° C. for 20 minutes, washed three times with 500 μl of a conjugated reaction solution containing 700 mM NaCl, and then methylated DNA bound to MBD2bt was subjected to QiaQuick PCR. It was isolated using a purification kit (QIAGEN, USA).

Thereafter, the methylated DNA bound to the MBD2bt was amplified using a genome amplification kit (Sigma, USA, Cat. No. WGA2), and then 4 μg of the amplified genomic DNA was added to BioPrime Total Genomic Labeling system I (Invitrogen Corp. , USA) was labeled with Cy5. In order to indirectly compare the degree of methylation between normal and bowel cancer patients, a standard comparison DNA was constructed. The standard comparative DNA was mixed in equal amounts of genomic DNA from tissues of 12 bowel cancer patients used for methylation analysis, and the DNA was amplified using a genome amplification kit (Sigma, USA, Cat. No. WGA2), and the amplified genome was then amplified. 4 μg of DNA was labeled with Cy3 using BioPrime Total Genomic Labeling system I (Invitrogen Corp., USA). After mixing the standard comparative DNA and each of the DNA of a normal person and a bowel cancer patient, it was hybridized to a 244K human CpG microarray (Agilent, USA) (Fig. After the hybridization, after a series of washing processes. Scanned using an Agilent scanner. The calculation of the signal value from the microarray image is performed by the Feature Extraction program v. 9.5.3.1 (Agilent) was used to calculate the relative intensity difference of the signal between the normal and bowel cancer patient samples.

In order to select probes with reliable hybridization signals, a cross gene error model was applied using the GeneSpring 7.3 program (Agilent, USA), and 64,325 probes with a Cy3 signal of 112.8 or more in at least 21 arrays out of a total of 26 arrays. Were selected as probes with reliable signals. From this, in order to select probes that are hypermethylated specifically for intestinal cancer, two methods were used to analyze them. First, the ANOVA test was performed to select the probes showing differential methylation compared to the intestinal tissue and the normal finding tissue connected to the intestinal cancer as the same group, and the p value was 0.05. The following 4,498 probes were selected. From this, 1,560 probes that are hypermethylated in the intestinal cancer tissue were re-selected, and four biomarker gene candidates ( CHST11 , IRX5 , KCNA1 , SDC2) simultaneously showing hypermethylation in two or more contiguous probes present within about 400 bp. , SORCS3 ) was discovered (Fig. 2). Second, in order to discover a methylated biomarker suitable for early diagnosis, the intestinal cancer tissue and the normal finding tissue connected thereto were regarded as the same group, and the probes that were methylated differentially from the intestinal tissue of a normal person were subjected to an anova test, and the p value was 3,242 probes less than or equal to 0.01 were selected. Among the 3,242 probes, 705 probes showing hypermethylation were selected from intestinal cancer tissues and normal tissues adjacent thereto, and two or more contiguous probes present within about 400 bp of them simultaneously showed hypermethylation 6 biomarker candidate genes ( CHST11 , IRX1 , IRX5 , KCNA1 , SIM1 , SORCS3 ) were selected (Fig. 2).

Of the biomarker candidate genes analyzed by the above two methods, four genes were identified as common genes, and thus seven biomarker candidate genes were obtained (Table 1). In addition, MethPrimer (http://itsa.ucsf.edu/ ~urolab/ methprimer/index1.html) was used for the nucleotide sequence of each probe of these 7 genes showing hypermethylation in CpG microarray analysis. Thus, it was confirmed that CpG islands exist.

List of methylated biomarker candidate genes for diagnosis of bowel cancer Candidate gene Probe position ^a GenBank No. Description CHST11 +501, +605 NM_018413 carbohydrate (chondroitin 4) sulfotransferase 11 IRX1 +809, +956, +1,021, +1,097 NM_024337 iroquois homeobox 1 IRX5 +2,647, +2,724 NM_005853 iroquois homeobox 5 KCNA1 -1,853, -1,612 NM_000217 potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia) SDC2 +1,168, +1,282 NM_002998 Syndecan 2 SIM1 -1,242, -1,178 NM_005068 single-minded homolog 1 (Drosophila) SORCS3 +1,478, +1,519 NM_014978 sortilin-related VPS10 domain containing receptor 3

^a, the nucleotide sequence distance from the transcription initiation site (+1) (bp)

In cancer cell lines Biomarker Measurement of gene methylation

In order to further confirm the mechylation state of the biomarker candidate gene selected in Example 1, pyrosequencing was performed for each promoter or intron site.

In order to transform unmethylated cytosine into uracil using bisulfite, the whole genome from intestinal cancer cell lines Caco-2 (Korea Cell Line Bank (KCLB No. 30037.1) and HCT116 (Korea Cell Line Bank (KCLB No. 10247)). DNA was isolated, and 200 ng of genomic DNA was treated with bisulfite using the EZ DNA methylation-Gold kit (Zymo Research, USA) When the DNA was treated with bisulfite, unmethylated cytosine was transformed into uracil. The bisulfite-treated DNA was eluted with 20 µl of sterile distilled water to perform pyrosequencing.

PCR and sequencing primers for performing pyrosequencing for the seven genes were designed using the PSQ assay design program (Biotage, USA). PCR and sequencing primers for measuring the methylation of each gene are shown in Tables 2 and 3 below.

PCR primer gene primer Sequence (5'→3') ^a order
number CpG position ^b Amplicon size (bp) CHST11 forward GAGATTATTTTGGTTAATATGG 4 +361, +368, +385, +391, +393 207 reverse TTTAAAACRAAATCTCACT 5 IRX1 forward YGAAAYGGAGTTTATTTTAAGTG 6 +660, +681, +686, +692 126 reverse ACRAAACRACCTCTTAAATC 7 IRX5 forward GGGTTYGGGTTAGGTTTTATAA 8 +2558, +2568, +2572, +2576 113 reverse TAACTCCRCAACATTTTC 9 KCNA1 forward GGGTGGGTTTYGTAGAGAGTAAG 10 -420, -410, -398, -394 114 reverse CCTCCRACRAATTTACTTTT 11 SDC2 forward YGTTTTTYGAGATTAGGGATGATT 12 +1100, +1115, +1131, +1133 107 reverse TCTCCCCAAAACTTACAT 13 SIM1 forward GGTTTTTAATTAGGAATAATAGTG 14 -1024, -1021, -1015, -1003 244 reverse AACRCCCATCTCTTAACT 15 SORCS3 forward GGGTTTTTTTGGATAAGG 16 +1741, +1751, +1754, +1763 101 reverse CAAACRCRATACTCAATC 17

^a Y = C or T, R = A or G

^b Distance from the start of transcription (+1) (nucleotide): The location on genomic DNA of the CpG site used for methylation measurement

Sequencing primer sequence of methylation marker gene gene Sequence (5' --> 3') Sequence number CHST11 TAGGAGAATGGTGTGAAT 18 IRX1 TCCCTCTTCTCCCTA 19 IRX5 ATTTTAATGGATTAAATTAG 20 KCNA1 TTTTTTGGGGGAGGA 21 SDC2 GGGATGATTTGGAAATT 22 SIM1 CATCTCTTAACTATTCTCATACCT 23 SORCS3 TTTTTTTGGATAAGGATG 24

20 ng of genomic DNA converted into the bifiite was amplified by PCR. PCR reaction solution (20 ng of genomic DNA converted to bisulfite, 5 µl of 10X PCR buffer (Enzynomics, Korea), 5 µl of Taq polymerase (Enzynomics, Korea), 4 µl of 2.5mM dNTP (Solgent, Korea), 2 µl of PCR primers ( 10 pmole/µl)) was treated at 95°C for 5 minutes, followed by a total of 45 times at 95°C for 40 seconds, 60°C for 45 seconds, and 72°C for 40 seconds, followed by reaction at 72°C for 5 minutes. Whether the PCR product was amplified was confirmed by electrophoresis using 2.0% agarose gel.

After treating the amplified PCR product with a PyroGold reagent (Biotage, USA), pyro-sequencing was performed using a PSQ96MA system (Biotage, USA). After the pyrosequencing, the degree of methylation was measured by calculating a methylation index. The methylation index was calculated by calculating the average rate of cytosine binding at each CpG site.

As a result of quantitatively measuring the degree of methylation of the biomarker candidate gene in intestinal cancer cell lines using a pyrosequencing method, as shown in FIG. 3A, all of the seven biomarker genes were at a high level in at least one cell line. It was confirmed that it was methylated. The seven genes showed a high level of methylation in a bowel cancer cell line, thereby demonstrating the possibility of having usefulness as a biomarker for diagnosis of bowel cancer. Accordingly, as follows, a methylation verification experiment using tissue samples was additionally conducted to verify this.

In normal human intestinal tissue Biomarker Measurement of methylation of candidate genes

In order for the seven biomarker candidate genes of Example 1 to have usefulness as markers for intestinal cancer diagnosis, the intestinal tissues of normal humans, not patients, should exhibit a low level of methylation, whereas in the intestinal cancer tissues, they should exhibit a high level of methylation.

Therefore, in order to verify this, first, after separating genomic DNA from two normal intestinal tissues (Biochain), not patients, using the QIAamp DNA Mini kit (QIAGEN, USA), EZ was added to 200 ng of the separated genomic DNA. After bisulfite was treated using a DNA methylation-Gold kit (Zymo Research, USA), it was eluted with 20 µl of sterile distilled water and used for pyrosequencing.

20 ng of genomic DNA converted to the bisulfite was amplified by PCR. PCR reaction solution (20 ng of genomic DNA converted to bisulfite, 5 µl of 10X PCR buffer (Enzynomics, Korea), 5 µl of Taq polymerase (Enzynomics, Korea), 4 µl of 2.5mM dNTP (Solgent, Korea), 2 µl of PCR primers (10pmole/µl)) was treated at 95°C for 5 minutes, followed by a total of 45 times at 95°C for 40 seconds, 60°C for 45 seconds, and 72°C for 40 seconds, and then reacted at 72°C for 5 minutes. Whether the PCR product was amplified was confirmed by electrophoresis using 2.0% agarose gel.

After treating the amplified PCR product with a PyroGold reagent (Biotage, USA), pyro-sequencing was performed using a PSQ96MA system (Biotage, USA). After pyrosequencing, the degree of methylation was measured by calculating the methylation index. The methylation index was calculated by calculating the average rate of cytosine binding at each CpG site. At this time, in the same manner as in Example 2, the PCR primers of Table 2 and the sequencing primers of Table 3 were used.

As a result, as shown in Figure 3B, of the seven genes IRX1 , IRX5 , KCNA1 and CHST11 showed a high methylation level of 40% or more in normal tissues, it was determined that there is no usefulness as a biomarker, thus excluded from the biomarker candidate Made it. On the other hand, SIM1 , SDC2 and SORCS3 showed a relatively low degree of methylation. Thus, these SIM1 , SDC2 and SORCS3 The usefulness of the gene as a biomarker was verified in the tissues of intestinal cancer patients as follows.

Bio in the tissues of intestinal cancer patients Marker Measurement of gene methylation

Low methylation levels in normal human intestinal tissues In order to verify the usefulness of the SIM1 , SDC2, and SORCS3 genes as biomarkers for bowel cancer diagnosis, it is used as a bowel cancer tissue obtained from 12 bowel cancer patient surgical tissues (Yonsei University National Biochip Center designated by the Ministry of Health, Welfare and Family Affairs) and normal findings connected thereto. Genomic DNA was isolated.

200 ng of the isolated genomic DNA was treated with bisulfite using an EZ DNA methylation-Gold kit (Zymo Research, USA), and then eluted with 20 µl of sterile distilled water and used for pyro-sequencing.

20 ng of genomic DNA converted to the bisulfite was amplified by PCR. PCR reaction solution (20 ng of genomic DNA converted to bisulfite, 5 µl of 10X PCR buffer (Enzynomics, Korea), 5 µl of Taq polymerase (Enzynomics, Korea), 4 µl of 2.5mM dNTP (Solgent, Korea), 2 µl of PCR primers (10pmole/µl)) was treated at 95°C for 5 minutes, followed by a total of 45 times at 95°C for 40 seconds, 60°C for 45 seconds, and 72°C for 40 seconds, and then reacted at 72°C for 5 minutes. Whether the PCR product was amplified was confirmed by electrophoresis using 2.0% agarose gel.

After treating the amplified PCR product with a PyroGold reagent (Biotage, USA), pyro-sequencing was performed using a PSQ96MA system (Biotage, USA). After pyrosequencing, the degree of methylation was measured by calculating the methylation index. The methylation index was calculated by calculating the average rate of cytosine binding at each CpG site. At this time, in the same manner as in Example 2, the PCR primers of Table 2 and the sequencing primers of Table 3 were used.

As a result of measuring the degree of methylation of the three genes, as shown in FIG. 4, the SDC2 and SIM1 genes showed higher methylation levels in all 12 patients (100%) than in normal tissues connected with the intestinal cancer tissues. . In addition, the SORCS3 gene showed a high level of methylation in bowel cancer tissues of 10 out of 12 patients (83.3%), confirming that all three genes are highly useful as methylated biomarkers for bowel cancer diagnosis. Table 4 shows the average value of methylation in the intestinal cancer tissues of the three biomarker genes and normal tissues connected thereto. In order to check whether the methylation levels of intestinal cancer tissues and normal tissues were statistically significantly different, a chi-square test was performed, and as a result, it was confirmed that all three genes showed a high significance level with p values of 0.01 or less. Could be (Table 4).

Quantitative analysis of methylation of 3 biomarkers
gene Mean methylation level (%, mean ± standard deviation) p value ^a Normal findings Bowel cancer tissue SDC2 5.7 ± 0.6 24.5 ± 15.4 <0.0001 SIM1 18.3 ± 4.7 29.8 ± 11.8 <0.0001 SORCS3 24.1 ± 5.0 51.8 ± 19.9 0.0012

^a p value obtained as a result of chi-square test

3 bios Marker Evaluation of the ability of genes to diagnose bowel cancer

SIM1 , SDC2 and SORCS3 confirming usefulness as intestinal cancer markers in Example 4 For the gene, ROC curve (Receiver Operating Characteristic) analysis was performed using the MedCalc program (MEDCALC, Belgium) to additionally evaluate the ability to diagnose bowel cancer.

As a result, as shown in FIG. 5, the sensitivity and specificity of the SDC2 gene were 100%, respectively, the SIM1 gene was 83.3% and 100%, and the SORCS3 gene was 83.3% and 100%, indicating that the ability to diagnose bowel cancer is very excellent. I could confirm.

In addition, the SDC2 gene, which has the best diagnostic ability in bowel cancer tissues among the three biomarkers, was used to evaluate bowel cancer diagnostic ability in fecal samples.

For this, genomic DNA was isolated from fecal samples (Yonsei University Biochip Research Center designated by the Ministry of Health and Welfare) of 4 normal people and 10 bowel cancer patients using nested methylation-specific PCR (MSP) technique. The separated genomic DNA 4 µg was treated with bisulfite using an EZ DNA methylation-Gold kit (Zymo Research, USA), and then eluted with 20 µl of sterile distilled water and used for nested MSP experiments. The primer sequences used in the nested MSP experiment are shown in Table 5.

SDC2 gene MSP primer sequence Methylation primer Primer sequence (5'--> 3') Amplification product size (bp) Sequence number Methylation Outer-F AATTTCGGTACGGGAAAGGAGTTC 248 25 Outer-R AAACAAAATACCGCAACGATTACGA 26 Inner-F TAGAAATTAATAAGTGAGAGGGCGT 121 27 Inner-R GACTCAAACTCGAAAACTCGAA 28 Unmethylated Outer-F TGAATTTTGGTATGGGAAAGGAGTTT 250 29 Outer-R AAACAAAATACCACAACAATTACAAC 30 Inner-F GAGTGTAGAAATTAATAAGTGAGAGGGT 129 31 Inner-R TACAACTCAAACTCAAAAACTCAAA 32

1 ug of genomic DNA converted to the bisulfite was amplified by PCR. PCR reaction solution (1 ug of genomic DNA converted to bisulfite, 5 µl of 10X PCR buffer (Enzynomics, Korea), 5 µl of Taq polymerase (Enzynomics, Korea), 4 µl of 2.5mM dNTP (Solgent, Korea), outer PCR primer 2 Μl (5pmole/µl)) was treated at 95°C for 5 minutes, followed by a total of 30 times at 95°C for 40 seconds, 60°C for 45 seconds, and 72°C for 40 seconds, followed by reaction at 72°C for 5 minutes. The PCR product 1/2 was taken and PCR was performed 45 times in the same manner, and the amplification of the PCR product was confirmed by electrophoresis using 2.0% agarose gel.

As a result, as shown in Figure 6, the SDC2 gene was not observed at all methylation in 4 normal people, while methylation was observed in 6 out of 10 intestinal cancer patients (60%), confirming that it is useful for diagnosis of bowel cancer using feces. I did.

As described above, a specific part of the content of the present invention has been described in detail. For those of ordinary skill in the art, this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby It will be obvious. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

No sign

<110> GENOMICTREE, INC. <120> Method for Detecting Methylation of Colorectal Cancer Specific Methylation Marker Gene for Colorectal Cancer Diagnosis <130> P11-B141 <160> 44 <170> KopatentIn 1.71 <210> 1 <211> 1120 <212> DNA <213> Intron of SDC2 gene <400> 1 gagtgggcca ggcggaggat gcgcgcgccg tttagggtgt ttgaagctac gagaggagcc 60 cgcagggaat aggggagcgc cacctgggga acccccagtc cccaagtata caccggagat 120 ccgctgggac aaatgcgctc gtccggtcac cctttccccc tcttcccttc ctcagaaaag 180 cgctgctcgc tggcgttacc ccgcggtccg cgggaatggg ggcaccgaga attgcggttt 240 ggtctagccg cagaggcccc tgaagtcact cccaacttct tcgccctcgg cgggtcttgc 300 tgcgtggtct gggaaggacg gaggggaaag ggtggcagga ggggggagcc tgggtcgggc 360 ccgcgaggga acggctccac tccgcgcgct cctcgagacc agggatgacc tggaaacttc 420 ggggtccctt cctccgcaca ccatcccccc cgcgccagct ttcctgtttg actgcatgca 480 agttctgggg agatgggggc cagatttaag agacccgcga gtgtccagag agaaaagttt 540 gcaaaagttc ttttgtttga tgctccctgc ggctagggcg aggtaaccga cactacgtgg 600 aatcgcagta ggcgatccct caaggggata ctgggggagg cacggaacgc gtccgaaaat 660 gctgggacgc cggccactgg attcccagtc ctgcggcgac cccctcctcg ttgaggggtg 720 gaggttgcac cgcggggcgt cagggacggg aggacatttt cataggagtt acacgggagt 780 gccgcaagca gggcgaggcg gggtacgtgt gacacggcgc tcggcttcgg gtcgcctggc 840 cgctggggga cagaggcttc cctcccgcca cgctcgccct ctctggccct ggcggggcgc 900 ttctggggcc gggaggagtc tcgtctccgg cggagcgcct gccggcaccc agcttccctc 960 ccccgccctg gcggtgggaa cttgatttct ccttttggtc gcgcttcggg ggctggagct 1020 tgtttcccca cgtcgcccaa tgagcgccct ctaaagggaa ctgcctcctt ggcctcctct 1080 cgtccgcagc tgcctccacc tgggcgccag gagctctgtc 1120 <210> 2 <211> 1000 <212> DNA <213> Promoter of SIM1 gene <400> 2 gcaaccggac agcgccgacc cggcaccctg agctcattag gagtccagcg gtcccgcggg 60 tagtaagatt cagagcccgg agcctgggcg cgcggagggc ggctcggggc cgactcgtgt 120 cactcagccc tattggccaa tgagcgcctc gcccctggcc gcgccaggcc aatgggaggc 180 gagggggctt gtgagtggca ttgagggagg gcgggagaga ggcggccccg gagtgaagtt 240 gaagctaaac ccttaagcta taaagaagtt acggggggca gttttcggct tccaattagg 300 aataatagtg aactggcttc gtagcaacta cggaggacca ggattctaaa atcacctcac 360 tcgtcccaaa gcttgcatcc tcctctttct gccacgcacc cctcctccaa ttcatgatcc 420 agaaaaggga gccgggaatg ctctgctcct ctctgccggt gggaagcgga gaggccggcg 480 gtgtcgctgg gttggacggt aggcatgaga acagttaaga gatgggcgcc cccgaaacct 540 ctgccgcttg tggggactga aggtaggtga agcagaagac gccccgcgcc cgcccagcag 600 ccccgcagct ccgcggtggt gtgggagagg ccgcggcgcc tcccaccccc gggggagcct 660 gcgaggggct gtcgcgagcg cgccacctgt taacctggcg ctgctgggcc ccgcttgttg 720 cagcccctgc tgggcagcca gagcgctggg tcgccttggg agtcccgaga gacttggtgt 780 gtaagtgtca ctttttgagg aatccctcag acttgagacc caagttaaag aggtagccaa 840 ggtccagatc tgccaaggta gggagctgaa aggcccctgc ctcgccttgg aggaattctg 900 atttgcggaa acctgctttc ctgggacgtg cgcccggcct gggcgcggac tcggggatcc 960 gcggcggaag atcccttgcg ggtcttcaga aatatgtatt 1000 <210> 3 <211> 1150 <212> DNA <213> Intron of SORCS3 gene <400> 3 cagcgtgagt acccacccgg cggcgggtcc gcctgtttcc tgacaccgaa ggggaatggg 60 ggggtgggtg ggagcgaggg acagatagtt gctcgggggt cgaggcgggg gacgcctcga 120 cttttcgaga taacaggttt gtccgattcc ccccacgccc ccaacaggtt aacggagttt 180 gttgttagac gctgtgtgtg tttgtttact ggagacccta ggcttcggcc gccgggaggg 240 gagtggagga aggggcttct taaagatgag tgggggaggg atctgtgctc actttctcca 300 atacttggct tggagggtca gttttcctgt ttgcggggtg cttgaattct tggatgagaa 360 aaagggctga cttggggcgg gagccgctga acagaccgat tcctgcggct gccgggctcc 420 ccctaccccc accccacccc caccccccct cccgtcacgc gaaagggaac ccggaaggcc 480 attcggactc ccagcctcct gctcgcctcg gggtcgctgc tatccgctcc aggcgcgcag 540 tcctccagcc caagagggag gctcggccaa gtcggccccc agccttggcc ttcaggtaac 600 cccggttcct ccttcaaagt ccagggagcg gccctggaaa gccgtagcag aggccgtaaa 660 aaaaagttta aagcgtgaag cgaaattcca cacccatcca gcgctcatgc cacaccgctc 720 gccctcacgc acgcacaggc acacggaagt cgctcagcag aaaactctcg acttcaccat 780 tgcgtcctgc gccacaaacg gctccctgag cggagttggg tgcctgagct tcctgcacac 840 ctctccaccc gcttttcccc gccaccgggt tctcctggac aaggatgtac cgagaggtgg 900 cgtcgttgag cccggtctgg cctactccgg cattccgaac tgggcgcccg actgagcatc 960 gcgcctgcct ggcagctgca gcggcccgca gcgcgtgccc ggaggggctc cccctacctc 1020 gccggcaccc agcgctgtgc agccaagcaa agaaaaggcg ggggacaggt tcccaccatc 1080 tccccgactt ccctccctcc cgcggtccct actagagcca gatttggaaa atcctttcct 1140 cttctctggc 1150 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for CHST11 gene <400> 4 gagattattt tggttaatat gg 22 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for CHST11 gene <400> 5 tttaaaacra aatctcact 19 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for IRX1 gene <400> 6 ygaaayggag tttattttaa gtg 23 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for IRX1 gene <400> 7 acraaacrac ctcttaaatc 20 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for IRX5 gene <400> 8 gggttygggt taggttttat aa 22 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for IRX5 gene <400> 9 taactccrca acattttc 18 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for KCNA1 gene <400> 10 gggtgggttt ygtagagagt aag 23 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for KCNA1 gene <400> 11 cctccracra atttactttt 20 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SDC2 gene <400> 12 ygtttttyga gattagggat gatt 24 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SDC2 gene <400> 13 tctccccaaa acttacat 18 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SIM1 gene <400> 14 ggtttttaat taggaataat agtg 24 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SIM1 gene <400> 15 aacrcccatc tcttaact 18 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for SORCS3 gene <400> 16 gggttttttt ggataagg 18 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SORCS3 gene <400> 17 caaacrcrat actcaatc 18 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for CHST11 gene <400> 18 taggagaatg gtgtgaat 18 <210> 19 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for IRX1 gene <400> 19 tccctcttct cccta 15 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for IRX5 gene <400> 20 attttaatgg attaaattag 20 <210> 21 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for KCNA1 gene <400> 21 ttttttgggg gagga 15 <210> 22 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for SDC2 gene <400> 22 gggatgattt ggaaatt 17 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for SIM1 gene <400> 23 catctcttaa ctattctcat acct 24 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Sequencing primer for SORCS3 gene <400> 24 tttttttgga taaggatg 18 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Outer-F primer <400> 25 aatttcggta cgggaaagga gttc 24 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Outer-R primer <400> 26 aaacaaaata ccgcaacgat tacga 25 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Inner-F primer <400> 27 tagaaattaa taagtgagag ggcgt 25 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Inner-R primer <400> 28 gactcaaact cgaaaactcg aa 22 <210> 29 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Outer-F primer <400> 29 tgaattttgg tatgggaaag gagttt 26 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Outer-R primer <400> 30 aaacaaaata ccacaacaat tacaac 26 <210> 31 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Inner-F primer <400> 31 gagtgtagaa attaataagt gagagggt 28 <210> 32 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Inner-R primer <400> 32 tacaactcaa actcaaaaac tcaaa 25 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Probe for SDC2 gene <400> 33 tgggtcgggc ccgcgaggga acggc 25 <210> 34 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Probe for SDC2 gene <400> 34 ggggggagcc tgggtcgggc ccgcgaggga acggctccac 40 <210> 35 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Probe for SDC2 gene <400> 35 tcgccctcgg cgggtcttgc tgcgtggtct gggaaggacg gaggggaaag 50 <210> 36 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> Probe for SDC2 gene <400> 36 ggggtccctt cctccgcaca ccatcccccc cgcgccagct ttcctgtttg actgcatgca 60 agttctgggg agatgggggc cagatttaag agacccgcga 100 <210> 37 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Probe for SIM1 gene <400> 37 gatgggcgcc cccgaaacct ctgcc 25 <210> 38 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Probe for SIM1 gene <400> 38 gccccgcgcc cgcccagcag ccccgcagct ccgcggtggt 40 <210> 39 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Probe for SIM1 gene <400> 39 gggaagcgga gaggccggcg gtgtcgctgg gttggacggt aggcatgaga 50 <210> 40 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> Probe for SIM1 gene <400> 40 gggaagcgga gaggccggcg gtgtcgctgg gttggacggt aggcatgaga acagttaaga 60 gatgggcgcc cccgaaacct ctgccgcttg tggggactga 100 <210> 41 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Probe for SORCS3 gene <400> 41 cgagaggtgg cgtcgttgag cccgg 25 <210> 42 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Probe for SORCS3 gene <400> 42 cgtcgttgag cccggtctgg cctactccgg cattccgaac 40 <210> 43 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Probe for SORCS3 gene <400> 43 cgagaggtgg cgtcgttgag cccggtctgg cctactccgg cattccgaac 50 <210> 44 <211> 110 <212> DNA <213> Artificial Sequence <220> <223> Probe for SORCS3 gene <400> 44 cgtcgttgag cccggtctgg cctactccgg cattccgaac tgggcgcccg actgagcatc 60 gcgcctgcct ggcagctgca gcggcccgca gcgcgtgccc ggaggggctc 110

Claims (15)

Intestinal cancer comprising detecting the methylation of the CpG island of the SORCS3 (NM_014978, Sotilin-Related VPS10 domain containing receptor 3, Sortilin-related VPS10 domain containing receptor 3) gene or CpG island of its promoter from DNA of clinical samples Method for detecting methylation of bowel cancer specific methylation marker gene for diagnosis.
The method of claim 1, wherein the detecting of the methylation comprises detecting methylation of the CpG island of the intron region of the SORCS3 gene comprising the nucleotide sequence of SEQ ID NO: 3. 8.
The methylation of CpG island of SDC2 (NM_002998, Cindecan 2, Syndecan 2) or SIM1 (NM_05068, single minded homolog 1, Drosophila) gene, or CpG island of its promoter Further detecting.
According to claim 3, SIM1 comprising the nucleotide sequence of SEQ ID NO: 2 or CpG island of the intron portion of the SDC2 gene comprising the nucleotide sequence of SEQ ID NO: Detecting methylation of the CpG island of the promoter region of the gene.
The method of claim 1, wherein the detecting of methylation comprises: PCR, methylation specific PCR, real time methylation specific PCR, PCR using methylated DNA specific binding protein, quantitative PCR, and DNA. And chip, pyro sequencing and bisulfite sequencing.
The method of claim 1, wherein the clinical sample is selected from the group consisting of tissue, cells, blood, plasma, feces and urine from a suspected cancer patient or a diagnostic subject.
A composition for diagnosing bowel cancer containing a CpG island of the SORCS3 (NM_014978, Sothylin-Related VPS10 domain container receptor 3, Sortilin-related VPS10 domain containing receptor 3) gene or a CpG island of its promoter region.
8. The composition for diagnosing bowel cancer according to claim 7, wherein the CpG island is located at an intron portion of the SORCS3 gene comprising the nucleotide sequence of SEQ ID NO: 3.
A pair of PCR primers and a primer for amplifying a fragment comprising a CpG island of the SORCS3 (NM_014978, Sotilin-Related VPS10 domain container receptor 3, Sortilin-related VPS10 domain containing receptor 3) gene or a CpG island of its promoter site A kit for diagnosing bowel cancer containing sequencing primers for pyro sequencing a PCR product amplified by a pair.
The diagnostic kit according to claim 9, wherein the PCR primer pair is a primer pair which is a nucleotide sequence represented by SEQ ID NOs: 16 and 17.
The diagnostic kit according to claim 9, wherein the sequencing primer is a nucleotide sequence represented by SEQ ID NO.
10. The method of claim 9, SDC2 (NM_002998, Shin-decane 2, Syndecan 2) or SIM1 (NM_05068, single ME bonded homology log 1 (Drosophila), Single-minded homolog 1) including the CpG islands or CpG island of the promoter of the gene And a PCR primer pair for amplifying the fragment and a sequencing primer for pyro sequencing the PCR product amplified by the primer pair.
SORCS3 (NM_014978, Sotilin-Related VPS10 Domain Containing Receptor 3, Sortilin-related VPS10 Domain Containing Receptor 3) A fragment containing a CpG island of the gene or a CpG island of its promoter site and capable of hybridization under stringent conditions A nucleic acid chip for diagnosing intestinal cancer with a probe fixed thereto.
The diagnostic nucleic acid chip according to claim 13, wherein the probe is selected from the group consisting of nucleotide sequences represented by SEQ ID NOs: 41 to 44.
14. The CpG islet of claim 13 or CpG islet of the promoter of SDC2 (NM_002998, Syndecan 2) or SIM1 (NM_05068, single minded homolog 1, Drosophila) gene. A diagnostic nucleic acid chip, characterized in that the fragment is further fixed with a probe capable of hybridization under strict conditions.

Images